#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3B	83858	hgsc.bcm.edu	37	1	1431055	1431055	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:1431055C>T	ENST00000308647.7	+	16	1921	c.1805C>T	c.(1804-1806)cCc>cTc	p.P602L		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	602						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GCCACGGACCCCTCCTACCCC	0.672																																					p.P602L		Atlas-SNP	.											.	ATAD3B	68	.	0			c.C1805T						.						35.0	36.0	36.0					1																	1431055		2202	4298	6500	SO:0001583	missense	83858	exon16			CGGACCCCTCCTA	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1805C>T	chr1.hg19:g.1431055C>T	ENSP00000311766:p.Pro602Leu	108.0	0.0		48.0	24.0	NM_031921	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	ENST00000308647.7	hg19	CCDS30.1	.	.	.	.	.	.	.	.	.	.	c	8.226	0.803560	0.16467	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.94376	-3.41	1.2	0.203	0.15195	.	10.614000	0.03382	U	0.200496	D	0.91109	0.7201	N	0.08118	0	0.09310	N	0.999999	D;P	0.69078	0.997;0.588	D;B	0.68483	0.958;0.072	T	0.81904	-0.0719	10	0.87932	D	0	.	3.3576	0.07174	0.0:0.7016:0.0:0.2984	.	556;602	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	L	436;602	ENSP00000311766:P602L	ENSP00000311766:P602L	P	+	2	0	ATAD3B	1420918	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-1.241000	0.02911	0.070000	0.16634	0.194000	0.17425	CCC	.	.		0.672	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	
TAS1R1	80835	hgsc.bcm.edu	37	1	6631179	6631179	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:6631179C>T	ENST00000333172.6	+	2	595	c.402C>T	c.(400-402)ctC>ctT	p.L134L	TAS1R1_ENST00000328191.4_Silent_p.L134L|TAS1R1_ENST00000351136.3_Silent_p.L134L	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	134					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GAGACCTTCTCCACTATTCCC	0.577																																					p.L134L		Atlas-SNP	.											.	TAS1R1	76	.	0			c.C402T						.						136.0	126.0	130.0					1																	6631179		2203	4300	6503	SO:0001819	synonymous_variant	80835	exon2			CCTTCTCCACTAT		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.402C>T	chr1.hg19:g.6631179C>T		104.0	0.0		89.0	21.0	NM_177540	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	hg19	CCDS81.1	.	.	.	.	.	.	.	.	.	.	C	3.842	-0.033535	0.07543	.	.	ENSG00000173662	ENST00000411823;ENST00000415267	.	.	.	5.08	3.18	0.36537	.	.	.	.	.	T	0.34571	0.0902	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20207	-1.0282	4	.	.	.	.	7.4485	0.27225	0.0:0.5539:0.3546:0.0915	.	.	.	.	F	60	.	.	S	+	2	0	TAS1R1	6553766	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.281000	0.08456	0.499000	0.27970	0.650000	0.86243	TCC	.	.		0.577	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
FHAD1	114827	hgsc.bcm.edu	37	1	15653625	15653625	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:15653625T>A	ENST00000375998.4	+	11	1544	c.1544T>A	c.(1543-1545)gTc>gAc	p.V515D	FHAD1_ENST00000375999.3_Missense_Mutation_p.V515D|FHAD1_ENST00000417793.1_Missense_Mutation_p.V515D|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000401090.2_Missense_Mutation_p.V185D|FHAD1_ENST00000358897.4_Missense_Mutation_p.V515D|RP3-467K16.2_ENST00000428747.1_RNA|FHAD1_ENST00000375995.3_Missense_Mutation_p.V120D			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	515										skin(1)|stomach(1)	2						GACAAGCCCGTCACCGACCAA	0.577																																					p.V515D		Atlas-SNP	.											.	FHAD1	78	.	0			c.T1544A						.						28.0	34.0	32.0					1																	15653625		692	1591	2283	SO:0001583	missense	114827	exon12			AGCCCGTCACCGA	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1544T>A	chr1.hg19:g.15653625T>A	ENSP00000365166:p.Val515Asp	374.0	2.0		242.0	133.0	NM_052929	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	hg19		.	.	.	.	.	.	.	.	.	.	T	15.83	2.949203	0.53186	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000524761;ENST00000375995;ENST00000401090	D;D;D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1	5.38	5.38	0.77491	.	0.941147	0.08875	N	0.880958	D	0.86230	0.5883	L	0.32530	0.975	0.80722	D	1	P;P	0.51537	0.91;0.946	P;P	0.53809	0.548;0.735	T	0.76233	-0.3034	10	0.12430	T	0.62	-2.9613	11.803	0.52139	0.0:0.0:0.0:1.0	.	515;206	B1AJZ9;B1AJZ8	FHAD1_HUMAN;.	D	515;515;515;515;71;120;185	ENSP00000351770:V515D;ENSP00000407615:V515D;ENSP00000365167:V515D;ENSP00000365166:V515D;ENSP00000436559:V71D;ENSP00000365163:V120D;ENSP00000383868:V185D	ENSP00000351770:V515D	V	+	2	0	FHAD1	15526212	0.954000	0.32549	0.903000	0.35520	0.151000	0.21798	4.243000	0.58721	2.043000	0.60533	0.459000	0.35465	GTC	.	.		0.577	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
TCEB3	6924	hgsc.bcm.edu	37	1	24070016	24070016	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:24070016A>G	ENST00000418390.2	+	1	372	c.101A>G	c.(100-102)cAa>cGa	p.Q34R	TCEB3_ENST00000609199.1_Missense_Mutation_p.Q8R	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	34	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TCGGCGCTCCAAGTTGTGGAG	0.721																																					p.Q34R		Atlas-SNP	.											.	TCEB3	61	.	0			c.A101G						.						4.0	4.0	4.0					1																	24070016		1818	3531	5349	SO:0001583	missense	6924	exon1			CGCTCCAAGTTGT	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.101A>G	chr1.hg19:g.24070016A>G	ENSP00000395574:p.Gln34Arg	48.0	0.0		27.0	15.0	NM_003198	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	hg19	CCDS239.2	.	.	.	.	.	.	.	.	.	.	a	10.57	1.387508	0.25031	.	.	ENSG00000011007	ENST00000418390	T	0.06218	3.33	3.02	3.02	0.34903	Transcription factor IIS, N-terminal (3);Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type (1);	0.316661	0.22419	U	0.060314	T	0.03608	0.0103	N	0.16790	0.44	0.29693	N	0.840764	B	0.26672	0.156	B	0.18871	0.023	T	0.32295	-0.9912	10	0.09338	T	0.73	-12.4162	11.5142	0.50511	1.0:0.0:0.0:0.0	.	34	Q14241	ELOA1_HUMAN	R	34	ENSP00000395574:Q34R	ENSP00000395574:Q34R	Q	+	2	0	TCEB3	23942603	1.000000	0.71417	0.995000	0.50966	0.024000	0.10985	3.473000	0.53122	1.160000	0.42584	0.370000	0.22315	CAA	.	.		0.721	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
TEKT2	27285	hgsc.bcm.edu	37	1	36551578	36551578	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:36551578G>A	ENST00000207457.3	+	4	551	c.424G>A	c.(424-426)Gag>Aag	p.E142K	ADPRHL2_ENST00000373178.4_5'Flank	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	142					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TAAAGAGGTGGAGGTCATCGA	0.592																																					p.E142K		Atlas-SNP	.											.	TEKT2	32	.	0			c.G424A						.						86.0	62.0	70.0					1																	36551578		2202	4300	6502	SO:0001583	missense	27285	exon4			GAGGTGGAGGTCA	AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.424G>A	chr1.hg19:g.36551578G>A	ENSP00000207457:p.Glu142Lys	231.0	1.0		161.0	79.0	NM_014466	A6NIS6|O60638	Missense_Mutation	SNP	ENST00000207457.3	hg19	CCDS401.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513959	0.64522	.	.	ENSG00000092850	ENST00000207457	T	0.02787	4.16	5.51	5.51	0.81932	.	0.104490	0.64402	D	0.000006	T	0.06005	0.0156	M	0.83312	2.635	0.48511	D	0.999667	P	0.34977	0.478	B	0.31390	0.129	T	0.23119	-1.0197	10	0.26408	T	0.33	.	13.1696	0.59591	0.0821:0.0:0.9179:0.0	.	142	Q9UIF3	TEKT2_HUMAN	K	142	ENSP00000207457:E142K	ENSP00000207457:E142K	E	+	1	0	TEKT2	36324165	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.693000	0.61753	2.593000	0.87608	0.655000	0.94253	GAG	.	.		0.592	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020200.1	NM_014466	
MFSD2A	84879	hgsc.bcm.edu	37	1	40422841	40422841	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:40422841C>T	ENST00000372809.5	+	2	319	c.176C>T	c.(175-177)aCg>aTg	p.T59M	MFSD2A_ENST00000372811.5_Missense_Mutation_p.T59M|MFSD2A_ENST00000420632.2_Intron	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	59					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						TACCAGGTGACGGGCTGTGCC	0.517																																					p.T59M		Atlas-SNP	.											.	MFSD2A	53	.	0			c.C176T						.						181.0	192.0	188.0					1																	40422841		2203	4300	6503	SO:0001583	missense	84879	exon2			AGGTGACGGGCTG	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.176C>T	chr1.hg19:g.40422841C>T	ENSP00000361895:p.Thr59Met	102.0	0.0		58.0	30.0	NM_032793	A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	ENST00000372809.5	hg19	CCDS44118.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029815	0.75504	.	.	ENSG00000168389	ENST00000372811;ENST00000434861;ENST00000372809	D;D;D	0.87103	-2.21;-2.21;-2.21	4.86	4.86	0.63082	Major facilitator superfamily domain, general substrate transporter (1);	0.093439	0.64402	D	0.000001	D	0.93080	0.7797	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.81914	0.995;0.977	D	0.91914	0.5542	10	0.27785	T	0.31	-13.4054	16.9853	0.86338	0.0:1.0:0.0:0.0	.	59;59	Q8NA29;Q8NA29-2	MFS2A_HUMAN;.	M	59;57;59	ENSP00000361898:T59M;ENSP00000407606:T57M;ENSP00000361895:T59M	ENSP00000361895:T59M	T	+	2	0	MFSD2A	40195428	1.000000	0.71417	0.944000	0.38274	0.904000	0.53231	7.258000	0.78371	2.250000	0.74265	0.462000	0.41574	ACG	.	.		0.517	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	NM_032793	
EBNA1BP2	10969	hgsc.bcm.edu	37	1	43637224	43637224	+	Silent	SNP	A	A	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:43637224A>C	ENST00000236051.2	-	3	390	c.249T>G	c.(247-249)tcT>tcG	p.S83S	EBNA1BP2_ENST00000472982.1_5'UTR|EBNA1BP2_ENST00000431635.2_Silent_p.S138S|WDR65_ENST00000372492.4_5'Flank|WDR65_ENST00000528956.1_5'Flank	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	83					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGGCGCCTCAGATCCACCGA	0.498																																					p.S138S		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.T414G						.						164.0	160.0	161.0					1																	43637224		2203	4300	6503	SO:0001819	synonymous_variant	10969	exon4			CGCCTCAGATCCA	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.249T>G	chr1.hg19:g.43637224A>C		140.0	0.0		121.0	71.0	NM_001159936	Q96A66	Silent	SNP	ENST00000236051.2	hg19	CCDS478.1																																																																																			.	.		0.498	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
FAM73A	374986	hgsc.bcm.edu	37	1	78245389	78245389	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:78245389G>C	ENST00000370791.3	+	1	81	c.49G>C	c.(49-51)Ggc>Cgc	p.G17R	RNA5SP21_ENST00000410917.1_RNA|FAM73A_ENST00000443751.2_Missense_Mutation_p.G17R	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	17						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		AGCTGGCGTGGGCAGGCCAGC	0.677																																					p.G17R		Atlas-SNP	.											.	FAM73A	56	.	0			c.G49C						.						7.0	7.0	7.0					1																	78245389		2178	4250	6428	SO:0001583	missense	374986	exon1			GGCGTGGGCAGGC		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.49G>C	chr1.hg19:g.78245389G>C	ENSP00000359827:p.Gly17Arg	84.0	0.0		59.0	26.0	NM_001270384	Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	hg19	CCDS681.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.363884	0.24684	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.38401	1.76;1.14	1.59	0.584	0.17422	.	.	.	.	.	T	0.06096	0.0158	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.32052	-0.9921	9	0.87932	D	0	-5.6091	3.1193	0.06386	0.302:0.0:0.698:0.0	.	17;17;17	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	R	17	ENSP00000359827:G17R;ENSP00000393675:G17R	ENSP00000359827:G17R	G	+	1	0	FAM73A	78017977	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.729000	0.04920	0.777000	0.33496	0.650000	0.86243	GGC	.	.		0.677	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
CLCA1	1179	hgsc.bcm.edu	37	1	86965557	86965558	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:86965557_86965558CA>AG	ENST00000234701.3	+	15	2925_2926	c.2574_2575CA>AG	c.(2572-2577)aaCAtt>aaAGtt	p.858_859NI>KV	CLCA1_ENST00000394711.1_Missense_Mutation_p.858_859NI>KV			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	858					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		AAATATCCAACATTGCACGAGT	0.386																																					p.N858K|p.I859V		Atlas-SNP	.											.	CLCA1	109	.	0			c.C2574A|c.A2575G						.																																			SO:0001583	missense	1179	exon14			ATCCAACATTGCA|TCCAACATTGCAC		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	Exception_encountered	chr1.hg19:g.86965557_86965558delinsAG	ENSP00000234701:p.N858_I859delinsKV	179.0|180.0	0.0		123.0|122.0	29.0	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	hg19	CCDS709.1																																																																																			.	.		0.386	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
GPR61	83873	hgsc.bcm.edu	37	1	110085966	110085966	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:110085966G>A	ENST00000527748.1	+	2	1005	c.322G>A	c.(322-324)Gcc>Acc	p.A108T	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.A108T(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		CTTTGACCACGCCCTCTTTGG	0.592																																					p.A108T		Atlas-SNP	.											GPR61,colon,carcinoma,0,1	GPR61	60	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A						.						94.0	88.0	90.0					1																	110085966		2203	4300	6503	SO:0001583	missense	83873	exon2			GACCACGCCCTCT	AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.322G>A	chr1.hg19:g.110085966G>A	ENSP00000432456:p.Ala108Thr	56.0	0.0		50.0	25.0	NM_031936	A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	ENST00000527748.1	hg19	CCDS801.1	.	.	.	.	.	.	.	.	.	.	G	7.585	0.669553	0.14776	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.71698	-0.59	5.46	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.380223	0.22057	N	0.065238	T	0.37892	0.1020	L	0.34521	1.04	0.29396	N	0.86225	B	0.11235	0.004	B	0.06405	0.002	T	0.27872	-1.0061	10	0.54805	T	0.06	-2.2681	6.2484	0.20832	0.1602:0.2661:0.5737:0.0	.	108	Q9BZJ8	GPR61_HUMAN	T	108;236	ENSP00000432456:A108T	ENSP00000286603:A236T	A	+	1	0	GPR61	109887489	0.007000	0.16637	0.804000	0.32291	0.976000	0.68499	1.699000	0.37804	1.294000	0.44707	0.655000	0.94253	GCC	.	.		0.592	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1		
MAGI3	260425	hgsc.bcm.edu	37	1	114162434	114162434	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:114162434A>C	ENST00000307546.9	+	8	1228	c.1153A>C	c.(1153-1155)Att>Ctt	p.I385L	MAGI3_ENST00000369617.4_Missense_Mutation_p.I410L|MAGI3_ENST00000369615.1_Missense_Mutation_p.I385L|MAGI3_ENST00000369611.4_Missense_Mutation_p.I385L	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	410					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGGTTGAAATTGGGTCTTC	0.348																																					p.I385L		Atlas-SNP	.											.	MAGI3	181	.	0			c.A1153C						.						104.0	110.0	108.0					1																	114162434		2203	4300	6503	SO:0001583	missense	260425	exon8			GTTGAAATTGGGT	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1153A>C	chr1.hg19:g.114162434A>C	ENSP00000304604:p.Ile385Leu	344.0	0.0		231.0	75.0	NM_152900	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	hg19	CCDS44196.1	.	.	.	.	.	.	.	.	.	.	A	9.647	1.140504	0.21205	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.13420	2.69;2.59;2.72;2.72	4.77	2.41	0.29592	.	0.374402	0.29383	N	0.012320	T	0.01558	0.0050	N	0.14661	0.345	0.24123	N	0.995796	B;B;B	0.14805	0.011;0.001;0.0	B;B;B	0.15052	0.012;0.002;0.001	T	0.47100	-0.9143	10	0.08837	T	0.75	-20.8909	5.3451	0.16004	0.6104:0.0:0.3896:0.0	.	385;385;410	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	L	410;385;385;385	ENSP00000358630:I410L;ENSP00000304604:I385L;ENSP00000358628:I385L;ENSP00000358624:I385L	ENSP00000304604:I385L	I	+	1	0	MAGI3	113963957	0.861000	0.29849	0.976000	0.42696	0.979000	0.70002	1.264000	0.33015	0.678000	0.31325	0.460000	0.39030	ATT	.	.		0.348	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	
PTPN22	26191	hgsc.bcm.edu	37	1	114380834	114380834	+	Silent	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:114380834T>C	ENST00000359785.5	-	13	1323	c.1188A>G	c.(1186-1188)aaA>aaG	p.K396K	PTPN22_ENST00000420377.2_Silent_p.K396K|PTPN22_ENST00000528414.1_Silent_p.K341K|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000538253.1_Silent_p.K152K|PTPN22_ENST00000525799.1_Silent_p.K269K	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	396					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTGTCTGCCATTTCATGGTTG	0.393																																					p.K396K		Atlas-SNP	.											.	PTPN22	90	.	0			c.A1188G						.						93.0	93.0	93.0					1																	114380834		2203	4300	6503	SO:0001819	synonymous_variant	26191	exon13			CTGCCATTTCATG	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1188A>G	chr1.hg19:g.114380834T>C		93.0	0.0		74.0	22.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Silent	SNP	ENST00000359785.5	hg19	CCDS863.1																																																																																			.	.		0.393	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
SPTA1	6708	hgsc.bcm.edu	37	1	158654957	158654957	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:158654957T>C	ENST00000368147.4	-	2	385	c.205A>G	c.(205-207)Atc>Gtc	p.I69V		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	69					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTCTCCATGATCCACTtcccc	0.448																																					p.I69V		Atlas-SNP	.											.	SPTA1	720	.	0			c.A205G						.						119.0	114.0	115.0					1																	158654957		1928	4145	6073	SO:0001583	missense	6708	exon2			CCATGATCCACTT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.205A>G	chr1.hg19:g.158654957T>C	ENSP00000357129:p.Ile69Val	120.0	0.0		171.0	32.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268040	0.40095	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.39787	1.06;1.06	5.18	4.05	0.47172	.	0.249234	0.21012	N	0.081678	T	0.53222	0.1783	M	0.79693	2.465	0.49582	D	0.999806	B	0.28820	0.224	P	0.54270	0.747	T	0.58272	-0.7665	10	0.51188	T	0.08	.	10.0598	0.42268	0.0:0.0798:0.0:0.9202	.	69	P02549	SPTA1_HUMAN	V	69	ENSP00000357130:I69V;ENSP00000357129:I69V	ENSP00000357129:I69V	I	-	1	0	SPTA1	156921581	1.000000	0.71417	0.997000	0.53966	0.320000	0.28249	5.567000	0.67378	0.989000	0.38761	0.383000	0.25322	ATC	.	.		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
ATP1A4	480	hgsc.bcm.edu	37	1	160137138	160137138	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:160137138C>A	ENST00000368081.4	+	10	1898	c.1427C>A	c.(1426-1428)gCg>gAg	p.A476E		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	476					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCTCTGTGGCGGAGATGAGA	0.517																																					p.A476E		Atlas-SNP	.											.	ATP1A4	167	.	0			c.C1427A						.						109.0	108.0	108.0					1																	160137138		2203	4300	6503	SO:0001583	missense	480	exon10			CTGTGGCGGAGAT	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1427C>A	chr1.hg19:g.160137138C>A	ENSP00000357060:p.Ala476Glu	114.0	0.0		147.0	21.0	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	hg19	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	C	1.570	-0.534430	0.04082	.	.	ENSG00000132681	ENST00000368081	D	0.96136	-3.92	4.55	-1.99	0.07457	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.953858	0.08790	N	0.893388	T	0.72211	0.3432	N	0.02854	-0.475	0.20074	N	0.999937	B	0.09022	0.002	B	0.16289	0.015	T	0.67043	-0.5770	10	0.48119	T	0.1	.	2.703	0.05154	0.2161:0.4662:0.1928:0.1248	.	476	Q13733	AT1A4_HUMAN	E	476	ENSP00000357060:A476E	ENSP00000357060:A476E	A	+	2	0	ATP1A4	158403762	0.000000	0.05858	0.960000	0.40013	0.700000	0.40528	-0.398000	0.07259	0.008000	0.14787	0.591000	0.81541	GCG	.	.		0.517	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
SELE	6401	hgsc.bcm.edu	37	1	169700980	169700980	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:169700980C>T	ENST00000333360.7	-	4	664	c.525G>A	c.(523-525)gaG>gaA	p.E175E	SELE_ENST00000367779.4_Silent_p.E175E|SELE_ENST00000367780.4_Silent_p.E175E|SELE_ENST00000367776.1_Silent_p.E175E|SELE_ENST00000367782.4_Silent_p.E175E|SELE_ENST00000367775.1_Silent_p.E175E|SELE_ENST00000367781.4_Silent_p.E175E|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367777.1_Silent_p.E175E|SELE_ENST00000367774.1_Silent_p.E175E	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	175	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	ACTTACTTTGCTCACACTTGA	0.493																																					p.E175E		Atlas-SNP	.											.	SELE	84	.	0			c.G525A						.						134.0	106.0	115.0					1																	169700980		2203	4300	6503	SO:0001819	synonymous_variant	6401	exon4			ACTTTGCTCACAC	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.525G>A	chr1.hg19:g.169700980C>T		84.0	0.0		112.0	17.0	NM_000450	A2RRD6|P16111	Silent	SNP	ENST00000333360.7	hg19	CCDS1283.1																																																																																			.	.		0.493	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450	
CFH	3075	hgsc.bcm.edu	37	1	196654311	196654311	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:196654311G>T	ENST00000359637.2	+	6	778	c.716G>T	c.(715-717)cGg>cTg	p.R239L	CFH_ENST00000439155.2_Missense_Mutation_p.R303L|CFH_ENST00000367429.4_Missense_Mutation_p.R303L			P08603	CFAH_HUMAN	complement factor H	303	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CCTGCAACCCGGGGAAATACA	0.398																																					p.R303L		Atlas-SNP	.											.	CFH	251	.	0			c.G908T	GRCh37	CM086802	CFH	M		.						121.0	111.0	114.0					1																	196654311		2203	4300	6503	SO:0001583	missense	3075	exon7			CAACCCGGGGAAA	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.716G>T	chr1.hg19:g.196654311G>T	ENSP00000352658:p.Arg239Leu	280.0	1.0		305.0	219.0	NM_001014975	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000359637.2	hg19		.	.	.	.	.	.	.	.	.	.	g	14.06	2.421254	0.42918	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.64991	-0.13;-0.13;-0.13	5.11	-5.86	0.02304	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.61788	0.2375	L	0.51422	1.61	0.09310	N	1	P;D;D;D	0.61080	0.788;0.989;0.965;0.976	P;P;P;P	0.58660	0.448;0.843;0.688;0.508	T	0.57590	-0.7785	9	0.27785	T	0.31	.	8.4014	0.32588	0.5061:0.1117:0.3823:0.0	.	239;303;303;303	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	L	303;303;303;239	ENSP00000356399:R303L;ENSP00000402656:R303L;ENSP00000352658:R239L	ENSP00000352658:R239L	R	+	2	0	CFH	194920934	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.875000	0.01634	-0.943000	0.03691	-1.329000	0.01275	CGG	.	.		0.398	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	
PTPRC	5788	hgsc.bcm.edu	37	1	198713253	198713253	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:198713253C>T	ENST00000367376.2	+	26	2933	c.2762C>T	c.(2761-2763)tCt>tTt	p.S921F	PTPRC_ENST00000352140.3_Missense_Mutation_p.S873F|PTPRC_ENST00000594404.1_Missense_Mutation_p.S760F|PTPRC_ENST00000348564.6_Missense_Mutation_p.S762F|PTPRC_ENST00000442510.2_Missense_Mutation_p.S923F	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	921					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GTGAATTTGTCTGAATTACAT	0.393																																					p.S923F		Atlas-SNP	.											.	PTPRC	229	.	0			c.C2768T						.						112.0	106.0	108.0					1																	198713253		2203	4299	6502	SO:0001583	missense	5788	exon26			ATTTGTCTGAATT	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2762C>T	chr1.hg19:g.198713253C>T	ENSP00000356346:p.Ser921Phe	134.0	0.0		176.0	26.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	hg19		.	.	.	.	.	.	.	.	.	.	C	19.70	3.877091	0.72180	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	T	0.14516	2.5	5.78	4.86	0.63082	.	0.139297	0.33553	N	0.004796	T	0.32882	0.0844	M	0.62723	1.935	0.48341	D	0.999637	D;D;D	0.60160	0.987;0.987;0.987	D;D;D	0.64595	0.91;0.927;0.927	T	0.01524	-1.1333	10	0.72032	D	0.01	.	15.2403	0.73465	0.0:0.9314:0.0:0.0686	.	762;873;921	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	F	923;873;921;760	ENSP00000193532:S873F	ENSP00000306782:S760F	S	+	2	0	PTPRC	196979876	0.999000	0.42202	0.965000	0.40720	0.900000	0.52787	2.404000	0.44539	2.724000	0.93272	0.637000	0.83480	TCT	.	.		0.393	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
TP53BP2	7159	hgsc.bcm.edu	37	1	223984262	223984262	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:223984262T>C	ENST00000343537.7	-	13	2270	c.1979A>G	c.(1978-1980)cAg>cGg	p.Q660R	TP53BP2_ENST00000391879.2_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.Q531R|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	654					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		CTGTTGATTCTGGGCAGCAGC	0.418																																					p.Q660R		Atlas-SNP	.											.	TP53BP2	144	.	0			c.A1979G						.						66.0	73.0	71.0					1																	223984262		2195	4251	6446	SO:0001583	missense	7159	exon13			TGATTCTGGGCAG	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.1979A>G	chr1.hg19:g.223984262T>C	ENSP00000341957:p.Gln660Arg	34.0	0.0		50.0	8.0	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	hg19	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527710	0.64860	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.46819	0.86;1.03	5.92	5.92	0.95590	.	0.590783	0.18967	N	0.126239	T	0.41811	0.1175	L	0.47716	1.5	0.80722	D	1	P;P	0.42827	0.791;0.592	B;B	0.38378	0.272;0.238	T	0.35151	-0.9800	10	0.42905	T	0.14	.	12.8313	0.57748	0.0:0.0:0.136:0.864	.	660;654	B4DG66;Q13625	.;ASPP2_HUMAN	R	531;660	ENSP00000375750:Q531R;ENSP00000341957:Q660R	ENSP00000341957:Q660R	Q	-	2	0	TP53BP2	222050885	1.000000	0.71417	0.901000	0.35422	0.934000	0.57294	3.762000	0.55250	2.274000	0.75844	0.533000	0.62120	CAG	.	.		0.418	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
FBXO28	23219	hgsc.bcm.edu	37	1	224345243	224345243	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr1:224345243A>G	ENST00000366862.5	+	5	945	c.902A>G	c.(901-903)cAg>cGg	p.Q301R	FBXO28_ENST00000424254.2_3'UTR	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	301										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		GACCAGGACCAGAAACTGCTA	0.458																																					p.Q301R		Atlas-SNP	.											.	FBXO28	34	.	0			c.A902G						.						164.0	168.0	167.0					1																	224345243		2203	4300	6503	SO:0001583	missense	23219	exon5			AGGACCAGAAACT	AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.902A>G	chr1.hg19:g.224345243A>G	ENSP00000355827:p.Gln301Arg	174.0	0.0		237.0	28.0	NM_015176	E9PEM8|O75070	Missense_Mutation	SNP	ENST00000366862.5	hg19	CCDS1539.1	.	.	.	.	.	.	.	.	.	.	A	11.87	1.767115	0.31320	.	.	ENSG00000143756	ENST00000366862	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.58495	0.2126	N	0.19112	0.55	0.80722	D	1	D	0.54601	0.967	D	0.65140	0.932	T	0.52434	-0.8576	9	0.07030	T	0.85	-14.222	16.8222	0.85835	1.0:0.0:0.0:0.0	.	301	Q9NVF7	FBX28_HUMAN	R	301	.	ENSP00000355827:Q301R	Q	+	2	0	FBXO28	222411866	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.707000	0.91367	2.371000	0.80710	0.533000	0.62120	CAG	.	.		0.458	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176	
DNMT3A	1788	hgsc.bcm.edu	37	2	25467443	25467443	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:25467443C>G	ENST00000264709.3	-	14	1970	c.1633G>C	c.(1633-1635)Gag>Cag	p.E545Q	DNMT3A_ENST00000402667.1_Missense_Mutation_p.E322Q|DNMT3A_ENST00000380746.4_Missense_Mutation_p.E356Q|DNMT3A_ENST00000321117.5_Missense_Mutation_p.E545Q|DNMT3A_ENST00000474887.1_5'Flank	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	545	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGAGCACCTCACGGCCCCCA	0.627			"""Mis, F, N, S"""		AML																																p.E545Q		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A	1807	.	0			c.G1633C						.						119.0	101.0	108.0					2																	25467443		2203	4300	6503	SO:0001583	missense	1788	exon14			GCACCTCACGGCC		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1633G>C	chr2.hg19:g.25467443C>G	ENSP00000264709:p.Glu545Gln	57.0	0.0		66.0	20.0	NM_175629	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	hg19	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417391	0.62622	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.65	5.65	0.86999	Zinc finger, FYVE/PHD-type (1);	0.100374	0.64402	D	0.000003	T	0.68568	0.3015	L	0.35542	1.07	0.80722	D	1	B;B	0.31227	0.314;0.008	B;B	0.21917	0.037;0.003	T	0.67745	-0.5591	10	0.46703	T	0.11	-11.8684	17.2343	0.86994	0.0:1.0:0.0:0.0	.	545;356	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	Q	356;545;545;322	ENSP00000370122:E356Q;ENSP00000324375:E545Q;ENSP00000264709:E545Q;ENSP00000384237:E322Q	ENSP00000264709:E545Q	E	-	1	0	DNMT3A	25320947	1.000000	0.71417	0.967000	0.41034	0.693000	0.40251	6.083000	0.71326	2.655000	0.90218	0.655000	0.94253	GAG	.	.		0.627	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
GAREML	150946	hgsc.bcm.edu	37	2	26407445	26407445	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:26407445T>A	ENST00000401533.2	+	4	858	c.728T>A	c.(727-729)cTg>cAg	p.L243Q	GAREML_ENST00000407684.1_Missense_Mutation_p.L166Q	NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	243	CABIT.					extracellular vesicular exosome (GO:0070062)											CGCAGCCCGCTGGAGCTGCAG	0.662																																					p.L243Q		Atlas-SNP	.											.	.	.	.	0			c.T728A						.						4.0	6.0	6.0					2																	26407445		627	1493	2120	SO:0001583	missense	150946	exon4			GCCCGCTGGAGCT	AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.728T>A	chr2.hg19:g.26407445T>A	ENSP00000384593:p.Leu243Gln	108.0	0.0		104.0	44.0	NM_001168241	B5MC97|B7WNK9|Q8NF27|Q9UIK8	Missense_Mutation	SNP	ENST00000401533.2	hg19	CCDS54336.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.714886	0.68844	.	.	ENSG00000157833	ENST00000401533;ENST00000407684	T;T	0.14144	2.53;2.53	4.08	4.08	0.47627	.	0.000000	0.53938	D	0.000057	T	0.20941	0.0504	L	0.43701	1.375	0.39813	D	0.972739	P;B	0.41624	0.757;0.444	B;P	0.51355	0.429;0.667	T	0.01988	-1.1234	10	0.56958	D	0.05	-12.2662	11.3188	0.49407	0.0:0.0:0.0:1.0	.	166;243	B7WNK9;Q75VX8	.;FA59B_HUMAN	Q	243;166	ENSP00000384593:L243Q;ENSP00000384581:L166Q	ENSP00000384593:L243Q	L	+	2	0	FAM59B	26260949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.125000	0.57931	1.630000	0.50440	0.491000	0.48974	CTG	.	.		0.662	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324498.2	NM_001168241	
GALNT13	114805	hgsc.bcm.edu	37	2	155115572	155115572	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:155115572G>T	ENST00000392825.3	+	8	1463	c.896G>T	c.(895-897)aGa>aTa	p.R299I	GALNT13_ENST00000409237.1_Missense_Mutation_p.R299I|GALNT13_ENST00000487047.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	299	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TCTATTGACAGAAACTACTTT	0.333																																					p.R299I		Atlas-SNP	.											.	GALNT13	170	.	0			c.G896T						.						96.0	102.0	100.0					2																	155115572		2203	4300	6503	SO:0001583	missense	114805	exon8			TTGACAGAAACTA	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.896G>T	chr2.hg19:g.155115572G>T	ENSP00000376570:p.Arg299Ile	146.0	0.0		143.0	29.0	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	hg19	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437693	0.62955	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.69040	-0.37;-0.37	5.85	5.85	0.93711	Glycosyl transferase, family 2 (1);	0.047828	0.85682	D	0.000000	T	0.82056	0.4954	H	0.95780	3.72	0.80722	D	1	B;B;B;B	0.32160	0.358;0.06;0.143;0.06	B;B;B;B	0.40199	0.322;0.124;0.171;0.124	D	0.84451	0.0588	10	0.87932	D	0	.	19.1513	0.93491	0.0:0.0:1.0:0.0	.	299;299;299;299	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8	.;.;.;GLT13_HUMAN	I	299	ENSP00000376570:R299I;ENSP00000387239:R299I	ENSP00000376570:R299I	R	+	2	0	GALNT13	154823818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.404000	0.66344	2.772000	0.95346	0.650000	0.86243	AGA	.	.		0.333	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
KCNJ3	3760	hgsc.bcm.edu	37	2	155711536	155711536	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:155711536T>A	ENST00000295101.2	+	3	1694	c.1217T>A	c.(1216-1218)aTt>aAt	p.I406N	KCNJ3_ENST00000544049.1_3'UTR|KCNJ3_ENST00000493505.1_3'UTR	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	406					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CTGCAGAAAATTACTGGAAGA	0.393																																					p.I406N		Atlas-SNP	.											.	KCNJ3	126	.	0			c.T1217A						.						87.0	96.0	93.0					2																	155711536		2203	4300	6503	SO:0001583	missense	3760	exon3			AGAAAATTACTGG	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1217T>A	chr2.hg19:g.155711536T>A	ENSP00000295101:p.Ile406Asn	190.0	0.0		247.0	41.0	NM_002239	B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	hg19	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	T	16.33	3.092444	0.55968	.	.	ENSG00000162989	ENST00000295101	D	0.89939	-2.59	5.95	5.95	0.96441	.	0.355624	0.31976	N	0.006763	T	0.77896	0.4199	N	0.08118	0	0.80722	D	1	P	0.41748	0.761	B	0.38562	0.276	T	0.78140	-0.2320	10	0.15952	T	0.53	.	15.6134	0.76744	0.0:0.0:0.0:1.0	.	406	P48549	IRK3_HUMAN	N	406	ENSP00000295101:I406N	ENSP00000295101:I406N	I	+	2	0	KCNJ3	155419782	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.281000	0.76405	0.528000	0.53228	ATT	.	.		0.393	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
KLHL41	10324	hgsc.bcm.edu	37	2	170366494	170366494	+	Missense_Mutation	SNP	C	C	T	rs151212497		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:170366494C>T	ENST00000284669.1	+	1	283	c.206C>T	c.(205-207)gCg>gTg	p.A69V	BBS5_ENST00000554017.1_Intron|RP11-724O16.1_ENST00000513963.1_Intron	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	69	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)		p.A69V(1)									ATTGATGAGGCGAAAAAAAAG	0.388																																					p.A69V		Atlas-SNP	.											KBTBD10,rectum,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C206T						.	C	VAL/ALA	4,4402	8.1+/-20.4	0,4,2199	147.0	146.0	146.0		206	-8.0	0.3	2	dbSNP_134	146	0,8600		0,0,4300	no	missense	KBTBD10	NM_006063.2	64	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	69/607	170366494	4,13002	2203	4300	6503	SO:0001583	missense	10324	exon1			ATGAGGCGAAAAA	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.206C>T	chr2.hg19:g.170366494C>T	ENSP00000284669:p.Ala69Val	153.0	0.0		132.0	33.0	NM_006063	Q53R42	Missense_Mutation	SNP	ENST00000284669.1	hg19	CCDS2234.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133833	0.37630	9.08E-4	0.0	ENSG00000239474	ENST00000284669	T	0.71698	-0.59	5.17	-8.03	0.01114	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.336995	0.33980	N	0.004372	T	0.56108	0.1963	L	0.58810	1.83	0.20703	N	0.999863	B	0.27594	0.182	B	0.28916	0.096	T	0.42666	-0.9438	10	0.56958	D	0.05	.	7.0064	0.24838	0.405:0.4496:0.0599:0.0855	.	69	O60662	KBTBA_HUMAN	V	69	ENSP00000284669:A69V	ENSP00000284669:A69V	A	+	2	0	KBTBD10	170074740	1.000000	0.71417	0.315000	0.25238	0.898000	0.52572	3.337000	0.52120	-1.967000	0.01008	-0.291000	0.09656	GCG	.	C|1.000;T|0.000		0.388	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255263.1	NM_006063	
KLHL23	151230	hgsc.bcm.edu	37	2	170592146	170592146	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:170592146A>G	ENST00000392647.2	+	2	866	c.622A>G	c.(622-624)Act>Gct	p.T208A	KLHL23_ENST00000272797.4_Missense_Mutation_p.T208A|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	208	BACK.									breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						TATTAAGTGGACTGCTCATGA	0.358																																					p.T208A		Atlas-SNP	.											.	KLHL23	52	.	0			c.A622G						.						47.0	50.0	49.0					2																	170592146		2203	4300	6503	SO:0001583	missense	151230	exon2			AAGTGGACTGCTC	BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.622A>G	chr2.hg19:g.170592146A>G	ENSP00000376419:p.Thr208Ala	220.0	0.0		182.0	28.0	NM_144711	Q8N9B9|Q96FT8	Missense_Mutation	SNP	ENST00000392647.2	hg19	CCDS2236.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.289934	0.23478	.	.	ENSG00000213160	ENST00000272797;ENST00000392647;ENST00000437875	T;T;T	0.68181	-0.31;-0.31;-0.31	5.81	5.81	0.92471	BTB/Kelch-associated (2);	0.177917	0.47852	D	0.000206	T	0.55893	0.1949	L	0.40543	1.245	0.31123	N	0.708669	B	0.06786	0.001	B	0.06405	0.002	T	0.63998	-0.6510	9	0.87932	D	0	.	8.2201	0.31537	0.8481:0.0:0.1519:0.0	.	208	Q8NBE8	KLH23_HUMAN	A	208;208;29	ENSP00000272797:T208A;ENSP00000376419:T208A;ENSP00000394732:T29A	ENSP00000272797:T208A	T	+	1	0	KLHL23	170300392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.977000	0.49297	2.210000	0.71456	0.533000	0.62120	ACT	.	.		0.358	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255271.2	NM_144711	
TTN	7273	hgsc.bcm.edu	37	2	179665283	179665283	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:179665283C>T	ENST00000591111.1	-	4	646	c.422G>A	c.(421-423)gGa>gAa	p.G141E	TTN_ENST00000342992.6_Missense_Mutation_p.G141E|TTN_ENST00000360870.5_Missense_Mutation_p.G141E|TTN_ENST00000342175.6_Missense_Mutation_p.G141E|TTN_ENST00000359218.5_Missense_Mutation_p.G141E|TTN_ENST00000460472.2_Missense_Mutation_p.G141E|TTN_ENST00000589042.1_Missense_Mutation_p.G141E			Q8WZ42	TITIN_HUMAN	titin	32759	Ig-like 2.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATTTCGGCTCCATCCCGGTA	0.507																																					p.G141E		Atlas-SNP	.											.	TTN	18412	.	0			c.G422A						.						143.0	129.0	134.0					2																	179665283		2203	4300	6503	SO:0001583	missense	7273	exon4			TCGGCTCCATCCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.422G>A	chr2.hg19:g.179665283C>T	ENSP00000465570:p.Gly141Glu	115.0	0.0		144.0	16.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.93	3.509613	0.64522	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	5.95	5.95	0.96441	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87386	0.6164	M	0.79123	2.44	0.46078	D	0.998859	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.984;0.984;0.984;0.984;0.995	D	0.87571	0.2478	9	0.87932	D	0	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	141;141;141;141;141	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	E	141	ENSP00000343764:G141E;ENSP00000434586:G141E;ENSP00000340554:G141E;ENSP00000352154:G141E;ENSP00000354117:G141E	ENSP00000340554:G141E	G	-	2	0	TTN	179373528	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.826000	0.97356	0.563000	0.77884	GGA	.	.		0.507	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802803	185802803	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:185802803G>A	ENST00000302277.6	+	4	3274	c.2680G>A	c.(2680-2682)Gaa>Aaa	p.E894K		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	894							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AACCAATGGTGAAACTGAGCA	0.403																																					p.E894K		Atlas-SNP	.											.	ZNF804A	322	.	0			c.G2680A						.						96.0	89.0	92.0					2																	185802803		2203	4300	6503	SO:0001583	missense	91752	exon4			AATGGTGAAACTG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2680G>A	chr2.hg19:g.185802803G>A	ENSP00000303252:p.Glu894Lys	110.0	0.0		106.0	16.0	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	4.377	0.069463	0.08436	.	.	ENSG00000170396	ENST00000302277	T	0.05925	3.37	5.57	1.42	0.22433	.	0.638690	0.14470	N	0.317606	T	0.03827	0.0108	N	0.17082	0.46	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.39482	-0.9612	10	0.41790	T	0.15	-3.0364	5.4331	0.16464	0.3234:0.2033:0.4733:0.0	.	894	Q7Z570	Z804A_HUMAN	K	894	ENSP00000303252:E894K	ENSP00000303252:E894K	E	+	1	0	ZNF804A	185511048	0.000000	0.05858	0.001000	0.08648	0.228000	0.25075	-0.376000	0.07465	0.694000	0.31654	0.591000	0.81541	GAA	.	.		0.403	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
XRCC5	7520	hgsc.bcm.edu	37	2	217006004	217006004	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:217006004A>G	ENST00000392133.3	+	15	1899	c.1438A>G	c.(1438-1440)Acc>Gcc	p.T480A	XRCC5_ENST00000392132.2_Missense_Mutation_p.T480A|XRCC5_ENST00000471649.1_3'UTR			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	480	Pro-rich.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		GTTTCCAACCACCAAAATCCC	0.383								Non-homologous end-joining																													p.T480A		Atlas-SNP	.											.	XRCC5	64	.	0			c.A1438G						.						134.0	133.0	133.0					2																	217006004		2203	4300	6503	SO:0001583	missense	7520	exon13			CCAACCACCAAAA	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1438A>G	chr2.hg19:g.217006004A>G	ENSP00000375978:p.Thr480Ala	126.0	0.0		90.0	29.0	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	hg19	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	A	9.588	1.125388	0.20959	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.41758	0.99;0.99	5.56	-0.622	0.11560	Spen Paralogue and Orthologue SPOC, C-terminal-like (1);Ku70/Ku80 C-terminal arm (2);	0.627414	0.16965	N	0.192329	T	0.23094	0.0558	L	0.29908	0.895	0.21604	N	0.999625	B	0.02656	0.0	B	0.04013	0.001	T	0.22836	-1.0205	10	0.12766	T	0.61	.	6.5536	0.22448	0.5625:0.0:0.0723:0.3652	.	480	P13010	XRCC5_HUMAN	A	480	ENSP00000375978:T480A;ENSP00000375977:T480A	ENSP00000375977:T480A	T	+	1	0	XRCC5	216714249	0.985000	0.35326	0.977000	0.42913	0.803000	0.45373	1.445000	0.35079	0.054000	0.16065	-0.336000	0.08194	ACC	.	.		0.383	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
DES	1674	hgsc.bcm.edu	37	2	220283471	220283471	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:220283471C>T	ENST00000373960.3	+	1	373	c.287C>T	c.(286-288)gCg>gTg	p.A96V		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	96	Head.				cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTGGCCGACGCGGTGAACCAG	0.677																																					p.A96V		Atlas-SNP	.											DES,NS,malignant_melanoma,0,1	DES	53	.	0			c.C287T						.						20.0	19.0	19.0					2																	220283471		2175	4263	6438	SO:0001583	missense	1674	exon1			CCGACGCGGTGAA	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.287C>T	chr2.hg19:g.220283471C>T	ENSP00000363071:p.Ala96Val	339.0	0.0		262.0	51.0	NM_001927	Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Missense_Mutation	SNP	ENST00000373960.3	hg19	CCDS33383.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090082	0.94149	.	.	ENSG00000175084	ENST00000373960	D	0.86694	-2.16	4.55	4.55	0.56014	Intermediate filament head, DNA-binding domain (1);	0.000000	0.49305	D	0.000143	D	0.93969	0.8069	M	0.84511	2.7	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94813	0.7980	10	0.62326	D	0.03	.	17.2901	0.87153	0.0:1.0:0.0:0.0	.	96	P17661	DESM_HUMAN	V	96	ENSP00000363071:A96V	ENSP00000363071:A96V	A	+	2	0	DES	219991715	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	7.593000	0.82686	2.254000	0.74563	0.561000	0.74099	GCG	.	.		0.677	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130240.1	NM_001927	
SPEG	10290	hgsc.bcm.edu	37	2	220348192	220348192	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:220348192G>T	ENST00000312358.7	+	30	6139	c.6007G>T	c.(6007-6009)Gct>Tct	p.A2003S	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2003					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGCAGCTGGGGCTAGCCCCAG	0.771																																					p.A2003S		Atlas-SNP	.											.	SPEG	272	.	0			c.G6007T						.						2.0	3.0	3.0					2																	220348192		1271	3082	4353	SO:0001583	missense	10290	exon30			GCTGGGGCTAGCC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.6007G>T	chr2.hg19:g.220348192G>T	ENSP00000311684:p.Ala2003Ser	37.0	0.0		30.0	20.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	0.767	-0.767292	0.02974	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.61980	0.06	4.06	-3.76	0.04359	.	1.079220	0.07387	N	0.888451	T	0.27063	0.0663	N	0.04508	-0.205	0.21762	N	0.999553	B	0.02656	0.0	B	0.01281	0.0	T	0.21245	-1.0251	10	0.06891	T	0.86	.	1.1771	0.01838	0.1367:0.2099:0.3213:0.3321	.	2003	Q15772	SPEG_HUMAN	S	2003	ENSP00000311684:A2003S	ENSP00000265327:A2003S	A	+	1	0	SPEG	220056436	0.003000	0.15002	0.013000	0.15412	0.264000	0.26372	-0.533000	0.06157	-0.585000	0.05905	-0.519000	0.04390	GCT	.	.		0.771	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
EPHA4	2043	hgsc.bcm.edu	37	2	222294720	222294720	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:222294720C>T	ENST00000281821.2	-	15	2689	c.2648G>A	c.(2647-2649)cGc>cAc	p.R883H	EPHA4_ENST00000409854.1_Missense_Mutation_p.R883H|EPHA4_ENST00000409938.1_Missense_Mutation_p.R883H|EPHA4_ENST00000392071.4_Missense_Mutation_p.R832H	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	883					adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GTTGGGGTTGCGGATGAGTTT	0.512																																					p.R883H		Atlas-SNP	.											.	EPHA4	263	.	0			c.G2648A						.						191.0	187.0	188.0					2																	222294720		2203	4300	6503	SO:0001583	missense	2043	exon15			GGGTTGCGGATGA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2648G>A	chr2.hg19:g.222294720C>T	ENSP00000281821:p.Arg883His	73.0	0.0		76.0	9.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994878	0.93167	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.89	5.89	0.94794	Protein kinase-like domain (1);	0.097095	0.64402	D	0.000001	T	0.76737	0.4029	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.76366	-0.2985	10	0.66056	D	0.02	.	20.3344	0.98733	0.0:1.0:0.0:0.0	.	883	P54764	EPHA4_HUMAN	H	883;883;883;832	ENSP00000281821:R883H;ENSP00000386276:R883H;ENSP00000386829:R883H;ENSP00000375923:R832H	ENSP00000281821:R883H	R	-	2	0	EPHA4	222002964	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.087000	0.71362	2.822000	0.97130	0.650000	0.86243	CGC	.	.		0.512	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
USP40	55230	hgsc.bcm.edu	37	2	234465583	234465583	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:234465583T>C	ENST00000427112.2	-	4	499	c.464A>G	c.(463-465)cAt>cGt	p.H155R	USP40_ENST00000450966.1_Missense_Mutation_p.H167R|USP40_ENST00000251722.6_Missense_Mutation_p.H155R			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	155	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GATGAGGTCATGACCGGAGGT	0.423																																					p.H167R		Atlas-SNP	.											.	USP40	174	.	0			c.A500G						.						101.0	94.0	96.0					2																	234465583		1858	4102	5960	SO:0001583	missense	55230	exon4			AGGTCATGACCGG	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.464A>G	chr2.hg19:g.234465583T>C	ENSP00000387898:p.His155Arg	160.0	0.0		165.0	53.0	NM_018218	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	hg19	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.107667	0.77096	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000435959	T;T;T	0.30182	1.54;1.54;1.54	5.33	5.33	0.75918	.	0.093277	0.64402	D	0.000001	T	0.35941	0.0949	N	0.25789	0.76	0.46564	D	0.999104	D	0.53885	0.963	P	0.54026	0.74	T	0.18493	-1.0335	10	0.66056	D	0.02	.	15.312	0.74042	0.0:0.0:0.0:1.0	.	167	Q9NVE5-3	.	R	167;155;155;155	ENSP00000415434:H167R;ENSP00000251722:H155R;ENSP00000387898:H155R	ENSP00000251722:H155R	H	-	2	0	USP40	234130322	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.700000	0.68318	2.022000	0.59522	0.533000	0.62120	CAT	.	.		0.423	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
ZNF197	10168	hgsc.bcm.edu	37	3	44674045	44674045	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:44674045G>A	ENST00000396058.1	+	4	890	c.723G>A	c.(721-723)ttG>ttA	p.L241L	RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Silent_p.L241L|ZNF197_ENST00000344387.4_Silent_p.L241L|ZNF197_ENST00000383744.4_Silent_p.L241L			O14709	ZN197_HUMAN	zinc finger protein 197	241	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AGAGGGCCTTGTACTGGGATG	0.448																																					p.L241L		Atlas-SNP	.											.	ZNF197	81	.	0			c.G723A						.						230.0	208.0	216.0					3																	44674045		2203	4300	6503	SO:0001819	synonymous_variant	10168	exon5			GGCCTTGTACTGG	AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.723G>A	chr3.hg19:g.44674045G>A		134.0	0.0		84.0	45.0	NM_001024855	B2RAH8|Q86VG0	Silent	SNP	ENST00000396058.1	hg19	CCDS2717.1																																																																																			.	.		0.448	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991	
HYAL3	8372	hgsc.bcm.edu	37	3	50330774	50330774	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:50330774C>A	ENST00000336307.1	-	4	1429	c.1157G>T	c.(1156-1158)aGc>aTc	p.S386I	HYAL3_ENST00000359051.3_Missense_Mutation_p.S356I|HYAL3_ENST00000450982.1_Missense_Mutation_p.S356I|HYAL3_ENST00000415204.1_Missense_Mutation_p.S137I|IFRD2_ENST00000336089.4_5'Flank|IFRD2_ENST00000429673.2_5'Flank|HYAL3_ENST00000513170.1_Missense_Mutation_p.S107I|IFRD2_ENST00000484043.1_5'Flank|IFRD2_ENST00000417626.2_5'Flank|IFRD2_ENST00000436390.1_5'Flank	NM_001200029.1|NM_003549.3	NP_001186958.1|NP_003540.2	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3	386	EGF-like.				carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)|response to virus (GO:0009615)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|lysosome (GO:0005764)	hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(5)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		ATCTCCAAGGCTGCCGTCTGG	0.632																																					p.S386I		Atlas-SNP	.											.	HYAL3	34	.	0			c.G1157T						.						41.0	46.0	44.0					3																	50330774		2203	4300	6503	SO:0001583	missense	8372	exon4			CCAAGGCTGCCGT	AF040710	CCDS2815.1, CCDS56259.1, CCDS56260.1, CCDS56257.1	3p21.3	2004-03-12			ENSG00000186792	ENSG00000186792			5322	protein-coding gene	gene with protein product		604038				10493834	Standard	NM_003549		Approved	LUCA-3, LUCA14, Minna14	uc021wyn.1	O43820	OTTHUMG00000156936	ENST00000336307.1:c.1157G>T	chr3.hg19:g.50330774C>A	ENSP00000337425:p.Ser386Ile	268.0	0.0		219.0	76.0	NM_001200029	O60540|Q8NFK2|Q8NFK3|Q8NFK4|Q96E56|Q9BRW9	Missense_Mutation	SNP	ENST00000336307.1	hg19	CCDS2815.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830294	0.32329	.	.	ENSG00000186792	ENST00000359051;ENST00000336307;ENST00000415204;ENST00000513170;ENST00000450982	T;T;T;T	0.45668	1.87;2.23;0.89;1.87	5.44	0.14	0.14804	Epidermal growth factor-like (1);	0.538663	0.13889	U	0.355763	T	0.42988	0.1227	M	0.88310	2.945	0.38319	D	0.943462	B;B;B;B	0.12630	0.001;0.001;0.003;0.006	B;B;B;B	0.14023	0.005;0.003;0.005;0.01	T	0.38757	-0.9646	10	0.45353	T	0.12	-9.5212	3.4003	0.07321	0.123:0.4823:0.2383:0.1563	.	107;137;386;356	O43820-4;O43820-3;O43820;O43820-2	.;.;HYAL3_HUMAN;.	I	356;386;137;107;356	ENSP00000351946:S356I;ENSP00000337425:S386I;ENSP00000401092:S137I;ENSP00000391922:S356I	ENSP00000337425:S386I	S	-	2	0	HYAL3	50305778	0.002000	0.14202	0.998000	0.56505	0.586000	0.36452	-0.055000	0.11807	0.106000	0.17784	-0.140000	0.14226	AGC	.	.		0.632	HYAL3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000346664.1	NM_003549	
CACNA2D3	55799	hgsc.bcm.edu	37	3	55052296	55052296	+	Missense_Mutation	SNP	G	G	A	rs376433361		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:55052296G>A	ENST00000474759.1	+	35	2987	c.2939G>A	c.(2938-2940)cGc>cAc	p.R980H	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.R886H|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.R980H|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.R980H|CACNA2D3_ENST00000478261.1_3'UTR	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	980						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GTCTCTGAGCGCACCATCAAG	0.483																																					p.R980H		Atlas-SNP	.											.	CACNA2D3	159	.	0			c.G2939A						.						86.0	84.0	85.0					3																	55052296		1946	4144	6090	SO:0001583	missense	55799	exon35			CTGAGCGCACCAT	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2939G>A	chr3.hg19:g.55052296G>A	ENSP00000419101:p.Arg980His	125.0	0.0		116.0	41.0	NM_018398	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	hg19	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393397	0.83011	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	M	0.61703	1.905	0.46798	D	0.9992	D	0.61080	0.989	P	0.50708	0.648	T	0.63065	-0.6720	10	0.46703	T	0.11	.	17.3487	0.87316	0.0:0.0:1.0:0.0	.	980	Q8IZS8	CA2D3_HUMAN	H	980;980;980;886;886	ENSP00000389506:R980H;ENSP00000419101:R980H;ENSP00000288197:R980H;ENSP00000417279:R886H	ENSP00000288197:R980H	R	+	2	0	CACNA2D3	55027336	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.233000	0.95337	2.522000	0.85027	0.563000	0.77884	CGC	.	.		0.483	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
DNAJB8	165721	hgsc.bcm.edu	37	3	128181523	128181523	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:128181523A>C	ENST00000469083.1	-	2	3123	c.566T>G	c.(565-567)aTc>aGc	p.I189S	DNAJB8-AS1_ENST00000471626.1_RNA|DNAJB8_ENST00000319153.3_Missense_Mutation_p.I189S			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	189					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		GTGGCCATTGATCATCTCGGT	0.627																																					p.I189S		Atlas-SNP	.											.	DNAJB8	34	.	0			c.T566G						.						134.0	112.0	120.0					3																	128181523		2203	4300	6503	SO:0001583	missense	165721	exon3			CCATTGATCATCT		CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.566T>G	chr3.hg19:g.128181523A>C	ENSP00000417418:p.Ile189Ser	110.0	0.0		81.0	38.0	NM_153330	B3KWV7	Missense_Mutation	SNP	ENST00000469083.1	hg19	CCDS3048.1	.	.	.	.	.	.	.	.	.	.	A	9.883	1.202088	0.22121	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.46063	0.88;0.88	4.75	3.59	0.41128	.	0.518516	0.20427	N	0.092549	T	0.38639	0.1048	L	0.51422	1.61	0.38866	D	0.956598	B	0.32968	0.392	B	0.36666	0.23	T	0.32079	-0.9920	10	0.59425	D	0.04	.	9.1168	0.36762	0.9156:0.0:0.0844:0.0	.	189	Q8NHS0	DNJB8_HUMAN	S	189	ENSP00000417418:I189S;ENSP00000316053:I189S	ENSP00000316053:I189S	I	-	2	0	DNAJB8	129664213	1.000000	0.71417	0.415000	0.26534	0.022000	0.10575	4.136000	0.58004	0.668000	0.31126	-0.375000	0.07067	ATC	.	.		0.627	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330	
ACPP	55	hgsc.bcm.edu	37	3	132071587	132071587	+	Silent	SNP	A	A	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:132071587A>C	ENST00000336375.5	+	9	978	c.888A>C	c.(886-888)ctA>ctC	p.L296L	ACPP_ENST00000351273.7_Silent_p.L296L|ACPP_ENST00000475741.1_Silent_p.L263L	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	296					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TGAGTGGCCTACAGATGGCGC	0.433																																					p.L296L		Atlas-SNP	.											.	ACPP	118	.	0			c.A888C						.						154.0	139.0	144.0					3																	132071587		2203	4300	6503	SO:0001819	synonymous_variant	55	exon9			TGGCCTACAGATG		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.888A>C	chr3.hg19:g.132071587A>C		62.0	0.0		63.0	19.0	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Silent	SNP	ENST00000336375.5	hg19	CCDS3073.1																																																																																			.	.		0.433	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
CEP70	80321	hgsc.bcm.edu	37	3	138289288	138289288	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:138289288T>C	ENST00000264982.3	-	6	603	c.337A>G	c.(337-339)Aat>Gat	p.N113D	CEP70_ENST00000484888.1_Missense_Mutation_p.N113D|CEP70_ENST00000489254.1_Intron|CEP70_ENST00000481834.1_Missense_Mutation_p.N113D|CEP70_ENST00000478673.1_5'UTR|CEP70_ENST00000464035.1_Missense_Mutation_p.N113D|CEP70_ENST00000542237.1_Missense_Mutation_p.N93D	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	113					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						TCCAAGTCATTAGCTCGTTGT	0.348																																					p.N113D		Atlas-SNP	.											.	CEP70	51	.	0			c.A337G						.						149.0	138.0	142.0					3																	138289288		2203	4299	6502	SO:0001583	missense	80321	exon6			AGTCATTAGCTCG	AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.337A>G	chr3.hg19:g.138289288T>C	ENSP00000264982:p.Asn113Asp	164.0	0.0		147.0	67.0	NM_024491	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	ENST00000264982.3	hg19	CCDS3102.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.039049	0.55003	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000484888;ENST00000474781;ENST00000481834;ENST00000468900;ENST00000462419;ENST00000464035;ENST00000470159	T;T;T;T;T;T;T;T	0.46451	1.48;1.49;1.48;1.49;1.47;0.88;0.88;0.87	4.98	4.98	0.66077	.	0.365869	0.28067	N	0.016730	T	0.33323	0.0859	L	0.43152	1.355	0.26613	N	0.972796	P;B;P	0.48503	0.911;0.026;0.911	B;B;B	0.41510	0.359;0.027;0.359	T	0.19321	-1.0309	10	0.19590	T	0.45	-15.1773	10.9787	0.47482	0.0:0.0:0.0:1.0	.	93;113;113	F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;CEP70_HUMAN	D	113;93;113;95;113;92;93;113;113	ENSP00000264982:N113D;ENSP00000444128:N93D;ENSP00000419231:N113D;ENSP00000419833:N95D;ENSP00000417465:N113D;ENSP00000418131:N92D;ENSP00000417819:N93D;ENSP00000419743:N113D	ENSP00000264982:N113D	N	-	1	0	CEP70	139771978	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	2.003000	0.40844	2.093000	0.63338	0.528000	0.53228	AAT	.	.		0.348	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491	
VWA5B2	90113	hgsc.bcm.edu	37	3	183953088	183953088	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:183953088G>A	ENST00000426955.2	+	7	1193	c.1093G>A	c.(1093-1095)Gca>Aca	p.A365T	EIF2B5_ENST00000444495.1_Intron|VWA5B2_ENST00000273794.5_Missense_Mutation_p.A146T	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	376	VWFA.									breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						CAGCAGCGTGGCACACAAGGC	0.652																																					p.A365T		Atlas-SNP	.											.	VWA5B2	47	.	0			c.G1093A						.						35.0	36.0	36.0					3																	183953088		692	1591	2283	SO:0001583	missense	90113	exon7			AGCGTGGCACACA		CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.1093G>A	chr3.hg19:g.183953088G>A	ENSP00000398688:p.Ala365Thr	143.0	0.0		135.0	27.0	NM_138345	B9EGN7	Missense_Mutation	SNP	ENST00000426955.2	hg19	CCDS54686.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304303	0.40795	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.21361	2.01;2.01	4.89	3.06	0.35304	von Willebrand factor, type A (1);	0.713046	0.12145	N	0.495466	T	0.17195	0.0413	L	0.44542	1.39	0.09310	N	1	B;B;B	0.15719	0.014;0.014;0.014	B;B;B	0.18263	0.021;0.021;0.021	T	0.15578	-1.0432	10	0.48119	T	0.1	0.484	5.4821	0.16729	0.0994:0.0:0.7012:0.1995	.	146;365;376	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	T	365;146	ENSP00000398688:A365T;ENSP00000273794:A146T	ENSP00000273794:A146T	A	+	1	0	VWA5B2	185435782	0.008000	0.16893	0.003000	0.11579	0.071000	0.16799	1.200000	0.32247	1.404000	0.46819	0.655000	0.94253	GCA	.	.		0.652	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346004.2	XM_291077	
CEP19	84984	hgsc.bcm.edu	37	3	196435517	196435517	+	Silent	SNP	A	A	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:196435517A>T	ENST00000409690.3	-	2	446	c.24T>A	c.(22-24)acT>acA	p.T8T	RNU6-646P_ENST00000364571.1_RNA|CEP19_ENST00000399942.4_Intron	NM_032898.3	NP_116287.2	Q96LK0	CEP19_HUMAN	centrosomal protein 19kDa	4						centriole (GO:0005814)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	10						ATTTCTTGGCAGTGCACATCA	0.413																																					p.T8T		Atlas-SNP	.											.	CEP19	22	.	0			c.T24A						.						110.0	101.0	104.0					3																	196435517		1909	4136	6045	SO:0001819	synonymous_variant	84984	exon2			CTTGGCAGTGCAC	BC007827	CCDS43193.2	3q29	2014-02-20	2011-05-06	2011-05-06	ENSG00000174007	ENSG00000174007			28209	protein-coding gene	gene with protein product		615586	"""chromosome 3 open reading frame 34"""	C3orf34		21399614	Standard	XM_005269370		Approved	MGC14126	uc011btw.2	Q96LK0	OTTHUMG00000153933	ENST00000409690.3:c.24T>A	chr3.hg19:g.196435517A>T		88.0	0.0		59.0	13.0	NM_032898	B2RA74|Q96I48	Silent	SNP	ENST00000409690.3	hg19	CCDS43193.2																																																																																			.	.		0.413	CEP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333080.2	NM_032898	
FAM157A	728262	hgsc.bcm.edu	37	3	197880167	197880167	+	lincRNA	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:197880167G>A	ENST00000437428.2	+	0	47							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcaACTGG	0.527																																					p.Q82Q		Atlas-SNP	.											.	FAM157A	4	.	0			c.G246A						.						2.0	6.0	5.0					3																	197880167		369	1057	1426			728262	exon2			GCAGCAGCAGCAA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			chr3.hg19:g.197880167G>A		483.0	0.0		407.0	20.0	NM_001145248		Silent	SNP	ENST00000437428.2	hg19																																																																																				.	.		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
SLBP	7884	hgsc.bcm.edu	37	4	1701359	1701359	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr4:1701359C>G	ENST00000489418.1	-	5	777	c.411G>C	c.(409-411)agG>agC	p.R137S	SLBP_ENST00000318386.4_Missense_Mutation_p.R144S|SLBP_ENST00000488267.1_Missense_Mutation_p.R102S|SLBP_ENST00000429429.2_Missense_Mutation_p.R98S	NM_006527.2	NP_006518.1	Q14493	SLBP_HUMAN	stem-loop binding protein	137	RNA-binding.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA transport (GO:0051028)|nuclear cell cycle DNA replication (GO:0033260)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	histone pre-mRNA DCP binding (GO:0071208)|histone pre-mRNA stem-loop binding (GO:0071207)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|lung(2)	5		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.0055)			GCTTCTGTCTCCTCATTAGGA	0.403																																					p.R137S		Atlas-SNP	.											.	SLBP	12	.	0			c.G411C						.						159.0	146.0	150.0					4																	1701359		2203	4300	6503	SO:0001583	missense	7884	exon5			CTGTCTCCTCATT	Z71188	CCDS3350.1	4p16.3	2008-02-11	2008-02-11		ENSG00000163950	ENSG00000163950			10904	protein-coding gene	gene with protein product	"""histone binding protein"""	602422	"""stem-loop (histone) binding protein"""			9049306, 1338771	Standard	NM_006527		Approved	HBP	uc003gdi.1	Q14493	OTTHUMG00000089349	ENST00000489418.1:c.411G>C	chr4.hg19:g.1701359C>G	ENSP00000417686:p.Arg137Ser	78.0	0.0		32.0	27.0	NM_006527	B3KRJ5	Missense_Mutation	SNP	ENST00000489418.1	hg19	CCDS3350.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	21.7|21.7|21.7	4.191240|4.191240|4.191240	0.78902|0.78902|0.78902	.|.|.	.|.|.	ENSG00000163950|ENSG00000163950|ENSG00000163950	ENST00000480936|ENST00000483348|ENST00000429429;ENST00000489418;ENST00000460392;ENST00000318386;ENST00000488267	.|.|.	.|.|.	.|.|.	5.08|5.08|5.08	-2.32|-2.32|-2.32	0.06745|0.06745|0.06745	.|.|.	.|.|0.053107	.|.|0.64402	.|.|D	.|.|0.000001	T|T|T	0.66257|0.66257|0.66257	0.2771|0.2771|0.2771	M|M|M	0.67397|0.67397|0.67397	2.05|2.05|2.05	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;P;B;D	.|.|0.89917	.|.|1.0;0.987;0.476;0.087;0.993	.|.|D;P;B;B;P	.|.|0.70716	.|.|0.97;0.88;0.216;0.063;0.88	T|T|T	0.63646|0.63646|0.63646	-0.6590|-0.6590|-0.6590	5|5|9	.|.|0.52906	.|.|T	.|.|0.07	-13.5987|-13.5987|-13.5987	9.0891|9.0891|9.0891	0.36598|0.36598|0.36598	0.0:0.2302:0.113:0.6568|0.0:0.2302:0.113:0.6568|0.0:0.2302:0.113:0.6568	.|.|.	.|.|102;144;98;117;137	.|.|E7EUV9;F8W8D3;B3KRJ5;C9IY53;Q14493	.|.|.;.;.;.;SLBP_HUMAN	Q|A|S	145|92|98;137;117;144;102	.|.|.	.|.|ENSP00000316490:R144S	E|G|R	-|-|-	1|2|3	0|0|2	SLBP|SLBP|SLBP	1671157|1671157|1671157	0.288000|0.288000|0.288000	0.24324|0.24324|0.24324	0.977000|0.977000|0.977000	0.42913|0.42913|0.42913	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	-0.484000|-0.484000|-0.484000	0.06528|0.06528|0.06528	-0.597000|-0.597000|-0.597000	0.05813|0.05813|0.05813	0.644000|0.644000|0.644000	0.83932|0.83932|0.83932	GAG|GGA|AGG	.	.		0.403	SLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203176.1	NM_006527	
TBC1D19	55296	hgsc.bcm.edu	37	4	26661311	26661312	+	Nonsense_Mutation	DNP	AA	AA	GT			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr4:26661311_26661312AA>GT	ENST00000264866.4	+	8	851_852	c.573_574AA>GT	c.(571-576)gtAAaa>gtGTaa	p.K192*	TBC1D19_ENST00000515568.1_3'UTR|TBC1D19_ENST00000511789.1_Nonsense_Mutation_p.K127*	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	192							Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				CACTGAAAGTAAAAGACATCCC	0.287																																					p.V191V|p.K192X		Atlas-SNP	.											.	TBC1D19	53	.	0			c.A573G|c.A574T						.																																			SO:0001587	stop_gained	55296	exon8			GAAAGTAAAAGAC|AAAGTAAAAGACA	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	Exception_encountered	chr4.hg19:g.26661311_26661312delinsGT	ENSP00000264866:p.Lys192*	72.0|71.0	0.0		45.0	32.0|33.0	NM_018317	B9A6M0|Q9NUX1	Silent|Nonsense_Mutation	SNP	ENST00000264866.4	hg19	CCDS3439.1																																																																																			.	.		0.287	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317	
GABRB1	2560	hgsc.bcm.edu	37	4	47163294	47163294	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr4:47163294A>C	ENST00000295454.3	+	4	561	c.269A>C	c.(268-270)cAg>cCg	p.Q90P	GABRB1_ENST00000538619.1_Missense_Mutation_p.Q20P	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	90					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TATTTCCAGCAGTCTTGGAAA	0.358																																					p.Q90P		Atlas-SNP	.											.	GABRB1	107	.	0			c.A269C						.						80.0	83.0	82.0					4																	47163294		2203	4298	6501	SO:0001583	missense	2560	exon4			TCCAGCAGTCTTG		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.269A>C	chr4.hg19:g.47163294A>C	ENSP00000295454:p.Gln90Pro	63.0	0.0		71.0	39.0	NM_000812	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	hg19	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.312877	0.81358	.	.	ENSG00000163288	ENST00000513567;ENST00000295454;ENST00000538619	T;T;T	0.79845	-1.31;-1.31;-1.31	5.01	5.01	0.66863	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	D	0.000003	D	0.92870	0.7732	H	0.96833	3.89	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.97110	1.0;0.992	D	0.94968	0.8114	10	0.87932	D	0	-13.0383	14.0523	0.64745	1.0:0.0:0.0:0.0	.	20;90	F5GXV5;P18505	.;GBRB1_HUMAN	P	57;90;20	ENSP00000426753:Q57P;ENSP00000295454:Q90P;ENSP00000440330:Q20P	ENSP00000295454:Q90P	Q	+	2	0	GABRB1	46858051	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.139000	0.94554	2.109000	0.64355	0.528000	0.53228	CAG	.	.		0.358	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		
REST	5978	hgsc.bcm.edu	37	4	57796730	57796730	+	Missense_Mutation	SNP	A	A	G	rs541994823		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr4:57796730A>G	ENST00000309042.7	+	4	2020	c.1706A>G	c.(1705-1707)aAa>aGa	p.K569R		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	569	Lys-rich.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					GAGGAGAATAAAAAGCAAAAT	0.348																																					p.K569R		Atlas-SNP	.											.	REST	104	.	0			c.A1706G						.						18.0	20.0	19.0					4																	57796730		2183	4290	6473	SO:0001583	missense	5978	exon4			AGAATAAAAAGCA	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.1706A>G	chr4.hg19:g.57796730A>G	ENSP00000311816:p.Lys569Arg	453.0	0.0		242.0	167.0	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	hg19	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	A	17.96	3.516842	0.64634	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.41400	1.0	5.35	5.35	0.76521	.	0.631179	0.15334	N	0.267877	T	0.63189	0.2490	M	0.71581	2.175	0.46609	D	0.999121	D;D	0.69078	0.997;0.986	D;P	0.65443	0.935;0.722	T	0.64639	-0.6360	10	0.62326	D	0.03	-5.6695	15.008	0.71527	1.0:0.0:0.0:0.0	.	546;569	F8WAN5;Q13127	.;REST_HUMAN	R	569;546	ENSP00000311816:K569R	ENSP00000311816:K569R	K	+	2	0	REST	57491487	1.000000	0.71417	0.267000	0.24556	0.495000	0.33615	3.170000	0.50816	2.029000	0.59856	0.459000	0.35465	AAA	.	.		0.348	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
PTPN13	5783	hgsc.bcm.edu	37	4	87556432	87556432	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr4:87556432C>A	ENST00000411767.2	+	2	86	c.23C>A	c.(22-24)gCc>gAc	p.A8D	PTPN13_ENST00000316707.6_Missense_Mutation_p.A8D|PTPN13_ENST00000502971.1_Missense_Mutation_p.A8D|PTPN13_ENST00000427191.2_Missense_Mutation_p.A8D|PTPN13_ENST00000511467.1_Missense_Mutation_p.A8D|PTPN13_ENST00000436978.1_Missense_Mutation_p.A8D			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	8	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CTAGCTGAGGCCCTGGAGGTT	0.428																																					p.A8D		Atlas-SNP	.											.	PTPN13	203	.	0			c.C23A						.						57.0	59.0	58.0					4																	87556432		1931	4133	6064	SO:0001583	missense	5783	exon2			CTGAGGCCCTGGA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.23C>A	chr4.hg19:g.87556432C>A	ENSP00000407249:p.Ala8Asp	92.0	0.0		60.0	45.0	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	hg19	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789033	0.90367	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000502971;ENST00000316707;ENST00000411767;ENST00000507902;ENST00000511467	T;T;T;T;T;T;T	0.33216	2.09;2.09;1.42;2.09;2.09;2.09;2.09	5.65	4.81	0.61882	KIND (2);	0.000000	0.50627	D	0.000105	T	0.55909	0.1950	M	0.75264	2.295	0.58432	D	0.999999	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.97110	0.981;1.0;0.999;1.0	T	0.61476	-0.7055	10	0.87932	D	0	.	14.4557	0.67416	0.0:0.9284:0.0:0.0716	.	8;8;8;8	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	D	8	ENSP00000408368:A8D;ENSP00000394794:A8D;ENSP00000423531:A8D;ENSP00000322675:A8D;ENSP00000407249:A8D;ENSP00000422835:A8D;ENSP00000426626:A8D	ENSP00000322675:A8D	A	+	2	0	PTPN13	87775456	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.157000	0.77461	1.379000	0.46325	0.650000	0.86243	GCC	.	.		0.428	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
CEP44	80817	hgsc.bcm.edu	37	4	175225507	175225507	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr4:175225507T>G	ENST00000503780.1	+	6	908	c.494T>G	c.(493-495)aTg>aGg	p.M165R	CEP44_ENST00000296519.4_Missense_Mutation_p.M165R|CEP44_ENST00000457424.2_Missense_Mutation_p.M165R|CEP44_ENST00000426172.1_Missense_Mutation_p.M165R	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	165						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						GGCAGGTTTATGACCTCAGGA	0.373																																					p.M165R		Atlas-SNP	.											.	CEP44	35	.	0			c.T494G						.						63.0	66.0	65.0					4																	175225507		2203	4300	6503	SO:0001583	missense	80817	exon6			GGTTTATGACCTC	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.494T>G	chr4.hg19:g.175225507T>G	ENSP00000423153:p.Met165Arg	206.0	0.0		142.0	96.0	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	hg19	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	T	6.671	0.492391	0.12702	.	.	ENSG00000164118	ENST00000503780;ENST00000457424;ENST00000515299;ENST00000426172;ENST00000296519	T;T;T;T;T	0.47177	0.88;0.85;0.87;0.85;0.88	4.59	3.4	0.38934	.	0.577476	0.17031	N	0.189696	T	0.39358	0.1075	L	0.47716	1.5	0.22412	N	0.999124	B;B	0.24963	0.036;0.115	B;B	0.26310	0.051;0.068	T	0.36866	-0.9730	10	0.62326	D	0.03	.	7.3367	0.26613	0.0:0.104:0.0:0.896	.	165;165	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	R	165	ENSP00000423153:M165R;ENSP00000389427:M165R;ENSP00000421128:M165R;ENSP00000408221:M165R;ENSP00000296519:M165R	ENSP00000296519:M165R	M	+	2	0	CEP44	175462082	0.994000	0.37717	0.875000	0.34327	0.003000	0.03518	3.892000	0.56235	0.853000	0.35312	0.379000	0.24179	ATG	.	.		0.373	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
SLC1A3	6507	hgsc.bcm.edu	37	5	36629587	36629587	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:36629587A>G	ENST00000265113.4	+	3	693	c.217A>G	c.(217-219)Atg>Gtg	p.M73V	SLC1A3_ENST00000381918.3_Missense_Mutation_p.M73V	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	73					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACCATACAGAATGAGCTACCG	0.403																																					p.M73V		Atlas-SNP	.											.	SLC1A3	88	.	0			c.A217G						.						183.0	162.0	169.0					5																	36629587		2203	4300	6503	SO:0001583	missense	6507	exon3			TACAGAATGAGCT		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.217A>G	chr5.hg19:g.36629587A>G	ENSP00000265113:p.Met73Val	102.0	0.0		96.0	18.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	hg19	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	A	11.63	1.696327	0.30052	.	.	ENSG00000079215	ENST00000265113;ENST00000513903;ENST00000505202;ENST00000513646;ENST00000381918	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	6.06	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	N	0.20881	0.62	0.44555	D	0.997511	B;B	0.21225	0.053;0.0	B;B	0.29524	0.103;0.007	T	0.29027	-1.0025	10	0.44086	T	0.13	-33.8452	9.2396	0.37489	0.7511:0.1273:0.0:0.1216	.	73;73	Q4JCQ8;P43003	.;EAA1_HUMAN	V	73	ENSP00000265113:M73V;ENSP00000427203:M73V;ENSP00000424986:M73V;ENSP00000420992:M73V;ENSP00000371343:M73V	ENSP00000265113:M73V	M	+	1	0	SLC1A3	36665344	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.488000	0.35551	2.324000	0.78689	0.533000	0.62120	ATG	.	.		0.403	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
DDX4	54514	hgsc.bcm.edu	37	5	55111225	55111225	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:55111225G>A	ENST00000505374.1	+	21	2163	c.2071G>A	c.(2071-2073)Gtg>Atg	p.V691M	DDX4_ENST00000511853.1_Missense_Mutation_p.V542M|DDX4_ENST00000354991.5_Missense_Mutation_p.V657M|DDX4_ENST00000514278.2_Missense_Mutation_p.V671M|DDX4_ENST00000353507.5_Missense_Mutation_p.V657M	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	691					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				AAGAGGAAACGTGTTTGCATC	0.363																																					p.V691M		Atlas-SNP	.											.	DDX4	194	.	0			c.G2071A						.						127.0	122.0	123.0					5																	55111225		2203	4300	6503	SO:0001583	missense	54514	exon21			GGAAACGTGTTTG	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.2071G>A	chr5.hg19:g.55111225G>A	ENSP00000424838:p.Val691Met	105.0	0.0		90.0	39.0	NM_024415	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	hg19	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	G	6.325	0.428110	0.11987	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000354991;ENST00000511853	T;T;T;T;T	0.22134	2.01;2.0;1.99;2.01;1.97	5.42	-1.16	0.09678	.	2.029550	0.02966	N	0.143808	T	0.21307	0.0513	L	0.49126	1.545	0.09310	N	1	B;B;B	0.20550	0.016;0.006;0.046	B;B;B	0.19391	0.011;0.025;0.014	T	0.27502	-1.0072	10	0.45353	T	0.12	-27.7346	6.8667	0.24098	0.5598:0.0:0.3163:0.1239	.	542;657;691	E9PCD8;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	M	657;671;691;657;542	ENSP00000334167:V657M;ENSP00000425359:V671M;ENSP00000424838:V691M;ENSP00000347087:V657M;ENSP00000423123:V542M	ENSP00000334167:V657M	V	+	1	0	DDX4	55146982	0.000000	0.05858	0.013000	0.15412	0.384000	0.30261	-0.290000	0.08354	-0.634000	0.05538	-0.253000	0.11424	GTG	.	.		0.363	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
HTR1A	3350	hgsc.bcm.edu	37	5	63256758	63256758	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:63256758C>G	ENST00000323865.3	-	1	1022	c.789G>C	c.(787-789)tgG>tgC	p.W263C	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	263					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CGCCCAGCCTCCAGTTCCTGC	0.652																																					p.W263C		Atlas-SNP	.											.	HTR1A	128	.	0			c.G789C						.						57.0	54.0	55.0					5																	63256758		2203	4300	6503	SO:0001583	missense	3350	exon1			CAGCCTCCAGTTC	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.789G>C	chr5.hg19:g.63256758C>G	ENSP00000316244:p.Trp263Cys	58.0	0.0		54.0	18.0	NM_000524	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	hg19	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	C	7.251	0.603189	0.13939	.	.	ENSG00000178394	ENST00000323865	T	0.61859	0.07	5.17	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.122077	0.64402	N	0.000013	T	0.53045	0.1772	L	0.45228	1.405	0.80722	D	1	B	0.23650	0.089	B	0.29077	0.098	T	0.54221	-0.8326	10	0.54805	T	0.06	.	15.2	0.73130	0.0:0.8593:0.1407:0.0	.	263	P08908	5HT1A_HUMAN	C	263	ENSP00000316244:W263C	ENSP00000316244:W263C	W	-	3	0	HTR1A	63292514	1.000000	0.71417	0.992000	0.48379	0.505000	0.33919	3.875000	0.56108	1.385000	0.46445	0.655000	0.94253	TGG	.	.		0.652	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
ANKRD32	84250	hgsc.bcm.edu	37	5	94001708	94001708	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:94001708C>G	ENST00000265140.5	+	12	1930	c.1511C>G	c.(1510-1512)tCt>tGt	p.S504C		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	504						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GGAGCATGGTCTTTAGTAGAA	0.368																																					p.S504C		Atlas-SNP	.											.	ANKRD32	117	.	0			c.C1511G						.						176.0	141.0	151.0					5																	94001708		692	1591	2283	SO:0001583	missense	84250	exon12			CATGGTCTTTAGT	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1511C>G	chr5.hg19:g.94001708C>G	ENSP00000265140:p.Ser504Cys	19.0	0.0		28.0	6.0	NM_032290	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	hg19	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483311	0.63962	.	.	ENSG00000133302	ENST00000265140	T	0.51817	0.69	5.21	4.34	0.51931	.	0.000000	0.42294	D	0.000728	T	0.47284	0.1437	L	0.43152	1.355	0.22771	N	0.998756	D	0.55172	0.97	P	0.47206	0.541	T	0.44605	-0.9317	10	0.66056	D	0.02	.	14.4281	0.67230	0.266:0.734:0.0:0.0	.	504	Q9BQI6	ANR32_HUMAN	C	504	ENSP00000265140:S504C	ENSP00000265140:S504C	S	+	2	0	ANKRD32	94027464	0.995000	0.38212	0.999000	0.59377	0.995000	0.86356	2.035000	0.41155	1.153000	0.42468	0.585000	0.79938	TCT	.	.		0.368	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
MAN2A1	4124	hgsc.bcm.edu	37	5	109106073	109106073	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:109106073G>T	ENST00000261483.4	+	7	2079	c.1027G>T	c.(1027-1029)Gat>Tat	p.D343Y		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	343					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ATCTGTCACAGATATTTTATG	0.363																																					p.D343Y		Atlas-SNP	.											.	MAN2A1	136	.	0			c.G1027T						.						102.0	99.0	100.0					5																	109106073		2202	4300	6502	SO:0001583	missense	4124	exon7			GTCACAGATATTT		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.1027G>T	chr5.hg19:g.109106073G>T	ENSP00000261483:p.Asp343Tyr	106.0	0.0		60.0	16.0	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	hg19	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035510	0.75617	.	.	ENSG00000112893	ENST00000261483	T	0.24908	1.83	5.75	4.87	0.63330	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.091298	0.64402	D	0.000001	T	0.58524	0.2128	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68804	-0.5312	10	0.87932	D	0	-12.3213	16.1022	0.81184	0.0:0.0:0.865:0.135	.	343	Q16706	MA2A1_HUMAN	Y	343	ENSP00000261483:D343Y	ENSP00000261483:D343Y	D	+	1	0	MAN2A1	109133972	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.832000	0.99423	1.395000	0.46643	0.563000	0.77884	GAT	.	.		0.363	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
PPIC	5480	hgsc.bcm.edu	37	5	122372304	122372304	+	Missense_Mutation	SNP	C	C	G	rs375305758		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:122372304C>G	ENST00000306442.4	-	1	132	c.17G>C	c.(16-18)cGg>cCg	p.R6P	RP11-359P5.1_ENST00000506859.1_RNA	NM_000943.4	NP_000934.1	P45877	PPIC_HUMAN	peptidylprolyl isomerase C (cyclophilin C)	6					protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	6		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	TAGCAGCAGCCGAGGACCCGG	0.711																																					p.R6P	Ovarian(99;690 1502 20765 45543 49568)	Atlas-SNP	.											.	PPIC	18	.	0			c.G17C						.						18.0	20.0	20.0					5																	122372304		2175	4259	6434	SO:0001583	missense	5480	exon1			AGCAGCCGAGGAC	S71018	CCDS4133.1	5q23.2	2008-02-05			ENSG00000168938	ENSG00000168938	5.2.1.8		9256	protein-coding gene	gene with protein product		123842				1383094, 8031755	Standard	NM_000943		Approved	CYPC	uc003kth.3	P45877	OTTHUMG00000128921	ENST00000306442.4:c.17G>C	chr5.hg19:g.122372304C>G	ENSP00000303057:p.Arg6Pro	166.0	0.0		126.0	28.0	NM_000943	A4LBB5	Missense_Mutation	SNP	ENST00000306442.4	hg19	CCDS4133.1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254484	0.22965	.	.	ENSG00000168938	ENST00000306442	T	0.24908	1.83	3.94	1.8	0.24995	.	0.297905	0.28754	U	0.014259	T	0.11665	0.0284	N	0.08118	0	0.09310	N	1	P;B	0.49862	0.929;0.165	B;B	0.40134	0.32;0.053	T	0.13845	-1.0494	10	0.72032	D	0.01	.	8.4358	0.32786	0.163:0.738:0.0:0.099	.	6;6	B4E200;P45877	.;PPIC_HUMAN	P	6	ENSP00000303057:R6P	ENSP00000303057:R6P	R	-	2	0	PPIC	122400203	0.992000	0.36948	0.457000	0.27056	0.033000	0.12548	0.897000	0.28390	0.637000	0.30526	-0.373000	0.07131	CGG	.	.		0.711	PPIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250898.2	NM_000943	
PKD2L2	27039	hgsc.bcm.edu	37	5	137257348	137257348	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:137257348T>C	ENST00000508883.1	+	9	1378	c.1352T>C	c.(1351-1353)cTt>cCt	p.L451P	PKD2L2_ENST00000350250.4_Missense_Mutation_p.L417P|PKD2L2_ENST00000508638.1_Intron|PKD2L2_ENST00000290431.5_Missense_Mutation_p.L451P|PKD2L2_ENST00000502810.1_Missense_Mutation_p.L429P			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	451					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CGAATTGTTCTTGGAGATTTT	0.338																																					p.L451P		Atlas-SNP	.											.	PKD2L2	68	.	0			c.T1352C						.						139.0	126.0	130.0					5																	137257348		1797	4070	5867	SO:0001583	missense	27039	exon9			TTGTTCTTGGAGA	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1352T>C	chr5.hg19:g.137257348T>C	ENSP00000424725:p.Leu451Pro	75.0	0.0		57.0	28.0	NM_014386	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	hg19		.	.	.	.	.	.	.	.	.	.	T	23.9	4.467755	0.84533	.	.	ENSG00000078795	ENST00000350250;ENST00000502810;ENST00000508883;ENST00000290431	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.89	5.89	0.94794	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.64402	D	0.000019	D	0.86251	0.5888	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.88592	0.3144	10	0.87932	D	0	-22.6061	15.9724	0.80031	0.0:0.0:0.0:1.0	.	451;451	Q9NZM6;Q9NZM6-5	PK2L2_HUMAN;.	P	417;429;451;451	ENSP00000344177:L417P;ENSP00000425513:L429P;ENSP00000424725:L451P;ENSP00000290431:L451P	ENSP00000290431:L451P	L	+	2	0	PKD2L2	137285247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.161000	0.77505	2.257000	0.74773	0.460000	0.39030	CTT	.	.		0.338	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
PCDHB15	56121	hgsc.bcm.edu	37	5	140626364	140626364	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:140626364A>T	ENST00000231173.3	+	1	1218	c.1218A>T	c.(1216-1218)gaA>gaT	p.E406D		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTAACAGAAGGGGCGCTGG	0.473																																					p.E406D		Atlas-SNP	.											.	PCDHB15	138	.	0			c.A1218T						.						69.0	69.0	69.0					5																	140626364		2203	4300	6503	SO:0001583	missense	56121	exon1			AACAGAAGGGGCG	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1218A>T	chr5.hg19:g.140626364A>T	ENSP00000231173:p.Glu406Asp	138.0	0.0		99.0	26.0	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	hg19	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	A	6.166	0.398783	0.11696	.	.	ENSG00000113248	ENST00000231173	T	0.52295	0.67	4.56	-9.13	0.00704	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.19685	0.0473	N	0.12746	0.255	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.13469	-1.0508	9	0.26408	T	0.33	.	3.0603	0.06197	0.1924:0.3566:0.0747:0.3763	.	406	Q9Y5E8	PCDBF_HUMAN	D	406	ENSP00000231173:E406D	ENSP00000231173:E406D	E	+	3	2	PCDHB15	140606548	0.000000	0.05858	0.004000	0.12327	0.719000	0.41307	-7.724000	0.00031	-1.243000	0.02519	0.402000	0.26972	GAA	.	.		0.473	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140778726	140778726	+	Intron	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:140778726A>G	ENST00000576222.1	+	1	2546				PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGAAGTTACATTCCATTCTC	0.403																																					p.T344T		Atlas-SNP	.											.	.	.	.	0			c.A1032G						.						91.0	90.0	91.0					5																	140778726		1884	4122	6006	SO:0001627	intron_variant	56101	exon1			AGTTACATTCCAT	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26350A>G	chr5.hg19:g.140778726A>G		156.0	0.0		97.0	19.0	NM_018925	A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	hg19	CCDS58980.1																																																																																			.	.		0.403	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
PCDH1	5097	hgsc.bcm.edu	37	5	141243510	141243510	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:141243510C>T	ENST00000394536.3	-	3	2525	c.2386G>A	c.(2386-2388)Gac>Aac	p.D796N	PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Missense_Mutation_p.D784N|PCDH1_ENST00000536585.1_Missense_Mutation_p.D774N|PCDH1_ENST00000287008.3_Missense_Mutation_p.D796N|PCDH1_ENST00000511044.1_5'UTR	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	796	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TTGCCGCGGTCACTGACCTTC	0.602																																					p.D796N	Ovarian(132;1609 1739 4190 14731 45037)	Atlas-SNP	.											.	PCDH1	119	.	0			c.G2386A						.						45.0	44.0	44.0					5																	141243510		2203	4300	6503	SO:0001583	missense	5097	exon3			CGCGGTCACTGAC	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2386G>A	chr5.hg19:g.141243510C>T	ENSP00000378043:p.Asp796Asn	67.0	0.0		47.0	9.0	NM_032420	Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	hg19	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.088431	0.76756	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.23	5.23	0.72850	Cadherin (4);Cadherin-like (1);	0.000000	0.52532	D	0.000070	D	0.83339	0.5233	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87276	0.2289	10	0.87932	D	0	.	16.2953	0.82767	0.0:1.0:0.0:0.0	.	796;796	Q08174;Q08174-2	PCDH1_HUMAN;.	N	796;796;784;807;774	ENSP00000287008:D796N;ENSP00000378043:D796N;ENSP00000403497:D784N;ENSP00000350122:D807N;ENSP00000438825:D774N	ENSP00000287008:D796N	D	-	1	0	PCDH1	141223694	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.783000	0.85696	2.445000	0.82738	0.457000	0.33378	GAC	.	.		0.602	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
NSD1	64324	hgsc.bcm.edu	37	5	176721807	176721807	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr5:176721807G>A	ENST00000439151.2	+	23	7483	c.7438G>A	c.(7438-7440)Gat>Aat	p.D2480N	NSD1_ENST00000354179.4_Missense_Mutation_p.D2211N|NSD1_ENST00000347982.4_Missense_Mutation_p.D2211N|NSD1_ENST00000361032.4_Missense_Mutation_p.D2377N	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2480					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ACCACAGGCTGATGAGAAGAT	0.517			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.D2480N		Atlas-SNP	.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	416	.	0			c.G7438A						.						98.0	95.0	96.0					5																	176721807		2203	4300	6503	SO:0001583	missense	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	CAGGCTGATGAGA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7438G>A	chr5.hg19:g.176721807G>A	ENSP00000395929:p.Asp2480Asn	40.0	0.0		25.0	13.0	NM_022455	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	hg19	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.370078	0.42003	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93426	-3.12;-3.12;-3.12;-3.22	4.78	3.82	0.43975	.	0.608791	0.15551	N	0.256422	D	0.84506	0.5487	N	0.19112	0.55	0.09310	N	1	P;P	0.37276	0.589;0.454	B;B	0.35770	0.21;0.104	T	0.76822	-0.2817	10	0.72032	D	0.01	.	2.4014	0.04402	0.1016:0.163:0.4564:0.279	.	2211;2480	Q96L73-2;Q96L73	.;NSD1_HUMAN	N	2211;2480;2211;2377	ENSP00000346111:D2211N;ENSP00000395929:D2480N;ENSP00000343209:D2211N;ENSP00000354310:D2377N	ENSP00000343209:D2211N	D	+	1	0	NSD1	176654413	0.409000	0.25368	0.997000	0.53966	0.889000	0.51656	3.031000	0.49728	2.502000	0.84385	0.462000	0.41574	GAT	.	.		0.517	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
LY6G5B	58496	hgsc.bcm.edu	37	6	31640030	31640030	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:31640030G>T	ENST00000375864.4	+	3	1361	c.577G>T	c.(577-579)Gct>Tct	p.A193S	LY6G5B_ENST00000409525.1_Missense_Mutation_p.A138S|CSNK2B-LY6G5B-1181_ENST00000375880.2_3'UTR	NM_021221.2	NP_067044.2	Q8NDX9	LY65B_HUMAN	lymphocyte antigen 6 complex, locus G5B	193						extracellular region (GO:0005576)				lung(4)	4						TCTTCCCCAGGCTGGACTCTT	0.512																																					p.A193S		Atlas-SNP	.											.	LY6G5B	8	.	0			c.G577T						.						151.0	149.0	150.0					6																	31640030		1511	2709	4220	SO:0001583	missense	58496	exon3			CCCCAGGCTGGAC	AF129756	CCDS34400.1	6p21.3	2008-08-01	2002-07-29	2002-08-01	ENSG00000240053	ENSG00000240053			13931	protein-coding gene	gene with protein product		610433	"""chromosome 6 open reading frame 19"""	C6orf19		8812450, 12079290, 17008713	Standard	NM_021221		Approved	G5b		Q8NDX9	OTTHUMG00000031227	ENST00000375864.4:c.577G>T	chr6.hg19:g.31640030G>T	ENSP00000365024:p.Ala193Ser	107.0	0.0		40.0	8.0	NM_021221	B0UXB2|B0UZ65|B0UZP8|B7ZCA3|Q5SQ62|Q5SST3|Q9UKT0|Q9UMQ0	Missense_Mutation	SNP	ENST00000375864.4	hg19	CCDS34400.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369035	0.24771	.	.	ENSG00000240053	ENST00000409691;ENST00000375864;ENST00000409525	T;T	0.27557	1.66;1.67	3.93	1.16	0.20824	.	.	.	.	.	T	0.07548	0.0190	N	0.24115	0.695	.	.	.	B	0.28760	0.221	B	0.27887	0.084	T	0.18366	-1.0339	8	0.66056	D	0.02	9.0E-4	6.6738	0.23083	0.188:0.1502:0.6617:0.0	.	193	Q8NDX9	LY65B_HUMAN	S	190;193;138	ENSP00000365024:A193S;ENSP00000386365:A138S	ENSP00000365024:A193S	A	+	1	0	LY6G5B	31748009	0.000000	0.05858	0.000000	0.03702	0.187000	0.23431	-0.140000	0.10342	-0.104000	0.12154	-3.714000	0.00023	GCT	.	.		0.512	LY6G5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000124389.4		
DNAH8	1769	hgsc.bcm.edu	37	6	38690665	38690665	+	5'Flank	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:38690665G>A	ENST00000359357.3	+	0	0				DNAH8_ENST00000449981.2_Missense_Mutation_p.R27H			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCCCCTCCCCGTTCAGAAGAG	0.612																																					p.R27H		Atlas-SNP	.											.	DNAH8	1239	.	0			c.G80A						.						20.0	21.0	21.0					6																	38690665		876	1991	2867	SO:0001631	upstream_gene_variant	1769	exon2			CTCCCCGTTCAGA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253		chr6.hg19:g.38690665G>A	Exception_encountered	62.0	0.0		45.0	25.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	G	11.80	1.745895	0.30955	.	.	ENSG00000124721	ENST00000373278;ENST00000449981;ENST00000327475	T	0.24350	1.86	3.78	-3.99	0.04069	.	1.855710	0.03000	N	0.148072	T	0.03348	0.0097	N	0.08118	0	0.09310	N	0.99999	P	0.51933	0.949	B	0.38378	0.272	T	0.15263	-1.0443	10	0.40728	T	0.16	.	5.5099	0.16874	0.1268:0.1974:0.5714:0.1044	.	27	Q8IU65	.	H	27;15;15	ENSP00000333363:R15H	ENSP00000333363:R15H	R	+	2	0	DNAH8	38798643	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.571000	0.02138	-1.088000	0.03077	-0.479000	0.04858	CGT	.	.		0.612	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
KHDC1L	100129128	hgsc.bcm.edu	37	6	73933531	73933531	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:73933531C>T	ENST00000370388.3	-	3	370	c.327G>A	c.(325-327)caG>caA	p.Q109Q	RP11-257K9.8_ENST00000423730.3_3'UTR|KHDC1L_ENST00000471312.1_5'Flank	NM_001126063.2	NP_001119535.1	Q5JSQ8	KHDCL_HUMAN	KH homology domain containing 1-like	109										breast(1)|endometrium(1)|kidney(1)|lung(3)|skin(1)	7						TGGTCAGGGGCTGGCTTCGGA	0.567																																					p.Q109Q		Atlas-SNP	.											.	KHDC1L	22	.	0			c.G327A						.						90.0	93.0	92.0					6																	73933531		692	1591	2283	SO:0001819	synonymous_variant	100129128	exon3			CAGGGGCTGGCTT	BC004267	CCDS47450.1	6q13	2014-05-15			ENSG00000256980	ENSG00000256980			37274	protein-coding gene	gene with protein product							Standard	NM_001126063		Approved	RP11-257K9.7	uc003pgm.4	Q5JSQ8	OTTHUMG00000132474	ENST00000370388.3:c.327G>A	chr6.hg19:g.73933531C>T		70.0	0.0		64.0	26.0	NM_001126063	E1P535	Silent	SNP	ENST00000370388.3	hg19	CCDS47450.1																																																																																			.	.		0.567	KHDC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255640.1	NM_001126063	
COL12A1	1303	hgsc.bcm.edu	37	6	75866062	75866062	+	Missense_Mutation	SNP	C	C	A	rs577784031		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:75866062C>A	ENST00000322507.8	-	15	3470	c.3161G>T	c.(3160-3162)cGa>cTa	p.R1054L	COL12A1_ENST00000483888.2_Missense_Mutation_p.R1054L|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.R1054L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1054	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGGCTGAAGTCGCTTTAACAC	0.473																																					p.R1054L		Atlas-SNP	.											.	COL12A1	385	.	0			c.G3161T						.						188.0	176.0	180.0					6																	75866062		1952	4152	6104	SO:0001583	missense	1303	exon15			TGAAGTCGCTTTA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3161G>T	chr6.hg19:g.75866062C>A	ENSP00000325146:p.Arg1054Leu	168.0	0.0		147.0	59.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891332	0.72524	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.54479	0.57;0.57;0.57	5.46	5.46	0.80206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.172689	0.42053	D	0.000772	T	0.61813	0.2377	L	0.57536	1.79	0.50813	D	0.999896	D	0.61080	0.989	D	0.63283	0.913	T	0.59600	-0.7424	10	0.42905	T	0.14	.	19.2969	0.94126	0.0:1.0:0.0:0.0	.	1054	Q99715	COCA1_HUMAN	L	1054	ENSP00000325146:R1054L;ENSP00000412864:R1054L;ENSP00000421216:R1054L	ENSP00000325146:R1054L	R	-	2	0	COL12A1	75922782	1.000000	0.71417	0.991000	0.47740	0.412000	0.31113	7.487000	0.81328	2.543000	0.85770	0.591000	0.81541	CGA	.	.		0.473	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
CASP8AP2	9994	hgsc.bcm.edu	37	6	90572457	90572457	+	RNA	SNP	A	A	G	rs9444715	byFrequency	TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:90572457A>G	ENST00000551025.1	+	0	2466									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ACAAAAAACTAGAAAGACAAA	0.343													A|||	12	0.00239617	0.0091	0.0	5008	,	,		21629	0.0		0.0	False		,,,				2504	0.0				p.L343L	Colon(187;1656 2025 17045 31481 39901)	Atlas-SNP	.											.	CASP8AP2	108	.	0			c.A1029G						.	A	,,	15,3601		0,15,1793	60.0	60.0	60.0		1029,1029,1029	0.5	1.0	6	dbSNP_119	60	0,8132		0,0,4066	no	coding-synonymous,coding-synonymous,coding-synonymous	CASP8AP2	NM_001137667.1,NM_001137668.1,NM_012115.3	,,	0,15,5859	GG,GA,AA		0.0,0.4148,0.1277	,,	343/1967,343/1967,343/1967	90572457	15,11733	1808	4066	5874			9994	exon7			AAAACTAGAAAGA	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		chr6.hg19:g.90572457A>G		134.0	0.0		69.0	20.0	NM_001137667		Silent	SNP	ENST00000551025.1	hg19																																																																																				.	A|1.000;|0.000		0.343	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
ASCC3	10973	hgsc.bcm.edu	37	6	101075740	101075740	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:101075740G>T	ENST00000369162.2	-	28	4843	c.4499C>A	c.(4498-4500)gCt>gAt	p.A1500D		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1500	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GAGCCAATCAGCAAGGTCTCT	0.333																																					p.A1500D		Atlas-SNP	.											.	ASCC3	205	.	0			c.C4499A						.						101.0	95.0	97.0					6																	101075740		2203	4300	6503	SO:0001583	missense	10973	exon28			CAATCAGCAAGGT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4499C>A	chr6.hg19:g.101075740G>T	ENSP00000358159:p.Ala1500Asp	74.0	0.0		73.0	11.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858958	0.91433	.	.	ENSG00000112249	ENST00000369162	T	0.38887	1.11	6.07	6.07	0.98685	DEAD-like helicase (2);	0.000000	0.85682	D	0.000000	T	0.79805	0.4509	H	0.99074	4.42	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87385	0.2359	10	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1500	Q8N3C0	HELC1_HUMAN	D	1500	ENSP00000358159:A1500D	ENSP00000358159:A1500D	A	-	2	0	ASCC3	101182461	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GCT	.	.		0.333	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ASCC3	10973	hgsc.bcm.edu	37	6	101075744	101075744	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:101075744G>A	ENST00000369162.2	-	28	4839	c.4495C>T	c.(4495-4497)Ctt>Ttt	p.L1499F		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1499	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CAATCAGCAAGGTCTCTGGCA	0.328																																					p.L1499F		Atlas-SNP	.											.	ASCC3	205	.	0			c.C4495T						.						105.0	99.0	101.0					6																	101075744		2203	4300	6503	SO:0001583	missense	10973	exon28			CAGCAAGGTCTCT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4495C>T	chr6.hg19:g.101075744G>A	ENSP00000358159:p.Leu1499Phe	78.0	0.0		77.0	11.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776571	0.90195	.	.	ENSG00000112249	ENST00000369162	T	0.40756	1.02	6.07	6.07	0.98685	DEAD-like helicase (2);	0.000000	0.85682	D	0.000000	T	0.62708	0.2450	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61292	-0.7092	10	0.56958	D	0.05	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1499	Q8N3C0	HELC1_HUMAN	F	1499	ENSP00000358159:L1499F	ENSP00000358159:L1499F	L	-	1	0	ASCC3	101182465	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.993000	0.88291	2.885000	0.99019	0.655000	0.94253	CTT	.	.		0.328	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
POPDC3	64208	hgsc.bcm.edu	37	6	105609574	105609574	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:105609574C>A	ENST00000254765.3	-	2	489	c.211G>T	c.(211-213)Gat>Tat	p.D71Y	BVES-AS1_ENST00000580511.1_RNA|POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580854.1_RNA|BVES-AS1_ENST00000369120.2_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	71					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				GCACAGACATCTACCCAAGCC	0.438																																					p.D71Y		Atlas-SNP	.											.	POPDC3	47	.	0			c.G211T						.						109.0	122.0	118.0					6																	105609574		2203	4300	6503	SO:0001583	missense	64208	exon2			AGACATCTACCCA	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.211G>T	chr6.hg19:g.105609574C>A	ENSP00000254765:p.Asp71Tyr	209.0	0.0		173.0	69.0	NM_022361	B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	ENST00000254765.3	hg19	CCDS5052.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874310	0.51695	.	.	ENSG00000132429	ENST00000254765	T	0.54279	0.58	5.72	4.85	0.62838	.	0.142736	0.64402	D	0.000011	T	0.34774	0.0909	L	0.57536	1.79	0.80722	D	1	B	0.32338	0.365	B	0.40101	0.319	T	0.46775	-0.9167	10	0.02654	T	1	-33.8669	16.9001	0.86110	0.0:0.8719:0.1281:0.0	.	71	Q9HBV1	POPD3_HUMAN	Y	71	ENSP00000254765:D71Y	ENSP00000254765:D71Y	D	-	1	0	POPDC3	105716267	0.999000	0.42202	0.997000	0.53966	0.996000	0.88848	4.070000	0.57548	1.420000	0.47138	0.655000	0.94253	GAT	.	.		0.438	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361	
BCLAF1	9774	hgsc.bcm.edu	37	6	136597048	136597048	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:136597048C>T	ENST00000531224.1	-	5	1867	c.1615G>A	c.(1615-1617)Gcg>Acg	p.A539T	BCLAF1_ENST00000527759.1_Missense_Mutation_p.A537T|BCLAF1_ENST00000530767.1_Missense_Mutation_p.A366T|BCLAF1_ENST00000353331.4_Missense_Mutation_p.A537T|BCLAF1_ENST00000527536.1_Missense_Mutation_p.A539T|BCLAF1_ENST00000392348.2_Missense_Mutation_p.A537T	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	539					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A539T(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GAATCACTCGCTATCATTTTG	0.423																																					p.A539T	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											BCLAF1_ENST00000531224,NS,carcinoma,0,1	BCLAF1	203	.	1	Substitution - Missense(1)	breast(1)	c.G1615A						.						210.0	210.0	210.0					6																	136597048		2203	4300	6503	SO:0001583	missense	9774	exon5			CACTCGCTATCAT	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1615G>A	chr6.hg19:g.136597048C>T	ENSP00000435210:p.Ala539Thr	80.0	0.0		60.0	15.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012753	0.75161	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14022	2.93;2.93;2.92;2.54;2.93;2.93;2.73	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000006	T	0.12732	0.0309	N	0.08118	0	0.80722	D	1	D;D;D;D	0.67145	0.971;0.964;0.971;0.996	P;P;P;D	0.73708	0.882;0.841;0.882;0.981	T	0.41413	-0.9510	10	0.32370	T	0.25	-4.6349	19.7634	0.96333	0.0:1.0:0.0:0.0	.	537;537;539;366	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	T	539;537;539;366;537;537;539	ENSP00000435210:A539T;ENSP00000229446:A537T;ENSP00000435441:A539T;ENSP00000436501:A366T;ENSP00000434826:A537T;ENSP00000376159:A537T;ENSP00000431734:A539T	ENSP00000229446:A537T	A	-	1	0	BCLAF1	136638741	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.497000	0.53295	2.747000	0.94245	0.460000	0.39030	GCG	.	.		0.423	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
Unknown	0	hgsc.bcm.edu	37	7	63673536	63673536	+	IGR	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr7:63673536G>T								GUSBP6 (62437 upstream) : ZNF679 (15315 downstream)																							CCTGGATCATGCTCAGCAGAA	0.398																																					p.A36S		Atlas-SNP	.											.	.	.	.	0			c.G106T						.						60.0	55.0	57.0					7																	63673536		692	1591	2283	SO:0001628	intergenic_variant	730291	exon2			GATCATGCTCAGC																													chr7.hg19:g.63673536G>T		375.0	0.0		354.0	145.0	NM_001159524		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.398								
OR6B1	135946	hgsc.bcm.edu	37	7	143701669	143701669	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr7:143701669A>G	ENST00000408922.2	+	1	648	c.580A>G	c.(580-582)Ata>Gta	p.I194V		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					AGACATGTCCATAACTGAGTT	0.458																																					p.I194V		Atlas-SNP	.											.	OR6B1	60	.	0			c.A580G						.						168.0	161.0	163.0					7																	143701669		2017	4212	6229	SO:0001583	missense	135946	exon1			ATGTCCATAACTG		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.580A>G	chr7.hg19:g.143701669A>G	ENSP00000386151:p.Ile194Val	96.0	0.0		84.0	31.0	NM_001005281	A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	ENST00000408922.2	hg19	CCDS43667.1	.	.	.	.	.	.	.	.	.	.	A	3.494	-0.103184	0.06967	.	.	ENSG00000221813	ENST00000408922	T	0.00130	8.69	5.17	-0.187	0.13268	GPCR, rhodopsin-like superfamily (1);	0.595840	0.13617	N	0.374669	T	0.00039	0.0001	N	0.03000	-0.44	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22661	-1.0210	10	0.02654	T	1	.	5.4014	0.16299	0.4889:0.3466:0.1645:0.0	.	194	O95007	OR6B1_HUMAN	V	194	ENSP00000386151:I194V	ENSP00000386151:I194V	I	+	1	0	OR6B1	143332602	0.000000	0.05858	0.219000	0.23793	0.986000	0.74619	-1.328000	0.02680	-0.182000	0.10602	0.533000	0.62120	ATA	.	.		0.458	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1		
SSPO	23145	hgsc.bcm.edu	37	7	149493599	149493599	+	RNA	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr7:149493599G>A	ENST00000378016.2	+	0	6675							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGGGCTGCGAGCCAGGTACAG	0.677																																					p.E2225E		Atlas-SNP	.											.	.	.	.	0			c.G6675A						.						59.0	71.0	67.0					7																	149493599		2149	4233	6382			23145	exon44			CTGCGAGCCAGGT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149493599G>A		61.0	0.0		61.0	28.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.677	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SGK223	157285	hgsc.bcm.edu	37	8	8185368	8185368	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr8:8185368C>A	ENST00000520004.1	-	5	3188	c.2924G>T	c.(2923-2925)gGc>gTc	p.G975V	SGK223_ENST00000330777.4_Missense_Mutation_p.G975V			Q86YV5	SG223_HUMAN		977							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTTTTTCTGGCCGCCCATGAA	0.537																																					p.G975V	GBM(34;731 755 10259 33573 33867)	Atlas-SNP	.											.	.	.	.	0			c.G2924T						.						66.0	68.0	68.0					8																	8185368		1935	4143	6078	SO:0001583	missense	0	exon4			TTCTGGCCGCCCA																												ENST00000520004.1:c.2924G>T	chr8.hg19:g.8185368C>A	ENSP00000428054:p.Gly975Val	102.0	0.0		45.0	31.0	NM_001080826	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	hg19	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.964055	0.34659	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.27557	1.66;1.66	4.73	4.73	0.59995	.	0.473238	0.21636	N	0.071408	T	0.27063	0.0663	L	0.50333	1.59	0.58432	D	0.999997	B	0.29988	0.264	B	0.26693	0.072	T	0.05131	-1.0904	10	0.44086	T	0.13	.	10.5646	0.45165	0.0:0.901:0.0:0.099	.	975	Q86YV5	SG223_HUMAN	V	975	ENSP00000330930:G975V;ENSP00000428054:G975V	ENSP00000330930:G975V	G	-	2	0	AC068353.1	8222778	0.570000	0.26651	1.000000	0.80357	0.990000	0.78478	1.436000	0.34980	2.623000	0.88846	0.563000	0.77884	GGC	.	.		0.537	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
RAB11FIP1	80223	hgsc.bcm.edu	37	8	37756665	37756665	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr8:37756665C>A	ENST00000330843.4	-	1	307	c.295G>T	c.(295-297)Ggc>Tgc	p.G99C	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.G99C	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	99	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TTGTCGAGGCCGAGCAGCGCG	0.741																																					p.G99C		Atlas-SNP	.											.	RAB11FIP1	105	.	0			c.G295T						.						4.0	5.0	5.0					8																	37756665		1986	4010	5996	SO:0001583	missense	80223	exon1			CGAGGCCGAGCAG	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.295G>T	chr8.hg19:g.37756665C>A	ENSP00000331342:p.Gly99Cys	30.0	0.0		16.0	5.0	NM_025151	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	hg19	CCDS34882.1	.	.	.	.	.	.	.	.	.	.	C	36	5.682575	0.96774	.	.	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000343853	T;T	0.72282	-0.64;-0.64	5.07	5.07	0.68467	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000008	D	0.90130	0.6916	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.93784	0.7086	10	0.87932	D	0	-14.8866	18.0698	0.89403	0.0:1.0:0.0:0.0	.	99;99	Q6WKZ4-3;Q6WKZ4	.;RFIP1_HUMAN	C	99	ENSP00000287263:G99C;ENSP00000331342:G99C	ENSP00000287263:G99C	G	-	1	0	RAB11FIP1	37875823	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.630000	0.83225	2.354000	0.79902	0.655000	0.94253	GGC	.	.		0.741	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
TRIM55	84675	hgsc.bcm.edu	37	8	67049364	67049364	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr8:67049364G>T	ENST00000315962.4	+	4	915	c.542G>T	c.(541-543)gGc>gTc	p.G181V	TRIM55_ENST00000350034.4_Missense_Mutation_p.G181V|TRIM55_ENST00000276573.7_Missense_Mutation_p.G181V|TRIM55_ENST00000353317.5_Missense_Mutation_p.G181V	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	181					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			ATCCTCGTGGGCAGCAACGAT	0.527																																					p.G181V		Atlas-SNP	.											.	TRIM55	91	.	0			c.G542T						.						106.0	88.0	94.0					8																	67049364		2203	4300	6503	SO:0001583	missense	84675	exon4			TCGTGGGCAGCAA	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.542G>T	chr8.hg19:g.67049364G>T	ENSP00000323913:p.Gly181Val	79.0	0.0		44.0	11.0	NM_184086	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	hg19	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891933	0.72524	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573;ENST00000350034	T;T;T;T	0.38722	1.48;1.52;1.47;1.12	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.61763	0.2373	M	0.75264	2.295	0.80722	D	1	P;P;P;P	0.50528	0.936;0.864;0.892;0.864	P;P;P;P	0.55545	0.511;0.646;0.778;0.713	T	0.64765	-0.6330	10	0.66056	D	0.02	.	19.5251	0.95201	0.0:0.0:1.0:0.0	.	181;181;181;181	Q9BYV6-4;Q9BYV6-2;Q9BYV6;Q9BYV6-3	.;.;TRI55_HUMAN;.	V	181	ENSP00000323913:G181V;ENSP00000297348:G181V;ENSP00000276573:G181V;ENSP00000332302:G181V	ENSP00000276573:G181V	G	+	2	0	TRIM55	67211918	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.508000	0.67006	2.678000	0.91216	0.655000	0.94253	GGC	.	.		0.527	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
TP53INP1	94241	hgsc.bcm.edu	37	8	95952161	95952161	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr8:95952161C>A	ENST00000342697.4	-	3	807	c.400G>T	c.(400-402)Gtg>Ttg	p.V134L	TP53INP1_ENST00000448464.2_Missense_Mutation_p.V134L|TP53INP1_ENST00000378776.4_Missense_Mutation_p.V134L|NDUFAF6_ENST00000396113.1_Intron	NM_033285.3	NP_150601.1	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	134					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to hydroperoxide (GO:0071447)|cellular response to methyl methanesulfonate (GO:0072703)|cellular response to UV (GO:0034644)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|response to heat (GO:0009408)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)			kidney(2)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	9	Breast(36;8.75e-07)					GAGTTATGCACAGCATAGACA	0.468																																					p.V134L		Atlas-SNP	.											.	TP53INP1	22	.	0			c.G400T						.						151.0	126.0	134.0					8																	95952161		2203	4300	6503	SO:0001583	missense	94241	exon3			TATGCACAGCATA	AF409115	CCDS6265.1, CCDS47899.1	8q22	2004-03-11				ENSG00000164938			18022	protein-coding gene	gene with protein product		606185				11511362, 12438758	Standard	NM_033285		Approved	DKFZp434M1317, FLJ22139, P53DINP1, SIP, TP53INP1A, TP53INP1B, Teap	uc003yhg.3	Q96A56		ENST00000342697.4:c.400G>T	chr8.hg19:g.95952161C>A	ENSP00000344215:p.Val134Leu	97.0	0.0		103.0	9.0	NM_001135733	B2RCE5|Q969R9	Missense_Mutation	SNP	ENST00000342697.4	hg19	CCDS6265.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717622	0.68844	.	.	ENSG00000164938	ENST00000448464;ENST00000342697;ENST00000378776	T;T;T	0.45276	0.9;0.9;0.9	5.45	3.59	0.41128	.	0.309813	0.34223	N	0.004157	T	0.59362	0.2188	M	0.61703	1.905	0.43073	D	0.994718	B;D	0.89917	0.003;1.0	B;D	0.80764	0.009;0.994	T	0.60586	-0.7234	10	0.49607	T	0.09	-10.0776	13.0286	0.58829	0.1292:0.7467:0.1241:0.0	.	134;134	Q96A56-2;Q96A56	.;T53I1_HUMAN	L	134	ENSP00000390063:V134L;ENSP00000344215:V134L;ENSP00000368052:V134L	ENSP00000344215:V134L	V	-	1	0	TP53INP1	96021337	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.094000	0.41719	0.888000	0.36160	0.655000	0.94253	GTG	.	.		0.468	TP53INP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379818.1		
HAS2	3037	hgsc.bcm.edu	37	8	122627072	122627072	+	Silent	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr8:122627072A>G	ENST00000303924.4	-	4	1473	c.936T>C	c.(934-936)ggT>ggC	p.G312G		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	312					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			GCCTGTCATCACCAAAGCTAC	0.443																																					p.G312G		Atlas-SNP	.											.	HAS2	87	.	0			c.T936C						.						159.0	151.0	154.0					8																	122627072		2203	4300	6503	SO:0001819	synonymous_variant	3037	exon4			GTCATCACCAAAG	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.936T>C	chr8.hg19:g.122627072A>G		80.0	0.0		79.0	10.0	NM_005328	Q32MM3	Silent	SNP	ENST00000303924.4	hg19	CCDS6335.1																																																																																			.	.		0.443	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
ZHX1	11244	hgsc.bcm.edu	37	8	124267098	124267098	+	Silent	SNP	T	T	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr8:124267098T>A	ENST00000522655.1	-	3	1629	c.1089A>T	c.(1087-1089)gtA>gtT	p.V363V	ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000395571.3_Silent_p.V363V|ZHX1_ENST00000297857.2_Silent_p.V363V|ZHX1-C8ORF76_ENST00000357082.4_Intron			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	363	Required for dimerization.|Required for interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TGGTCTGAGGTACAGTATGCA	0.428																																					p.V363V		Atlas-SNP	.											.	ZHX1	89	.	0			c.A1089T						.						227.0	187.0	200.0					8																	124267098		2203	4300	6503	SO:0001819	synonymous_variant	11244	exon3			CTGAGGTACAGTA	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1089A>T	chr8.hg19:g.124267098T>A		142.0	0.0		225.0	24.0	NM_007222	Q8IWD8	Silent	SNP	ENST00000522655.1	hg19	CCDS6342.1	.	.	.	.	.	.	.	.	.	.	T	5.142	0.211822	0.09757	.	.	ENSG00000165156	ENST00000520474	.	.	.	5.27	2.8	0.32819	.	.	.	.	.	T	0.43722	0.1260	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29640	-1.0005	4	.	.	.	-16.5914	1.4834	0.02441	0.282:0.081:0.2926:0.3443	.	.	.	.	F	48	.	.	Y	-	2	0	ZHX1	124336279	0.998000	0.40836	1.000000	0.80357	0.986000	0.74619	0.438000	0.21559	0.413000	0.25759	0.454000	0.30748	TAC	.	.		0.428	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
CNTLN	54875	hgsc.bcm.edu	37	9	17340879	17340879	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr9:17340879C>G	ENST00000380647.3	+	11	1783	c.1699C>G	c.(1699-1701)Cag>Gag	p.Q567E	CNTLN_ENST00000425824.1_Missense_Mutation_p.Q567E|CNTLN_ENST00000262360.5_Missense_Mutation_p.Q567E			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	567					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGAACGGCTACAGATGTTACA	0.388																																					p.Q567E		Atlas-SNP	.											.	CNTLN	128	.	0			c.C1699G						.						89.0	85.0	86.0					9																	17340879		1911	4129	6040	SO:0001583	missense	54875	exon11			CGGCTACAGATGT	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1699C>G	chr9.hg19:g.17340879C>G	ENSP00000370021:p.Gln567Glu	368.0	0.0		393.0	16.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	hg19	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532147	0.64972	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.10960	2.82;2.82;2.82	5.4	5.4	0.78164	.	.	.	.	.	T	0.24890	0.0604	M	0.63428	1.95	0.33236	D	0.556564	D;D;D	0.67145	0.996;0.991;0.991	P;P;P	0.59056	0.851;0.789;0.789	T	0.14727	-1.0462	9	0.08381	T	0.77	.	19.1457	0.93467	0.0:1.0:0.0:0.0	.	567;567;567	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	E	567	ENSP00000370021:Q567E;ENSP00000392798:Q567E;ENSP00000262360:Q567E	ENSP00000262360:Q567E	Q	+	1	0	CNTLN	17330879	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.442000	0.59988	2.518000	0.84900	0.591000	0.81541	CAG	.	.		0.388	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
IFNA5	3442	hgsc.bcm.edu	37	9	21305082	21305082	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr9:21305082G>C	ENST00000259555.4	-	1	230	c.174C>G	c.(172-174)gaC>gaG	p.D58E		NM_002169.2	NP_002160.1	P01569	IFNA5_HUMAN	interferon, alpha 5	58					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				Lung(24;2.34e-24)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GAAATCCAAAGTCATGTCTGT	0.483																																					p.D58E		Atlas-SNP	.											.	IFNA5	21	.	0			c.C174G						.						144.0	137.0	139.0					9																	21305082		2203	4300	6503	SO:0001583	missense	3442	exon1			TCCAAAGTCATGT		CCDS6502.1	9p22	2010-08-24			ENSG00000147873	ENSG00000147873		"""Interferons"""	5426	protein-coding gene	gene with protein product		147565				1385305	Standard	NM_002169		Approved	IFN-alphaG	uc011lnh.2	P01569	OTTHUMG00000019664	ENST00000259555.4:c.174C>G	chr9.hg19:g.21305082G>C	ENSP00000259555:p.Asp58Glu	114.0	0.0		92.0	23.0	NM_002169	Q52LX3	Missense_Mutation	SNP	ENST00000259555.4	hg19	CCDS6502.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489528	0.44249	.	.	ENSG00000147873	ENST00000259555	T	0.04862	3.54	4.16	4.16	0.48862	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.785759	0.11871	N	0.521452	T	0.24084	0.0583	H	0.95328	3.655	0.26721	N	0.97077	B	0.20164	0.042	B	0.34452	0.183	T	0.14035	-1.0487	10	0.72032	D	0.01	.	13.7771	0.63059	0.0:0.0:1.0:0.0	.	58	P01569	IFNA5_HUMAN	E	58	ENSP00000259555:D58E	ENSP00000259555:D58E	D	-	3	2	IFNA5	21295082	0.966000	0.33281	0.109000	0.21407	0.007000	0.05969	2.275000	0.43399	2.052000	0.61016	0.537000	0.68136	GAC	.	.		0.483	IFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051893.1	NM_002169	
HSDL2	84263	hgsc.bcm.edu	37	9	115171195	115171195	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr9:115171195A>G	ENST00000398805.3	+	4	516	c.289A>G	c.(289-291)Att>Gtt	p.I97V	HSDL2_ENST00000262542.7_5'UTR|HSDL2_ENST00000398803.1_Intron|HSDL2_ENST00000488101.1_3'UTR|HSDL2_ENST00000539114.1_5'UTR	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	97						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						AGGAATTGATATTCTGGTAAA	0.358																																					p.I97V		Atlas-SNP	.											.	HSDL2	24	.	0			c.A289G						.						94.0	84.0	87.0					9																	115171195		1858	4103	5961	SO:0001583	missense	84263	exon4			ATTGATATTCTGG	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.289A>G	chr9.hg19:g.115171195A>G	ENSP00000381785:p.Ile97Val	71.0	0.0		58.0	21.0	NM_032303	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	hg19	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.337394	0.41398	.	.	ENSG00000119471	ENST00000398805	D	0.86865	-2.18	6.17	1.21	0.21127	NAD(P)-binding domain (1);	0.265476	0.41712	N	0.000835	T	0.76593	0.4009	N	0.21282	0.65	0.80722	D	1	B	0.12013	0.005	B	0.19946	0.027	T	0.64609	-0.6367	10	0.32370	T	0.25	.	10.3627	0.44003	0.6855:0.0:0.3145:0.0	.	97	Q6YN16	HSDL2_HUMAN	V	97	ENSP00000381785:I97V	ENSP00000381785:I97V	I	+	1	0	HSDL2	114211016	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.681000	0.37618	0.207000	0.20607	0.533000	0.62120	ATT	.	.		0.358	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
PPP2R4	5524	hgsc.bcm.edu	37	9	131891300	131891300	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr9:131891300G>C	ENST00000337738.1	+	5	625	c.358G>C	c.(358-360)Gac>Cac	p.D120H	PPP2R4_ENST00000393370.2_Missense_Mutation_p.D85H|PPP2R4_ENST00000357197.4_Missense_Mutation_p.D56H|PPP2R4_ENST00000348141.5_Missense_Mutation_p.D91H|PPP2R4_ENST00000347048.4_Intron|PPP2R4_ENST00000358994.4_Missense_Mutation_p.D85H|PPP2R4_ENST00000355007.3_Intron|PPP2R4_ENST00000452489.2_Missense_Mutation_p.D120H	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	120					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CAACACGCTGGACAGGTGGAT	0.547																																					p.D120H	Colon(158;2158 2504 4450 20433)	Atlas-SNP	.											.	PPP2R4	32	.	0			c.G358C						.						95.0	80.0	86.0					9																	131891300		2203	4300	6503	SO:0001583	missense	5524	exon5			ACGCTGGACAGGT	X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.358G>C	chr9.hg19:g.131891300G>C	ENSP00000337448:p.Asp120His	126.0	0.0		93.0	35.0	NM_178001	A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	ENST00000337738.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.0	4.231536	0.79688	.	.	ENSG00000119383	ENST00000358994;ENST00000455292;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000452489;ENST00000357197;ENST00000445241;ENST00000414331;ENST00000417728;ENST00000453358;ENST00000417504;ENST00000440346	T;T;T;T;T;T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.48;1.43;1.43;1.43	5.08	5.08	0.68730	.	0.046675	0.85682	D	0.000000	T	0.47432	0.1445	M	0.69463	2.115	0.80722	D	1	P;P;B;D	0.57899	0.951;0.831;0.11;0.981	P;P;B;P	0.58873	0.847;0.516;0.098;0.785	T	0.47598	-0.9105	10	0.72032	D	0.01	-32.6307	11.3487	0.49575	0.0829:0.0:0.9171:0.0	.	56;120;120;85	Q15257-3;B4DZF8;Q15257;Q15257-2	.;.;PTPA_HUMAN;.	H	85;120;85;120;91;120;56;120;48;50;50;108;50	ENSP00000351885:D85H;ENSP00000395499:D120H;ENSP00000377036:D85H;ENSP00000337448:D120H;ENSP00000335200:D91H;ENSP00000394338:D120H;ENSP00000349726:D56H;ENSP00000406997:D120H;ENSP00000399069:D48H;ENSP00000403542:D50H;ENSP00000393092:D50H;ENSP00000400314:D108H;ENSP00000393796:D50H	ENSP00000337448:D120H	D	+	1	0	PPP2R4	130931121	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	7.964000	0.87933	2.507000	0.84556	0.655000	0.94253	GAC	.	.		0.547	PPP2R4-201	KNOWN	basic	protein_coding	protein_coding		NM_021131	
ITIH5	80760	hgsc.bcm.edu	37	10	7679256	7679256	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr10:7679256C>G	ENST00000256861.6	-	5	665	c.587G>C	c.(586-588)gGc>gCc	p.G196A	ITIH5_ENST00000397145.2_Missense_Mutation_p.G196A|ITIH5_ENST00000397146.2_Missense_Mutation_p.G196A|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	196					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GGATGCGATGCCCGCGCTCTC	0.662																																					p.G196A		Atlas-SNP	.											.	ITIH5	343	.	0			c.G587C						.						72.0	73.0	73.0					10																	7679256		2203	4300	6503	SO:0001583	missense	80760	exon5			GCGATGCCCGCGC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.587G>C	chr10.hg19:g.7679256C>G	ENSP00000256861:p.Gly196Ala	32.0	0.0		40.0	9.0	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	C	13.53	2.264026	0.39995	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.03124	4.55;4.04;4.04	5.88	5.88	0.94601	.	0.143885	0.64402	D	0.000007	T	0.21227	0.0511	.	.	.	0.42283	D	0.992109	D;P	0.76494	0.999;0.78	D;B	0.77004	0.989;0.18	T	0.00042	-1.2230	9	0.72032	D	0.01	-40.7125	20.2092	0.98286	0.0:1.0:0.0:0.0	.	196;196	G5E9D8;Q86UX2	.;ITIH5_HUMAN	A	196	ENSP00000256861:G196A;ENSP00000380333:G196A;ENSP00000380332:G196A	ENSP00000256861:G196A	G	-	2	0	ITIH5	7719262	1.000000	0.71417	0.339000	0.25562	0.013000	0.08279	3.717000	0.54911	2.776000	0.95493	0.655000	0.94253	GGC	.	.		0.662	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
ADAMTS14	140766	hgsc.bcm.edu	37	10	72432599	72432599	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr10:72432599T>G	ENST00000373207.1	+	1	41	c.41T>G	c.(40-42)tTg>tGg	p.L14W	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.L14W	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	14					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CTGCTGCCTTTGCACTGTGCG	0.761																																					p.L14W		Atlas-SNP	.											.	ADAMTS14	148	.	0			c.T41G						.						3.0	3.0	3.0					10																	72432599		1817	3587	5404	SO:0001583	missense	140766	exon1			TGCCTTTGCACTG	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.41T>G	chr10.hg19:g.72432599T>G	ENSP00000362303:p.Leu14Trp	88.0	0.0		67.0	5.0	NM_080722	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	hg19	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.819137	0.32145	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.63255	-0.03;-0.01	3.68	2.5	0.30297	.	1.110620	0.07131	N	0.845627	T	0.43433	0.1247	N	0.12182	0.205	0.22112	N	0.999351	B;B	0.12630	0.006;0.006	B;B	0.08055	0.003;0.003	T	0.32241	-0.9914	10	0.46703	T	0.11	.	6.8519	0.24020	0.0:0.0:0.2536:0.7464	.	14;14	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	W	14	ENSP00000362304:L14W;ENSP00000362303:L14W	ENSP00000362303:L14W	L	+	2	0	ADAMTS14	72102605	0.095000	0.21747	0.997000	0.53966	0.292000	0.27327	1.539000	0.36104	0.540000	0.28808	0.379000	0.24179	TTG	.	.		0.761	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
WAPAL	23063	hgsc.bcm.edu	37	10	88259625	88259625	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr10:88259625T>G	ENST00000298767.5	-	3	1847	c.1375A>C	c.(1375-1377)Agt>Cgt	p.S459R		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	459	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TCGCTTTCACTGAGATCATCA	0.388																																					p.S459R		Atlas-SNP	.											.	WAPAL	81	.	0			c.A1375C						.						122.0	114.0	116.0					10																	88259625		2203	4300	6503	SO:0001583	missense	23063	exon3			TTTCACTGAGATC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1375A>C	chr10.hg19:g.88259625T>G	ENSP00000298767:p.Ser459Arg	129.0	0.0		109.0	18.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	hg19	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000294	0.74818	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.56275	0.47	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.69305	0.3096	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.85130	0.991;0.991;0.997	T	0.72074	-0.4400	10	0.66056	D	0.02	.	15.4971	0.75662	0.0:0.0:0.0:1.0	.	459;459;502	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	R	544;459;544	ENSP00000298767:S459R	ENSP00000298767:S459R	S	-	1	0	WAPAL	88249605	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.068000	0.61886	0.533000	0.62120	AGT	.	.		0.388	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
SIRT3	23410	hgsc.bcm.edu	37	11	219012	219012	+	Silent	SNP	G	G	A	rs376721867		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:219012G>A	ENST00000382743.4	-	6	1101	c.999C>T	c.(997-999)gcC>gcT	p.A333A	SIRT3_ENST00000529382.1_Silent_p.A191A|SIRT3_ENST00000532956.1_Silent_p.A279A|SIRT3_ENST00000525319.1_Silent_p.A252A|SIRT3_ENST00000524564.1_Silent_p.A269A	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	333	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		AGCTCCGCACGGCCTCGGTCA	0.612																																					p.A333A		Atlas-SNP	.											.	SIRT3	28	.	0			c.C999T						.	G	,	0,4406		0,0,2203	45.0	42.0	43.0		573,999	-10.1	0.0	11		43	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	SIRT3	NM_001017524.2,NM_012239.5	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	191/258,333/400	219012	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23410	exon6			CCGCACGGCCTCG	AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.999C>T	chr11.hg19:g.219012G>A		113.0	0.0		84.0	32.0	NM_012239	B7Z5U6|Q9Y6E8	Silent	SNP	ENST00000382743.4	hg19	CCDS7691.1																																																																																			.	.		0.612	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239288.3		
OR51V1	283111	hgsc.bcm.edu	37	11	5221636	5221636	+	Nonsense_Mutation	SNP	G	G	A	rs558002486		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:5221636G>A	ENST00000321255.1	-	1	294	c.295C>T	c.(295-297)Cga>Tga	p.R99*		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	99					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGATCTCTCGAATGATCCCC	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		19423	0.0		0.0	False		,,,				2504	0.001				p.R99X		Atlas-SNP	.											.	OR51V1	77	.	0			c.C295T						.						70.0	63.0	65.0					11																	5221636		2201	4298	6499	SO:0001587	stop_gained	283111	exon1			TCTCTCGAATGAT	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.295C>T	chr11.hg19:g.5221636G>A	ENSP00000321729:p.Arg99*	118.0	0.0		103.0	37.0	NM_001004760		Nonsense_Mutation	SNP	ENST00000321255.1	hg19	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760934	0.31137	.	.	ENSG00000176742	ENST00000321255	.	.	.	5.48	-5.71	0.02413	.	1.102880	0.07131	N	0.845508	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.698	0.17867	0.0621:0.2469:0.1743:0.5166	.	.	.	.	X	99	.	ENSP00000321729:R99X	R	-	1	2	OR51V1	5178212	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-0.800000	0.04555	-0.777000	0.04572	-0.127000	0.14921	CGA	.	.		0.537	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760	
ZNF215	7762	hgsc.bcm.edu	37	11	6977365	6977365	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:6977365A>G	ENST00000278319.5	+	7	1745	c.1157A>G	c.(1156-1158)aAa>aGa	p.K386R	ZNF215_ENST00000414517.2_Missense_Mutation_p.K386R|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	386					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CAATGTGGGAAAGCCTTCTGC	0.388																																					p.K386R		Atlas-SNP	.											.	ZNF215	72	.	0			c.A1157G						.						73.0	71.0	72.0					11																	6977365		2201	4296	6497	SO:0001583	missense	7762	exon7			GTGGGAAAGCCTT	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1157A>G	chr11.hg19:g.6977365A>G	ENSP00000278319:p.Lys386Arg	78.0	0.0		71.0	18.0	NM_013250	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	hg19	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.471824	0.26423	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.20738	2.05;2.05	4.85	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000189	T	0.17365	0.0417	M	0.62016	1.91	0.80722	D	1	B	0.28208	0.203	B	0.32583	0.148	T	0.07829	-1.0752	9	.	.	.	-4.3472	1.2929	0.02064	0.4446:0.1598:0.0869:0.3087	.	386	Q9UL58	ZN215_HUMAN	R	386	ENSP00000278319:K386R;ENSP00000393202:K386R	.	K	+	2	0	ZNF215	6933941	1.000000	0.71417	0.830000	0.32933	0.356000	0.29392	3.202000	0.51067	0.080000	0.16959	-0.333000	0.08304	AAA	.	.		0.388	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1		
PLEKHA7	144100	hgsc.bcm.edu	37	11	16863174	16863174	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:16863174G>A	ENST00000355661.3	-	9	802	c.792C>T	c.(790-792)gcC>gcT	p.A264A	PLEKHA7_ENST00000532079.1_Intron|RN7SKP90_ENST00000363013.1_RNA|PLEKHA7_ENST00000448080.2_Silent_p.A264A|PLEKHA7_ENST00000531066.1_Silent_p.A264A			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	264	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CCTGGGTGTCGGCACTGAAGT	0.582																																					p.A264A		Atlas-SNP	.											.	PLEKHA7	120	.	0			c.C792T						.						126.0	104.0	111.0					11																	16863174		2200	4294	6494	SO:0001819	synonymous_variant	144100	exon9			GGTGTCGGCACTG	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.792C>T	chr11.hg19:g.16863174G>A		68.0	0.0		73.0	30.0	NM_175058	B4DK33|B4DWC3|Q86VZ7	Silent	SNP	ENST00000355661.3	hg19	CCDS31434.1																																																																																			.	.		0.582	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
ACCS	84680	hgsc.bcm.edu	37	11	44089305	44089305	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:44089305A>T	ENST00000263776.8	+	2	562	c.128A>T	c.(127-129)aAg>aTg	p.K43M	ACCS_ENST00000432284.2_Missense_Mutation_p.K43M|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	43					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						CTGGACCAGAAGCTGCCAGAG	0.552																																					p.K43M	Esophageal Squamous(158;148 1889 8077 23160 41213)	Atlas-SNP	.											.	ACCS	64	.	0			c.A128T						.						91.0	91.0	91.0					11																	44089305		2203	4300	6503	SO:0001583	missense	84680	exon2			ACCAGAAGCTGCC	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.128A>T	chr11.hg19:g.44089305A>T	ENSP00000263776:p.Lys43Met	112.0	0.0		81.0	23.0	NM_032592	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	hg19	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	A	14.57	2.575550	0.45902	.	.	ENSG00000110455	ENST00000524990;ENST00000263776;ENST00000432284;ENST00000533404	T;T;T;T	0.62788	0.9;0.0;0.9;0.52	4.66	3.51	0.40186	.	0.438298	0.21208	N	0.078344	T	0.71256	0.3318	M	0.65975	2.015	0.18873	N	0.999984	D;P	0.76494	0.999;0.901	D;P	0.63192	0.912;0.541	T	0.60647	-0.7222	10	0.45353	T	0.12	-23.1932	8.4274	0.32737	0.8032:0.1968:0.0:0.0	.	43;43	B4E219;Q96QU6	.;1A1L1_HUMAN	M	43	ENSP00000434156:K43M;ENSP00000263776:K43M;ENSP00000391775:K43M;ENSP00000435919:K43M	ENSP00000263776:K43M	K	+	2	0	ACCS	44045881	0.985000	0.35326	0.590000	0.28732	0.643000	0.38383	2.502000	0.45398	0.794000	0.33899	0.496000	0.49642	AAG	.	.		0.552	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
LPXN	9404	hgsc.bcm.edu	37	11	58318615	58318615	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:58318615G>A	ENST00000395074.2	-	5	497	c.409C>T	c.(409-411)Cag>Tag	p.Q137*	LPXN_ENST00000528954.1_Nonsense_Mutation_p.Q142*|LPXN_ENST00000528489.1_Nonsense_Mutation_p.Q117*	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	137					cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TGCAATTCCTGCTCCAGACCC	0.552																																					p.Q142X		Atlas-SNP	.											.	LPXN	55	.	0			c.C424T						.						110.0	91.0	97.0					11																	58318615		2201	4295	6496	SO:0001587	stop_gained	9404	exon5			ATTCCTGCTCCAG	AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.409C>T	chr11.hg19:g.58318615G>A	ENSP00000378512:p.Gln137*	84.0	0.0		98.0	21.0	NM_001143995	B2R8B4|B4DV71|Q53FW6|Q6FI07	Nonsense_Mutation	SNP	ENST00000395074.2	hg19	CCDS7969.1	.	.	.	.	.	.	.	.	.	.	G	35	5.595418	0.96602	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	.	.	.	5.7	5.7	0.88788	.	0.203947	0.45606	D	0.000352	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	12.0042	0.53248	0.0797:0.0:0.9203:0.0	.	.	.	.	X	142;137	.	ENSP00000378512:Q137X	Q	-	1	0	LPXN	58075191	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	5.941000	0.70195	2.683000	0.91414	0.655000	0.94253	CAG	.	.		0.552	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394709.1	NM_004811	
ZP1	22917	hgsc.bcm.edu	37	11	60641131	60641131	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:60641131C>A	ENST00000278853.5	+	9	1455	c.1455C>A	c.(1453-1455)taC>taA	p.Y485*		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	485	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GCGACAGCTACAGAACCCAAA	0.587																																					p.Y485X		Atlas-SNP	.											.	ZP1	69	.	0			c.C1455A						.						143.0	146.0	145.0					11																	60641131		2203	4299	6502	SO:0001587	stop_gained	22917	exon9			CAGCTACAGAACC	BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1455C>A	chr11.hg19:g.60641131C>A	ENSP00000278853:p.Tyr485*	105.0	0.0		91.0	36.0	NM_207341		Nonsense_Mutation	SNP	ENST00000278853.5	hg19	CCDS31572.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.991325	0.74703	.	.	ENSG00000149506	ENST00000278853;ENST00000544498	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.4487	13.2789	0.60202	0.0:0.9218:0.0:0.0782	.	.	.	.	X	485;192	.	ENSP00000278853:Y485X	Y	+	3	2	ZP1	60397707	0.993000	0.37304	1.000000	0.80357	0.177000	0.22998	1.030000	0.30153	2.477000	0.83638	0.313000	0.20887	TAC	.	.		0.587	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396329.1	NM_207341	
C11orf95	65998	hgsc.bcm.edu	37	11	63533563	63533563	+	lincRNA	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:63533563T>C	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							CCGGGCAGGGTTGAAGTCCAT	0.662																																					p.N118S		Atlas-SNP	.											.	.	.	.	0			c.A353G						.						67.0	69.0	69.0					11																	63533563		692	1591	2283			65998	exon2			GCAGGGTTGAAGT																													chr11.hg19:g.63533563T>C		73.0	0.0		63.0	31.0	NM_001144936		Missense_Mutation	SNP	ENST00000546282.2	hg19																																																																																				.	.		0.662	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000396567.2		
ANO1	55107	hgsc.bcm.edu	37	11	69949238	69949238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:69949238G>T	ENST00000355303.5	+	3	813	c.508G>T	c.(508-510)Gag>Tag	p.E170*	ANO1_ENST00000530676.1_Nonsense_Mutation_p.E54*|ANO1_ENST00000398543.2_Nonsense_Mutation_p.E54*|ANO1_ENST00000538023.1_Nonsense_Mutation_p.E170*|ANO1_ENST00000316296.5_Nonsense_Mutation_p.E142*	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	170					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CAGAGAGGCCGAGTTTCTGAA	0.532																																					p.E170X		Atlas-SNP	.											.	ANO1	156	.	0			c.G508T						.						77.0	84.0	82.0					11																	69949238		2031	4169	6200	SO:0001587	stop_gained	55107	exon3			GAGGCCGAGTTTC	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.508G>T	chr11.hg19:g.69949238G>T	ENSP00000347454:p.Glu170*	173.0	0.0		142.0	30.0	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Nonsense_Mutation	SNP	ENST00000355303.5	hg19	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	G	32	5.119449	0.94385	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000316296;ENST00000530676	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9172	0.88955	0.0:0.0:1.0:0.0	.	.	.	.	X	170;170;54;142;54	.	.	E	+	1	0	ANO1	69626886	1.000000	0.71417	0.793000	0.32043	0.258000	0.26162	8.978000	0.93450	2.474000	0.83562	0.650000	0.86243	GAG	.	.		0.532	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
PRDM10	56980	hgsc.bcm.edu	37	11	129827684	129827684	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr11:129827684G>A	ENST00000360871.3	-	3	422	c.191C>T	c.(190-192)cCa>cTa	p.P64L	PRDM10_ENST00000358825.5_Missense_Mutation_p.P64L|PRDM10_ENST00000528746.1_Missense_Mutation_p.P64L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	64					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CGTGTGCTCTGGACCATCCAC	0.502																																					p.P64L		Atlas-SNP	.											.	PRDM10	120	.	0			c.C191T						.						188.0	165.0	172.0					11																	129827684		2201	4297	6498	SO:0001583	missense	56980	exon3			TGCTCTGGACCAT	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.191C>T	chr11.hg19:g.129827684G>A	ENSP00000354118:p.Pro64Leu	75.0	0.0		38.0	29.0	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	hg19	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.612566	0.66672	.	.	ENSG00000170325	ENST00000358825;ENST00000360871;ENST00000528746;ENST00000527581;ENST00000531431	T;T;T;T;T	0.46819	1.13;1.13;2.9;0.9;0.86	5.75	4.84	0.62591	.	0.198064	0.44688	D	0.000424	T	0.33789	0.0875	N	0.19112	0.55	0.80722	D	1	B;B;B	0.28128	0.002;0.001;0.201	B;B;B	0.19148	0.004;0.003;0.024	T	0.18524	-1.0334	10	0.72032	D	0.01	-24.742	14.7624	0.69614	0.0693:0.0:0.9307:0.0	.	64;64;64	Q9NQV6-4;G3XAE5;Q9NQV6	.;.;PRD10_HUMAN	L	64	ENSP00000351686:P64L;ENSP00000354118:P64L;ENSP00000431262:P64L;ENSP00000432093:P64L;ENSP00000436681:P64L	ENSP00000351686:P64L	P	-	2	0	PRDM10	129332894	1.000000	0.71417	0.574000	0.28523	0.991000	0.79684	7.526000	0.81920	1.447000	0.47661	0.650000	0.86243	CCA	.	.		0.502	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
OS9	10956	hgsc.bcm.edu	37	12	58087962	58087962	+	Silent	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:58087962G>T	ENST00000315970.7	+	1	59	c.18G>T	c.(16-18)ctG>ctT	p.L6L	OS9_ENST00000552285.1_Silent_p.L6L|OS9_ENST00000435406.2_Silent_p.L6L|OS9_ENST00000389142.5_Silent_p.L6L|OS9_ENST00000413095.2_Silent_p.L6L|OS9_ENST00000551035.1_Silent_p.L6L|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000439210.2_Silent_p.L6L|OS9_ENST00000389146.6_Silent_p.L6L|OS9_ENST00000257966.8_Silent_p.L6L	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	6					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CGGAAACGCTGCTGTCCAGTT	0.592																																					p.L6L		Atlas-SNP	.											.	OS9	55	.	0			c.G18T						.						139.0	138.0	138.0					12																	58087962		2203	4300	6503	SO:0001819	synonymous_variant	10956	exon1			AACGCTGCTGTCC	AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.18G>T	chr12.hg19:g.58087962G>T		128.0	0.0		95.0	35.0	NM_001261423	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Silent	SNP	ENST00000315970.7	hg19	CCDS31843.1																																																																																			.	.		0.592	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408344.1	NM_006812	
IRAK3	11213	hgsc.bcm.edu	37	12	66638955	66638955	+	Silent	SNP	C	C	G	rs367771929		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:66638955C>G	ENST00000261233.4	+	11	1648	c.1227C>G	c.(1225-1227)ccC>ccG	p.P409P	IRAK3_ENST00000457197.2_Silent_p.P348P	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		AAGTGCCTCCCTGCCCTCGGA	0.478																																					p.P409P		Atlas-SNP	.											.	IRAK3	75	.	0			c.C1227G						.						79.0	81.0	80.0					12																	66638955		2203	4300	6503	SO:0001819	synonymous_variant	11213	exon11			GCCTCCCTGCCCT	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1227C>G	chr12.hg19:g.66638955C>G		144.0	0.0		88.0	18.0	NM_007199		Silent	SNP	ENST00000261233.4	hg19	CCDS8975.1																																																																																			.	.		0.478	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		
LUM	4060	hgsc.bcm.edu	37	12	91502117	91502117	+	Missense_Mutation	SNP	T	T	A	rs375444776		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:91502117T>A	ENST00000266718.4	-	2	1094	c.640A>T	c.(640-642)Aac>Tac	p.N214Y	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	214					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						ATCTTATTGTTGTCTAAGTAG	0.413																																					p.N214Y		Atlas-SNP	.											.	LUM	65	.	0			c.A640T						.						157.0	150.0	152.0					12																	91502117		2203	4300	6503	SO:0001583	missense	4060	exon2			TATTGTTGTCTAA	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.640A>T	chr12.hg19:g.91502117T>A	ENSP00000266718:p.Asn214Tyr	110.0	0.0		77.0	40.0	NM_002345	B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	hg19	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.606668	0.28623	.	.	ENSG00000139329	ENST00000266718	T	0.59906	0.23	5.84	4.66	0.58398	.	0.144445	0.64402	D	0.000013	T	0.52354	0.1729	L	0.55017	1.72	0.54753	D	0.999986	B	0.12013	0.005	B	0.15870	0.014	T	0.45644	-0.9247	10	0.34782	T	0.22	-15.0475	12.9935	0.58634	0.0:0.0:0.135:0.865	.	214	P51884	LUM_HUMAN	Y	214	ENSP00000266718:N214Y	ENSP00000266718:N214Y	N	-	1	0	LUM	90026248	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.384000	0.44362	1.002000	0.39104	0.455000	0.32223	AAC	.	.		0.413	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345	
ATP2A2	488	hgsc.bcm.edu	37	12	110765661	110765661	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:110765661C>T	ENST00000539276.2	+	8	1043	c.934C>T	c.(934-936)Cct>Tct	p.P312S	ATP2A2_ENST00000395494.2_Missense_Mutation_p.P285S|ATP2A2_ENST00000308664.6_Missense_Mutation_p.P312S			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	312					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TGAAGGTCTGCCTGCAGTCAT	0.512																																					p.P312S		Atlas-SNP	.											.	ATP2A2	78	.	0			c.C934T						.						66.0	63.0	64.0					12																	110765661		2203	4300	6503	SO:0001583	missense	488	exon8			GGTCTGCCTGCAG		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.934C>T	chr12.hg19:g.110765661C>T	ENSP00000440045:p.Pro312Ser	91.0	0.0		117.0	18.0	NM_001681	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	hg19	CCDS9144.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.400539|5.400539	0.96030|0.96030	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000548169|ENST00000308664;ENST00000395494;ENST00000539276	.|D;D;D	.|0.92495	.|-3.05;-3.05;-3.05	5.48|5.48	5.48|5.48	0.80851|0.80851	.|ATPase, P-type, ATPase-associated domain (1);	.|0.046197	.|0.85682	.|D	.|0.000000	D|D	0.96700|0.96700	0.8923|0.8923	M|M	0.88775|0.88775	2.98|2.98	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.64830	.|0.986;0.986;0.994	.|D;P;D	.|0.67725	.|0.953;0.884;0.929	D|D	0.96980|0.96980	0.9714|0.9714	5|10	.|0.87932	.|D	.|0	.|.	19.7748|19.7748	0.96388|0.96388	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|285;312;312	.|P16615-4;P16615-2;P16615	.|.;.;AT2A2_HUMAN	V|S	202|312;285;312	.|ENSP00000311186:P312S;ENSP00000378872:P285S;ENSP00000440045:P312S	.|ENSP00000311186:P312S	A|P	+|+	2|1	0|0	ATP2A2|ATP2A2	109250044|109250044	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.760000|7.760000	0.85248|0.85248	2.741000|2.741000	0.93983|0.93983	0.585000|0.585000	0.79938|0.79938	GCC|CCT	.	.		0.512	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
HECTD4	283450	hgsc.bcm.edu	37	12	112681775	112681775	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:112681775C>T	ENST00000430131.2	-	29	4431	c.3286G>A	c.(3286-3288)Gct>Act	p.A1096T	HECTD4_ENST00000550722.1_Missense_Mutation_p.A1372T|HECTD4_ENST00000377560.5_Missense_Mutation_p.A1346T			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1096					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGCCTGACAGCGTGAGATATC	0.393																																					p.A1384T		Atlas-SNP	.											.	.	.	.	0			c.G4150A						.						74.0	74.0	74.0					12																	112681775		1901	4126	6027	SO:0001583	missense	283450	exon30			TGACAGCGTGAGA	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.3286G>A	chr12.hg19:g.112681775C>T	ENSP00000404379:p.Ala1096Thr	208.0	0.0		251.0	49.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	20.2	3.953806	0.73902	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.44881	0.91;0.91;0.91	5.85	5.85	0.93711	.	.	.	.	.	T	0.24275	0.0588	N	0.08118	0	0.46823	D	0.999212	P	0.39782	0.688	B	0.25884	0.064	T	0.21042	-1.0257	9	0.72032	D	0.01	.	20.1649	0.98147	0.0:1.0:0.0:0.0	.	1096	Q9Y4D8	K0614_HUMAN	T	1346;1096;1372	ENSP00000366783:A1346T;ENSP00000404379:A1096T;ENSP00000449784:A1372T	ENSP00000366783:A1346T	A	-	1	0	C12orf51	111166158	0.965000	0.33210	0.999000	0.59377	0.971000	0.66376	2.094000	0.41719	2.753000	0.94483	0.655000	0.94253	GCT	.	.		0.393	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
TBX3	6926	hgsc.bcm.edu	37	12	115109713	115109713	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:115109713T>A	ENST00000257566.3	-	8	2554	c.2165A>T	c.(2164-2166)cAg>cTg	p.Q722L	TBX3_ENST00000349155.2_Missense_Mutation_p.Q702L	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	722					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CTGGATGCTCTGCAGTTCGCT	0.627																																					p.Q722L		Atlas-SNP	.											.	TBX3	106	.	0			c.A2165T						.						18.0	15.0	16.0					12																	115109713		2201	4289	6490	SO:0001583	missense	6926	exon8			ATGCTCTGCAGTT	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.2165A>T	chr12.hg19:g.115109713T>A	ENSP00000257566:p.Gln722Leu	108.0	0.0		92.0	16.0	NM_016569	Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	hg19	CCDS9176.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.785247	0.90282	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.93307	-3.2;-3.05	4.92	4.92	0.64577	.	1.865220	0.02247	N	0.066317	D	0.97219	0.9091	M	0.78637	2.42	0.80722	D	1	D;D	0.76494	0.999;0.967	D;D	0.91635	0.999;0.932	D	0.88306	0.2953	10	0.72032	D	0.01	.	13.7499	0.62901	0.0:0.0:0.0:1.0	.	702;722	O15119-2;O15119	.;TBX3_HUMAN	L	702;722;579	ENSP00000257567:Q702L;ENSP00000257566:Q722L	ENSP00000257566:Q722L	Q	-	2	0	TBX3	113594096	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.451000	0.80668	1.851000	0.53745	0.460000	0.39030	CAG	.	.		0.627	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996	
VSIG10	54621	hgsc.bcm.edu	37	12	118506330	118506330	+	Missense_Mutation	SNP	C	C	A	rs67582641|rs72125532	byFrequency	TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr12:118506330C>A	ENST00000359236.5	-	8	1695	c.1419G>T	c.(1417-1419)gaG>gaT	p.E473D		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	473	Glu-rich.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						CAGCAtcttcctcctcctcct	0.488																																					p.E473D		Atlas-SNP	.											.	VSIG10	41	.	0			c.G1419T						.						116.0	118.0	118.0					12																	118506330		2078	4210	6288	SO:0001583	missense	54621	exon8			ATCTTCCTCCTCC		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1419G>T	chr12.hg19:g.118506330C>A	ENSP00000352172:p.Glu473Asp	32.0	0.0		59.0	6.0	NM_019086	Q9NWQ7	Missense_Mutation	SNP	ENST00000359236.5	hg19	CCDS44992.1	.	.	.	.	.	.	.	.	.	.	C	0.055	-1.239784	0.01493	.	.	ENSG00000176834	ENST00000359236	T	0.54479	0.57	4.75	-4.46	0.03536	.	2.032290	0.02720	N	0.113904	T	0.44603	0.1301	M	0.63428	1.95	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14783	-1.0460	10	0.14656	T	0.56	.	6.5058	0.22194	0.1399:0.2336:0.0:0.6265	.	473	Q8N0Z9	VSI10_HUMAN	D	473	ENSP00000352172:E473D	ENSP00000352172:E473D	E	-	3	2	VSIG10	116990713	0.012000	0.17670	0.009000	0.14445	0.089000	0.18198	-0.503000	0.06383	-0.757000	0.04697	-1.453000	0.01033	GAG	.	.		0.488	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
DACH1	1602	hgsc.bcm.edu	37	13	72063270	72063270	+	Silent	SNP	C	C	T	rs370706409		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr13:72063270C>T	ENST00000359684.2	-	8	1742	c.1743G>A	c.(1741-1743)ccG>ccA	p.P581P	DACH1_ENST00000354591.4_Silent_p.P327P|DACH1_ENST00000305425.4_Silent_p.P529P|DACH1_ENST00000313174.7_Silent_p.P381P			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	581					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GTGTAGAAAGCGGGGTCTCAT	0.443																																					p.P529P		Atlas-SNP	.											.	DACH1	123	.	0			c.G1587A						.	C	,,	1,3789		0,1,1894	194.0	191.0	192.0		981,1587,1143	4.2	1.0	13		192	1,8261		0,1,4130	no	coding-synonymous,coding-synonymous,coding-synonymous	DACH1	NM_004392.5,NM_080759.4,NM_080760.4	,,	0,2,6024	TT,TC,CC		0.0121,0.0264,0.0166	,,	327/507,529/709,381/561	72063270	2,12050	1895	4131	6026	SO:0001819	synonymous_variant	1602	exon7			AGAAAGCGGGGTC	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.1743G>A	chr13.hg19:g.72063270C>T		71.0	0.0		31.0	18.0	NM_080759	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Silent	SNP	ENST00000359684.2	hg19																																																																																				.	.		0.443	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
MYCBP2	23077	hgsc.bcm.edu	37	13	77700507	77700507	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr13:77700507T>A	ENST00000544440.2	-	53	7733	c.7716A>T	c.(7714-7716)agA>agT	p.R2572S	MYCBP2_ENST00000482517.1_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.R2572S|MYCBP2_ENST00000360084.5_Missense_Mutation_p.R35S|MYCBP2_ENST00000407578.2_Missense_Mutation_p.R2610S					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTGGGATACCTCTAAGGTTAG	0.438																																					p.R2610S		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A7830T						.						200.0	167.0	178.0					13																	77700507		2203	4300	6503	SO:0001583	missense	23077	exon53			GATACCTCTAAGG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.7716A>T	chr13.hg19:g.77700507T>A	ENSP00000444596:p.Arg2572Ser	131.0	0.0		51.0	31.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	T	16.09	3.024165	0.54683	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440;ENST00000360084	T;T;T;T	0.51071	1.48;1.47;1.48;0.72	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.59851	0.2224	L	0.40543	1.245	0.54753	D	0.999982	D;D	0.61080	0.989;0.967	D;P	0.72625	0.978;0.879	T	0.63418	-0.6642	10	0.72032	D	0.01	.	14.696	0.69121	0.0:0.0:0.0:1.0	.	2572;2572	O75592-2;O75592	.;MYCB2_HUMAN	S	2572;2610;2572;35	ENSP00000349892:R2572S;ENSP00000384288:R2610S;ENSP00000444596:R2572S;ENSP00000353197:R35S	ENSP00000349892:R2572S	R	-	3	2	MYCBP2	76598508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.611000	0.61162	1.873000	0.54277	0.460000	0.39030	AGA	.	.		0.438	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
ADPRHL1	113622	hgsc.bcm.edu	37	13	114083321	114083321	+	Missense_Mutation	SNP	G	G	A	rs375108772		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr13:114083321G>A	ENST00000375418.3	-	4	678	c.592C>T	c.(592-594)Cgg>Tgg	p.R198W	ADPRHL1_ENST00000356501.4_Missense_Mutation_p.R116W	NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	198					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			GGCACCGCCCGCAGCATGTCT	0.662																																					p.R198W		Atlas-SNP	.											ADPRHL1,NS,carcinoma,0,1	ADPRHL1	30	.	0			c.C592T						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	52.0	47.0	49.0		592,346	-4.4	0.0	13		49	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADPRHL1	NM_138430.3,NM_199162.1	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	198/355,116/273	114083321	1,13005	2203	4300	6503	SO:0001583	missense	113622	exon4			CCGCCCGCAGCAT	AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.592C>T	chr13.hg19:g.114083321G>A	ENSP00000364567:p.Arg198Trp	62.0	0.0		23.0	14.0	NM_138430	Q5JUG2|Q96GD1	Missense_Mutation	SNP	ENST00000375418.3	hg19	CCDS9535.1	.	.	.	.	.	.	.	.	.	.	G	14.50	2.553440	0.45487	0.0	1.16E-4	ENSG00000153531	ENST00000356501;ENST00000375418;ENST00000413169	T;T;T	0.31769	1.48;1.48;1.48	5.26	-4.37	0.03633	.	0.382789	0.29884	N	0.010960	T	0.36054	0.0953	L	0.51422	1.61	0.23138	N	0.998234	D	0.67145	0.996	P	0.51101	0.659	T	0.50474	-0.8824	10	0.72032	D	0.01	-13.3827	18.9624	0.92681	0.0:0.0:0.6911:0.3089	.	198	Q8NDY3	ARHL1_HUMAN	W	116;198;116	ENSP00000348894:R116W;ENSP00000364567:R198W;ENSP00000416213:R116W	ENSP00000348894:R116W	R	-	1	2	ADPRHL1	113131322	1.000000	0.71417	0.001000	0.08648	0.004000	0.04260	1.838000	0.39211	-1.079000	0.03113	-0.475000	0.04921	CGG	.	.		0.662	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045915.2	NM_138430	
FLRT2	23768	hgsc.bcm.edu	37	14	86087999	86087999	+	Silent	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr14:86087999C>A	ENST00000330753.4	+	2	908	c.141C>A	c.(139-141)gtC>gtA	p.V47V	FLRT2_ENST00000554746.1_Silent_p.V47V	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	47	LRRNT.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGAACTTTGTCTACTGTAATG	0.502																																					p.V47V		Atlas-SNP	.											.	FLRT2	168	.	0			c.C141A						.						131.0	121.0	125.0					14																	86087999		2203	4300	6503	SO:0001819	synonymous_variant	23768	exon2			CTTTGTCTACTGT	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.141C>A	chr14.hg19:g.86087999C>A		78.0	0.0		42.0	27.0	NM_013231	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	hg19	CCDS9877.1																																																																																			.	.		0.502	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
CHGA	1113	hgsc.bcm.edu	37	14	93399004	93399004	+	Missense_Mutation	SNP	C	C	A	rs200576557		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr14:93399004C>A	ENST00000216492.5	+	7	1378	c.1098C>A	c.(1096-1098)gaC>gaA	p.D366E	CHGA_ENST00000334654.4_Missense_Mutation_p.D215E	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	366					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		AGGAGGAGGACAACCGGGACA	0.677																																					p.D366E	Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)	Atlas-SNP	.											.	CHGA	32	.	0			c.C1098A						.						24.0	19.0	21.0					14																	93399004		2199	4295	6494	SO:0001583	missense	1113	exon7			GGAGGACAACCGG		CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.1098C>A	chr14.hg19:g.93399004C>A	ENSP00000216492:p.Asp366Glu	77.0	0.0		28.0	18.0	NM_001275	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	hg19	CCDS9906.1	.	.	.	.	.	.	.	.	.	.	C	0.463	-0.887995	0.02511	.	.	ENSG00000100604	ENST00000216492;ENST00000334654	T;T	0.01560	4.77;4.77	4.66	-9.32	0.00643	.	1.158180	0.06445	N	0.726621	T	0.00875	0.0029	N	0.10809	0.05	0.18873	N	0.999985	B;B	0.27625	0.183;0.001	B;B	0.24974	0.057;0.003	T	0.45891	-0.9230	10	0.21014	T	0.42	-0.0084	3.94	0.09323	0.2863:0.114:0.4446:0.155	.	215;366	G5E968;P10645	.;CMGA_HUMAN	E	366;215	ENSP00000216492:D366E;ENSP00000334023:D215E	ENSP00000216492:D366E	D	+	3	2	CHGA	92468757	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-2.121000	0.01322	-2.554000	0.00477	-0.233000	0.12211	GAC	.	.		0.677	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412411.1	NM_001275	
KIF26A	26153	hgsc.bcm.edu	37	14	104641670	104641670	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr14:104641670G>A	ENST00000423312.2	+	12	2545	c.2545G>A	c.(2545-2547)Gaa>Aaa	p.E849K	KIF26A_ENST00000315264.7_Missense_Mutation_p.E710K	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	849					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GGAGCGGCTGGAATGCATGGA	0.711																																					p.E849K		Atlas-SNP	.											.	KIF26A	84	.	0			c.G2545A						.						14.0	17.0	16.0					14																	104641670		1993	4140	6133	SO:0001583	missense	26153	exon12			CGGCTGGAATGCA	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2545G>A	chr14.hg19:g.104641670G>A	ENSP00000388241:p.Glu849Lys	114.0	0.0		38.0	29.0	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	hg19	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532825	0.64972	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.81163	-1.46;-1.46	3.9	3.9	0.45041	.	.	.	.	.	T	0.81039	0.4740	M	0.64404	1.975	0.80722	D	1	P	0.50443	0.935	P	0.45829	0.494	D	0.83552	0.0102	9	0.49607	T	0.09	.	16.2557	0.82516	0.0:0.0:1.0:0.0	.	849	Q9ULI4	KI26A_HUMAN	K	849;710	ENSP00000388241:E849K;ENSP00000325452:E710K	ENSP00000325452:E710K	E	+	1	0	KIF26A	103711423	1.000000	0.71417	0.860000	0.33809	0.269000	0.26545	7.578000	0.82498	1.894000	0.54839	0.462000	0.41574	GAA	.	.		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
APBA2	321	hgsc.bcm.edu	37	15	29406112	29406112	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:29406112C>T	ENST00000558402.1	+	15	2670	c.2071C>T	c.(2071-2073)Cga>Tga	p.R691*	APBA2_ENST00000411764.1_Nonsense_Mutation_p.R679*|APBA2_ENST00000561069.1_Nonsense_Mutation_p.R691*|APBA2_ENST00000558330.1_Nonsense_Mutation_p.R679*|APBA2_ENST00000558259.1_Nonsense_Mutation_p.R691*			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	691	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CATTGCTGAGCGAGGGGGCGT	0.632																																					p.R691X		Atlas-SNP	.											.	APBA2	132	.	0			c.C2071T						.						82.0	71.0	75.0					15																	29406112		2203	4300	6503	SO:0001587	stop_gained	321	exon13			GCTGAGCGAGGGG	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.2071C>T	chr15.hg19:g.29406112C>T	ENSP00000453293:p.Arg691*	47.0	0.0		20.0	8.0	NM_005503	E9PGI4|O60571|Q5XKC0	Nonsense_Mutation	SNP	ENST00000558402.1	hg19	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	C	40	8.022872	0.98616	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	.	.	.	4.55	4.55	0.56014	.	0.087637	0.41097	D	0.000944	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4989	0.44794	0.3159:0.6841:0.0:0.0	.	.	.	.	X	679;691	.	ENSP00000219865:R691X	R	+	1	2	APBA2	27193404	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	1.077000	0.30741	2.068000	0.61886	0.462000	0.41574	CGA	.	.		0.632	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
MGA	23269	hgsc.bcm.edu	37	15	42058313	42058313	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:42058313G>T	ENST00000570161.1	+	23	8033	c.8033G>T	c.(8032-8034)aGc>aTc	p.S2678I	MGA_ENST00000566586.1_Missense_Mutation_p.S2469I|MGA_ENST00000389936.4_Missense_Mutation_p.S2639I|MGA_ENST00000219905.7_Missense_Mutation_p.S2678I|MGA_ENST00000545763.1_Missense_Mutation_p.S2469I			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTTCCTGATAGCAAGCCATCT	0.433																																					p.S2678I		Atlas-SNP	.											.	MGA	264	.	0			c.G8033T						.						79.0	75.0	77.0					15																	42058313		1905	4128	6033	SO:0001583	missense	23269	exon24			CTGATAGCAAGCC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8033G>T	chr15.hg19:g.42058313G>T	ENSP00000457035:p.Ser2678Ile	310.0	0.0		166.0	65.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	hg19	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250318	0.39797	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.84873	-1.91;-1.89;-1.91	5.38	3.44	0.39384	.	1.228810	0.05850	N	0.620973	T	0.77552	0.4147	N	0.08118	0	0.19775	N	0.999957	B;B	0.27791	0.189;0.167	B;B	0.35607	0.206;0.063	T	0.69105	-0.5233	10	0.87932	D	0	.	11.1122	0.48239	0.075:0.1384:0.7866:0.0	.	2469;2678	F5H7K2;E7ENI0	.;.	I	2678;2639;2469	ENSP00000219905:S2678I;ENSP00000374586:S2639I;ENSP00000442467:S2469I	ENSP00000219905:S2678I	S	+	2	0	MGA	39845605	0.998000	0.40836	0.998000	0.56505	0.961000	0.63080	1.967000	0.40491	1.516000	0.48900	-0.122000	0.15005	AGC	.	.		0.433	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
PML	5371	hgsc.bcm.edu	37	15	74328285	74328285	+	Intron	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:74328285G>T	ENST00000268058.3	+	7	1806				PML_ENST00000569965.1_Intron|PML_ENST00000395135.3_Intron|PML_ENST00000395132.2_Intron|PML_ENST00000354026.6_Missense_Mutation_p.G780V|PML_ENST00000268059.6_Missense_Mutation_p.G828V|PML_ENST00000563500.1_3'UTR|PML_ENST00000565898.1_Intron|PML_ENST00000564428.1_Intron|PML_ENST00000435786.2_3'UTR|PML_ENST00000436891.3_3'UTR|PML_ENST00000359928.4_Intron	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CGTCAAGCAGGCCTCTGAGAG	0.622			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.G828V		Atlas-SNP	.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML	169	.	0			c.G2483T						.						136.0	163.0	154.0					15																	74328285		2198	4297	6495	SO:0001627	intron_variant	5371	exon8			AAGCAGGCCTCTG	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1710+1414G>T	chr15.hg19:g.74328285G>T		51.0	0.0		40.0	11.0	NM_033239	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	hg19	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.239891	0.39598	.	.	ENSG00000140464	ENST00000268059;ENST00000354026	.	.	.	3.59	-0.651	0.11454	.	.	.	.	.	T	0.15176	0.0366	N	0.08118	0	0.09310	N	1	P;P	0.43701	0.815;0.815	B;B	0.42522	0.39;0.39	T	0.13710	-1.0499	8	0.87932	D	0	.	4.3844	0.11309	0.2161:0.3631:0.4208:0.0	.	780;828	P29590-13;P29590-8	.;.	V	828;780	.	ENSP00000268059:G828V	G	+	2	0	PML	72115338	0.000000	0.05858	0.001000	0.08648	0.040000	0.13550	0.338000	0.19858	-0.097000	0.12307	0.456000	0.33151	GGC	.	.		0.622	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
PSTPIP1	9051	hgsc.bcm.edu	37	15	77310799	77310799	+	Splice_Site	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:77310799G>T	ENST00000558012.1	+	3	628	c.139G>T	c.(139-141)Gcc>Tcc	p.A47S	PSTPIP1_ENST00000559295.1_Splice_Site_p.A47S|PSTPIP1_ENST00000379595.3_Splice_Site_p.A47S|PSTPIP1_ENST00000267939.5_Splice_Site_p.A46S	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	47	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						TTTTTGCAGGGCCCAGGCGGA	0.577																																					p.A47S		Atlas-SNP	.											.	PSTPIP1	50	.	0			c.G139T						.						28.0	33.0	31.0					15																	77310799		1971	4125	6096	SO:0001630	splice_region_variant	9051	exon3			TGCAGGGCCCAGG	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.138-1G>T	chr15.hg19:g.77310799G>T		80.0	0.0		29.0	9.0	NM_003978	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	hg19	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632312	0.67015	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.19669	2.13;2.13	3.81	3.81	0.43845	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.198845	0.42420	D	0.000716	T	0.43389	0.1245	M	0.69463	2.115	0.51767	D	0.999932	P;D;D;D	0.69078	0.859;0.997;0.996;0.994	P;D;P;D	0.70487	0.623;0.969;0.883;0.934	T	0.46638	-0.9177	10	0.72032	D	0.01	-10.2682	14.9929	0.71401	0.0:0.0:1.0:0.0	.	47;46;47;47	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	S	47;46	ENSP00000368914:A47S;ENSP00000267939:A46S	ENSP00000267939:A46S	A	+	1	0	PSTPIP1	75097854	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	5.122000	0.64697	2.136000	0.66102	0.591000	0.81541	GCC	.	.		0.577	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	Missense_Mutation
ALPK3	57538	hgsc.bcm.edu	37	15	85399661	85399661	+	Silent	SNP	G	G	A	rs549394061		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:85399661G>A	ENST00000258888.5	+	6	2465	c.2298G>A	c.(2296-2298)tcG>tcA	p.S766S		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	766	Poly-Ser.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTACCATGTCGGCCAGCAGCA	0.498																																					p.S766S		Atlas-SNP	.											.	ALPK3	289	.	0			c.G2298A						.						123.0	115.0	118.0					15																	85399661		2203	4299	6502	SO:0001819	synonymous_variant	57538	exon6			CATGTCGGCCAGC	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.2298G>A	chr15.hg19:g.85399661G>A		133.0	0.0		74.0	19.0	NM_020778	Q9P2L6	Silent	SNP	ENST00000258888.5	hg19	CCDS10333.1																																																																																			.	.		0.498	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
BLM	641	hgsc.bcm.edu	37	15	91326134	91326134	+	Missense_Mutation	SNP	G	G	C	rs201770808		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:91326134G>C	ENST00000355112.3	+	13	2756	c.2638G>C	c.(2638-2640)Gaa>Caa	p.E880Q	BLM_ENST00000560509.1_Missense_Mutation_p.E880Q|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	880	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TGATTGCCTAGAATGGATCAG	0.348			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.E880Q		Atlas-SNP	.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	122	.	0			c.G2638C						.	G	GLN/GLU	0,4396		0,0,2198	71.0	59.0	63.0		2638	4.6	1.0	15		63	2,8594	2.2+/-6.3	0,2,4296	yes	missense	BLM	NM_000057.2	29	0,2,6494	CC,CG,GG		0.0233,0.0,0.0154	benign	880/1418	91326134	2,12990	2198	4298	6496	SO:0001583	missense	641	exon13	Familial Cancer Database		TGCCTAGAATGGA	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2638G>C	chr15.hg19:g.91326134G>C	ENSP00000347232:p.Glu880Gln	288.0	0.0		175.0	7.0	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	hg19	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614372	0.46631	0.0	2.33E-4	ENSG00000197299	ENST00000355112;ENST00000536925;ENST00000543977	T	0.48201	0.82	5.54	4.56	0.56223	Helicase, C-terminal (1);	0.366671	0.31438	N	0.007656	T	0.34803	0.0910	L	0.31476	0.935	0.44956	D	0.99797	B;B;B	0.29571	0.167;0.249;0.167	B;B;B	0.29176	0.099;0.082;0.099	T	0.11397	-1.0589	10	0.25751	T	0.34	-11.2439	12.8729	0.57975	0.0:0.0:0.8365:0.1635	.	880;505;880	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	Q	880;533;67	ENSP00000347232:E880Q	ENSP00000347232:E880Q	E	+	1	0	BLM	89127138	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.586000	0.46119	2.603000	0.88011	0.655000	0.94253	GAA	.	.		0.348	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
PIGQ	9091	hgsc.bcm.edu	37	16	633537	633537	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr16:633537A>C	ENST00000026218.5	+	10	2274	c.2186A>C	c.(2185-2187)aAg>aCg	p.K729T	PIGQ_ENST00000321878.5_3'UTR	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	729					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				GGGGGATTGAAGCAGTCGCTG	0.642																																					p.K729T		Atlas-SNP	.											.	PIGQ	43	.	0			c.A2186C						.						40.0	40.0	40.0					16																	633537		2200	4300	6500	SO:0001583	missense	9091	exon10			GATTGAAGCAGTC	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.2186A>C	chr16.hg19:g.633537A>C	ENSP00000026218:p.Lys729Thr	78.0	0.0		35.0	26.0	NM_148920	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	hg19	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	A	8.297	0.819046	0.16607	.	.	ENSG00000007541	ENST00000026218	T	0.22945	1.93	3.3	-2.21	0.06973	.	.	.	.	.	T	0.09642	0.0237	N	0.08118	0	0.09310	N	1	B;B	0.28713	0.22;0.002	B;B	0.27076	0.076;0.003	T	0.34329	-0.9833	8	.	.	.	.	4.0361	0.09730	0.3543:0.2199:0.4257:0.0	.	299;729	B3KRR7;Q9BRB3	.;PIGQ_HUMAN	T	729	ENSP00000026218:K729T	.	K	+	2	0	PIGQ	573538	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.847000	0.01675	-0.197000	0.10350	0.369000	0.22263	AAG	.	.		0.642	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204	
TRAF7	84231	hgsc.bcm.edu	37	16	2218152	2218152	+	Missense_Mutation	SNP	G	G	T	rs547586265		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr16:2218152G>T	ENST00000326181.6	+	4	346	c.214G>T	c.(214-216)Gac>Tac	p.D72Y		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	72					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						CTCCCCGCGGGACGAGGAGGA	0.667																																					p.D72Y		Atlas-SNP	.											.	TRAF7	158	.	0			c.G214T						.						82.0	62.0	69.0					16																	2218152		2198	4300	6498	SO:0001583	missense	84231	exon4			CCGCGGGACGAGG	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.214G>T	chr16.hg19:g.2218152G>T	ENSP00000318944:p.Asp72Tyr	64.0	0.0		24.0	16.0	NM_032271	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	hg19	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726518	0.48833	.	.	ENSG00000131653	ENST00000326181	T	0.32988	1.43	4.8	4.8	0.61643	.	0.048962	0.85682	D	0.000000	T	0.36468	0.0968	N	0.24115	0.695	0.80722	D	1	D	0.67145	0.996	P	0.57548	0.823	T	0.25502	-1.0130	10	0.72032	D	0.01	-22.9954	15.3698	0.74554	0.0:0.0:1.0:0.0	.	72	Q6Q0C0	TRAF7_HUMAN	Y	72	ENSP00000318944:D72Y	ENSP00000318944:D72Y	D	+	1	0	TRAF7	2158153	1.000000	0.71417	0.639000	0.29394	0.101000	0.19017	8.497000	0.90488	2.368000	0.80403	0.561000	0.74099	GAC	.	.		0.667	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
DNAH3	55567	hgsc.bcm.edu	37	16	21156684	21156684	+	Missense_Mutation	SNP	G	G	C	rs138032546		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr16:21156684G>C	ENST00000261383.3	-	3	265	c.266C>G	c.(265-267)aCg>aGg	p.T89R	DNAH3_ENST00000575491.1_5'UTR|DNAH3_ENST00000415178.1_Missense_Mutation_p.T89R	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	89	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGTCCATGACGTGCGTTGCAT	0.527																																					p.T89R		Atlas-SNP	.											.	DNAH3	1142	.	0			c.C266G						.						168.0	129.0	142.0					16																	21156684		2201	4300	6501	SO:0001583	missense	55567	exon3			CATGACGTGCGTT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.266C>G	chr16.hg19:g.21156684G>C	ENSP00000261383:p.Thr89Arg	115.0	0.0		57.0	39.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.485799	0.26686	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.22539	1.95;2.14	5.8	4.84	0.62591	.	0.199508	0.35555	N	0.003135	T	0.11922	0.0290	N	0.22421	0.69	0.26371	N	0.976883	B;P	0.37141	0.2;0.584	B;B	0.35899	0.069;0.213	T	0.18147	-1.0346	10	0.12103	T	0.63	.	9.3454	0.38104	0.1627:0.0:0.8373:0.0	.	89;60	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	R	89;89;60	ENSP00000261383:T89R;ENSP00000394245:T89R	ENSP00000261383:T89R	T	-	2	0	DNAH3	21064185	0.006000	0.16342	0.978000	0.43139	0.749000	0.42624	0.956000	0.29202	2.750000	0.94351	0.650000	0.86243	ACG	.	G|1.000;A|0.000		0.527	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
CBFB	865	hgsc.bcm.edu	37	16	67100668	67100668	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr16:67100668G>A	ENST00000290858.6	+	4	627	c.366G>A	c.(364-366)atG>atA	p.M122I	CBFB_ENST00000412916.2_Missense_Mutation_p.M122I|CBFB_ENST00000561924.2_Missense_Mutation_p.M22I	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	122					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		TGGATGGTATGGGCTGTCTGG	0.478			T	MYH11	AML																																p.M122I		Atlas-SNP	.		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	.	CBFB	52	.	0			c.G366A						.						145.0	124.0	131.0					16																	67100668		2200	4300	6500	SO:0001583	missense	865	exon4			TGGTATGGGCTGT	BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.366G>A	chr16.hg19:g.67100668G>A	ENSP00000290858:p.Met122Ile	138.0	0.0		84.0	32.0	NM_022845	A8K347|Q13124|Q9HCT2	Missense_Mutation	SNP	ENST00000290858.6	hg19	CCDS10827.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375083	0.61735	.	.	ENSG00000067955	ENST00000290858;ENST00000412916	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.66877	0.2834	L	0.27053	0.805	0.80722	D	1	B;B	0.28820	0.187;0.224	P;P	0.51055	0.526;0.657	T	0.59085	-0.7520	9	0.15499	T	0.54	-12.5189	18.1601	0.89705	0.0:0.0:1.0:0.0	.	122;122	Q13951-2;Q13951	.;PEBB_HUMAN	I	122	.	ENSP00000290858:M122I	M	+	3	0	CBFB	65658169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.578000	0.98200	2.648000	0.89879	0.561000	0.74099	ATG	.	.		0.478	CBFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268843.2	NM_001755	
FHOD1	29109	hgsc.bcm.edu	37	16	67265130	67265130	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr16:67265130G>A	ENST00000258201.4	-	17	2875	c.2628C>T	c.(2626-2628)gaC>gaT	p.D876D		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	876	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CTGAATAGAGGTCAGAGGACT	0.592																																					p.D876D		Atlas-SNP	.											.	FHOD1	86	.	0			c.C2628T						.						69.0	60.0	63.0					16																	67265130		2198	4300	6498	SO:0001819	synonymous_variant	29109	exon17			ATAGAGGTCAGAG	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2628C>T	chr16.hg19:g.67265130G>A		141.0	0.0		62.0	48.0	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	hg19	CCDS10834.1																																																																																			.	.		0.592	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
DPH1	1801	hgsc.bcm.edu	37	17	1945139	1945139	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:1945139G>A	ENST00000263083.6	+	12	1365	c.1320G>A	c.(1318-1320)ccG>ccA	p.P440P	OVCA2_ENST00000572195.1_5'Flank|RP11-667K14.3_ENST00000572790.1_lincRNA|DPH1_ENST00000570477.1_Silent_p.P360P|RP11-667K14.4_ENST00000572404.1_RNA	NM_001383.3	NP_001374.3	Q9BZG8	DPH1_HUMAN	diphthamide biosynthesis 1	440					cell proliferation (GO:0008283)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	17						AGGTGGCGCCGCTGGCTCCTT	0.692											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P440P		Atlas-SNP	.											.	DPH1	32	.	0			c.G1320A						.						10.0	14.0	13.0					17																	1945139		2056	4170	6226	SO:0001819	synonymous_variant	1801	exon12			GGCGCCGCTGGCT	S81752	CCDS42228.1	17p13.3	2013-05-02	2013-05-02	2005-06-03	ENSG00000108963	ENSG00000108963			3003	protein-coding gene	gene with protein product	"""ovarian tumor suppressor candidate 1"""	603527	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 1 (S. cerevisiae)"", ""DPH-like 1 (S. cerevisiae)"", ""DPH1 homolog (S. cerevisiae)"""	DPH2L, DPH2L1		8603384, 15485916, 22869748	Standard	NM_001383		Approved	OVCA1	uc002fts.3	Q9BZG8	OTTHUMG00000177724	ENST00000263083.6:c.1320G>A	chr17.hg19:g.1945139G>A		60.0	0.0	599	50.0	39.0	NM_001383	D3DTI3|Q16439|Q4VBA2|Q9BTW7|Q9UCY0	Silent	SNP	ENST00000263083.6	hg19	CCDS42228.1																																																																																			.	.		0.692	DPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438660.1	NM_001383	
TP53	7157	hgsc.bcm.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,right_lower_lobe,carcinoma,-2,1	TP53	33396	.	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	chr17.hg19:g.7577534C>A	ENSP00000269305:p.Arg249Ser	120.0	0.0		70.0	50.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KIAA0100	9703	hgsc.bcm.edu	37	17	26965006	26965006	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:26965006T>G	ENST00000528896.2	-	14	1693	c.1619A>C	c.(1618-1620)cAa>cCa	p.Q540P	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.Q397P|KIAA0100_ENST00000544884.1_Missense_Mutation_p.Q397P	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	540						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AGACAGACATTGGGCACAGGT	0.488																																					p.Q540P		Atlas-SNP	.											.	KIAA0100	175	.	0			c.A1619C						.						87.0	77.0	81.0					17																	26965006		2203	4300	6503	SO:0001583	missense	9703	exon14			AGACATTGGGCAC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1619A>C	chr17.hg19:g.26965006T>G	ENSP00000436773:p.Gln540Pro	79.0	0.0		56.0	12.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.016149	0.35606	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.23950	1.88;1.88	5.95	5.95	0.96441	FMP27, N-terminal (1);	0.372867	0.30401	N	0.009714	T	0.18759	0.0450	N	0.14661	0.345	0.32272	N	0.568716	P	0.35821	0.523	B	0.35727	0.209	T	0.15435	-1.0437	10	0.46703	T	0.11	.	16.4101	0.83708	0.0:0.0:0.0:1.0	.	540	Q14667	K0100_HUMAN	P	540;540;540;397	ENSP00000436773:Q540P;ENSP00000446443:Q397P	ENSP00000005905:Q540P	Q	-	2	0	KIAA0100	23989133	1.000000	0.71417	0.717000	0.30585	0.508000	0.34012	5.345000	0.65987	2.280000	0.76307	0.460000	0.39030	CAA	.	.		0.488	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KCNH4	23415	hgsc.bcm.edu	37	17	40330149	40330149	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:40330149C>A	ENST00000264661.3	-	4	886	c.554G>T	c.(553-555)cGc>cTc	p.R185L	KCNH4_ENST00000607371.1_Missense_Mutation_p.R185L	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	185					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTGGCCCCGGCGGCCAAAGTG	0.592																																					p.R185L	NSCLC(117;707 1703 2300 21308 31858)	Atlas-SNP	.											.	KCNH4	105	.	0			c.G554T						.						72.0	80.0	78.0					17																	40330149		2203	4300	6503	SO:0001583	missense	23415	exon4			CCCCGGCGGCCAA	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.554G>T	chr17.hg19:g.40330149C>A	ENSP00000264661:p.Arg185Leu	112.0	0.0		74.0	27.0	NM_012285		Missense_Mutation	SNP	ENST00000264661.3	hg19	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.002981	0.54254	.	.	ENSG00000089558	ENST00000264661	D	0.98807	-5.15	4.86	4.86	0.63082	.	0.000000	0.41500	D	0.000865	D	0.97663	0.9234	M	0.68593	2.085	0.31562	N	0.657439	B	0.21606	0.058	B	0.23419	0.046	D	0.98342	1.0539	10	0.62326	D	0.03	.	17.1648	0.86812	0.0:1.0:0.0:0.0	.	185	Q9UQ05	KCNH4_HUMAN	L	185	ENSP00000264661:R185L	ENSP00000264661:R185L	R	-	2	0	KCNH4	37583675	0.649000	0.27322	0.999000	0.59377	0.747000	0.42532	1.560000	0.36331	2.520000	0.84964	0.467000	0.42956	CGC	.	.		0.592	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
NPEPPS	9520	hgsc.bcm.edu	37	17	45669377	45669377	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:45669377G>T	ENST00000322157.4	+	11	1553	c.1316G>T	c.(1315-1317)aGc>aTc	p.S439I	NPEPPS_ENST00000544660.1_Missense_Mutation_p.S359I|NPEPPS_ENST00000525037.1_3'UTR|NPEPPS_ENST00000530173.1_Missense_Mutation_p.S435I	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	439					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						ATATCATATAGCAAAGGTGCA	0.393																																					p.S439I		Atlas-SNP	.											.	NPEPPS	59	.	0			c.G1316T						.						149.0	88.0	108.0					17																	45669377		1980	4121	6101	SO:0001583	missense	9520	exon11			CATATAGCAAAGG	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1316G>T	chr17.hg19:g.45669377G>T	ENSP00000320324:p.Ser439Ile	498.0	0.0		548.0	28.0	NM_006310	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	hg19	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121816	0.77436	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660;ENST00000527964;ENST00000527360	T;T;T;T;T	0.03004	4.08;4.08;4.08;4.08;4.08	5.51	5.51	0.81932	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	M	0.84219	2.685	0.80722	D	1	D;D;P	0.55605	0.972;0.966;0.935	D;P;P	0.65233	0.933;0.796;0.733	T	0.00203	-1.1924	10	0.62326	D	0.03	.	19.4176	0.94708	0.0:0.0:1.0:0.0	.	439;435;439	A6NEC2;E9PLK3;P55786	PSAL_HUMAN;.;PSA_HUMAN	I	435;439;426;359;122;136	ENSP00000433287:S435I;ENSP00000320324:S439I;ENSP00000442461:S359I;ENSP00000435639:S122I;ENSP00000435966:S136I	ENSP00000320324:S439I	S	+	2	0	NPEPPS	43024376	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.626000	0.98410	2.596000	0.87737	0.650000	0.86243	AGC	.	.		0.393	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
AATK	9625	hgsc.bcm.edu	37	17	79096446	79096446	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:79096446C>T	ENST00000326724.4	-	11	1314	c.1290G>A	c.(1288-1290)gcG>gcA	p.A430A	MIR657_ENST00000385003.1_RNA|AATK_ENST00000572339.1_5'Flank|AATK_ENST00000417379.1_Silent_p.A327A	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	430					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			Tgggccccgccgcaccgggcc	0.761																																					p.A430A		Atlas-SNP	.											.	AATK	102	.	0			c.G1290A						.						1.0	1.0	1.0					17																	79096446		874	2043	2917	SO:0001819	synonymous_variant	9625	exon11			CCCCGCCGCACCG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1290G>A	chr17.hg19:g.79096446C>T		19.0	0.0		16.0	9.0	NM_001080395	O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	hg19	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	c	0.897	-0.723410	0.03158	.	.	ENSG00000181409	ENST00000417379	.	.	.	2.95	-3.48	0.04739	.	.	.	.	.	T	0.20455	0.0492	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30357	-0.9981	4	.	.	.	.	3.8175	0.08821	0.0:0.2904:0.382:0.3276	.	.	.	.	Q	383	.	.	R	-	2	0	AATK	76711041	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.897000	0.01603	-0.394000	0.07727	-0.461000	0.05368	CGG	.	.		0.761	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
RAB3D	9545	hgsc.bcm.edu	37	19	11446411	11446411	+	Missense_Mutation	SNP	G	G	C	rs200767418	byFrequency	TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:11446411G>C	ENST00000222120.3	-	3	537	c.277C>G	c.(277-279)Cgg>Ggg	p.R93G	RAB3D_ENST00000589655.1_Missense_Mutation_p.R93G	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	93					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						ATGGCTCCCCGGTAGTAGGCC	0.587																																					p.R93G		Atlas-SNP	.											.	RAB3D	24	.	0			c.C277G						.						171.0	151.0	158.0					19																	11446411		2203	4300	6503	SO:0001583	missense	9545	exon3			CTCCCCGGTAGTA	AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.277C>G	chr19.hg19:g.11446411G>C	ENSP00000222120:p.Arg93Gly	109.0	0.0		96.0	12.0	NM_004283		Missense_Mutation	SNP	ENST00000222120.3	hg19	CCDS12257.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474598	0.63737	.	.	ENSG00000105514	ENST00000222120	D	0.82081	-1.57	4.64	3.52	0.40303	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.92848	0.7725	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93809	0.7108	10	0.87932	D	0	.	12.0923	0.53733	0.0:0.0:0.7754:0.2246	.	93	O95716	RAB3D_HUMAN	G	93	ENSP00000222120:R93G	ENSP00000222120:R93G	R	-	1	2	RAB3D	11307411	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	2.071000	0.41500	2.584000	0.87258	0.462000	0.41574	CGG	.	.		0.587	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283	
GTPBP3	84705	hgsc.bcm.edu	37	19	17452488	17452488	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:17452488C>T	ENST00000324894.8	+	9	1523	c.1455C>T	c.(1453-1455)ttC>ttT	p.F485F	GTPBP3_ENST00000358792.7_Silent_p.F517F|GTPBP3_ENST00000600625.1_Silent_p.F464F|GTPBP3_ENST00000361619.5_Silent_p.F507F|GTPBP3_ENST00000598038.1_3'UTR	NM_032620.3|NM_133644.3	NP_116009.2|NP_598399.2	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial)	485					tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	18						ACATCATCTTCCAGGACTTCT	0.642																																					p.F517F		Atlas-SNP	.											.	GTPBP3	40	.	0			c.C1551T						.						56.0	63.0	60.0					19																	17452488		2202	4300	6502	SO:0001819	synonymous_variant	84705	exon8			CATCTTCCAGGAC	AF360742	CCDS32950.1, CCDS32951.1, CCDS56088.1, CCDS59364.1	19p13.2	2008-02-05				ENSG00000130299			14880	protein-coding gene	gene with protein product		608536				1290633	Standard	NM_001128855		Approved	MSS1, THDF1, GTPBG3, MTGP1, FLJ14700	uc010xpo.2	Q969Y2		ENST00000324894.8:c.1455C>T	chr19.hg19:g.17452488C>T		202.0	0.0		178.0	15.0	NM_133644	A6NFH1|A6NIG5|A6NKR4|A8K7B4|B7Z4V8|Q8TCY6|Q8WUW9|Q969G4|Q9BX61	Silent	SNP	ENST00000324894.8	hg19	CCDS32951.1																																																																																			.	.		0.642	GTPBP3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463624.1	NM_032620	
COMP	1311	hgsc.bcm.edu	37	19	18896509	18896509	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:18896509C>T	ENST00000222271.2	-	14	1686	c.1642G>A	c.(1642-1644)Gac>Aac	p.D548N	COMP_ENST00000425807.1_Missense_Mutation_p.D495N|COMP_ENST00000542601.2_Missense_Mutation_p.D515N	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	548	Mediates cell survival and induction of the IAP family of survival proteins.|TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CAGTTGGGGTCAATCTGCGCG	0.627																																					p.D548N		Atlas-SNP	.											.	COMP	62	.	0			c.G1642A						.						55.0	52.0	53.0					19																	18896509		2203	4300	6503	SO:0001583	missense	1311	exon14			TGGGGTCAATCTG	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1642G>A	chr19.hg19:g.18896509C>T	ENSP00000222271:p.Asp548Asn	72.0	0.0		61.0	23.0	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	ENST00000222271.2	hg19	CCDS12385.1	.	.	.	.	.	.	.	.	.	.	C	36	5.934338	0.97122	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.95622	-3.76;-3.76;-3.76	4.61	4.61	0.57282	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.85682	U	0.000000	D	0.98021	0.9348	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.989;0.999	D	0.99260	1.0890	10	0.87932	D	0	-30.656	15.9659	0.79970	0.0:1.0:0.0:0.0	.	495;548	B4DKJ3;P49747	.;COMP_HUMAN	N	515;548;495;535	ENSP00000439156:D515N;ENSP00000222271:D548N;ENSP00000403792:D495N	ENSP00000222271:D548N	D	-	1	0	COMP	18757509	1.000000	0.71417	0.990000	0.47175	0.977000	0.68977	7.676000	0.84012	2.106000	0.64143	0.491000	0.48974	GAC	.	.		0.627	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
ZFP82	284406	hgsc.bcm.edu	37	19	36884088	36884088	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:36884088T>C	ENST00000392161.3	-	5	1396	c.1154A>G	c.(1153-1155)cAc>cGc	p.H385R	ZFP82_ENST00000392171.1_Missense_Mutation_p.H385R	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATGAATTCTGTGATGGAGAAT	0.383																																					p.H385R		Atlas-SNP	.											.	ZFP82	71	.	0			c.A1154G						.						114.0	113.0	113.0					19																	36884088		2203	4300	6503	SO:0001583	missense	284406	exon5			ATTCTGTGATGGA	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.1154A>G	chr19.hg19:g.36884088T>C	ENSP00000431265:p.His385Arg	120.0	0.0		75.0	23.0	NM_133466	Q8NC63|Q8TF53	Missense_Mutation	SNP	ENST00000392161.3	hg19	CCDS12493.1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.371076	0.24771	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	T;T	0.33865	1.39;1.39	4.53	4.53	0.55603	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43747	D	0.000524	T	0.25082	0.0609	N	0.10782	0.045	0.26717	N	0.970861	B	0.32467	0.372	B	0.42959	0.403	T	0.14868	-1.0457	10	0.52906	T	0.07	.	6.6697	0.23062	0.0:0.1048:0.0:0.8952	.	385	Q8N141	ZFP82_HUMAN	R	385	ENSP00000431265:H385R;ENSP00000446080:H385R	ENSP00000431265:H385R	H	-	2	0	ZFP82	41575928	0.016000	0.18221	1.000000	0.80357	0.993000	0.82548	0.139000	0.16036	1.905000	0.55150	0.482000	0.46254	CAC	.	.		0.383	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	NM_133466	
ZC3H4	23211	hgsc.bcm.edu	37	19	47593287	47593287	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:47593287C>T	ENST00000253048.5	-	5	689	c.652G>A	c.(652-654)Gac>Aac	p.D218N	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	218							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GTGAAGTCGTCATAGTCCTCC	0.577																																					p.D218N		Atlas-SNP	.											.	ZC3H4	96	.	0			c.G652A						.						134.0	137.0	136.0					19																	47593287		2159	4249	6408	SO:0001583	missense	23211	exon5			AGTCGTCATAGTC	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.652G>A	chr19.hg19:g.47593287C>T	ENSP00000253048:p.Asp218Asn	92.0	0.0		81.0	31.0	NM_015168	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	hg19	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.317685	0.60524	.	.	ENSG00000130749	ENST00000253048	T	0.26373	1.74	5.74	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.30198	0.0757	L	0.55481	1.735	0.80722	D	1	P	0.41393	0.748	B	0.41374	0.355	T	0.11991	-1.0565	10	0.87932	D	0	.	15.5167	0.75830	0.0:0.8497:0.1503:0.0	.	218	Q9UPT8	ZC3H4_HUMAN	N	218	ENSP00000253048:D218N	ENSP00000253048:D218N	D	-	1	0	ZC3H4	52285127	1.000000	0.71417	0.932000	0.37286	0.349000	0.29174	7.363000	0.79516	1.409000	0.46915	-0.211000	0.12701	GAC	.	.		0.577	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ADM5	199800	hgsc.bcm.edu	37	19	50193723	50193723	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:50193723C>A	ENST00000420022.3	+	2	1609	c.435C>A	c.(433-435)ttC>ttA	p.F145L	CPT1C_ENST00000354199.5_5'Flank|CPT1C_ENST00000392518.4_5'Flank|CPT1C_ENST00000598293.1_5'Flank|CPT1C_ENST00000405931.2_5'Flank|CTB-33G10.6_ENST00000596472.1_RNA|CPT1C_ENST00000323446.5_5'Flank	NM_001101340.1	NP_001094810.1	C9JUS6	ADM5_HUMAN	adrenomedullin 5 (putative)	145						extracellular region (GO:0005576)											AAACCGTCTTCCCCAGTCCCT	0.577																																					p.F145L		Atlas-SNP	.											.	.	.	.	0			c.C435A						.						32.0	36.0	35.0					19																	50193723		1349	2764	4113	SO:0001583	missense	199800	exon2			CGTCTTCCCCAGT	BC032764	CCDS46146.1	19q13.33	2012-12-07	2012-12-07	2012-10-29	ENSG00000224420	ENSG00000224420			27293	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 76"", ""adrenomedullin 5 homolog (pig)"""	C19orf76		18434369	Standard	NM_001101340		Approved	AM5	uc002pph.2	C9JUS6		ENST00000420022.3:c.435C>A	chr19.hg19:g.50193723C>A	ENSP00000393631:p.Phe145Leu	141.0	0.0		100.0	55.0	NM_001101340		Missense_Mutation	SNP	ENST00000420022.3	hg19	CCDS46146.1	.	.	.	.	.	.	.	.	.	.	C	8.587	0.883609	0.17467	.	.	ENSG00000224420	ENST00000420022	.	.	.	1.84	-2.15	0.07102	.	.	.	.	.	T	0.16257	0.0391	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.20042	-1.0287	8	0.87932	D	0	.	4.8657	0.13607	0.2194:0.3721:0.4085:0.0	.	145	C9JUS6	ADM5_HUMAN	L	145	.	ENSP00000393631:F145L	F	+	3	2	C19orf76	54885535	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.812000	0.04496	-0.435000	0.07264	0.561000	0.74099	TTC	.	.		0.577	ADM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465777.1	NM_001101340	
MYH14	79784	hgsc.bcm.edu	37	19	50753873	50753873	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:50753873C>T	ENST00000596571.1	+	13	1734	c.1734C>T	c.(1732-1734)ggC>ggT	p.G578G	MYH14_ENST00000440075.2_Silent_p.G586G|MYH14_ENST00000598205.1_Silent_p.G586G|MYH14_ENST00000262269.8_Silent_p.G586G|MYH14_ENST00000376970.2_Silent_p.G578G|MYH14_ENST00000601313.1_Silent_p.G586G|MYH14_ENST00000425460.1_Silent_p.G586G			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	578	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		AGCAGGGCGGCCACCCCAAGT	0.662																																					p.G586G		Atlas-SNP	.											.	MYH14	261	.	0			c.C1758T						.						32.0	40.0	37.0					19																	50753873		2169	4266	6435	SO:0001819	synonymous_variant	79784	exon15			GGGCGGCCACCCC	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1734C>T	chr19.hg19:g.50753873C>T		244.0	0.0		191.0	41.0	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	ENST00000596571.1	hg19	CCDS59411.1																																																																																			.	.		0.662	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
ZNF816	125893	hgsc.bcm.edu	37	19	53454379	53454379	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:53454379T>C	ENST00000357666.4	-	5	949	c.649A>G	c.(649-651)Aca>Gca	p.T217A	ZNF816_ENST00000434371.2_Intron|ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000444460.2_Missense_Mutation_p.T217A	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						TGTATTTGTGTGAATGAAGAA	0.373																																					p.T217A		Atlas-SNP	.											.	ZNF816	73	.	0			c.A649G						.						73.0	79.0	77.0					19																	53454379		2203	4300	6503	SO:0001583	missense	125893	exon4			TTTGTGTGAATGA	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.649A>G	chr19.hg19:g.53454379T>C	ENSP00000350295:p.Thr217Ala	87.0	0.0		66.0	13.0	NM_001202457	A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	ENST00000357666.4	hg19	CCDS33096.1	.	.	.	.	.	.	.	.	.	.	-	1.148	-0.647601	0.03506	.	.	ENSG00000180257	ENST00000357666;ENST00000444460	T;T	0.15256	2.44;2.44	0.852	-0.54	0.11861	.	.	.	.	.	T	0.11153	0.0272	N	0.25485	0.75	0.20926	N	0.999829	P	0.48694	0.914	P	0.46825	0.528	T	0.17471	-1.0368	9	0.17369	T	0.5	.	2.7723	0.05338	0.4181:0.0:0.0:0.5819	.	217	Q0VGE8	ZN816_HUMAN	A	217	ENSP00000350295:T217A;ENSP00000403266:T217A	ENSP00000350295:T217A	T	-	1	0	ZNF816	58146191	0.000000	0.05858	0.012000	0.15200	0.166000	0.22503	-0.618000	0.05578	-0.242000	0.09667	0.163000	0.16589	ACA	.	.		0.373	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55610211	55610211	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr19:55610211C>T	ENST00000263433.3	-	6	907	c.892G>A	c.(892-894)Gac>Aac	p.D298N	PPP1R12C_ENST00000435544.2_Missense_Mutation_p.D224N|PPP1R12C_ENST00000376393.2_Missense_Mutation_p.D298N	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TCGGCCAGGTCACAGGGACGC	0.652																																					p.D298N		Atlas-SNP	.											.	PPP1R12C	46	.	0			c.G892A						.						77.0	60.0	65.0					19																	55610211		2203	4300	6503	SO:0001583	missense	54776	exon6			CCAGGTCACAGGG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.892G>A	chr19.hg19:g.55610211C>T	ENSP00000263433:p.Asp298Asn	178.0	0.0		128.0	22.0	NM_017607		Missense_Mutation	SNP	ENST00000263433.3	hg19	CCDS12916.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959503	0.92791	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.57107	0.42;0.42;0.42	5.03	5.03	0.67393	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.72285	0.3441	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.984;0.999;0.999	D;D;D	0.80764	0.96;0.994;0.985	T	0.75725	-0.3217	10	0.72032	D	0.01	.	16.2252	0.82286	0.0:1.0:0.0:0.0	.	224;298;298	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	N	298;298;224	ENSP00000263433:D298N;ENSP00000365573:D298N;ENSP00000387833:D224N	ENSP00000263433:D298N	D	-	1	0	PPP1R12C	60302023	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	6.839000	0.75364	2.506000	0.84524	0.563000	0.77884	GAC	.	.		0.652	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
GGT7	2686	hgsc.bcm.edu	37	20	33460489	33460489	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr20:33460489G>A	ENST00000336431.5	-	1	174	c.130C>T	c.(130-132)Cgc>Tgc	p.R44C	ACSS2_ENST00000336325.4_5'Flank	NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	44					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						TCGTCCTTGCGGCCCCTCAGC	0.711																																					p.R44C		Atlas-SNP	.											.	GGT7	41	.	0			c.C130T						.						6.0	9.0	8.0					20																	33460489		2140	4211	6351	SO:0001583	missense	2686	exon1			CCTTGCGGCCCCT	AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.130C>T	chr20.hg19:g.33460489G>A	ENSP00000338964:p.Arg44Cys	245.0	0.0		231.0	100.0	NM_178026	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	ENST00000336431.5	hg19	CCDS13242.2	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873395	0.72180	.	.	ENSG00000131067	ENST00000336431;ENST00000427420	T;T	0.49720	3.18;0.77	3.35	3.35	0.38373	.	0.469748	0.21700	N	0.070438	T	0.44052	0.1275	L	0.44542	1.39	0.80722	D	1	D;D;D	0.71674	0.998;0.975;0.975	P;B;B	0.47744	0.556;0.432;0.249	T	0.47711	-0.9096	10	0.87932	D	0	-6.0296	9.8145	0.40844	0.0977:0.0:0.9023:0.0	.	44;44;44	Q9UJ14-5;A4FU32;Q9UJ14	.;.;GGT7_HUMAN	C	44	ENSP00000338964:R44C;ENSP00000394993:R44C	ENSP00000338964:R44C	R	-	1	0	GGT7	32924150	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.784000	0.62411	2.202000	0.70862	0.313000	0.20887	CGC	.	.		0.711	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026	
AAR2	25980	hgsc.bcm.edu	37	20	34828015	34828015	+	Missense_Mutation	SNP	G	G	T	rs147662826		TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr20:34828015G>T	ENST00000373932.3	+	2	571	c.225G>T	c.(223-225)atG>atT	p.M75I	AAR2_ENST00000320849.4_Missense_Mutation_p.M75I|AAR2_ENST00000397286.3_Missense_Mutation_p.M75I	NM_015511.3	NP_056326.2	Q9Y312	AAR2_HUMAN	AAR2 splicing factor homolog (S. cerevisiae)	75																	GCCCTCGTATGGGTTTCTTCC	0.602																																					p.M75I		Atlas-SNP	.											.	.	.	.	0			c.G225T						.						69.0	67.0	68.0					20																	34828015		2203	4300	6503	SO:0001583	missense	25980	exon2			TCGTATGGGTTTC		CCDS13273.1	20q11.23	2012-07-20	2012-07-20	2012-07-20	ENSG00000131043	ENSG00000131043			15886	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 4"""	C20orf4			Standard	NM_015511		Approved	bA234K24.2	uc002xfc.3	Q9Y312	OTTHUMG00000032380	ENST00000373932.3:c.225G>T	chr20.hg19:g.34828015G>T	ENSP00000363043:p.Met75Ile	152.0	0.0		128.0	48.0	NM_001271874	E1P5S7|Q9H4F9|Q9P1P3|Q9UFK9	Missense_Mutation	SNP	ENST00000373932.3	hg19	CCDS13273.1	.	.	.	.	.	.	.	.	.	.	G	4.095	0.015638	0.07959	.	.	ENSG00000131043	ENST00000397286;ENST00000320849;ENST00000373932	T;T;T	0.40225	1.04;1.04;1.04	5.03	3.1	0.35709	.	0.222035	0.53938	N	0.000045	T	0.19087	0.0458	N	0.05487	-0.04	0.30156	N	0.802655	B;B	0.17268	0.021;0.004	B;B	0.13407	0.009;0.005	T	0.12319	-1.0552	10	0.22109	T	0.4	.	6.4086	0.21678	0.1634:0.1503:0.6862:0.0	.	75;75	A2A2Q9;Q9Y312	.;CT004_HUMAN	I	75	ENSP00000380455:M75I;ENSP00000313674:M75I;ENSP00000363043:M75I	ENSP00000313674:M75I	M	+	3	0	C20orf4	34291429	0.982000	0.34865	0.994000	0.49952	0.622000	0.37654	0.120000	0.15647	0.834000	0.34852	-0.140000	0.14226	ATG	.	G|1.000;C|0.000		0.602	AAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079001.2	NM_015511	
CDH22	64405	hgsc.bcm.edu	37	20	44806803	44806803	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr20:44806803C>A	ENST00000372262.3	-	10	2097	c.1697G>T	c.(1696-1698)gGc>gTc	p.G566V	CDH22_ENST00000537909.1_Missense_Mutation_p.G566V	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	566	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CCGGTTGAAGCCCACGTGCTG	0.637																																					p.G566V		Atlas-SNP	.											.	CDH22	112	.	0			c.G1697T						.						72.0	55.0	60.0					20																	44806803		2203	4300	6503	SO:0001583	missense	64405	exon11			TTGAAGCCCACGT	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1697G>T	chr20.hg19:g.44806803C>A	ENSP00000361336:p.Gly566Val	94.0	0.0		70.0	28.0	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	hg19	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819249	0.71028	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.58506	0.33;0.33	4.36	4.36	0.52297	Cadherin (4);Cadherin-like (1);	0.128938	0.51477	D	0.000083	T	0.63426	0.2510	M	0.74546	2.27	0.80722	D	1	P	0.49559	0.925	P	0.48524	0.58	T	0.68648	-0.5353	10	0.59425	D	0.04	.	11.6329	0.51187	0.0:0.8198:0.1802:0.0	.	566	Q9UJ99	CAD22_HUMAN	V	566	ENSP00000361336:G566V;ENSP00000437790:G566V	ENSP00000361336:G566V	G	-	2	0	CDH22	44240210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.795000	0.55499	2.263000	0.75096	0.650000	0.86243	GGC	.	.		0.637	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
ZMYND8	23613	hgsc.bcm.edu	37	20	45905296	45905296	+	Silent	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr20:45905296C>T	ENST00000311275.7	-	11	1435	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	ZMYND8_ENST00000540497.1_Silent_p.Q389Q|ZMYND8_ENST00000461685.1_Silent_p.Q414Q|ZMYND8_ENST00000396281.4_Silent_p.Q394Q|ZMYND8_ENST00000446994.2_Silent_p.Q331Q|ZMYND8_ENST00000471951.2_Silent_p.Q414Q|ZMYND8_ENST00000360911.3_Silent_p.Q389Q|ZMYND8_ENST00000262975.4_Silent_p.Q394Q|ZMYND8_ENST00000536340.1_Silent_p.Q421Q|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000372023.3_Silent_p.Q389Q|ZMYND8_ENST00000352431.2_Silent_p.Q414Q|ZMYND8_ENST00000355972.4_Silent_p.Q394Q|ZMYND8_ENST00000458360.2_Silent_p.Q389Q	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	394					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TGACCTTCTCCTGCTTGTCTA	0.557																																					p.Q414Q		Atlas-SNP	.											.	ZMYND8	166	.	0			c.G1242A						.						165.0	145.0	151.0					20																	45905296		2203	4300	6503	SO:0001819	synonymous_variant	23613	exon11			CTTCTCCTGCTTG	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1182G>A	chr20.hg19:g.45905296C>T		161.0	0.0		170.0	44.0	NM_183047	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Silent	SNP	ENST00000311275.7	hg19		.	.	.	.	.	.	.	.	.	.	C	8.519	0.868267	0.17250	.	.	ENSG00000101040	ENST00000467200	.	.	.	5.63	3.36	0.38483	.	.	.	.	.	T	0.59088	0.2168	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56025	-0.8047	4	.	.	.	-22.1805	9.2138	0.37335	0.0:0.7434:0.0:0.2566	.	.	.	.	R	321	.	.	G	-	1	0	ZMYND8	45338703	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.736000	0.26130	1.379000	0.46325	0.655000	0.94253	GGA	.	.		0.557	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047	
KCNJ15	3772	hgsc.bcm.edu	37	21	39671702	39671702	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr21:39671702G>A	ENST00000328656.4	+	4	822	c.519G>A	c.(517-519)aaG>aaA	p.K173K	KCNJ15_ENST00000398930.1_Silent_p.K173K|KCNJ15_ENST00000398938.2_Silent_p.K173K|KCNJ15_ENST00000398932.1_Silent_p.K173K|KCNJ15_ENST00000398934.1_Silent_p.K173K	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	173					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GACCCAAAAAGCGGGCTGAGA	0.507																																					p.M173I		Atlas-SNP	.											.	KCNJ15	43	.	0			c.G519A						.						62.0	60.0	61.0					21																	39671702		2203	4300	6503	SO:0001819	synonymous_variant	3772	exon3			CAAAAAGCGGGCT	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.519G>A	chr21.hg19:g.39671702G>A		54.0	0.0		33.0	20.0	NM_170737	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	hg19	CCDS13656.1																																																																																			.	.		0.507	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
DGCR14	8220	hgsc.bcm.edu	37	22	19126677	19126677	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr22:19126677C>T	ENST00000252137.6	-	6	860	c.817G>A	c.(817-819)Gcc>Acc	p.A273T		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	273					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					CTCACCTGGGCATTGAGGGCG	0.647																																					p.A273T		Atlas-SNP	.											.	DGCR14	43	.	0			c.G817A						.						28.0	28.0	28.0					22																	19126677		2203	4298	6501	SO:0001583	missense	8220	exon6			CCTGGGCATTGAG	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.817G>A	chr22.hg19:g.19126677C>T	ENSP00000252137:p.Ala273Thr	40.0	0.0		29.0	15.0	NM_022719	Q49AH7|Q9BTZ4	Missense_Mutation	SNP	ENST00000252137.6	hg19	CCDS13756.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589071	0.86851	.	.	ENSG00000100056	ENST00000252137	T	0.46063	0.88	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.61924	0.2386	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58853	-0.7563	10	0.30854	T	0.27	-17.3583	17.7639	0.88471	0.0:1.0:0.0:0.0	.	273	Q96DF8	DGC14_HUMAN	T	273	ENSP00000252137:A273T	ENSP00000252137:A273T	A	-	1	0	DGCR14	17506677	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.683000	0.68189	2.284000	0.76573	0.563000	0.77884	GCC	.	.		0.647	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2		
MAGEB6	158809	hgsc.bcm.edu	37	X	26212737	26212737	+	Missense_Mutation	SNP	C	C	G	rs143373947	byFrequency	TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:26212737C>G	ENST00000379034.1	+	2	923	c.774C>G	c.(772-774)agC>agG	p.S258R		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	258	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.S258R(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						TGGATTCCAGCGGCGAGTCCT	0.537																																					p.S258R		Atlas-SNP	.											.	MAGEB6	91	.	1	Substitution - Missense(1)	lung(1)	c.C774G						.						76.0	64.0	68.0					X																	26212737		2202	4300	6502	SO:0001583	missense	158809	exon2			TTCCAGCGGCGAG	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.774C>G	chrX.hg19:g.26212737C>G	ENSP00000368320:p.Ser258Arg	152.0	0.0		58.0	29.0	NM_173523	Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	hg19	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	C	1.741	-0.491709	0.04322	.	.	ENSG00000176746	ENST00000379034	T	0.04360	3.64	3.1	-5.37	0.02681	.	0.334596	0.28760	U	0.014226	T	0.03263	0.0095	N	0.20881	0.62	0.09310	N	1	P	0.39181	0.663	B	0.43018	0.405	T	0.21381	-1.0247	10	0.40728	T	0.16	.	6.1106	0.20097	0.1447:0.1932:0.0:0.6621	.	258	Q8N7X4	MAGB6_HUMAN	R	258	ENSP00000368320:S258R	ENSP00000368320:S258R	S	+	3	2	MAGEB6	26122658	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.360000	0.01084	-1.784000	0.01272	-1.119000	0.02030	AGC	.	C|0.997;T|0.003		0.537	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523	
WNK3	65267	hgsc.bcm.edu	37	X	54275438	54275438	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:54275438C>A	ENST00000375159.2	-	16	3342	c.3343G>T	c.(3343-3345)Gaa>Taa	p.E1115*	WNK3_ENST00000354646.2_Nonsense_Mutation_p.E1115*|WNK3_ENST00000375169.3_Nonsense_Mutation_p.E1115*			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1115					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CTTAATTTTTCATCCAGAGTT	0.438																																					p.E1115X		Atlas-SNP	.											.	WNK3	218	.	0			c.G3343T						.						102.0	99.0	100.0					X																	54275438		2203	4300	6503	SO:0001587	stop_gained	65267	exon17			ATTTTTCATCCAG	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3343G>T	chrX.hg19:g.54275438C>A	ENSP00000364301:p.Glu1115*	161.0	0.0		109.0	25.0	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Nonsense_Mutation	SNP	ENST00000375159.2	hg19	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	C	42	9.367798	0.99150	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	.	.	.	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-16.631	16.4428	0.83907	0.0:1.0:0.0:0.0	.	.	.	.	X	1115	.	ENSP00000346667:E1115X	E	-	1	0	WNK3	54292163	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.367000	0.66127	2.138000	0.66242	0.544000	0.68410	GAA	.	.		0.438	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
FGD1	2245	hgsc.bcm.edu	37	X	54475585	54475585	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:54475585G>A	ENST00000375135.3	-	15	2998	c.2265C>T	c.(2263-2265)gcC>gcT	p.A755A		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	755					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CATGCCCGCAGGCCTTGCAGT	0.622																																					p.A755A		Atlas-SNP	.											.	FGD1	99	.	0			c.C2265T						.						76.0	70.0	72.0					X																	54475585		2203	4300	6503	SO:0001819	synonymous_variant	2245	exon15			CCCGCAGGCCTTG	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2265C>T	chrX.hg19:g.54475585G>A		103.0	0.0		80.0	25.0	NM_004463	Q5H999|Q8N4D9	Silent	SNP	ENST00000375135.3	hg19	CCDS14359.1																																																																																			.	.		0.622	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
DGAT2L6	347516	hgsc.bcm.edu	37	X	69419697	69419697	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:69419697C>A	ENST00000333026.3	+	3	332	c.232C>A	c.(232-234)Cta>Ata	p.L78I		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	78					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						AAACTGGACCCTATGGAAGTA	0.557																																					p.L78I		Atlas-SNP	.											.	DGAT2L6	40	.	0			c.C232A						.						93.0	73.0	80.0					X																	69419697		2203	4300	6503	SO:0001583	missense	347516	exon3			TGGACCCTATGGA	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.232C>A	chrX.hg19:g.69419697C>A	ENSP00000328036:p.Leu78Ile	139.0	0.0		88.0	18.0	NM_198512	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	hg19	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	C	8.678	0.904479	0.17760	.	.	ENSG00000184210	ENST00000333026	T	0.11821	2.74	4.86	0.871	0.19107	.	0.443686	0.20940	N	0.082922	T	0.05456	0.0144	N	0.05608	-0.01	0.29275	N	0.87044	B	0.17465	0.022	B	0.25987	0.065	T	0.44513	-0.9323	10	0.02654	T	1	-12.5692	8.6207	0.33859	0.5688:0.2939:0.1373:0.0	.	78	Q6ZPD8	DG2L6_HUMAN	I	78	ENSP00000328036:L78I	ENSP00000328036:L78I	L	+	1	2	DGAT2L6	69336422	0.930000	0.31532	0.908000	0.35775	0.694000	0.40290	1.451000	0.35145	-0.069000	0.12931	0.600000	0.82982	CTA	.	.		0.557	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
P2RY10	27334	hgsc.bcm.edu	37	X	78216995	78216996	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:78216995_78216996CC>AA	ENST00000171757.2	+	4	1258_1259	c.978_979CC>AA	c.(976-981)tcCCgc>tcAAgc	p.R327S	P2RY10_ENST00000544091.1_Missense_Mutation_p.R327S	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	327						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.S326S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TGACCCGCTCCCGCCTCATGAG	0.426																																					p.S326S|p.R327S		Atlas-SNP	.											.	P2RY10	99	.	1	Substitution - coding silent(1)	lung(1)	c.C978A|c.C979A						.																																			SO:0001583	missense	27334	exon2			CCGCTCCCGCCTC|CGCTCCCGCCTCA	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	Exception_encountered	chrX.hg19:g.78216995_78216996delinsAA	ENSP00000171757:p.Arg327Ser	250.0|251.0	0.0		195.0|196.0	89.0	NM_198333	D3DTE5|Q4VBN7|Q86V16	Silent|Missense_Mutation	SNP	ENST00000171757.2	hg19	CCDS14442.1																																																																																			.	.		0.426	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1		
RNF128	79589	hgsc.bcm.edu	37	X	105970236	105970236	+	Silent	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:105970236G>A	ENST00000255499.2	+	1	343	c.93G>A	c.(91-93)ccG>ccA	p.P31P	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	31					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						CCCTGAGTCCGCAGGCACCCG	0.706																																					p.P31P		Atlas-SNP	.											.	RNF128	74	.	0			c.G93A						.						12.0	11.0	11.0					X																	105970236		2188	4267	6455	SO:0001819	synonymous_variant	79589	exon1			GAGTCCGCAGGCA	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.93G>A	chrX.hg19:g.105970236G>A		277.0	0.0		216.0	58.0	NM_194463	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Silent	SNP	ENST00000255499.2	hg19	CCDS14521.1																																																																																			.	.		0.706	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
MAGEA11	4110	hgsc.bcm.edu	37	X	148798034	148798034	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:148798034C>G	ENST00000355220.5	+	5	990	c.888C>G	c.(886-888)aaC>aaG	p.N296K	MAGEA11_ENST00000333104.4_Missense_Mutation_p.N267K	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	296	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CCTCCCTCAACCTCTCTTATG	0.493																																					p.N296K		Atlas-SNP	.											.	MAGEA11	86	.	0			c.C888G						.						137.0	125.0	129.0					X																	148798034		2203	4300	6503	SO:0001583	missense	4110	exon5			CCTCAACCTCTCT		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.888C>G	chrX.hg19:g.148798034C>G	ENSP00000347358:p.Asn296Lys	332.0	0.0		211.0	40.0	NM_005366	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	hg19	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	4.673	0.125040	0.08931	.	.	ENSG00000185247	ENST00000412632;ENST00000333104;ENST00000355220	T;T;T	0.04275	3.66;3.66;3.66	0.762	0.762	0.18454	.	.	.	.	.	T	0.03520	0.0101	N	0.17082	0.46	0.09310	N	1	B;B	0.19817	0.004;0.039	B;B	0.25759	0.038;0.063	T	0.42799	-0.9430	8	0.51188	T	0.08	.	.	.	.	.	267;296	G5E962;P43364	.;MAGAB_HUMAN	K	267;267;296	ENSP00000391496:N267K;ENSP00000328177:N267K;ENSP00000347358:N296K	ENSP00000328177:N267K	N	+	3	2	MAGEA11	148576371	0.023000	0.18921	0.007000	0.13788	0.003000	0.03518	-0.148000	0.10219	0.635000	0.30488	0.377000	0.23210	AAC	.	.		0.493	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4	NM_005366	
TREX2	11219	hgsc.bcm.edu	37	X	152710779	152710779	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrX:152710779C>G	ENST00000334497.2	-	11	1380	c.239G>C	c.(238-240)cGc>cCc	p.R80P	TREX2_ENST00000330912.2_Missense_Mutation_p.R37P|TREX2_ENST00000393862.2_Missense_Mutation_p.R37P|TREX2_ENST00000414588.1_Missense_Mutation_p.R79P|TREX2_ENST00000370232.1_Missense_Mutation_p.R80P|TREX2_ENST00000370231.2_Missense_Mutation_p.R37P|TREX2_ENST00000338525.2_Missense_Mutation_p.R37P|TREX2_ENST00000402951.1_Missense_Mutation_p.R80P|HAUS7_ENST00000484394.1_5'Flank			Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	80					DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)	nucleus (GO:0005634)	3'-5'-exodeoxyribonuclease activity (GO:0008296)|exodeoxyribonuclease III activity (GO:0008853)|magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)			endometrium(4)|large_intestine(2)|lung(3)|ovary(2)	11	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGGAGGAGCGGTGGACAGC	0.657								Editing and processing nucleases																													p.R37P		Atlas-SNP	.											.	TREX2	36	.	0			c.G110C						.						41.0	42.0	41.0					X																	152710779		2202	4299	6501	SO:0001583	missense	11219	exon2			GAGGAGCGGTGGA	AF151107	CCDS35437.1	Xq28	2012-05-08			ENSG00000183479	ENSG00000183479			12270	protein-coding gene	gene with protein product		300370				10391904	Standard	NM_080701		Approved		uc011myp.2	Q9BQ50	OTTHUMG00000159319	ENST00000334497.2:c.239G>C	chrX.hg19:g.152710779C>G	ENSP00000334993:p.Arg80Pro	323.0	1.0		200.0	93.0	NM_080701	Q45F08|Q9UN77	Missense_Mutation	SNP	ENST00000334497.2	hg19		.	.	.	.	.	.	.	.	.	.	C	14.47	2.545058	0.45280	.	.	ENSG00000183479	ENST00000393862;ENST00000330912;ENST00000338525;ENST00000334497;ENST00000370232;ENST00000402951;ENST00000414588;ENST00000370231	T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.04	4.18	0.49190	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.572588	0.14640	U	0.307244	T	0.38852	0.1056	L	0.45137	1.4	0.32453	N	0.545107	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.48175	-0.9058	10	0.72032	D	0.01	0.6256	5.8999	0.18960	0.1883:0.7104:0.0:0.1013	.	79;80	Q06S70;Q9BQ50	.;TREX2_HUMAN	P	37;37;37;80;80;80;79;37	ENSP00000377442:R37P;ENSP00000333441:R37P;ENSP00000345218:R37P;ENSP00000334993:R80P;ENSP00000359252:R80P;ENSP00000386078:R80P;ENSP00000401692:R79P;ENSP00000359251:R37P	ENSP00000333441:R37P	R	-	2	0	TREX2	152363973	0.994000	0.37717	0.959000	0.39883	0.346000	0.29079	2.519000	0.45546	0.913000	0.36797	0.529000	0.55759	CGC	.	.		0.657	TREX2-001	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000060966.1	NM_080701	
MT-CYB	4519	hgsc.bcm.edu	37	M	14846	14846	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chrM:14846G>A	ENST00000361789.2	+	1	100	c.100G>A	c.(100-102)Ggc>Agc	p.G34S	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	34			G -> S (in mitochondrial myopathy; sporadic). {ECO:0000269|PubMed:10502593}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GATGAAACTTCGGCTCACTCC	0.483																																					p.G34S		Atlas-SNP	.											.	.	.	.	0			c.G100A						.																																			SO:0001583	missense	0	exon1			AACTTCGGCTCAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.100G>A	chrM.hg19:g.14846G>A	ENSP00000354554:p.Gly34Ser	72.0	0.0		118.0	102.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.483	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
GJD2	57369	hgsc.bcm.edu	37	15	35045139	35045139	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr15:35045139delA	ENST00000290374.4	-	2	982	c.506delT	c.(505-507)ttafs	p.L169fs	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	169					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		CTTAACCTCTAAACAATCTGG	0.483																																					p.L169fs		Atlas-Indel,Pindel	.											.	GJD2	49	.	0			c.507delA						.						182.0	188.0	186.0					15																	35045139		2201	4298	6499	SO:0001589	frameshift_variant	57369	exon2			.	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.506delT	chr15.hg19:g.35045139delA	ENSP00000290374:p.Leu169fs	142.0	0.0		84.0	27.0	NM_020660	Q2M241|Q9P2R0	Frame_Shift_Del	DEL	ENST00000290374.4	hg19	CCDS10040.1																																																																																			.	.		0.483	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251875.2		
IKZF3	22806	hgsc.bcm.edu	37	17	37947672	37947681	+	Frame_Shift_Del	DEL	AATGTGTCCT	AATGTGTCCT	-			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	AATGTGTCCT	AATGTGTCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr17:37947672_37947681delAATGTGTCCT	ENST00000346872.3	-	5	641_650	c.580_589delAGGACACATT	c.(580-591)aggacacattctfs	p.RTHS194fs	IKZF3_ENST00000377944.3_Intron|IKZF3_ENST00000467757.1_Intron|IKZF3_ENST00000350532.3_Frame_Shift_Del_p.RTHS194fs|IKZF3_ENST00000351680.3_Frame_Shift_Del_p.RTHS194fs|IKZF3_ENST00000346243.3_Frame_Shift_Del_p.RTHS194fs|IKZF3_ENST00000377945.3_Intron|IKZF3_ENST00000377958.2_Frame_Shift_Del_p.RTHS107fs|IKZF3_ENST00000535189.1_Frame_Shift_Del_p.RTHS160fs|IKZF3_ENST00000377952.2_Intron|IKZF3_ENST00000439016.2_Intron|IKZF3_ENST00000394189.2_Intron|IKZF3_ENST00000439167.2_Frame_Shift_Del_p.RTHS160fs	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	194					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CACTTACCAGAATGTGTCCTAAGATGCCCC	0.462																																					p.194_197del		Atlas-Indel,Pindel	.											.	IKZF3	79	.	0			c.581_590del						.																																			SO:0001589	frameshift_variant	22806	exon5			.	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.580_589delAGGACACATT	chr17.hg19:g.37947672_37947681delAATGTGTCCT	ENSP00000344544:p.Arg194fs	78.0	0.0		89.0	11.0	NM_183229	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Frame_Shift_Del	DEL	ENST00000346872.3	hg19	CCDS11346.1																																																																																			.	.		0.462	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
ASCC3	10973	hgsc.bcm.edu	37	6	101075734	101075735	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr6:101075734_101075735insAG	ENST00000369162.2	-	28	4848_4849	c.4504_4505insCT	c.(4504-4506)tggfs	p.W1502fs		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1502	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AATATTGAGCCAATCAGCAAGG	0.317																																					p.W1502fs		Atlas-INDEL	.											.	ASCC3	205	.	0			c.4505_4506insCT						.																																			SO:0001589	frameshift_variant	10973	exon28			.	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4504_4505insCT	chr6.hg19:g.101075734_101075735insAG	ENSP00000358159:p.Trp1502fs	74.0	0.0		73.0	11.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Frame_Shift_Ins	INS	ENST00000369162.2	hg19	CCDS5046.1																																																																																			.	.		0.317	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
PRSS42	339906	hgsc.bcm.edu	37	3	46871985	46871986	+	Splice_Site	INS	-	-	A			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:46871985_46871986insA	ENST00000429665.1	-	5	792		c.e5-2		PRSS42_ENST00000447340.1_Splice_Site	NM_182702.1	NP_874361.1	Q7Z5A4	PRS42_HUMAN	protease, serine, 42						germ cell development (GO:0007281)|spermatogenesis (GO:0007283)	anchored component of plasma membrane (GO:0046658)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	8						AGAATCTCCCTAGAGAAAGAGA	0.5																																					.		Atlas-INDEL	.											.	PRSS42	17	.	0			c.793-2->T						.																																			SO:0001630	splice_region_variant	339906	exon6			.		CCDS46816.1	3p21.31	2010-05-07			ENSG00000178055	ENSG00000178055		"""Serine peptidases / Serine peptidases"""	30716	protein-coding gene	gene with protein product	"""testis serine protease 2"""					12838346	Standard	NM_182702		Approved	TESSP2	uc011bap.2	Q7Z5A4	OTTHUMG00000156496	ENST00000429665.1:c.793-2->T	chr3.hg19:g.46871986_46871986dupA		90.0	0.0		70.0	17.0	NM_182702		Splice_Site	INS	ENST00000429665.1	hg19	CCDS46816.1																																																																																			.	.		0.500	PRSS42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344347.1	NM_182702	Intron
SETD2	29072	hgsc.bcm.edu	37	3	47163348	47163348	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr3:47163348delT	ENST00000409792.3	-	3	2820	c.2778delA	c.(2776-2778)aaafs	p.K926fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	926					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTATTGTTTCTTTCCCTGCAT	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.E927fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.2779delG						.						115.0	119.0	117.0					3																	47163348		2203	4300	6503	SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2778delA	chr3.hg19:g.47163348delT	ENSP00000386759:p.Lys926fs	114.0	0.0		102.0	45.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.		0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SCN1A	6323	hgsc.bcm.edu	37	2	166847916	166847917	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr2:166847916_166847917insT	ENST00000303395.4	-	26	5867_5868	c.5868_5869insA	c.(5866-5871)aaagaafs	p.E1957fs	SCN1A_ENST00000409050.1_Frame_Shift_Ins_p.E1929fs|SCN1A_ENST00000423058.2_Frame_Shift_Ins_p.E1957fs|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Frame_Shift_Ins_p.E1946fs			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1957			E -> G (in infantile spasms; dbSNP:rs121918802). {ECO:0000269|PubMed:14504318}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATCATGTCTTCTTTTATAAGAA	0.386																																					p.E1957fs		Atlas-Indel,Pindel	.											.	SCN1A	641	.	0			c.5869_5870insA						.																																			SO:0001589	frameshift_variant	6323	exon28			.	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5869dupA	chr2.hg19:g.166847920_166847920dupT	ENSP00000303540:p.Glu1957fs	107.0	0.0		134.0	17.0	NM_001202435	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Frame_Shift_Ins	INS	ENST00000303395.4	hg19	CCDS54413.1																																																																																			.	.		0.386	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
KIAA2026	158358	hgsc.bcm.edu	37	9	5922128	5922129	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-CC-A8HV-01A-11D-A35Z-10	TCGA-CC-A8HV-10A-01D-A35Z-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0093c24-2b98-43fb-87bc-090fedcba21d	34604e11-7a84-4463-a0db-b90bf2ee82a5	g.chr9:5922128_5922129delCA	ENST00000399933.3	-	8	3866_3867	c.3867_3868delTG	c.(3865-3870)actggafs	p.G1290fs	KIAA2026_ENST00000381461.2_Frame_Shift_Del_p.G1260fs	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1290										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTTACAACTCCAGTGTTCCCAC	0.426																																					p.1290_1290del		Atlas-Indel,Pindel	.											.	KIAA2026	231	.	0			c.3868_3869del						.																																			SO:0001589	frameshift_variant	158358	exon8			.	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3867_3868delTG	chr9.hg19:g.5922128_5922129delCA	ENSP00000382815:p.Gly1290fs	150.0	0.0		173.0	54.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Frame_Shift_Del	DEL	ENST00000399933.3	hg19																																																																																				.	.		0.426	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
