#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCEB3	6924	hgsc.bcm.edu	37	1	24078287	24078287	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:24078287G>A	ENST00000418390.2	+	4	1541	c.1270G>A	c.(1270-1272)Gat>Aat	p.D424N	TCEB3_ENST00000609199.1_Missense_Mutation_p.D398N	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	424					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AGATATGGAGGATGAATTCGA	0.448											OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D424N		Atlas-SNP	.											.	TCEB3	61	.	0			c.G1270A						.						116.0	132.0	127.0					1																	24078287		2203	4300	6503	SO:0001583	missense	6924	exon4			ATGGAGGATGAAT	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1270G>A	chr1.hg19:g.24078287G>A	ENSP00000395574:p.Asp424Asn	173.0	0.0	768	95.0	83.0	NM_003198	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	hg19	CCDS239.2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254306	0.80135	.	.	ENSG00000011007	ENST00000418390	T	0.12879	2.64	5.72	5.72	0.89469	.	0.078764	0.53938	D	0.000052	T	0.30665	0.0772	M	0.61703	1.905	0.80722	D	1	D	0.64830	0.994	P	0.55055	0.767	T	0.00256	-1.1873	10	0.38643	T	0.18	-18.9194	19.8965	0.96963	0.0:0.0:1.0:0.0	.	424	Q14241	ELOA1_HUMAN	N	424	ENSP00000395574:D424N	ENSP00000395574:D424N	D	+	1	0	TCEB3	23950874	1.000000	0.71417	0.975000	0.42487	0.223000	0.24884	7.782000	0.85680	2.717000	0.92951	0.655000	0.94253	GAT	.	.		0.448	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
PDZK1IP1	10158	hgsc.bcm.edu	37	1	47649702	47649702	+	Nonsense_Mutation	SNP	C	C	A	rs559430062		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:47649702C>A	ENST00000294338.2	-	4	408	c.286G>T	c.(286-288)Gag>Tag	p.E96*	PDZK1IP1_ENST00000491793.1_5'UTR|PDZK1IP1_ENST00000371885.1_Nonsense_Mutation_p.E96*	NM_005764.3	NP_005755.1	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1	96						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)	3						TAGGCATTCTCATGCTCACTG	0.567																																					p.E96X		Atlas-SNP	.											.	PDZK1IP1	9	.	0			c.G286T						.						181.0	122.0	142.0					1																	47649702		2202	4298	6500	SO:0001587	stop_gained	10158	exon4			CATTCTCATGCTC	U21049	CCDS546.1	1p33	2008-02-05			ENSG00000162366	ENSG00000162366			16887	protein-coding gene	gene with protein product		607178				9815914, 8701988, 12754212, 12837682	Standard	NM_005764		Approved	DD96, MAP17, SPAP	uc001cqw.3	Q13113	OTTHUMG00000007852	ENST00000294338.2:c.286G>T	chr1.hg19:g.47649702C>A	ENSP00000294338:p.Glu96*	61.0	0.0		65.0	24.0	NM_005764	Q6ICT9|Q96EI1	Nonsense_Mutation	SNP	ENST00000294338.2	hg19	CCDS546.1	.	.	.	.	.	.	.	.	.	.	c	20.1	3.939024	0.73557	.	.	ENSG00000162366	ENST00000294338;ENST00000371885	.	.	.	4.64	-1.28	0.09318	.	1.101510	0.07068	N	0.834946	.	.	.	.	.	.	0.51482	D	0.999928	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-0.9702	5.1918	0.15214	0.0:0.4866:0.161:0.3523	.	.	.	.	X	96	.	ENSP00000294338:E96X	E	-	1	0	PDZK1IP1	47422289	0.000000	0.05858	0.347000	0.25668	0.963000	0.63663	-0.298000	0.08265	-0.115000	0.11915	0.556000	0.70494	GAG	.	.		0.567	PDZK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021655.1	NM_005764	
DMRTA2	63950	hgsc.bcm.edu	37	1	50885040	50885040	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:50885040G>T	ENST00000404795.3	-	3	1318	c.926C>A	c.(925-927)tCg>tAg	p.S309*	DMRTA2_ENST00000418121.1_Nonsense_Mutation_p.S309*	NM_032110.2	NP_115486.1	Q96SC8	DMTA2_HUMAN	DMRT-like family A2	309	Gly-rich.				cerebral cortex regionalization (GO:0021796)|dopaminergic neuron differentiation (GO:0071542)|neuron fate specification (GO:0048665)|positive regulation of neuroblast proliferation (GO:0002052)|skeletal muscle cell differentiation (GO:0035914)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(4)|pancreas(1)	6						CCGTGGACCCGAGCCTCCGCC	0.706																																					p.S309X	Colon(196;1651 2045 3292 36497 38236)|Esophageal Squamous(2;257 258 11567 27043 43804)	Atlas-SNP	.											.	DMRTA2	17	.	0			c.C926A						.						29.0	32.0	31.0					1																	50885040		1753	3782	5535	SO:0001587	stop_gained	63950	exon3			GGACCCGAGCCTC	AJ301580	CCDS44141.1	1p33	2008-08-04			ENSG00000142700	ENSG00000142700			13908	protein-coding gene	gene with protein product		614804				11863363	Standard	NM_032110		Approved		uc010onb.2	Q96SC8	OTTHUMG00000007884	ENST00000404795.3:c.926C>A	chr1.hg19:g.50885040G>T	ENSP00000383909:p.Ser309*	18.0	0.0		32.0	13.0	NM_032110	Q5TFQ3	Nonsense_Mutation	SNP	ENST00000404795.3	hg19	CCDS44141.1	.	.	.	.	.	.	.	.	.	.	G	37	6.116258	0.97296	.	.	ENSG00000142700	ENST00000404795;ENST00000418121	.	.	.	3.8	3.8	0.43715	.	0.678034	0.14119	N	0.340156	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.3709	14.946	0.71032	0.0:0.0:1.0:0.0	.	.	.	.	X	309	.	ENSP00000383909:S309X	S	-	2	0	DMRTA2	50657627	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.607000	0.82883	2.107000	0.64212	0.462000	0.41574	TCG	.	.		0.706	DMRTA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351074.1	NM_032110	
DEPDC1	55635	hgsc.bcm.edu	37	1	68947881	68947881	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:68947881T>A	ENST00000456315.2	-	8	1724	c.1610A>T	c.(1609-1611)aAt>aTt	p.N537I	DEPDC1_ENST00000370966.5_Intron|RP4-694A7.2_ENST00000425820.1_RNA	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	537					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		TTGTCCAACATTTGGTTTCAT	0.378																																					p.N537I		Atlas-SNP	.											.	DEPDC1	102	.	0			c.A1610T						.						236.0	215.0	222.0					1																	68947881		1568	3582	5150	SO:0001583	missense	55635	exon8			CCAACATTTGGTT	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.1610A>T	chr1.hg19:g.68947881T>A	ENSP00000412292:p.Asn537Ile	78.0	0.0		145.0	63.0	NM_001114120	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Missense_Mutation	SNP	ENST00000456315.2	hg19	CCDS44159.1	.	.	.	.	.	.	.	.	.	.	T	9.976	1.226690	0.22542	.	.	ENSG00000024526	ENST00000456315	T	0.10382	2.88	5.61	1.79	0.24919	Rho GTPase activation protein (1);	0.424789	0.25823	N	0.028064	T	0.01905	0.0060	N	0.24115	0.695	0.22918	N	0.998567	B	0.20671	0.047	B	0.19148	0.024	T	0.41858	-0.9485	10	0.87932	D	0	-2.4203	2.7912	0.05388	0.1021:0.1329:0.283:0.482	.	537	Q5TB30	DEP1A_HUMAN	I	537	ENSP00000412292:N537I	ENSP00000412292:N537I	N	-	2	0	DEPDC1	68720469	0.022000	0.18835	0.903000	0.35520	0.876000	0.50452	0.349000	0.20055	0.363000	0.24346	0.528000	0.53228	AAT	.	.		0.378	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779	
SOX13	9580	hgsc.bcm.edu	37	1	204095155	204095155	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:204095155G>A	ENST00000367204.1	+	14	1871	c.1762G>A	c.(1762-1764)Gat>Aat	p.D588N		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	588					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			TGAGGGCACAGATGACAGGCA	0.612																																					p.D588N		Atlas-SNP	.											.	SOX13	38	.	0			c.G1762A						.						115.0	135.0	128.0					1																	204095155		2176	4263	6439	SO:0001583	missense	9580	exon14			GGCACAGATGACA		CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1762G>A	chr1.hg19:g.204095155G>A	ENSP00000356172:p.Asp588Asn	135.0	0.0		210.0	68.0	NM_005686	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	hg19	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307400	0.40795	.	.	ENSG00000143842	ENST00000367204	T	0.41400	1.0	4.58	4.58	0.56647	.	0.204892	0.33591	N	0.004743	T	0.34513	0.0900	L	0.40543	1.245	0.35814	D	0.824099	B;B;B	0.20780	0.048;0.048;0.048	B;B;B	0.20767	0.031;0.016;0.031	T	0.32745	-0.9895	10	0.18710	T	0.47	.	15.6929	0.77469	0.0:0.0:1.0:0.0	.	455;455;588	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	N	588	ENSP00000356172:D588N	ENSP00000356172:D588N	D	+	1	0	SOX13	202361778	1.000000	0.71417	0.476000	0.27291	0.520000	0.34377	7.160000	0.77495	2.540000	0.85666	0.561000	0.74099	GAT	.	.		0.612	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204198158	204198158	+	Silent	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:204198158G>A	ENST00000272203.3	-	19	2974	c.2658C>T	c.(2656-2658)ggC>ggT	p.G886G	PLEKHA6_ENST00000414478.1_Silent_p.G906G	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	886										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			AGGCATGCCCGCCAGGCTCCT	0.607																																					p.G886G		Atlas-SNP	.											.	PLEKHA6	115	.	0			c.C2658T						.						57.0	60.0	59.0					1																	204198158		2203	4300	6503	SO:0001819	synonymous_variant	22874	exon19			ATGCCCGCCAGGC	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2658C>T	chr1.hg19:g.204198158G>A		75.0	0.0		128.0	43.0	NM_014935	A7MD51|Q5VTI6	Silent	SNP	ENST00000272203.3	hg19	CCDS1444.1																																																																																			.	.		0.607	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
FMN2	56776	hgsc.bcm.edu	37	1	240256986	240256986	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:240256986C>T	ENST00000319653.9	+	1	1807	c.1577C>T	c.(1576-1578)gCc>gTc	p.A526V		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	526					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCGTCTGGGGCCCCCGCGGCT	0.726																																					p.A526V		Atlas-SNP	.											.	FMN2	451	.	0			c.C1577T						.						3.0	5.0	4.0					1																	240256986		1754	3651	5405	SO:0001583	missense	56776	exon1			CTGGGGCCCCCGC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1577C>T	chr1.hg19:g.240256986C>T	ENSP00000318884:p.Ala526Val	15.0	0.0		40.0	10.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	8.049	0.765619	0.15914	.	.	ENSG00000155816	ENST00000319653	T	0.79554	-1.28	4.14	2.07	0.26955	.	0.615335	0.14123	N	0.339901	T	0.59851	0.2224	N	0.11560	0.145	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.47598	-0.9105	10	0.32370	T	0.25	.	6.2136	0.20644	0.0:0.6034:0.0:0.3966	.	526	Q9NZ56	FMN2_HUMAN	V	526	ENSP00000318884:A526V	ENSP00000318884:A526V	A	+	2	0	FMN2	238323609	0.725000	0.28048	0.134000	0.22075	0.456000	0.32438	1.163000	0.31798	0.942000	0.37525	0.563000	0.77884	GCC	.	.		0.726	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
BIRC6	57448	hgsc.bcm.edu	37	2	32724628	32724628	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr2:32724628C>T	ENST00000421745.2	+	46	8617	c.8483C>T	c.(8482-8484)aCa>aTa	p.T2828I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2828					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCTTTCCAGACAGGCCAAGGA	0.418																																					p.T2828I	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.C8483T						.						44.0	40.0	41.0					2																	32724628		2203	4300	6503	SO:0001583	missense	57448	exon46			TCCAGACAGGCCA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8483C>T	chr2.hg19:g.32724628C>T	ENSP00000393596:p.Thr2828Ile	42.0	0.0		67.0	31.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220619	0.58560	.	.	ENSG00000115760	ENST00000421745	T	0.74315	-0.83	4.99	4.99	0.66335	.	0.063541	0.64402	D	0.000005	T	0.61085	0.2319	N	0.14661	0.345	0.58432	D	0.999996	P	0.44578	0.838	B	0.38803	0.282	T	0.68777	-0.5319	10	0.56958	D	0.05	.	18.6543	0.91445	0.0:1.0:0.0:0.0	.	2828	Q9NR09	BIRC6_HUMAN	I	2828	ENSP00000393596:T2828I	ENSP00000393596:T2828I	T	+	2	0	BIRC6	32578132	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.055000	0.71103	2.465000	0.83290	0.563000	0.77884	ACA	.	.		0.418	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
CYTIP	9595	hgsc.bcm.edu	37	2	158300471	158300471	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr2:158300471C>T	ENST00000264192.3	-	1	183	c.62G>A	c.(61-63)gGg>gAg	p.G21E	AC019201.1_ENST00000401235.1_RNA|CYTIP_ENST00000540637.1_Intron|CYTIP_ENST00000497432.1_Intron	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	21					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						ATACGCTGGCCCAGCGCAGAA	0.507																																					p.G21E		Atlas-SNP	.											.	CYTIP	45	.	0			c.G62A						.						163.0	150.0	154.0					2																	158300471		2203	4300	6503	SO:0001583	missense	9595	exon1			GCTGGCCCAGCGC	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.62G>A	chr2.hg19:g.158300471C>T	ENSP00000264192:p.Gly21Glu	69.0	0.0		74.0	35.0	NM_004288	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	hg19	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	C	7.768	0.706801	0.15239	.	.	ENSG00000115165	ENST00000264192	T	0.17370	2.28	5.72	3.9	0.45041	.	0.209202	0.39615	N	0.001318	T	0.11707	0.0285	L	0.27053	0.805	0.26543	N	0.974059	P	0.45986	0.87	B	0.41571	0.36	T	0.09796	-1.0658	10	0.52906	T	0.07	-2.5154	6.7546	0.23505	0.1755:0.7338:0.0:0.0907	.	21	O60759	CYTIP_HUMAN	E	21	ENSP00000264192:G21E	ENSP00000264192:G21E	G	-	2	0	CYTIP	158008717	0.041000	0.20044	0.004000	0.12327	0.005000	0.04900	2.954000	0.49113	0.735000	0.32537	0.655000	0.94253	GGG	.	.		0.507	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288	
RBM45	129831	hgsc.bcm.edu	37	2	178985043	178985043	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr2:178985043A>T	ENST00000286070.5	+	4	672	c.580A>T	c.(580-582)Aat>Tat	p.N194Y		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	194	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TGAACCTAAAAATAAAGCATC	0.333																																					p.N194Y		Atlas-SNP	.											.	RBM45	49	.	0			c.A580T						.						68.0	72.0	71.0					2																	178985043		2203	4300	6503	SO:0001583	missense	129831	exon4			CCTAAAAATAAAG	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.580A>T	chr2.hg19:g.178985043A>T	ENSP00000286070:p.Asn194Tyr	133.0	0.0		177.0	64.0	NM_152945	Q6NYL0|Q8NFC9	Missense_Mutation	SNP	ENST00000286070.5	hg19	CCDS33335.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575069	0.86542	.	.	ENSG00000155636	ENST00000286070	T	0.05786	3.39	6.16	6.16	0.99307	.	0.088341	0.85682	D	0.000000	T	0.16257	0.0391	L	0.39245	1.2	0.80722	D	1	D	0.65815	0.995	P	0.61201	0.885	T	0.00303	-1.1833	10	0.51188	T	0.08	-26.1567	15.9872	0.80168	1.0:0.0:0.0:0.0	.	194	Q8IUH3-3	.	Y	194	ENSP00000286070:N194Y	ENSP00000286070:N194Y	N	+	1	0	RBM45	178693289	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.028000	0.70889	2.367000	0.80283	0.528000	0.53228	AAT	.	.		0.333	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945	
TTN	7273	hgsc.bcm.edu	37	2	179451970	179451970	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr2:179451970G>A	ENST00000591111.1	-	257	59269	c.59045C>T	c.(59044-59046)aCa>aTa	p.T19682I	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T18755I|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T21323I|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T12450I|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T12383I|TTN_ENST00000460472.2_Missense_Mutation_p.T12258I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19682	Fibronectin type-III 42. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGGAAGCTTGTTTTCTTAAC	0.473																																					p.T21323I		Atlas-SNP	.											.	TTN	18412	.	0			c.C63968T						.						136.0	135.0	135.0					2																	179451970		1927	4137	6064	SO:0001583	missense	7273	exon307			AAGCTTGTTTTCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59045C>T	chr2.hg19:g.179451970G>A	ENSP00000465570:p.Thr19682Ile	111.0	0.0		134.0	64.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	21.2	4.120260	0.77323	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.98	5.11	0.69529	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68274	0.2983	M	0.81614	2.55	0.53005	D	0.999967	D;D;D;D	0.60160	0.987;0.987;0.987;0.987	P;P;P;P	0.54889	0.763;0.763;0.763;0.763	T	0.74717	-0.3571	9	0.87932	D	0	.	15.2241	0.73336	0.067:0.0:0.933:0.0	.	12258;12383;12450;19682	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	18755;12258;12450;12383;12256	ENSP00000343764:T18755I;ENSP00000434586:T12258I;ENSP00000340554:T12450I;ENSP00000352154:T12383I	ENSP00000340554:T12450I	T	-	2	0	TTN	179160216	1.000000	0.71417	0.986000	0.45419	0.873000	0.50193	6.633000	0.74286	1.536000	0.49237	0.650000	0.86243	ACA	.	.		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ADAM23	8745	hgsc.bcm.edu	37	2	207437863	207437863	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr2:207437863C>T	ENST00000264377.3	+	18	2009	c.1681C>T	c.(1681-1683)Cgg>Tgg	p.R561W	ADAM23_ENST00000374416.1_Missense_Mutation_p.R561W|ADAM23_ENST00000374415.3_Missense_Mutation_p.R561W	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	561	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		GTATGAATGCCGGGATGCTGT	0.373																																					p.R561W	Melanoma(194;1127 2130 19620 24042 27855)	Atlas-SNP	.											.	ADAM23	239	.	0			c.C1681T						.						243.0	219.0	227.0					2																	207437863		2203	4300	6503	SO:0001583	missense	8745	exon18			GAATGCCGGGATG	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1681C>T	chr2.hg19:g.207437863C>T	ENSP00000264377:p.Arg561Trp	94.0	0.0		113.0	46.0	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	hg19	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983609	0.93044	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.19532	2.14;2.14;2.14	5.99	5.99	0.97316	Blood coagulation inhibitor, Disintegrin (5);	0.118923	0.37857	N	0.001915	T	0.64114	0.2569	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75755	-0.3206	10	0.87932	D	0	.	19.3086	0.94175	0.0:1.0:0.0:0.0	.	561	O75077	ADA23_HUMAN	W	561;561;455;561	ENSP00000264377:R561W;ENSP00000363537:R561W;ENSP00000363536:R561W	ENSP00000264377:R561W	R	+	1	2	ADAM23	207146108	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.794000	0.62482	2.857000	0.98124	0.650000	0.86243	CGG	.	.		0.373	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
SETD2	29072	hgsc.bcm.edu	37	3	47129617	47129617	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr3:47129617G>C	ENST00000409792.3	-	10	5305	c.5263C>G	c.(5263-5265)Ctg>Gtg	p.L1755V	snoU13_ENST00000516129.1_RNA	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1755					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATGAGTTCCAGACAGGTAAGT	0.378			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.L1755V		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.C5263G						.						122.0	127.0	125.0					3																	47129617		2203	4300	6503	SO:0001583	missense	29072	exon10			GTTCCAGACAGGT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5263C>G	chr3.hg19:g.47129617G>C	ENSP00000386759:p.Leu1755Val	55.0	0.0		81.0	22.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643554	0.67244	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.95035	-3.59	4.46	4.46	0.54185	.	0.000000	0.46758	D	0.000268	D	0.97155	0.9070	M	0.80183	2.485	0.58432	D	0.999993	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.991	D	0.97599	1.0122	10	0.62326	D	0.03	.	17.6746	0.88227	0.0:0.0:1.0:0.0	.	1755;1755	F2Z317;Q9BYW2	.;SETD2_HUMAN	V	1755	ENSP00000386759:L1755V	ENSP00000386759:L1755V	L	-	1	2	SETD2	47104621	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	6.041000	0.70988	2.464000	0.83262	0.650000	0.86243	CTG	.	.		0.378	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
EOGT	285203	hgsc.bcm.edu	37	3	69028841	69028841	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr3:69028841C>T	ENST00000383701.3	-	16	2054	c.1312G>A	c.(1312-1314)Gac>Aac	p.D438N	EOGT_ENST00000295571.5_Missense_Mutation_p.D354N|EOGT_ENST00000540764.1_Missense_Mutation_p.D337N|EOGT_ENST00000540955.1_Missense_Mutation_p.D162N	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	438					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)										GCAGCCCAGTCTGGAAGGAAA	0.408																																					p.D354N		Atlas-SNP	.											.	.	.	.	0			c.G1060A						.						175.0	164.0	167.0					3																	69028841		2203	4300	6503	SO:0001583	missense	285203	exon13			CCCAGTCTGGAAG	AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.1312G>A	chr3.hg19:g.69028841C>T	ENSP00000373206:p.Asp438Asn	108.0	0.0		110.0	70.0	NM_173654	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Missense_Mutation	SNP	ENST00000383701.3	hg19		.	.	.	.	.	.	.	.	.	.	C	29.6	5.016922	0.93404	.	.	ENSG00000163378	ENST00000383701;ENST00000295571;ENST00000540955;ENST00000540764	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.68496	-0.5393	9	0.17832	T	0.49	.	19.9987	0.97401	0.0:1.0:0.0:0.0	.	438;354	Q5NDL2;Q5NDL2-3	AER61_HUMAN;.	N	438;354;162;337	.	ENSP00000295571:D354N	D	-	1	0	C3orf64	69111531	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.481000	0.81124	2.738000	0.93877	0.591000	0.81541	GAC	.	.		0.408	EOGT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343722.1	NM_173654	
TRMT10C	54931	hgsc.bcm.edu	37	3	101284816	101284816	+	Silent	SNP	A	A	G			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr3:101284816A>G	ENST00000309922.6	+	2	1345	c.1191A>G	c.(1189-1191)agA>agG	p.R397R		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	397					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										TTATCAACAGACTAAAGAAGG	0.368																																					p.R397R		Atlas-SNP	.											.	.	.	.	0			c.A1191G						.						39.0	37.0	38.0					3																	101284816		1807	4089	5896	SO:0001819	synonymous_variant	54931	exon2			CAACAGACTAAAG	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.1191A>G	chr3.hg19:g.101284816A>G		189.0	0.0		170.0	8.0	NM_017819	Q9NRG5|Q9NX54|Q9Y596	Silent	SNP	ENST00000309922.6	hg19	CCDS43122.1																																																																																			.	.		0.368	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
CCDC39	339829	hgsc.bcm.edu	37	3	180334069	180334069	+	Splice_Site	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr3:180334069C>T	ENST00000442201.2	-	19	2788	c.2669G>A	c.(2668-2670)aGg>aAg	p.R890K	TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	890	Ser-rich.				axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTCCGCTTACCTTGCTGATAG	0.453																																					p.R890K		Atlas-SNP	.											.	CCDC39	242	.	0			c.G2669A						.						124.0	112.0	115.0					3																	180334069		1912	4122	6034	SO:0001630	splice_region_variant	339829	exon19			GCTTACCTTGCTG	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2669+1G>A	chr3.hg19:g.180334069C>T		91.0	0.0		91.0	41.0	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	hg19	CCDS46964.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.63|13.63	2.293590|2.293590	0.40594|0.40594	.|.	.|.	ENSG00000145075|ENSG00000145075	ENST00000473854|ENST00000489868;ENST00000442201	.|.	.|.	.|.	4.99|4.99	4.12|4.12	0.48240|0.48240	.|.	.|.	.|.	.|.	.|.	T|T	0.54208|0.54208	0.1844|0.1844	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|B	.|0.15930	.|0.015	.|B	.|0.14023	.|0.01	T|T	0.49163|0.49163	-0.8968|-0.8968	5|7	.|.	.|.	.|.	.|.	12.3535|12.3535	0.55161|0.55161	0.0:0.9171:0.0:0.0829|0.0:0.9171:0.0:0.0829	.|.	.|890	.|Q9UFE4	.|CCD39_HUMAN	S|K	74|62;890	.|.	.|.	G|R	-|-	1|2	0|0	CCDC39|CCDC39	181816763|181816763	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.096000|0.096000	0.18686|0.18686	1.440000|1.440000	0.35024|0.35024	1.245000|1.245000	0.43885|0.43885	0.455000|0.455000	0.32223|0.32223	GGT|AGA;AGG	.	.		0.453	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	Missense_Mutation
GABRG1	2565	hgsc.bcm.edu	37	4	46043146	46043146	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr4:46043146A>C	ENST00000295452.4	-	9	1424	c.1257T>G	c.(1255-1257)ttT>ttG	p.F419L		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	419					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGCAGTCTTCAAAGCAACAGA	0.423																																					p.F419L		Atlas-SNP	.											.	GABRG1	172	.	0			c.T1257G						.						123.0	124.0	124.0					4																	46043146		2203	4300	6503	SO:0001583	missense	2565	exon9			GTCTTCAAAGCAA	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.1257T>G	chr4.hg19:g.46043146A>C	ENSP00000295452:p.Phe419Leu	146.0	0.0		198.0	8.0	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	hg19	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.427180	0.43122	.	.	ENSG00000163285	ENST00000295452	D	0.82526	-1.62	5.49	0.104	0.14531	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.69178	0.3082	L	0.48642	1.525	0.49213	D	0.999761	P	0.38582	0.638	B	0.32677	0.15	T	0.61642	-0.7021	10	0.10636	T	0.68	.	9.1931	0.37211	0.7105:0.0:0.2895:0.0	.	419	Q8N1C3	GBRG1_HUMAN	L	419	ENSP00000295452:F419L	ENSP00000295452:F419L	F	-	3	2	GABRG1	45737903	0.988000	0.35896	0.999000	0.59377	0.998000	0.95712	0.349000	0.20055	0.032000	0.15435	0.477000	0.44152	TTT	.	.		0.423	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
IMPG1	3617	hgsc.bcm.edu	37	6	76712648	76712648	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr6:76712648C>A	ENST00000369950.3	-	12	1467	c.1278G>T	c.(1276-1278)gaG>gaT	p.E426D	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GTAGACCATGCTCTGCTCCGT	0.443																																					p.E426D	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.G1278T						.						129.0	111.0	117.0					6																	76712648		2203	4300	6503	SO:0001583	missense	3617	exon12			ACCATGCTCTGCT	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1278G>T	chr6.hg19:g.76712648C>A	ENSP00000358966:p.Glu426Asp	105.0	0.0		143.0	63.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	hg19	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	C	4.958	0.177989	0.09443	.	.	ENSG00000112706	ENST00000369950	T	0.20200	2.09	5.14	0.391	0.16282	.	1.183520	0.05997	N	0.647093	T	0.01800	0.0057	N	0.08118	0	0.09310	N	1	P	0.38335	0.627	B	0.29598	0.104	T	0.31024	-0.9958	10	0.13108	T	0.6	.	2.3811	0.04354	0.3833:0.2743:0.0:0.3424	.	426	Q17R60	IMPG1_HUMAN	D	426	ENSP00000358966:E426D	ENSP00000358966:E426D	E	-	3	2	IMPG1	76769368	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.043000	0.13971	-0.180000	0.10637	-0.309000	0.09137	GAG	.	.		0.443	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
SASH1	23328	hgsc.bcm.edu	37	6	148846451	148846451	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr6:148846451G>C	ENST00000367467.3	+	11	1709	c.1234G>C	c.(1234-1236)Gac>Cac	p.D412H	AL033378.1_ENST00000411390.2_RNA	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	412					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TGGAGGATTTGACTTGACGAA	0.473																																					p.D412H		Atlas-SNP	.											.	SASH1	123	.	0			c.G1234C						.						225.0	206.0	213.0					6																	148846451		2203	4300	6503	SO:0001583	missense	23328	exon11			GGATTTGACTTGA	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1234G>C	chr6.hg19:g.148846451G>C	ENSP00000356437:p.Asp412His	57.0	0.0		65.0	22.0	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	hg19	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	31	5.065409	0.93898	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.49432	0.78	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.65749	0.2721	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67213	-0.5727	10	0.87932	D	0	-33.0619	20.0442	0.97604	0.0:0.0:1.0:0.0	.	393;412	Q6P4R9;O94885	.;SASH1_HUMAN	H	412;173	ENSP00000356437:D412H	ENSP00000356437:D412H	D	+	1	0	SASH1	148888144	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.420000	0.97426	2.814000	0.96858	0.655000	0.94253	GAC	.	.		0.473	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
ZNF703	80139	hgsc.bcm.edu	37	8	37554679	37554679	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr8:37554679G>A	ENST00000331569.4	+	2	489	c.260G>A	c.(259-261)aGc>aAc	p.S87N		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	87					adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			GCCAAGAAGAGCCCCTTGGCG	0.711																																					p.S87N		Atlas-SNP	.											.	ZNF703	16	.	0			c.G260A						.						14.0	16.0	15.0					8																	37554679		2091	4052	6143	SO:0001583	missense	80139	exon2			AGAAGAGCCCCTT	AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.260G>A	chr8.hg19:g.37554679G>A	ENSP00000332325:p.Ser87Asn	79.0	0.0		32.0	21.0	NM_025069	Q5XG76	Missense_Mutation	SNP	ENST00000331569.4	hg19	CCDS6094.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933487	0.52866	.	.	ENSG00000183779	ENST00000331569;ENST00000397235	T	0.73897	-0.79	3.87	1.95	0.26073	.	0.050532	0.85682	D	0.000000	D	0.83746	0.5321	M	0.77103	2.36	0.54753	D	0.999984	D	0.63046	0.992	D	0.75020	0.985	D	0.83429	0.0037	10	0.87932	D	0	-2.3712	10.8896	0.46988	0.0:0.0:0.6588:0.3412	.	87	Q9H7S9	ZN703_HUMAN	N	87	ENSP00000332325:S87N	ENSP00000332325:S87N	S	+	2	0	ZNF703	37673837	1.000000	0.71417	0.296000	0.24974	0.834000	0.47266	8.833000	0.92089	0.269000	0.21961	0.313000	0.20887	AGC	.	.		0.711	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
UBR5	51366	hgsc.bcm.edu	37	8	103335715	103335715	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr8:103335715C>G	ENST00000520539.1	-	14	2214	c.1608G>C	c.(1606-1608)ttG>ttC	p.L536F	UBR5_ENST00000521922.1_Missense_Mutation_p.L530F|UBR5_ENST00000220959.4_Missense_Mutation_p.L536F	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	536					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GATTATTTCTCAAGCATACCT	0.303																																					p.L536F	Ovarian(131;96 1741 5634 7352 27489)	Atlas-SNP	.											UBR5,NS,carcinoma,0,1	UBR5	285	.	0			c.G1608C						.						55.0	49.0	51.0					8																	103335715		2203	4300	6503	SO:0001583	missense	51366	exon14			ATTTCTCAAGCAT	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.1608G>C	chr8.hg19:g.103335715C>G	ENSP00000429084:p.Leu536Phe	97.0	0.0		136.0	30.0	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	hg19	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.005084	0.54254	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.53206	0.63;0.63;0.63	5.78	2.06	0.26882	.	0.000000	0.64402	D	0.000001	T	0.42743	0.1216	L	0.33485	1.01	0.51012	D	0.999907	D;D	0.54207	0.965;0.965	P;P	0.51016	0.656;0.656	T	0.13683	-1.0500	10	0.40728	T	0.16	.	9.2968	0.37819	0.0:0.2115:0.0:0.7885	.	530;536	E7EMW7;O95071	.;UBR5_HUMAN	F	536;536;530	ENSP00000429084:L536F;ENSP00000220959:L536F;ENSP00000427819:L530F	ENSP00000220959:L536F	L	-	3	2	UBR5	103404891	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	1.588000	0.36633	0.110000	0.17919	-0.469000	0.05056	TTG	.	.		0.303	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
CSMD3	114788	hgsc.bcm.edu	37	8	113697726	113697726	+	Silent	SNP	A	A	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr8:113697726A>T	ENST00000297405.5	-	15	2635	c.2391T>A	c.(2389-2391)ccT>ccA	p.P797P	CSMD3_ENST00000343508.3_Silent_p.P757P|CSMD3_ENST00000352409.3_Silent_p.P797P|CSMD3_ENST00000455883.2_Silent_p.P693P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	797	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAAGATGGGAAGGCACCTCAG	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P797P		Atlas-SNP	.											.	CSMD3	2325	.	0			c.T2391A						.						94.0	93.0	93.0					8																	113697726		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon15			ATGGGAAGGCACC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2391T>A	chr8.hg19:g.113697726A>T		106.0	0.0		112.0	107.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TRPS1	7227	hgsc.bcm.edu	37	8	116426936	116426936	+	Missense_Mutation	SNP	G	G	T	rs78385846		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr8:116426936G>T	ENST00000220888.5	-	6	3320	c.3161C>A	c.(3160-3162)tCc>tAc	p.S1054Y	TRPS1_ENST00000395715.3_Missense_Mutation_p.S1067Y|TRPS1_ENST00000519076.1_Missense_Mutation_p.S808Y|TRPS1_ENST00000520276.1_Missense_Mutation_p.S1058Y			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1054	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTCAGATACGGATGAACTATT	0.438									Langer-Giedion syndrome																												p.S1067Y		Atlas-SNP	.											.	TRPS1	516	.	0			c.C3200A						.						183.0	175.0	177.0					8																	116426936		1894	4111	6005	SO:0001583	missense	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	GATACGGATGAAC	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3161C>A	chr8.hg19:g.116426936G>T	ENSP00000220888:p.Ser1054Tyr	106.0	0.0		141.0	128.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	G	12.30	1.895856	0.33442	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D;D;D;D	0.98649	-5.05;-5.03;-5.0;-5.03	5.72	5.72	0.89469	.	0.130143	0.53938	D	0.000041	D	0.98058	0.9360	N	0.19112	0.55	0.80722	D	1	D;D;D	0.64830	0.994;0.99;0.994	P;P;P	0.62560	0.904;0.804;0.904	D	0.99903	1.1170	10	0.87932	D	0	.	19.865	0.96801	0.0:0.0:1.0:0.0	.	1058;1054;1067	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	Y	1067;1054;808;1058	ENSP00000379065:S1067Y;ENSP00000220888:S1054Y;ENSP00000428910:S808Y;ENSP00000428680:S1058Y	ENSP00000220888:S1054Y	S	-	2	0	TRPS1	116496112	1.000000	0.71417	0.935000	0.37517	0.522000	0.34438	5.456000	0.66665	2.685000	0.91497	0.655000	0.94253	TCC	.	.		0.438	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
SVEP1	79987	hgsc.bcm.edu	37	9	113170455	113170455	+	Silent	SNP	A	A	G			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr9:113170455A>G	ENST00000401783.2	-	38	7761	c.7425T>C	c.(7423-7425)aaT>aaC	p.N2475N	SVEP1_ENST00000374469.1_Silent_p.N2452N|SVEP1_ENST00000297826.5_Silent_p.N401N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2475	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGGTGGTAGTATTTCCCACCA	0.458																																					p.N2475N		Atlas-SNP	.											.	SVEP1	326	.	0			c.T7425C						.						58.0	58.0	58.0					9																	113170455		1918	4134	6052	SO:0001819	synonymous_variant	79987	exon38			GGTAGTATTTCCC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.7425T>C	chr9.hg19:g.113170455A>G		77.0	0.0		67.0	54.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	hg19	CCDS48004.1																																																																																			.	.		0.458	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TNC	3371	hgsc.bcm.edu	37	9	117849523	117849523	+	Missense_Mutation	SNP	C	C	T	rs368041702		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr9:117849523C>T	ENST00000350763.4	-	3	898	c.487G>A	c.(487-489)Ggt>Agt	p.G163S	TNC_ENST00000346706.3_Missense_Mutation_p.G163S|TNC_ENST00000341037.4_Missense_Mutation_p.G163S|TNC_ENST00000535648.1_Missense_Mutation_p.G163S|TNC_ENST00000537320.1_Missense_Mutation_p.G163S|TNC_ENST00000423613.2_Missense_Mutation_p.G163S|TNC_ENST00000542877.1_Missense_Mutation_p.G163S|TNC_ENST00000340094.3_Missense_Mutation_p.G163S|TNC_ENST00000345230.3_Missense_Mutation_p.G163S	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	163					bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTGCCCCGACCGCTACAGAAG	0.557																																					p.G163S		Atlas-SNP	.											.	TNC	282	.	0			c.G487A						.						57.0	55.0	56.0					9																	117849523		2203	4300	6503	SO:0001583	missense	3371	exon3			CCCGACCGCTACA		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.487G>A	chr9.hg19:g.117849523C>T	ENSP00000265131:p.Gly163Ser	132.0	0.0		162.0	75.0	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	hg19	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676073	0.88445	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.43	5.43	0.79202	.	0.098992	0.64402	D	0.000001	T	0.57475	0.2056	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.54309	-0.8313	10	0.40728	T	0.16	.	18.5715	0.91137	0.0:1.0:0.0:0.0	.	163;163	E9PC84;P24821	.;TENA_HUMAN	S	163	ENSP00000344400:G163S;ENSP00000438152:G163S;ENSP00000344555:G163S;ENSP00000345861:G163S;ENSP00000265131:G163S;ENSP00000339553:G163S;ENSP00000411406:G163S;ENSP00000443478:G163S;ENSP00000442242:G163S	ENSP00000344400:G163S	G	-	1	0	TNC	116889344	1.000000	0.71417	0.775000	0.31657	0.871000	0.50021	7.776000	0.85560	2.702000	0.92279	0.467000	0.42956	GGT	.	.		0.557	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
LCN15	389812	hgsc.bcm.edu	37	9	139656673	139656673	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr9:139656673G>T	ENST00000316144.5	-	5	511	c.487C>A	c.(487-489)Ccc>Acc	p.P163T	LCN15_ENST00000482511.1_5'UTR	NM_203347.1	NP_976222.1	Q6UWW0	LCN15_HUMAN	lipocalin 15	163					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)|transporter activity (GO:0005215)			endometrium(1)|lung(1)	2						ATGTCCTTGGGGAGCCCCAGG	0.652																																					p.P163T		Atlas-SNP	.											.	LCN15	11	.	0			c.C487A						.						18.0	19.0	18.0					9																	139656673		2192	4295	6487	SO:0001583	missense	389812	exon5			CCTTGGGGAGCCC		CCDS7006.1	9q34.3	2011-10-24			ENSG00000177984	ENSG00000177984		"""Lipocalins"""	33777	protein-coding gene	gene with protein product							Standard	NM_203347		Approved	UNQ2541, PRO6093	uc004cjd.3	Q6UWW0	OTTHUMG00000020943	ENST00000316144.5:c.487C>A	chr9.hg19:g.139656673G>T	ENSP00000313833:p.Pro163Thr	154.0	0.0		186.0	77.0	NM_203347		Missense_Mutation	SNP	ENST00000316144.5	hg19	CCDS7006.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.417072	0.00188	.	.	ENSG00000177984	ENST00000316144	T	0.08193	3.12	4.0	-3.89	0.04193	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	2.044890	0.02605	N	0.101526	T	0.03783	0.0107	N	0.16098	0.37	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32666	-0.9898	10	0.10111	T	0.7	.	1.1132	0.01708	0.2622:0.1244:0.3835:0.23	.	163	Q6UWW0	LCN15_HUMAN	T	163	ENSP00000313833:P163T	ENSP00000313833:P163T	P	-	1	0	LCN15	138776494	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.421000	0.07053	-0.829000	0.04268	-1.736000	0.00690	CCC	.	.		0.652	LCN15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055114.2	NM_203347	
VTI1A	143187	hgsc.bcm.edu	37	10	114220309	114220309	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr10:114220309G>T	ENST00000393077.2	+	2	237	c.121G>T	c.(121-123)Gtg>Ttg	p.V41L	VTI1A_ENST00000432306.1_Missense_Mutation_p.V41L	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	41					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		GGTTGCAAATGTGGAGAAACA	0.318			T	TCF7L2	colorectal																																p.V41L		Atlas-SNP	.		Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	.	VTI1A	15	.	0			c.G121T						.						92.0	92.0	92.0					10																	114220309		2203	4300	6503	SO:0001583	missense	143187	exon2			GCAAATGTGGAGA	BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.121G>T	chr10.hg19:g.114220309G>T	ENSP00000376792:p.Val41Leu	528.0	1.0		471.0	132.0	NM_145206	A2A307|B4E137|Q5W0D7	Missense_Mutation	SNP	ENST00000393077.2	hg19	CCDS7575.2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227189	0.79576	.	.	ENSG00000151532	ENST00000393077;ENST00000432306	.	.	.	5.11	5.11	0.69529	t-SNARE (1);Vesicle transport v-SNARE, N-terminal (1);	0.062472	0.64402	D	0.000006	T	0.68860	0.3047	M	0.64997	1.995	0.47949	D	0.999558	B;B	0.22414	0.069;0.031	B;B	0.35353	0.159;0.201	T	0.64145	-0.6476	9	0.19147	T	0.46	-41.2954	18.1206	0.89569	0.0:0.0:1.0:0.0	.	41;41	Q5W0D7;Q96AJ9	.;VTI1A_HUMAN	L	41	.	ENSP00000376792:V41L	V	+	1	0	VTI1A	114210299	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.033000	0.76504	2.383000	0.81215	0.655000	0.94253	GTG	.	.		0.318	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050397.2		
VTI1A	143187	hgsc.bcm.edu	37	10	114220314	114220315	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr10:114220314_114220315GA>TT	ENST00000393077.2	+	2	242_243	c.126_127GA>TT	c.(124-129)gaGAaa>gaTTaa	p.42_43EK>D*	VTI1A_ENST00000432306.1_Nonsense_Mutation_p.42_43EK>D*	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	42					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		CAAATGTGGAGAAACAGCTTGA	0.322			T	TCF7L2	colorectal																																p.E42D|p.K43X		Atlas-SNP	.		Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	.	VTI1A	15	.	0			c.G126T|c.A127T						.																																			SO:0001587	stop_gained	143187	exon2			TGTGGAGAAACAG|GTGGAGAAACAGC	BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	Exception_encountered	chr10.hg19:g.114220314_114220315delinsTT	ENSP00000376792:p.E42_K43delinsD*	538.0|536.0	1.0		454.0|451.0	111.0|112.0	NM_145206	A2A307|B4E137|Q5W0D7	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000393077.2	hg19	CCDS7575.2																																																																																			.	.		0.322	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050397.2		
SFXN4	119559	hgsc.bcm.edu	37	10	120916266	120916266	+	Silent	SNP	T	T	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr10:120916266T>A	ENST00000355697.2	-	10	559	c.540A>T	c.(538-540)gtA>gtT	p.V180V	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Silent_p.V171V	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	180					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		ACTGAGGGATTACCTAGAAAA	0.468																																					p.V180V		Atlas-SNP	.											.	SFXN4	24	.	0			c.A540T						.						40.0	36.0	38.0					10																	120916266		2203	4300	6503	SO:0001819	synonymous_variant	119559	exon10			AGGGATTACCTAG		CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.540A>T	chr10.hg19:g.120916266T>A		53.0	0.0		60.0	24.0	NM_213649	Q6WSU4|Q86TD9	Silent	SNP	ENST00000355697.2	hg19	CCDS7610.1																																																																																			.	.		0.468	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3	XM_058406	
OR10A3	26496	hgsc.bcm.edu	37	11	7960486	7960486	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr11:7960486T>A	ENST00000360759.3	-	1	655	c.582A>T	c.(580-582)ttA>ttT	p.L194F		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	194					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L194L(1)		endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGATTTCAAATAAGAAGGTGT	0.413																																					p.L194F		Atlas-SNP	.											OR10A3,NS,carcinoma,0,1	OR10A3	54	.	1	Substitution - coding silent(1)	endometrium(1)	c.A582T						.						91.0	86.0	88.0					11																	7960486		2201	4296	6497	SO:0001583	missense	26496	exon1			TTCAAATAAGAAG	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.582A>T	chr11.hg19:g.7960486T>A	ENSP00000353988:p.Leu194Phe	173.0	0.0		175.0	47.0	NM_001003745	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	hg19	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	T	3.041	-0.197404	0.06259	.	.	ENSG00000170683	ENST00000360759	T	0.00237	8.47	4.81	1.81	0.25067	GPCR, rhodopsin-like superfamily (1);	0.247095	0.20217	U	0.096794	T	0.00144	0.0004	L	0.41356	1.27	0.09310	N	1	B	0.14012	0.009	B	0.21708	0.036	T	0.25572	-1.0128	10	0.33940	T	0.23	.	5.22	0.15364	0.1452:0.6246:0.1419:0.0883	.	194	P58181	O10A3_HUMAN	F	194	ENSP00000353988:L194F	ENSP00000353988:L194F	L	-	3	2	OR10A3	7917062	0.000000	0.05858	0.554000	0.28268	0.168000	0.22595	-2.055000	0.01397	0.285000	0.22329	-1.049000	0.02347	TTA	.	.		0.413	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745	
OR4A16	81327	hgsc.bcm.edu	37	11	55111591	55111591	+	Silent	SNP	T	T	C			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr11:55111591T>C	ENST00000314721.2	+	1	965	c.915T>C	c.(913-915)agT>agC	p.S305S		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						AAAAGTTAAGTATAGTTAGAA	0.323																																					p.S305S		Atlas-SNP	.											.	OR4A16	120	.	0			c.T915C						.						35.0	35.0	35.0					11																	55111591		2201	4295	6496	SO:0001819	synonymous_variant	81327	exon1			GTTAAGTATAGTT	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.915T>C	chr11.hg19:g.55111591T>C		40.0	0.0		24.0	8.0	NM_001005274	Q6IFL3	Silent	SNP	ENST00000314721.2	hg19	CCDS31499.1																																																																																			.	.		0.323	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
C12orf57	113246	hgsc.bcm.edu	37	12	7053299	7053299	+	Silent	SNP	G	G	T	rs144652065		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr12:7053299G>T	ENST00000229281.5	+	1	114	c.15G>T	c.(13-15)tcG>tcT	p.S5S	U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000544681.1_Silent_p.S5S|PTPN6_ENST00000447931.2_5'Flank|RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000542222.1_Intron|PTPN6_ENST00000399448.1_5'Flank|C12orf57_ENST00000540506.2_5'UTR|C12orf57_ENST00000537087.1_Silent_p.S5S	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	5						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						CGTCCGCCTCGACCCAACCGG	0.587											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S5S		Atlas-SNP	.											.	C12orf57	10	.	0			c.G15T						.						90.0	95.0	94.0					12																	7053299		2203	4300	6503	SO:0001819	synonymous_variant	113246	exon1			CGCCTCGACCCAA	U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.15G>T	chr12.hg19:g.7053299G>T		84.0	0.0	638	83.0	4.0	NM_138425	B2R4Q6	Silent	SNP	ENST00000229281.5	hg19	CCDS8571.1																																																																																			.	G|1.000;A|0.000		0.587	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401959.1	NM_138425	
SOX5	6660	hgsc.bcm.edu	37	12	23793762	23793762	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr12:23793762C>T	ENST00000451604.2	-	8	1102	c.1001G>A	c.(1000-1002)gGc>gAc	p.G334D	RP11-437F6.1_ENST00000546118.1_RNA|SOX5_ENST00000309359.1_Missense_Mutation_p.G321D|SOX5_ENST00000545921.1_Missense_Mutation_p.G324D|SOX5_ENST00000381381.2_Missense_Mutation_p.G321D|SOX5_ENST00000541536.1_Missense_Mutation_p.G321D|SOX5_ENST00000537393.1_Missense_Mutation_p.G299D|SOX5_ENST00000546136.1_Missense_Mutation_p.G321D			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	334					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TTGGAGTGGGCCTAAGCCTGG	0.453																																					p.G334D		Atlas-SNP	.											.	SOX5	134	.	0			c.G1001A						.						120.0	117.0	118.0					12																	23793762		2203	4300	6503	SO:0001583	missense	6660	exon8			AGTGGGCCTAAGC	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1001G>A	chr12.hg19:g.23793762C>T	ENSP00000398273:p.Gly334Asp	54.0	0.0		53.0	28.0	NM_006940	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	hg19	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554304	0.45487	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.97256	-4.29;-4.29;-4.28;-4.29;-4.31;-4.28;-4.29	5.81	5.81	0.92471	.	0.164822	0.52532	D	0.000068	D	0.95001	0.8382	L	0.54323	1.7	0.58432	D	0.999998	B;P;P	0.43477	0.438;0.49;0.808	B;B;B	0.39706	0.197;0.125;0.307	D	0.93602	0.6931	10	0.19147	T	0.46	.	15.5471	0.76112	0.0:0.8627:0.1373:0.0	.	299;321;334	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	D	321;321;321;334;286;299;321;324	ENSP00000437487:G321D;ENSP00000308927:G321D;ENSP00000370788:G321D;ENSP00000398273:G334D;ENSP00000439832:G299D;ENSP00000441973:G321D;ENSP00000443520:G324D	ENSP00000308927:G321D	G	-	2	0	SOX5	23685029	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.115000	0.71566	2.736000	0.93811	0.655000	0.94253	GGC	.	.		0.453	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
ITPR2	3709	hgsc.bcm.edu	37	12	26640009	26640009	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr12:26640009C>A	ENST00000381340.3	-	40	5962	c.5546G>T	c.(5545-5547)cGa>cTa	p.R1849L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1849					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	ACCTCTCATTCGTGGACCAGA	0.368																																					p.R1849L		Atlas-SNP	.											.	ITPR2	270	.	0			c.G5546T						.						198.0	181.0	186.0					12																	26640009		1875	4114	5989	SO:0001583	missense	3709	exon40			CTCATTCGTGGAC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5546G>T	chr12.hg19:g.26640009C>A	ENSP00000370744:p.Arg1849Leu	91.0	0.0		102.0	53.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	hg19	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.585441	0.46110	.	.	ENSG00000123104	ENST00000381340	D	0.89415	-2.51	4.94	4.94	0.65067	.	0.628906	0.15732	N	0.247382	D	0.82595	0.5071	L	0.41492	1.28	0.28954	N	0.890259	B	0.19817	0.039	B	0.17433	0.018	T	0.70167	-0.4946	10	0.21540	T	0.41	.	9.711	0.40245	0.0:0.8756:0.0:0.1244	.	1849	Q14571	ITPR2_HUMAN	L	1849	ENSP00000370744:R1849L	ENSP00000370744:R1849L	R	-	2	0	ITPR2	26531276	0.942000	0.31987	0.040000	0.18447	0.994000	0.84299	2.202000	0.42743	2.745000	0.94114	0.650000	0.86243	CGA	.	.		0.368	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
LRIG3	121227	hgsc.bcm.edu	37	12	59266374	59266374	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr12:59266374A>T	ENST00000320743.3	-	19	3626	c.3340T>A	c.(3340-3342)Tct>Act	p.S1114T	LRIG3_ENST00000379141.4_Missense_Mutation_p.S1054T	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	1114					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			AAGTCATAAGACTGAAAATTT	0.338			T	ROS1	NSCLC																																p.S1114T		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.T3340A						.						62.0	70.0	67.0					12																	59266374		2203	4300	6503	SO:0001583	missense	121227	exon19			CATAAGACTGAAA	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.3340T>A	chr12.hg19:g.59266374A>T	ENSP00000326759:p.Ser1114Thr	56.0	0.0		55.0	36.0	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	hg19	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	A	9.814	1.184035	0.21870	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.61859	0.12;0.07	5.79	3.33	0.38152	.	0.216295	0.23635	N	0.046098	T	0.36220	0.0959	N	0.19112	0.55	0.23739	N	0.996972	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.002	T	0.13629	-1.0502	9	.	.	.	.	6.9043	0.24301	0.7928:0.0:0.0735:0.1338	.	1054;1114	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	T	1054;1114	ENSP00000368436:S1054T;ENSP00000326759:S1114T	.	S	-	1	0	LRIG3	57552641	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	3.317000	0.51968	1.032000	0.39892	0.460000	0.39030	TCT	.	.		0.338	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
MYF5	4617	hgsc.bcm.edu	37	12	81112793	81112793	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr12:81112793G>C	ENST00000228644.3	+	3	883	c.731G>C	c.(730-732)gGg>gCg	p.G244A		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	244					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						GCAACTCCAGGGGCTTCTAGT	0.507																																					p.G244A		Atlas-SNP	.											.	MYF5	78	.	0			c.G731C						.						81.0	80.0	80.0					12																	81112793		2203	4300	6503	SO:0001583	missense	4617	exon3			CTCCAGGGGCTTC		CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.731G>C	chr12.hg19:g.81112793G>C	ENSP00000228644:p.Gly244Ala	67.0	0.0		56.0	33.0	NM_005593	Q6ISR9	Missense_Mutation	SNP	ENST00000228644.3	hg19	CCDS9020.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306859	0.23821	.	.	ENSG00000111049	ENST00000228644	D	0.98362	-4.89	6.06	6.06	0.98353	.	0.140827	0.64402	D	0.000012	D	0.94255	0.8155	L	0.38175	1.15	0.38266	D	0.942013	P	0.37525	0.598	B	0.34824	0.19	D	0.92106	0.5692	10	0.06099	T	0.92	-7.413	9.4003	0.38428	0.1507:0.0:0.8493:0.0	.	244	P13349	MYF5_HUMAN	A	244	ENSP00000228644:G244A	ENSP00000228644:G244A	G	+	2	0	MYF5	79636924	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	3.953000	0.56699	2.882000	0.98803	0.655000	0.94253	GGG	.	.		0.507	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	
DNAH10	196385	hgsc.bcm.edu	37	12	124341720	124341720	+	Missense_Mutation	SNP	G	G	A	rs557513283		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr12:124341720G>A	ENST00000409039.3	+	36	6227	c.6202G>A	c.(6202-6204)Gtc>Atc	p.V2068I		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2068					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V2068I(1)|p.V660I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTGCCCTCGCGTCCGCTACCC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		13626	0.0		0.0	False		,,,				2504	0.001				p.V2068I		Atlas-SNP	.											DNAH10_same_name,NS,carcinoma,0,2	DNAH10	888	.	2	Substitution - Missense(2)	breast(2)	c.G6202A						.						135.0	138.0	137.0					12																	124341720		2078	4205	6283	SO:0001583	missense	196385	exon36			CCTCGCGTCCGCT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6202G>A	chr12.hg19:g.124341720G>A	ENSP00000386770:p.Val2068Ile	104.0	0.0		105.0	32.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883920	0.33255	.	.	ENSG00000197653	ENST00000409039	T	0.22134	1.97	5.75	5.75	0.90469	.	0.000000	0.64402	U	0.000007	T	0.33789	0.0875	L	0.50919	1.6	0.80722	D	1	D	0.65815	0.995	P	0.52159	0.691	T	0.00555	-1.1673	10	0.33940	T	0.23	.	19.9522	0.97203	0.0:0.0:1.0:0.0	.	2068	Q8IVF4	DYH10_HUMAN	I	2068	ENSP00000386770:V2068I	ENSP00000386770:V2068I	V	+	1	0	DNAH10	122907673	1.000000	0.71417	0.763000	0.31416	0.165000	0.22458	9.725000	0.98778	2.725000	0.93324	0.655000	0.94253	GTC	.	.		0.532	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
FLT1	2321	hgsc.bcm.edu	37	13	28959141	28959141	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr13:28959141T>A	ENST00000282397.4	-	14	2248	c.1997A>T	c.(1996-1998)aAc>aTc	p.N666I	FLT1_ENST00000541932.1_Missense_Mutation_p.N666I	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	666	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATCACTGAGGTTTCGCAGGAG	0.438																																					p.N666I		Atlas-SNP	.											.	FLT1	393	.	0			c.A1997T						.						206.0	185.0	192.0					13																	28959141		2203	4300	6503	SO:0001583	missense	2321	exon14			CTGAGGTTTCGCA	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1997A>T	chr13.hg19:g.28959141T>A	ENSP00000282397:p.Asn666Ile	119.0	0.0		68.0	59.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	hg19	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419333	0.83559	.	.	ENSG00000102755	ENST00000282397;ENST00000541932	T;T	0.65364	-0.15;2.65	5.59	5.59	0.84812	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.158216	0.53938	D	0.000043	T	0.72070	0.3415	L	0.43646	1.37	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.71414	0.973;0.966	T	0.74774	-0.3551	10	0.72032	D	0.01	.	14.3433	0.66643	0.0:0.0:0.0:1.0	.	666;666	P17948-3;P17948	.;VGFR1_HUMAN	I	666	ENSP00000282397:N666I;ENSP00000437631:N666I	ENSP00000282397:N666I	N	-	2	0	FLT1	27857141	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.956000	0.63645	2.125000	0.65367	0.460000	0.39030	AAC	.	.		0.438	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
OR4N2	390429	hgsc.bcm.edu	37	14	20296476	20296476	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr14:20296476G>A	ENST00000315947.1	+	1	869	c.869G>A	c.(868-870)cGc>cAc	p.R290H	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATACCCTTCGCAACCAGGAA	0.403																																					p.R290H		Atlas-SNP	.											OR4N2,NS,carcinoma,+1,2	OR4N2	125	.	0			c.G869A						.						47.0	50.0	49.0					14																	20296476		2203	4296	6499	SO:0001583	missense	390429	exon1			CCCTTCGCAACCA		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.869G>A	chr14.hg19:g.20296476G>A	ENSP00000319601:p.Arg290His	93.0	1.0		99.0	4.0	NM_001004723	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	hg19	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	7.943	0.743201	0.15642	.	.	ENSG00000176294	ENST00000315947	T	0.41065	1.01	4.57	2.73	0.32206	.	0.000000	0.39909	N	0.001237	T	0.49372	0.1553	M	0.93462	3.42	0.19945	N	0.999941	B	0.32302	0.363	B	0.27715	0.082	T	0.53844	-0.8381	10	0.87932	D	0	-6.4057	8.7854	0.34818	0.1889:0.0:0.8111:0.0	.	290	Q8NGD1	OR4N2_HUMAN	H	290	ENSP00000319601:R290H	ENSP00000319601:R290H	R	+	2	0	OR4N2	19366316	0.173000	0.23056	0.675000	0.29917	0.112000	0.19704	2.979000	0.49313	0.651000	0.30788	0.591000	0.81541	CGC	.	.		0.403	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
C14orf166	51637	hgsc.bcm.edu	37	14	52458049	52458049	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr14:52458049A>G	ENST00000261700.3	+	2	241	c.76A>G	c.(76-78)Aga>Gga	p.R26G	C14orf166_ENST00000556760.1_Missense_Mutation_p.R26G	NM_016039.2	NP_057123.1	Q9Y224	CN166_HUMAN	chromosome 14 open reading frame 166	26					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA transport (GO:0050658)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core binding (GO:0000993)			endometrium(1)|large_intestine(3)|lung(2)	6	Breast(41;0.0639)|all_epithelial(31;0.101)					AACAGAATTTAGAAACTTCAT	0.358																																					p.R26G		Atlas-SNP	.											.	C14orf166	23	.	0			c.A76G						.						62.0	64.0	64.0					14																	52458049		2203	4300	6503	SO:0001583	missense	51637	exon2			GAATTTAGAAACT	AF151857	CCDS9705.1	14q22.1	2014-05-29			ENSG00000087302	ENSG00000087302			23169	protein-coding gene	gene with protein product	"""RLL motif containing 1"""	610858				10810093, 24608264	Standard	NM_016039		Approved	CGI-99, RLLM1, CLE, CLE7, LCRP369	uc010aod.3	Q9Y224	OTTHUMG00000152332	ENST00000261700.3:c.76A>G	chr14.hg19:g.52458049A>G	ENSP00000261700:p.Arg26Gly	277.0	0.0		278.0	166.0	NM_016039		Missense_Mutation	SNP	ENST00000261700.3	hg19	CCDS9705.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.602070	0.66445	.	.	ENSG00000087302	ENST00000261700;ENST00000556760	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.79598	0.4473	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.82273	-0.0539	9	0.62326	D	0.03	0.0063	10.4046	0.44249	0.7024:0.2976:0.0:0.0	.	26	Q9Y224	CN166_HUMAN	G	26	.	ENSP00000261700:R26G	R	+	1	2	C14orf166	51527799	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.541000	0.60670	1.967000	0.57214	0.397000	0.26171	AGA	.	.		0.358	C14orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276887.1	NM_016039	
ZSCAN29	146050	hgsc.bcm.edu	37	15	43661977	43661977	+	Silent	SNP	C	C	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr15:43661977C>A	ENST00000396976.2	-	1	269	c.135G>T	c.(133-135)cgG>cgT	p.R45R	ZSCAN29_ENST00000396972.1_Silent_p.R45R|ZSCAN29_ENST00000563508.1_5'Flank|ZSCAN29_ENST00000568898.1_Silent_p.R44R|ZSCAN29_ENST00000562072.1_Silent_p.R44R|TUBGCP4_ENST00000570081.1_Intron|TUBGCP4_ENST00000564079.1_5'Flank|TUBGCP4_ENST00000260383.7_5'Flank	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	45	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		GCCTTAGCCACCGACAGCAAA	0.562																																					p.R45R		Atlas-SNP	.											ZSCAN29,NS,carcinoma,0,1	ZSCAN29	57	.	0			c.G135T						.						68.0	68.0	68.0					15																	43661977		2201	4299	6500	SO:0001819	synonymous_variant	146050	exon1			TAGCCACCGACAG	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.135G>T	chr15.hg19:g.43661977C>A		66.0	0.0		65.0	21.0	NM_152455	B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	ENST00000396976.2	hg19	CCDS10095.2																																																																																			.	.		0.562	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455	
AXIN1	8312	hgsc.bcm.edu	37	16	360070	360070	+	Splice_Site	SNP	C	C	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr16:360070C>A	ENST00000262320.3	-	4	1391		c.e4-1		AXIN1_ENST00000481769.1_Splice_Site|AXIN1_ENST00000354866.3_Splice_Site	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1						activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GATCCCATCCCTGTCCAGGAG	0.627																																					.		Atlas-SNP	.											.	AXIN1	290	.	0			c.1020-1G>T						.						50.0	34.0	39.0					16																	360070		2201	4300	6501	SO:0001630	splice_region_variant	8312	exon5			CCATCCCTGTCCA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1020-1G>T	chr16.hg19:g.360070C>A		85.0	0.0		56.0	46.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Splice_Site	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150069	0.37923	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9963	0.89185	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AXIN1	300071	1.000000	0.71417	0.995000	0.50966	0.058000	0.15608	7.310000	0.78947	2.257000	0.74773	0.456000	0.33151	.	.	.		0.627	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		Intron
MAP2K3	5606	hgsc.bcm.edu	37	17	21203869	21203869	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr17:21203869G>C	ENST00000342679.4	+	4	427	c.178G>C	c.(178-180)Gag>Cag	p.E60Q	MAP2K3_ENST00000316920.6_Missense_Mutation_p.E31Q|MAP2K3_ENST00000361818.5_Missense_Mutation_p.E31Q	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	60					activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CTTTGAGGTGGAGGCTGATGA	0.577																																					p.E60Q		Atlas-SNP	.											.	MAP2K3	135	.	0			c.G178C						.						56.0	50.0	52.0					17																	21203869		2201	4300	6501	SO:0001583	missense	5606	exon4			GAGGTGGAGGCTG	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.178G>C	chr17.hg19:g.21203869G>C	ENSP00000345083:p.Glu60Gln	117.0	0.0		120.0	31.0	NM_145109	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	hg19	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560567	0.45590	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	T;T;D	0.89050	1.1;1.1;-2.46	5.47	5.47	0.80525	Protein kinase-like domain (1);	0.149655	0.42420	D	0.000711	T	0.79581	0.4470	N	0.25485	0.75	0.43408	D	0.995542	B	0.33413	0.411	B	0.24701	0.055	T	0.76820	-0.2818	10	0.20519	T	0.43	-48.034	12.6439	0.56723	0.0755:0.0:0.9245:0.0	.	60	P46734	MP2K3_HUMAN	Q	60;31;31;31;64	ENSP00000345083:E60Q;ENSP00000355081:E31Q;ENSP00000434068:E31Q	ENSP00000319139:E64Q	E	+	1	0	MAP2K3	21144462	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.909000	0.56363	2.582000	0.87167	0.655000	0.94253	GAG	.	.		0.577	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
PIGS	94005	hgsc.bcm.edu	37	17	26885512	26885512	+	Missense_Mutation	SNP	G	G	A	rs201018217		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr17:26885512G>A	ENST00000308360.7	-	8	1291	c.916C>T	c.(916-918)Cca>Tca	p.P306S	PIGS_ENST00000543734.1_Missense_Mutation_p.P245S|PIGS_ENST00000395346.2_Missense_Mutation_p.P298S|PIGS_ENST00000465444.1_5'Flank	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	306					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					GACTCCACTGGGTTGATGACA	0.557																																					p.P306S		Atlas-SNP	.											.	PIGS	42	.	0			c.C916T						.						58.0	53.0	55.0					17																	26885512		2203	4300	6503	SO:0001583	missense	94005	exon8			CCACTGGGTTGAT		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.916C>T	chr17.hg19:g.26885512G>A	ENSP00000309430:p.Pro306Ser	85.0	0.0		72.0	47.0	NM_033198	Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	hg19	CCDS11235.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793003	0.70452	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.37915	1.17;1.17;1.17	5.64	5.64	0.86602	.	0.097154	0.64402	N	0.000001	T	0.32041	0.0816	N	0.21617	0.685	0.80722	D	1	B;B	0.23854	0.092;0.075	B;B	0.38106	0.265;0.173	T	0.06625	-1.0816	10	0.02654	T	1	-4.9301	19.6862	0.95979	0.0:0.0:1.0:0.0	.	306;298	Q96S52;Q96S52-2	PIGS_HUMAN;.	S	298;306;245	ENSP00000378755:P298S;ENSP00000309430:P306S;ENSP00000438447:P245S	ENSP00000309430:P306S	P	-	1	0	PIGS	23909639	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	9.209000	0.95087	2.657000	0.90304	0.491000	0.48974	CCA	.	G|0.999;C|0.001		0.557	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198	
MEOX1	4222	hgsc.bcm.edu	37	17	41738601	41738601	+	Missense_Mutation	SNP	G	G	A	rs183202008		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr17:41738601G>A	ENST00000318579.4	-	1	721	c.302C>T	c.(301-303)gCc>gTc	p.A101V	MEOX1_ENST00000549132.1_Missense_Mutation_p.P72S|MEOX1_ENST00000329168.3_Missense_Mutation_p.A101V|MEOX1_ENST00000393661.2_5'UTR	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	101					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		CCTGCGCCGGGCGTCTGAGAC	0.667																																					p.A101V		Atlas-SNP	.											.	MEOX1	29	.	0			c.C302T						.						47.0	55.0	53.0					17																	41738601		2203	4300	6503	SO:0001583	missense	4222	exon1			CGCCGGGCGTCTG		CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.302C>T	chr17.hg19:g.41738601G>A	ENSP00000321684:p.Ala101Val	125.0	0.0		89.0	21.0	NM_004527	A8K524|A8MWF9|Q15069	Missense_Mutation	SNP	ENST00000318579.4	hg19	CCDS11466.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.43|12.43	1.936433|1.936433	0.34189|0.34189	.|.	.|.	ENSG00000005102|ENSG00000005102	ENST00000318579;ENST00000329168|ENST00000549132	D;T|.	0.91407|.	-2.84;0.59|.	4.92|4.92	3.94|3.94	0.45596|0.45596	.|.	0.292544|.	0.38663|.	N|.	0.001605|.	T|T	0.59783|0.59783	0.2219|0.2219	L|L	0.53249|0.53249	1.67|1.67	0.33764|0.33764	D|D	0.622209|0.622209	P;P|.	0.42692|.	0.787;0.745|.	P;B|.	0.44359|.	0.447;0.164|.	T|T	0.72959|0.72959	-0.4133|-0.4133	10|6	0.51188|0.87932	T|D	0.08|0	-26.9951|-26.9951	13.1299|13.1299	0.59375|0.59375	0.0:0.3068:0.6932:0.0|0.0:0.3068:0.6932:0.0	.|.	101;101|.	Q15069;P50221|.	.;MEOX1_HUMAN|.	V|S	101|72	ENSP00000321684:A101V;ENSP00000328678:A101V|.	ENSP00000321684:A101V|ENSP00000449049:P72S	A|P	-|-	2|1	0|0	MEOX1|MEOX1	39094127|39094127	0.998000|0.998000	0.40836|0.40836	0.996000|0.996000	0.52242|0.52242	0.392000|0.392000	0.30506|0.30506	3.059000|3.059000	0.49947|0.49947	1.277000|1.277000	0.44412|0.44412	0.655000|0.655000	0.94253|0.94253	GCC|CCC	.	G|0.999;T|0.001		0.667	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409452.1		
PNMAL2	57469	hgsc.bcm.edu	37	19	46997793	46997793	+	Intron	SNP	G	G	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr19:46997793G>A	ENST00000377655.2	-	1	734				AC011484.1_ENST00000377652.3_5'UTR|PNMAL2_ENST00000599531.1_Silent_p.D310D|PNMAL2_ENST00000594749.1_Intron			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TCTCCGAAGTGTCGCTGTCCA	0.577																																					p.D310D		Atlas-SNP	.											.	PNMAL2	44	.	0			c.C930T						.						65.0	70.0	68.0					19																	46997793		2203	4298	6501	SO:0001627	intron_variant	57469	exon1			CGAAGTGTCGCTG	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.734+195C>T	chr19.hg19:g.46997793G>A		88.0	0.0		154.0	14.0	NM_020709	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Silent	SNP	ENST00000377655.2	hg19																																																																																				.	.		0.577	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding		NM_020709	
TTYH1	57348	hgsc.bcm.edu	37	19	54930426	54930426	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr19:54930426C>G	ENST00000376530.3	+	2	354	c.251C>G	c.(250-252)tCg>tGg	p.S84W	TTYH1_ENST00000376531.3_Missense_Mutation_p.S84W|TTYH1_ENST00000391739.3_Missense_Mutation_p.S133W|TTYH1_ENST00000301194.4_Missense_Mutation_p.S84W	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	84					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		AAGATCCCCTCGCCCGGGGGA	0.706																																					p.S84W		Atlas-SNP	.											.	TTYH1	78	.	0			c.C251G						.						24.0	30.0	28.0					19																	54930426		2199	4290	6489	SO:0001583	missense	57348	exon2			TCCCCTCGCCCGG	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.251C>G	chr19.hg19:g.54930426C>G	ENSP00000365713:p.Ser84Trp	36.0	0.0		75.0	64.0	NM_020659	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	hg19	CCDS12893.1	.	.	.	.	.	.	.	.	.	.	C	9.920	1.211808	0.22289	.	.	ENSG00000167614	ENST00000444661;ENST00000423529;ENST00000301194;ENST00000376530;ENST00000445095;ENST00000391739;ENST00000376531	T;T;T;T;T;T	0.48522	0.81;2.82;2.82;1.4;2.11;2.63	3.51	-0.352	0.12598	.	0.547787	0.17616	N	0.167901	T	0.45994	0.1370	N	0.24115	0.695	0.09310	N	1	D;P;D;P	0.71674	0.998;0.941;0.983;0.924	D;P;P;P	0.67382	0.951;0.609;0.609;0.555	T	0.33059	-0.9883	10	0.66056	D	0.02	-11.3325	6.662	0.23018	0.5082:0.3255:0.1664:0.0	.	133;84;84;84	B7Z1H9;Q9H313-2;Q9H313-3;Q9H313	.;.;.;TTYH1_HUMAN	W	56;80;84;84;133;133;84	ENSP00000391282:S80W;ENSP00000301194:S84W;ENSP00000365713:S84W;ENSP00000393592:S133W;ENSP00000375619:S133W;ENSP00000365714:S84W	ENSP00000301194:S84W	S	+	2	0	TTYH1	59622238	0.000000	0.05858	0.006000	0.13384	0.047000	0.14425	0.142000	0.16096	-0.050000	0.13356	0.561000	0.74099	TCG	.	.		0.706	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1		
TIAM1	7074	hgsc.bcm.edu	37	21	32595765	32595765	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr21:32595765A>T	ENST00000286827.3	-	9	2423	c.1952T>A	c.(1951-1953)aTg>aAg	p.M651K	TIAM1_ENST00000541036.1_Missense_Mutation_p.M651K|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	651					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AAGGCGGCCCATGGCCACTTT	0.478																																					p.M651K		Atlas-SNP	.											.	TIAM1	522	.	0			c.T1952A						.						85.0	89.0	88.0					21																	32595765		2203	4300	6503	SO:0001583	missense	7074	exon9			CGGCCCATGGCCA		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1952T>A	chr21.hg19:g.32595765A>T	ENSP00000286827:p.Met651Lys	92.0	0.0		96.0	4.0	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	hg19	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.731586	0.89390	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.47869	0.86;0.83	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.53142	0.1778	L	0.51422	1.61	0.80722	D	1	P;P;D;P	0.58620	0.942;0.905;0.983;0.905	P;B;P;P	0.51615	0.675;0.298;0.628;0.475	T	0.59375	-0.7466	10	0.87932	D	0	.	14.2703	0.66147	1.0:0.0:0.0:0.0	.	651;651;492;651	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	K	651;492;651	ENSP00000286827:M651K;ENSP00000441570:M651K	ENSP00000286827:M651K	M	-	2	0	TIAM1	31517636	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.015000	0.93640	2.020000	0.59435	0.533000	0.62120	ATG	.	.		0.478	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
DGCR14	8220	hgsc.bcm.edu	37	22	19124915	19124915	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr22:19124915C>A	ENST00000252137.6	-	8	999	c.956G>T	c.(955-957)gGg>gTg	p.G319V		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	319					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					CTCAACCTCCCCCCAGGTCAT	0.597																																					p.G319V		Atlas-SNP	.											.	DGCR14	43	.	0			c.G956T						.						200.0	172.0	182.0					22																	19124915		2203	4300	6503	SO:0001583	missense	8220	exon8			ACCTCCCCCCAGG	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.956G>T	chr22.hg19:g.19124915C>A	ENSP00000252137:p.Gly319Val	88.0	0.0		82.0	35.0	NM_022719	Q49AH7|Q9BTZ4	Missense_Mutation	SNP	ENST00000252137.6	hg19	CCDS13756.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172109	0.78452	.	.	ENSG00000100056	ENST00000252137	T	0.59638	0.25	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.80681	0.4669	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85501	0.1191	10	0.87932	D	0	-36.6444	17.2171	0.86947	0.0:1.0:0.0:0.0	.	319	Q96DF8	DGC14_HUMAN	V	319	ENSP00000252137:G319V	ENSP00000252137:G319V	G	-	2	0	DGCR14	17504915	1.000000	0.71417	0.999000	0.59377	0.694000	0.40290	7.000000	0.76290	2.394000	0.81467	0.484000	0.47621	GGG	.	.		0.597	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2		
BRINP3	339479	hgsc.bcm.edu	37	1	190068224	190068228	+	Frame_Shift_Del	DEL	AGAGA	AGAGA	-			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	AGAGA	AGAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr1:190068224_190068228delAGAGA	ENST00000367462.3	-	8	1452_1456	c.1221_1225delTCTCT	c.(1219-1227)tttctctacfs	p.FLY407fs	BRINP3_ENST00000534846.1_Frame_Shift_Del_p.FLY305fs	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	407					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TCATTGCAGTAGAGAAAAGACTGGA	0.478																																					p.408_409del		Atlas-Indel,Pindel	.											.	FAM5C	343	.	0			c.1222_1226del						.																																			SO:0001589	frameshift_variant	339479	exon8			.	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1221_1225delTCTCT	chr1.hg19:g.190068224_190068228delAGAGA	ENSP00000356432:p.Phe407fs	175.0	0.0		298.0	66.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Frame_Shift_Del	DEL	ENST00000367462.3	hg19	CCDS1373.1																																																																																			.	.		0.478	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
REXO1	57455	hgsc.bcm.edu	37	19	1827911	1827912	+	Frame_Shift_Ins	INS	-	-	CTCAT			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr19:1827911_1827912insCTCAT	ENST00000170168.4	-	2	970_971	c.876_877insATGAG	c.(874-879)gaggccfs	p.A293fs	REXO1_ENST00000587524.1_De_novo_Start_OutOfFrame	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	293						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGTGGCGGCCTCATCTTCTG	0.653																																					p.A293fs		Atlas-Indel,Pindel	.											.	REXO1	55	.	0			c.877_878insATGAG						.																																			SO:0001589	frameshift_variant	57455	exon2			.	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.872_876dupATGAG	chr19.hg19:g.1827912_1827916dupCTCAT	ENSP00000170168:p.Ala293fs	63.0	0.0		62.0	46.0	NM_020695	Q9ULT2	Frame_Shift_Ins	INS	ENST00000170168.4	hg19	CCDS32866.1																																																																																			.	.		0.653	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
LPA	4018	hgsc.bcm.edu	37	6	160953610	160953611	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr6:160953610_160953611insA	ENST00000316300.5	-	38	5957_5958	c.5913_5914insT	c.(5911-5916)tataagfs	p.K1972fs	LPA_ENST00000447678.1_Frame_Shift_Ins_p.K1972fs			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4480	Kringle 18. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAAATATACTTATAGTGATTGC	0.426																																					p.K1972_Y1973delinsX		Atlas-Indel,Pindel	.											.	LPA	237	.	0			c.5914_5915insT						.																																			SO:0001589	frameshift_variant	4018	exon39			.	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5914dupT	chr6.hg19:g.160953611_160953611dupA	ENSP00000321334:p.Lys1972fs	32.0	0.0		46.0	18.0	NM_005577	Q5VTD7|Q9UD88	Frame_Shift_Ins	INS	ENST00000316300.5	hg19	CCDS43523.1																																																																																			.	.		0.426	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
BRSK1	84446	hgsc.bcm.edu	37	19	55815479	55815480	+	Splice_Site	INS	-	-	TAA			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr19:55815479_55815480insTAA	ENST00000309383.1	+	13	1624		c.e13+1		BRSK1_ENST00000326848.7_Splice_Site|BRSK1_ENST00000590333.1_Splice_Site|BRSK1_ENST00000588584.1_Splice_Site	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1						axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CAGCCCAAGGGTAAGGCCAGGT	0.49																																					.		Atlas-Indel,Pindel	.											.	BRSK1	192	.	0			c.1347+1->TAA						.																																			SO:0001630	splice_region_variant	84446	exon13			.	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1347+1->TAA	chr19.hg19:g.55815480_55815482dupTAA		53.0	0.0		86.0	17.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Splice_Site	INS	ENST00000309383.1	hg19	CCDS12921.1																																																																																			.	.		0.490	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	Intron
DSPP	1834	hgsc.bcm.edu	37	4	88536956	88536973	+	In_Frame_Del	DEL	AGCAGTGACAGCAGTGAC	AGCAGTGACAGCAGTGAC	-	rs200486992|rs368829445|rs199560438|rs546297122|rs373171676		TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	AGCAGTGACAGCAGTGAC	AGCAGTGACAGCAGTGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr4:88536956_88536973delAGCAGTGACAGCAGTGAC	ENST00000282478.7	+	4	3175_3192	c.3142_3159delAGCAGTGACAGCAGTGAC	c.(3142-3159)agcagtgacagcagtgacdel	p.SSDSSD1048del	DSPP_ENST00000399271.1_In_Frame_Del_p.SSDSSD1048del|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1048	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		cagcagcgatagcagtgacagcagtgacagcagcaata	0.518																																					p.1047_1053del		Pindel	.											.	DSPP	174	.	0			c.3141_3158del						.																																			SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3142_3159delAGCAGTGACAGCAGTGAC	chr4.hg19:g.88536956_88536973delAGCAGTGACAGCAGTGAC	ENSP00000282478:p.Ser1048_Asp1053del	204.0	0.0		172.0	10.0	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.518	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
VTI1A	143187	hgsc.bcm.edu	37	10	114220309	114220315	+	Frame_Shift_Del	DEL	GTGGAGA	GTGGAGA	-			TCGA-CC-A9FU-01A-11D-A36X-10	TCGA-CC-A9FU-10A-01D-A370-10	GTGGAGA	GTGGAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	07019fc1-db55-4a50-806c-4e370020cf28	b19b1b61-ed1e-48d0-a04b-759095dacf7c	g.chr10:114220309_114220315delGTGGAGA	ENST00000393077.2	+	2	237_243	c.121_127delGTGGAGA	c.(121-129)gtggagaaafs	p.VEK41fs	VTI1A_ENST00000432306.1_Frame_Shift_Del_p.VEK41fs	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	41					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		GGTTGCAAATGTGGAGAAACAGCTTGA	0.314			T	TCF7L2	colorectal																																p.40_42del		Pindel	.		Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	.	VTI1A	15	.	0			c.120_126del						.																																			SO:0001589	frameshift_variant	143187	exon2			.	BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.121_127delGTGGAGA	chr10.hg19:g.114220309_114220315delGTGGAGA	ENSP00000376792:p.Val41fs	533.0	0.0		480.0	87.0	NM_145206	A2A307|B4E137|Q5W0D7	Frame_Shift_Del	DEL	ENST00000393077.2	hg19	CCDS7575.2																																																																																			.	.		0.314	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050397.2		
