#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu	37	1	19490752	19490752	+	Silent	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:19490752G>A	ENST00000375254.3	-	33	4722	c.4695C>T	c.(4693-4695)agC>agT	p.S1565S	UBR4_ENST00000375226.2_Silent_p.S1565S|UBR4_ENST00000375267.2_Silent_p.S1565S|UBR4_ENST00000375217.2_Silent_p.S1565S	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1565					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTTACCATCTGCTCAGCCAAT	0.443																																					p.S1565S		Atlas-SNP	.											.	UBR4	415	.	0			c.C4695T						.						71.0	60.0	64.0					1																	19490752		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon33			CCATCTGCTCAGC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4695C>T	chr1.hg19:g.19490752G>A		295.0	0.0		204.0	137.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	hg19	CCDS189.1																																																																																			.	.		0.443	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
PITHD1	57095	hgsc.bcm.edu	37	1	24113847	24113847	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:24113847A>T	ENST00000246151.4	+	6	728	c.617A>T	c.(616-618)cAg>cTg	p.Q206L	PITHD1_ENST00000374524.1_Missense_Mutation_p.Q93L	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	206						nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						GTTACCCCACAGACACACTTT	0.527																																					p.Q206L		Atlas-SNP	.											.	PITHD1	20	.	0			c.A617T						.						89.0	81.0	83.0					1																	24113847		2203	4300	6503	SO:0001583	missense	57095	exon6			CCCCACAGACACA		CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.617A>T	chr1.hg19:g.24113847A>T	ENSP00000246151:p.Gln206Leu	81.0	0.0		53.0	36.0	NM_020362	B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Missense_Mutation	SNP	ENST00000246151.4	hg19	CCDS240.1	.	.	.	.	.	.	.	.	.	.	A	17.91	3.504636	0.64410	.	.	ENSG00000057757	ENST00000246151;ENST00000374524	.	.	.	5.75	5.75	0.90469	.	0.231700	0.46145	D	0.000304	T	0.52885	0.1762	L	0.32530	0.975	0.80722	D	1	B	0.20887	0.049	B	0.19666	0.026	T	0.46871	-0.9160	9	0.30078	T	0.28	-8.957	16.0591	0.80826	1.0:0.0:0.0:0.0	.	206	Q9GZP4	PITH1_HUMAN	L	206;93	.	ENSP00000246151:Q206L	Q	+	2	0	PITHD1	23986434	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.126000	0.94411	2.185000	0.69588	0.533000	0.62120	CAG	.	.		0.527	PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008243.1	NM_020362	
RLF	6018	hgsc.bcm.edu	37	1	40701785	40701785	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:40701785G>T	ENST00000372771.4	+	8	1438	c.1411G>T	c.(1411-1413)Gac>Tac	p.D471Y		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	471					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TGAGTTTTGGGACTGGAAAAC	0.393																																					p.D471Y		Atlas-SNP	.											.	RLF	152	.	0			c.G1411T						.						67.0	73.0	71.0					1																	40701785		2203	4300	6503	SO:0001583	missense	6018	exon8			TTTTGGGACTGGA		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.1411G>T	chr1.hg19:g.40701785G>T	ENSP00000361857:p.Asp471Tyr	109.0	0.0		81.0	56.0	NM_012421	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	hg19	CCDS448.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.545078	0.65198	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.39056	1.1	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68054	0.2959	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67620	-0.5624	10	0.66056	D	0.02	-14.5446	20.6593	0.99626	0.0:0.0:1.0:0.0	.	164;471	F5H2M5;Q13129	.;RLF_HUMAN	Y	471;164	ENSP00000361857:D471Y	ENSP00000361857:D471Y	D	+	1	0	RLF	40474372	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GAC	.	.		0.393	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
HYI	81888	hgsc.bcm.edu	37	1	43916134	43916134	+	IGR	SNP	T	T	G	rs75906384		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:43916134T>G	ENST00000372425.4	-	0	1115				SZT2_ENST00000562955.1_Missense_Mutation_p.W3371G|SZT2-AS1_ENST00000396885.2_RNA|SZT2_ENST00000372442.1_Missense_Mutation_p.W2529G			Q5T013	HYI_HUMAN	hydroxypyruvate isomerase (putative)								hydroxypyruvate isomerase activity (GO:0008903)			large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	6	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTTCACCCTCTGGACCCGCCT	0.597																																					p.W3371G		Atlas-SNP	.											.	SZT2	383	.	0			c.T10111G						.						141.0	137.0	138.0					1																	43916134		2203	4300	6503	SO:0001628	intergenic_variant	23334	exon71			ACCCTCTGGACCC		CCDS488.1, CCDS488.2, CCDS53309.1, CCDS72771.1	1p34.2	2010-06-24	2010-06-24		ENSG00000178922	ENSG00000178922	5.3.1.22		26948	protein-coding gene	gene with protein product			"""hydroxypyruvate isomerase homolog (E. coli)"""			10561547	Standard	NM_031207		Approved	HT036	uc001cjo.3	Q5T013	OTTHUMG00000007502		chr1.hg19:g.43916134T>G		114.0	0.0		65.0	39.0	NM_015284	D3DPX4|D3DPX5|Q5Q9A2|Q7Z778|Q96S83|Q9BZR3|Q9BZR4	Missense_Mutation	SNP	ENST00000372425.4	hg19	CCDS53309.1	.	.	.	.	.	.	.	.	.	.	T	18.36	3.607180	0.66558	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.76154	0.3948	L	0.54323	1.7	0.39212	D	0.963345	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.79572	-0.1748	9	0.87932	D	0	.	16.3817	0.83467	0.0:0.0:0.0:1.0	.	3428;3371	Q5T011;Q5T011-5	SZT2_HUMAN;.	G	2529	.	ENSP00000361519:W2529G	W	+	1	0	SZT2	43688721	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.556000	0.82233	2.276000	0.75962	0.454000	0.30748	TGG	.	.		0.597	HYI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031207	
COL24A1	255631	hgsc.bcm.edu	37	1	86426957	86426957	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:86426957C>A	ENST00000370571.2	-	24	2903	c.2537G>T	c.(2536-2538)gGa>gTa	p.G846V	COL24A1_ENST00000436319.1_Missense_Mutation_p.G846V	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	846	Collagen-like 5.			GYAGEPGPEGLKGEVGDQGNIG -> ITVFATLYSFLTGRS RRSRKYW (in Ref. 5; BAD92923). {ECO:0000305}.	extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TCCAATATTTCCTTGATCTCC	0.279																																					p.G846V		Atlas-SNP	.											.	COL24A1	202	.	0			c.G2537T						.						98.0	95.0	96.0					1																	86426957		1800	4057	5857	SO:0001583	missense	255631	exon24			ATATTTCCTTGAT	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2537G>T	chr1.hg19:g.86426957C>A	ENSP00000359603:p.Gly846Val	210.0	0.0		176.0	121.0	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	hg19	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442699	0.43326	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.99488	-6.0;-6.0	4.74	4.74	0.60224	.	.	.	.	.	D	0.99775	0.9907	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96912	0.9668	9	0.87932	D	0	.	15.6133	0.76744	0.0:1.0:0.0:0.0	.	846	Q17RW2	COOA1_HUMAN	V	846	ENSP00000359603:G846V;ENSP00000392531:G846V	ENSP00000359603:G846V	G	-	2	0	COL24A1	86199545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.791000	0.62460	2.349000	0.79799	0.655000	0.94253	GGA	.	.		0.279	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
ADAM30	11085	hgsc.bcm.edu	37	1	120436833	120436833	+	Silent	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:120436833C>A	ENST00000369400.1	-	1	2285	c.2127G>T	c.(2125-2127)cgG>cgT	p.R709R		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	709					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		CTATCACTTGCCGGAAAAACA	0.393																																					p.R709R		Atlas-SNP	.											.	ADAM30	88	.	0			c.G2127T						.						96.0	102.0	100.0					1																	120436833		2203	4300	6503	SO:0001819	synonymous_variant	11085	exon1			CACTTGCCGGAAA	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.2127G>T	chr1.hg19:g.120436833C>A		144.0	0.0		94.0	61.0	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Silent	SNP	ENST00000369400.1	hg19	CCDS907.1																																																																																			.	.		0.393	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
SPRR2G	6706	hgsc.bcm.edu	37	1	153122523	153122523	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:153122523T>A	ENST00000368748.4	-	2	102	c.64A>T	c.(64-66)Aag>Tag	p.K22*		NM_001014291.3	NP_001014313.1	Q9BYE4	SPR2G_HUMAN	small proline-rich protein 2G	22	3 X 9 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(1)|lung(1)|skin(1)	3	all_lung(78;1.78e-30)|Lung NSC(65;7.29e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCTGGGCACTTTGGCGTGGGG	0.577																																					p.K22X		Atlas-SNP	.											.	SPRR2G	20	.	0			c.A64T						.						130.0	102.0	112.0					1																	153122523		2203	4298	6501	SO:0001587	stop_gained	6706	exon2			GGCACTTTGGCGT	AF333957	CCDS30868.1	1q21-q22	2008-02-05			ENSG00000159516	ENSG00000159516			11267	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014291		Approved		uc009wod.2	Q9BYE4	OTTHUMG00000014399	ENST00000368748.4:c.64A>T	chr1.hg19:g.153122523T>A	ENSP00000357737:p.Lys22*	33.0	0.0		59.0	10.0	NM_001014291		Nonsense_Mutation	SNP	ENST00000368748.4	hg19	CCDS30868.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.303983	0.60305	.	.	ENSG00000159516	ENST00000368748	.	.	.	5.89	3.47	0.39725	.	.	.	.	.	.	.	.	.	.	.	0.39099	D	0.96124	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-20.1786	5.4686	0.16658	0.0:0.0878:0.1754:0.7368	.	.	.	.	X	22	.	ENSP00000357737:K22X	K	-	1	0	SPRR2G	151389147	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.502000	0.22594	1.059000	0.40554	0.496000	0.49642	AAG	.	.		0.577	SPRR2G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040057.1		
UBAP2L	9898	hgsc.bcm.edu	37	1	154226519	154226519	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:154226519C>T	ENST00000361546.2	+	14	1850	c.1808C>T	c.(1807-1809)cCc>cTc	p.P603L	UBAP2L_ENST00000343815.6_Missense_Mutation_p.P603L|UBAP2L_ENST00000271877.7_Missense_Mutation_p.P614L|UBAP2L_ENST00000428931.1_Missense_Mutation_p.P603L|AL590431.1_ENST00000517008.1_RNA			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	603					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CGGCGGTACCCCAGCTCCATC	0.493																																					p.P603L		Atlas-SNP	.											.	UBAP2L	197	.	0			c.C1808T						.						68.0	64.0	65.0					1																	154226519		2203	4300	6503	SO:0001583	missense	9898	exon15			GGTACCCCAGCTC	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1808C>T	chr1.hg19:g.154226519C>T	ENSP00000355343:p.Pro603Leu	102.0	0.0		131.0	24.0	NM_001127320	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	hg19	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740597	0.69304	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.12774	2.65;2.66;2.69;2.66	5.05	5.05	0.67936	.	0.115656	0.64402	D	0.000012	T	0.20536	0.0494	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;0.999;0.999;0.998	D;D;D;D;D	0.87578	0.981;0.998;0.991;0.991;0.981	T	0.01036	-1.1473	10	0.48119	T	0.1	-7.3634	17.5691	0.87930	0.0:1.0:0.0:0.0	.	517;614;596;603;603	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	L	603;603;99;99;614;603	ENSP00000345308:P603L;ENSP00000389445:P603L;ENSP00000271877:P614L;ENSP00000355343:P603L	ENSP00000271877:P614L	P	+	2	0	UBAP2L	152493143	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.164000	0.71885	2.623000	0.88846	0.655000	0.94253	CCC	.	.		0.493	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
C1orf53	388722	hgsc.bcm.edu	37	1	197872017	197872017	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:197872017G>A	ENST00000367393.3	+	1	241	c.238G>A	c.(238-240)Gcg>Acg	p.A80T		NM_001024594.2	NP_001019765.1	Q5VUE5	CA053_HUMAN	chromosome 1 open reading frame 53	80										endometrium(1)|lung(1)	2						GCGACAGATCGCGGAGCTGCA	0.776																																					p.A80T		Atlas-SNP	.											.	C1orf53	18	.	0			c.G238A						.						5.0	7.0	6.0					1																	197872017		1761	3867	5628	SO:0001583	missense	388722	exon1			CAGATCGCGGAGC	BC038214	CCDS44290.1	1q31.3	2011-01-26			ENSG00000203724	ENSG00000203724			30003	protein-coding gene	gene with protein product						15897902	Standard	NM_001024594		Approved		uc001guh.3	Q5VUE5	OTTHUMG00000035659	ENST00000367393.3:c.238G>A	chr1.hg19:g.197872017G>A	ENSP00000356363:p.Ala80Thr	48.0	0.0		63.0	17.0	NM_001024594	A1L4N2|Q5VUE4	Missense_Mutation	SNP	ENST00000367393.3	hg19	CCDS44290.1	.	.	.	.	.	.	.	.	.	.	G	7.343	0.621283	0.14193	.	.	ENSG00000203724	ENST00000367393	.	.	.	3.34	1.17	0.20885	.	0.739003	0.11375	U	0.570463	T	0.25195	0.0612	L	0.52573	1.65	0.09310	N	1	D	0.56746	0.977	B	0.36666	0.23	T	0.14476	-1.0471	9	0.29301	T	0.29	-20.5471	7.543	0.27751	0.0:0.0:0.5386:0.4614	.	80	Q5VUE5	CA053_HUMAN	T	80	.	ENSP00000356363:A80T	A	+	1	0	C1orf53	196138640	0.196000	0.23350	0.076000	0.20297	0.027000	0.11550	0.205000	0.17356	0.723000	0.32274	0.313000	0.20887	GCG	.	.		0.776	C1orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086555.1	NM_001024594	
RNPEP	6051	hgsc.bcm.edu	37	1	201970854	201970854	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:201970854A>G	ENST00000295640.4	+	8	1428	c.1385A>G	c.(1384-1386)tAt>tGt	p.Y462C	RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000415582.1_RNA|RNPEP_ENST00000367286.3_Missense_Mutation_p.Y423C|RP11-465N4.4_ENST00000419190.1_RNA	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	462					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TACTTGGAATATTTCCCTGAG	0.428																																					p.Y462C	GBM(19;39 479 7473 13131 19462)	Atlas-SNP	.											.	RNPEP	39	.	0			c.A1385G						.						127.0	129.0	128.0					1																	201970854		2203	4300	6503	SO:0001583	missense	6051	exon8			TGGAATATTTCCC	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1385A>G	chr1.hg19:g.201970854A>G	ENSP00000295640:p.Tyr462Cys	114.0	0.0		121.0	52.0	NM_020216	Q9BVM9|Q9H1D4|Q9NPT7	Missense_Mutation	SNP	ENST00000295640.4	hg19	CCDS1418.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.772289	0.49680	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312	T;T;T	0.05081	3.5;3.5;3.5	5.71	3.39	0.38822	.	0.078022	0.52532	D	0.000065	T	0.19167	0.0460	M	0.84948	2.725	0.51767	D	0.999932	P;P	0.44478	0.836;0.584	P;P	0.53954	0.738;0.548	T	0.00165	-1.1967	10	0.72032	D	0.01	-7.3823	7.6867	0.28544	0.7853:0.1411:0.0736:0.0	.	470;462	Q7RU04;Q9H4A4	.;AMPB_HUMAN	C	462;423;331	ENSP00000295640:Y462C;ENSP00000356255:Y423C;ENSP00000389602:Y331C	ENSP00000295640:Y462C	Y	+	2	0	RNPEP	200237477	1.000000	0.71417	0.636000	0.29352	0.457000	0.32468	3.401000	0.52601	0.431000	0.26258	0.459000	0.35465	TAT	.	.		0.428	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
WNT3A	89780	hgsc.bcm.edu	37	1	228238391	228238391	+	Silent	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:228238391C>A	ENST00000284523.1	+	3	426	c.348C>A	c.(346-348)gcC>gcA	p.A116A	WNT3A_ENST00000366753.2_Silent_p.A116A	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	116					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				ACGCCATTGCCTCAGCCGGTG	0.627																																					p.A116A		Atlas-SNP	.											.	WNT3A	40	.	0			c.C348A						.						107.0	82.0	91.0					1																	228238391		2203	4300	6503	SO:0001819	synonymous_variant	89780	exon3			CATTGCCTCAGCC	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.348C>A	chr1.hg19:g.228238391C>A		89.0	0.0		109.0	54.0	NM_033131	Q3SY79|Q3SY80|Q969P2	Silent	SNP	ENST00000284523.1	hg19	CCDS1564.1																																																																																			.	.		0.627	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131	
KCNK3	3777	hgsc.bcm.edu	37	2	26951035	26951035	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:26951035G>A	ENST00000302909.3	+	2	909	c.784G>A	c.(784-786)Gcg>Acg	p.A262T		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	262					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	CGAGCACCGCGCGCTGCTCAC	0.731																																					p.A262T	GBM(80;1457 1631 27100 45946)	Atlas-SNP	.											.	KCNK3	43	.	0			c.G784A						.						24.0	19.0	21.0					2																	26951035		2191	4281	6472	SO:0001583	missense	3777	exon2			CACCGCGCGCTGC	AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.784G>A	chr2.hg19:g.26951035G>A	ENSP00000306275:p.Ala262Thr	38.0	0.0		66.0	23.0	NM_002246	Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	hg19	CCDS1727.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603441	0.66445	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.25414	1.8	4.76	4.76	0.60689	.	0.333064	0.31177	N	0.008103	T	0.23611	0.0571	L	0.47716	1.5	0.53005	D	0.999962	B	0.27765	0.188	B	0.21360	0.034	T	0.04255	-1.0965	10	0.52906	T	0.07	.	13.6164	0.62110	0.0:0.0:1.0:0.0	.	262	O14649	KCNK3_HUMAN	T	139;262	ENSP00000306275:A262T	ENSP00000306275:A262T	A	+	1	0	KCNK3	26804539	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.561000	0.98142	2.329000	0.79093	0.511000	0.50034	GCG	.	.		0.731	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
UCN	7349	hgsc.bcm.edu	37	2	27530547	27530547	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:27530547G>T	ENST00000296099.2	-	2	515	c.217C>A	c.(217-219)Ctc>Atc	p.L73I		NM_003353.2	NP_003344.1	P55089	UCN1_HUMAN	urocortin	73					activation of protein kinase A activity (GO:0034199)|aerobic respiration (GO:0009060)|associative learning (GO:0008306)|drinking behavior (GO:0042756)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell size (GO:0045792)|negative regulation of feeding behavior (GO:2000252)|negative regulation of gastric acid secretion (GO:0060455)|negative regulation of gene expression (GO:0010629)|negative regulation of hormone secretion (GO:0046888)|negative regulation of necrotic cell death (GO:0060547)|negative regulation of neuron death (GO:1901215)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|pancreatic juice secretion (GO:0030157)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell growth (GO:0030307)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of translation (GO:0045727)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasodilation (GO:0045909)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|response to pain (GO:0048265)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|perikaryon (GO:0043204)|varicosity (GO:0043196)	histone deacetylase inhibitor activity (GO:0046811)|neuropeptide hormone activity (GO:0005184)			lung(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCGTCCCGAGTCCCAATcgg	0.746																																					p.L73I		Atlas-SNP	.											.	UCN	4	.	0			c.C217A						.						5.0	7.0	6.0					2																	27530547		1998	3938	5936	SO:0001583	missense	7349	exon2			TCCCGAGTCCCAA	AF038633	CCDS1747.1	2p23-p21	2013-02-28			ENSG00000163794	ENSG00000163794		"""Endogenous ligands"""	12516	protein-coding gene	gene with protein product	"""prepro-urocortin"""	600945				9628819, 861256	Standard	NM_003353		Approved	UROC, UI	uc002rjp.1	P55089	OTTHUMG00000097068	ENST00000296099.2:c.217C>A	chr2.hg19:g.27530547G>T	ENSP00000296099:p.Leu73Ile	1005.0	0.0		1009.0	233.0	NM_003353	Q6FG64	Missense_Mutation	SNP	ENST00000296099.2	hg19	CCDS1747.1	.	.	.	.	.	.	.	.	.	.	G	7.962	0.747188	0.15710	.	.	ENSG00000163794	ENST00000296099	.	.	.	4.89	-8.27	0.01017	.	1.314350	0.05352	N	0.532015	T	0.14098	0.0341	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.18335	-1.0340	9	0.34782	T	0.22	-4.0E-4	3.7812	0.08682	0.1527:0.3541:0.3763:0.1168	.	73	P55089	UCN1_HUMAN	I	73	.	ENSP00000296099:L73I	L	-	1	0	UCN	27384051	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.258000	0.01179	-1.006000	0.03412	-0.367000	0.07326	CTC	.	.		0.746	UCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214184.2	NM_003353	
PLEKHB2	55041	hgsc.bcm.edu	37	2	131890529	131890529	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:131890529C>T	ENST00000403716.1	+	6	948	c.388C>T	c.(388-390)Cca>Tca	p.P130S	PLEKHB2_ENST00000409612.1_Missense_Mutation_p.P130S|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.P82S|PLEKHB2_ENST00000404460.1_Missense_Mutation_p.P130S|PLEKHB2_ENST00000438882.2_Missense_Mutation_p.P130S|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.P130S|PLEKHB2_ENST00000303908.3_Missense_Mutation_p.P130S|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.P130S|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.P130S|PLEKHB2_ENST00000439822.2_Intron	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	130						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		TTCCTCACCTCCACCATACAC	0.602																																					p.P130S		Atlas-SNP	.											.	PLEKHB2	47	.	0			c.C388T						.						126.0	107.0	114.0					2																	131890529		2203	4300	6503	SO:0001583	missense	55041	exon6			TCACCTCCACCAT		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.388C>T	chr2.hg19:g.131890529C>T	ENSP00000385892:p.Pro130Ser	181.0	0.0		229.0	128.0	NM_001267062	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	ENST00000403716.1	hg19	CCDS46413.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327906	0.41197	.	.	ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000438882;ENST00000538982;ENST00000404460;ENST00000409612;ENST00000409279;ENST00000303908	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	U	0.000000	T	0.77558	0.4148	M	0.74258	2.255	0.58432	D	0.999996	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.993;1.0;1.0	D;D;D;D;D;D	0.87578	0.992;0.996;0.998;0.979;0.996;0.996	T	0.78826	-0.2051	9	0.51188	T	0.08	-2.571	13.7255	0.62756	0.0:1.0:0.0:0.0	.	130;130;130;130;130;130	B4DF08;Q53FF1;Q96CS7-3;B7WPA5;Q96CS7;B8ZZN1	.;.;.;.;PKHB2_HUMAN;.	S	130;130;130;130;82;130;130;130;130	.	ENSP00000234115:P130S	P	+	1	0	PLEKHB2	131606999	0.998000	0.40836	0.941000	0.38009	0.037000	0.13140	4.001000	0.57046	2.383000	0.81215	0.491000	0.48974	CCA	.	.		0.602	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958	
R3HDM1	23518	hgsc.bcm.edu	37	2	136389287	136389287	+	Splice_Site	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:136389287G>A	ENST00000264160.4	+	8	867		c.e8-1		R3HDM1_ENST00000410054.1_Splice_Site|R3HDM1_ENST00000409606.1_Splice_Site|R3HDM1_ENST00000409478.1_Splice_Site|R3HDM1_ENST00000329971.3_Splice_Site	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1								poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		CTTTGTTTCAGGGACAGAATG	0.323																																					.		Atlas-SNP	.											.	R3HDM1	84	.	0			c.498-1G>A						.						90.0	91.0	91.0					2																	136389287		2202	4300	6502	SO:0001630	splice_region_variant	23518	exon8			GTTTCAGGGACAG	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.498-1G>A	chr2.hg19:g.136389287G>A		105.0	0.0		110.0	28.0	NM_015361	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Splice_Site	SNP	ENST00000264160.4	hg19	CCDS2177.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.635123	0.87760	.	.	ENSG00000048991	ENST00000422577;ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000436436;ENST00000409606;ENST00000456040	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9405	0.97159	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	R3HDM1	136105757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.716000	0.92895	0.650000	0.86243	.	.	.		0.323	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	Intron
PIKFYVE	200576	hgsc.bcm.edu	37	2	209188869	209188869	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:209188869A>G	ENST00000264380.4	+	18	2352	c.2194A>G	c.(2194-2196)Agg>Ggg	p.R732G		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	732					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TACTTAGGAAAGGGAATTCTT	0.383																																					p.R732G		Atlas-SNP	.											.	PIKFYVE	223	.	0			c.A2194G						.						127.0	127.0	127.0					2																	209188869		2203	4300	6503	SO:0001583	missense	200576	exon18			TAGGAAAGGGAAT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2194A>G	chr2.hg19:g.209188869A>G	ENSP00000264380:p.Arg732Gly	95.0	0.0		145.0	36.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	hg19	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.209709	0.79240	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.79845	-1.31;-1.31	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.88833	0.6544	M	0.73598	2.24	0.80722	D	1	D;D	0.69078	0.997;0.994	P;D	0.75020	0.908;0.985	D	0.89613	0.3843	10	0.59425	D	0.04	-18.1534	14.6334	0.68673	1.0:0.0:0.0:0.0	.	732;676	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	G	732;308;676	ENSP00000264380:R732G;ENSP00000405736:R676G	ENSP00000264380:R732G	R	+	1	2	PIKFYVE	208897114	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	6.905000	0.75714	2.196000	0.70406	0.374000	0.22700	AGG	.	.		0.383	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
ERBB4	2066	hgsc.bcm.edu	37	2	212537964	212537964	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:212537964C>T	ENST00000342788.4	-	14	1951	c.1641G>A	c.(1639-1641)gaG>gaA	p.E547E	ERBB4_ENST00000402597.1_Silent_p.E547E|ERBB4_ENST00000436443.1_Silent_p.E547E	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	547	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TGGAGCCATTCTCAAACTCCC	0.473										TSP Lung(8;0.080)																											p.E547E		Atlas-SNP	.											.	ERBB4	480	.	0			c.G1641A						.						117.0	93.0	102.0					2																	212537964		2203	4300	6503	SO:0001819	synonymous_variant	2066	exon14			GCCATTCTCAAAC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1641G>A	chr2.hg19:g.212537964C>T		70.0	0.0		74.0	17.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	hg19	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	7.196	0.592517	0.13875	.	.	ENSG00000178568	ENST00000260943	.	.	.	5.33	3.49	0.39957	.	.	.	.	.	T	0.47544	0.1451	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40098	-0.9581	4	.	.	.	.	4.1158	0.10081	0.0:0.3795:0.3409:0.2796	.	.	.	.	K	547	.	.	R	-	2	0	ERBB4	212246209	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.455000	0.35190	1.203000	0.43233	0.557000	0.71058	AGA	.	.		0.473	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
TUBA4A	7277	hgsc.bcm.edu	37	2	220115164	220115164	+	Silent	SNP	G	G	A	rs199590938		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:220115164G>A	ENST00000248437.4	-	4	1430	c.1257C>T	c.(1255-1257)tcC>tcT	p.S419S	TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000392088.2_Silent_p.S404S|TUBA4A_ENST00000498660.1_5'Flank	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	419					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	CACGGGCCTCGGAGAACTCAC	0.582																																					p.S419S		Atlas-SNP	.											.	TUBA4A	96	.	0			c.C1257T						.						122.0	117.0	119.0					2																	220115164		2203	4300	6503	SO:0001819	synonymous_variant	7277	exon4			GGCCTCGGAGAAC	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.1257C>T	chr2.hg19:g.220115164G>A		201.0	0.0		186.0	98.0	NM_006000	A8MUB1|B3KNQ6|P05215	Silent	SNP	ENST00000248437.4	hg19	CCDS2438.1																																																																																			.	G|0.999;A|0.001		0.582	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256816.3	NM_006000	
CHPF	79586	hgsc.bcm.edu	37	2	220404725	220404725	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:220404725C>T	ENST00000243776.6	-	4	1956	c.1708G>A	c.(1708-1710)Gtg>Atg	p.V570M	CHPF_ENST00000535926.1_Missense_Mutation_p.V408M	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	570	Ala-rich.				carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AGCTCTGCCACGTGGGCCTTG	0.657																																					p.V570M		Atlas-SNP	.											.	CHPF	56	.	0			c.G1708A						.						27.0	32.0	30.0					2																	220404725		2202	4297	6499	SO:0001583	missense	79586	exon4			CTGCCACGTGGGC	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1708G>A	chr2.hg19:g.220404725C>T	ENSP00000243776:p.Val570Met	129.0	0.0		132.0	70.0	NM_024536	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	hg19	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456932	0.63401	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15603	2.41;2.41	4.62	4.62	0.57501	.	0.073067	0.56097	D	0.000023	T	0.15132	0.0365	N	0.08118	0	0.40918	D	0.984286	D	0.63880	0.993	D	0.63793	0.918	T	0.11867	-1.0570	10	0.23302	T	0.38	-30.4285	5.7428	0.18104	0.0:0.7648:0.0:0.2352	.	570	Q8IZ52	CHSS2_HUMAN	M	570;408	ENSP00000243776:V570M;ENSP00000445571:V408M	ENSP00000243776:V570M	V	-	1	0	CHPF	220112969	0.993000	0.37304	0.994000	0.49952	0.998000	0.95712	2.546000	0.45778	2.563000	0.86464	0.561000	0.74099	GTG	.	.		0.657	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
SLC4A3	6508	hgsc.bcm.edu	37	2	220502422	220502422	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:220502422C>A	ENST00000358055.3	+	17	3167	c.2655C>A	c.(2653-2655)agC>agA	p.S885R	SLC4A3_ENST00000373762.3_Missense_Mutation_p.S912R|SLC4A3_ENST00000317151.3_Missense_Mutation_p.S885R|SLC4A3_ENST00000273063.6_Missense_Mutation_p.S912R|SLC4A3_ENST00000373760.2_Missense_Mutation_p.S885R			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	885	Membrane (anion exchange).			SPR -> GPE (in Ref. 2; AAB05850). {ECO:0000305}.	bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCCCCCCAGCCCGAGGAACC	0.647																																					p.S912R		Atlas-SNP	.											.	SLC4A3	144	.	0			c.C2736A						.						60.0	49.0	53.0					2																	220502422		2203	4300	6503	SO:0001583	missense	6508	exon17			CCCCAGCCCGAGG		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2655C>A	chr2.hg19:g.220502422C>A	ENSP00000350756:p.Ser885Arg	178.0	0.0		183.0	56.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	hg19	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	C	8.527	0.870061	0.17322	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000356251;ENST00000317151	T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18	4.54	1.5	0.22942	Bicarbonate transporter, C-terminal (1);	0.516257	0.16127	N	0.228373	T	0.54351	0.1853	N	0.15975	0.35	0.24045	N	0.996068	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.0	T	0.31166	-0.9953	10	0.18710	T	0.47	.	4.8304	0.13437	0.1264:0.6074:0.1121:0.154	.	589;885;912	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	R	885;885;912;912;145;885	ENSP00000350756:S885R;ENSP00000362865:S885R;ENSP00000273063:S912R;ENSP00000362867:S912R;ENSP00000314006:S885R	ENSP00000273063:S912R	S	+	3	2	SLC4A3	220210666	0.403000	0.25319	0.981000	0.43875	0.138000	0.21146	0.079000	0.14782	0.640000	0.30582	-0.270000	0.10280	AGC	.	.		0.647	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
SLC16A14	151473	hgsc.bcm.edu	37	2	230924025	230924025	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:230924025C>T	ENST00000295190.4	-	2	502	c.44G>A	c.(43-45)gGc>gAc	p.G15D	RNY4P19_ENST00000362530.1_RNA	NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		GTCTTTGGGGCCATCTTCAAA	0.393																																					p.G15D		Atlas-SNP	.											.	SLC16A14	75	.	0			c.G44A						.						78.0	73.0	75.0					2																	230924025		2203	4300	6503	SO:0001583	missense	151473	exon2			TTGGGGCCATCTT	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.44G>A	chr2.hg19:g.230924025C>T	ENSP00000295190:p.Gly15Asp	150.0	0.0		147.0	78.0	NM_152527	A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	ENST00000295190.4	hg19	CCDS2473.1	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.292404	0.01375	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034;ENST00000425822;ENST00000436869	T;T;T	0.08102	3.13;3.13;3.14	5.5	-1.05	0.10036	Major facilitator superfamily domain, general substrate transporter (1);	0.479994	0.19173	N	0.120896	T	0.02304	0.0071	N	0.02539	-0.55	0.20975	N	0.999813	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46652	-0.9176	10	0.10902	T	0.67	.	6.0552	0.19807	0.1193:0.3494:0.0:0.5313	.	15;15	E7EMG7;Q7RTX9	.;MOT14_HUMAN	D	15	ENSP00000295190:G15D;ENSP00000400352:G15D;ENSP00000395775:G15D	ENSP00000295190:G15D	G	-	2	0	SLC16A14	230632269	0.983000	0.35010	0.996000	0.52242	0.323000	0.28346	0.275000	0.18698	-0.064000	0.13043	-1.004000	0.02495	GGC	.	.		0.393	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
TMEM40	55287	hgsc.bcm.edu	37	3	12791298	12791298	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:12791298C>A	ENST00000314124.7	-	2	390	c.34G>T	c.(34-36)Gac>Tac	p.D12Y	TMEM40_ENST00000435218.2_Missense_Mutation_p.D12Y|TMEM40_ENST00000431022.2_Missense_Mutation_p.D28Y|TMEM40_ENST00000435575.1_Missense_Mutation_p.D12Y|TMEM40_ENST00000264728.8_Missense_Mutation_p.D12Y	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40	12						integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						TGACTGTTGTCCTGAGGCTGG	0.433																																					p.D12Y		Atlas-SNP	.											.	TMEM40	22	.	0			c.G34T						.						204.0	174.0	184.0					3																	12791298		2203	4300	6503	SO:0001583	missense	55287	exon2			TGTTGTCCTGAGG	BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.34G>T	chr3.hg19:g.12791298C>A	ENSP00000322837:p.Asp12Tyr	171.0	0.0		198.0	31.0	NM_018306	C9JID5|Q8NAL4|Q9NUZ4	Missense_Mutation	SNP	ENST00000314124.7	hg19	CCDS2613.1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573435	0.28092	.	.	ENSG00000088726	ENST00000314124;ENST00000435575;ENST00000435218;ENST00000264728;ENST00000431022	.	.	.	3.81	2.92	0.33932	.	0.320112	0.22782	N	0.055701	T	0.51568	0.1682	L	0.59436	1.845	0.09310	N	1	D;D;D;D	0.65815	0.995;0.992;0.969;0.995	P;P;P;P	0.60415	0.874;0.757;0.824;0.874	T	0.36744	-0.9735	9	0.87932	D	0	-16.4868	7.795	0.29141	0.0:0.8844:0.0:0.1156	.	28;12;12;12	B4DXI0;C9JID5;Q8WWA1-2;Q8WWA1	.;.;.;TMM40_HUMAN	Y	12;12;12;12;28	.	ENSP00000264728:D12Y	D	-	1	0	TMEM40	12766298	0.024000	0.19004	0.024000	0.17045	0.412000	0.31113	1.427000	0.34881	1.152000	0.42452	0.655000	0.94253	GAC	.	.		0.433	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252029.2	NM_018306	
TTC21A	199223	hgsc.bcm.edu	37	3	39166927	39166927	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:39166927G>T	ENST00000431162.2	+	11	1454	c.1320G>T	c.(1318-1320)atG>atT	p.M440I	TTC21A_ENST00000440121.1_Missense_Mutation_p.M391I|TTC21A_ENST00000301819.6_Missense_Mutation_p.M440I			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	440										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TCTCCAGCATGCAAGGCATCC	0.532											OREG0015487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M440I		Atlas-SNP	.											.	TTC21A	96	.	0			c.G1320T						.						99.0	97.0	97.0					3																	39166927		2050	4201	6251	SO:0001583	missense	199223	exon11			CAGCATGCAAGGC	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.1320G>T	chr3.hg19:g.39166927G>T	ENSP00000398211:p.Met440Ile	74.0	0.0	883	52.0	21.0	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	hg19	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397832	0.42512	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.59638	0.25;0.25;0.36	5.73	4.84	0.62591	.	0.259217	0.39544	N	0.001328	T	0.49184	0.1542	L	0.39898	1.24	0.38087	D	0.936836	B;B;B	0.24920	0.017;0.114;0.07	B;B;B	0.20955	0.008;0.032;0.014	T	0.49293	-0.8955	10	0.36615	T	0.2	-14.3663	14.9106	0.70755	0.0:0.0:0.8554:0.1446	.	391;440;440	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	I	440;422;440;391	ENSP00000301819:M440I;ENSP00000398211:M440I;ENSP00000410882:M391I	ENSP00000301819:M440I	M	+	3	0	TTC21A	39141931	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	1.673000	0.37534	1.388000	0.46506	0.609000	0.83330	ATG	.	.		0.532	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266104	41266104	+	Missense_Mutation	SNP	G	G	T	rs28931589|rs121913416		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:41266104G>T	ENST00000349496.5	+	3	381	c.101G>T	c.(100-102)gGa>gTa	p.G34V	CTNNB1_ENST00000453024.1_Missense_Mutation_p.G27V|CTNNB1_ENST00000405570.1_Missense_Mutation_p.G34V|CTNNB1_ENST00000396183.3_Missense_Mutation_p.G34V|CTNNB1_ENST00000396185.3_Missense_Mutation_p.G34V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G34E(73)|p.G34V(72)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTGGACTCTGGAATCCATTCT	0.488	G34E(AGS_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34V	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,161	CTNNB1	4904	.	276	Substitution - Missense(145)|Deletion - In frame(105)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(146)|endometrium(30)|large_intestine(27)|stomach(21)|central_nervous_system(20)|skin(8)|pancreas(8)|ovary(6)|small_intestine(2)|lung(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|pituitary(1)|prostate(1)|bone(1)	c.G101T						.						93.0	78.0	83.0					3																	41266104		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACTCTGGAATCCA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.101G>T	chr3.hg19:g.41266104G>T	ENSP00000344456:p.Gly34Val	142.0	0.0		122.0	44.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450603	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-31.2232	19.9596	0.97236	0.0:0.0:1.0:0.0	rs28931589	34	P35222	CTNB1_HUMAN	V	27;34;34;34;34;27;34;34;34	ENSP00000400508:G27V;ENSP00000385604:G34V;ENSP00000412219:G34V;ENSP00000379486:G34V;ENSP00000344456:G34V;ENSP00000411226:G27V;ENSP00000379488:G34V;ENSP00000409302:G34V;ENSP00000401599:G34V	ENSP00000344456:G34V	G	+	2	0	CTNNB1	41241108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GGA	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LAMB2	3913	hgsc.bcm.edu	37	3	49161060	49161060	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:49161060C>A	ENST00000418109.1	-	26	3966	c.3802G>T	c.(3802-3804)Gaa>Taa	p.E1268*	LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000305544.4_Nonsense_Mutation_p.E1268*|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000398888.2_5'Flank|USP19_ENST00000434032.2_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1268	Domain II.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCCCCAATTTCACGCCTGCAA	0.562																																					p.E1268X		Atlas-SNP	.											.	LAMB2	156	.	0			c.G3802T						.						101.0	99.0	99.0					3																	49161060		2203	4300	6503	SO:0001587	stop_gained	3913	exon25			CAATTTCACGCCT		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3802G>T	chr3.hg19:g.49161060C>A	ENSP00000388325:p.Glu1268*	78.0	0.0		43.0	14.0	NM_002292	Q16321	Nonsense_Mutation	SNP	ENST00000418109.1	hg19	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	C	39	7.671004	0.98425	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000395387	.	.	.	5.83	4.95	0.65309	.	0.363722	0.31709	N	0.007192	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	9.5476	0.39291	0.0:0.6553:0.2727:0.072	.	.	.	.	X	1268;1268;35	.	ENSP00000307156:E1268X	E	-	1	0	LAMB2	49136064	0.152000	0.22762	1.000000	0.80357	0.453000	0.32348	0.386000	0.20702	1.434000	0.47414	0.655000	0.94253	GAA	.	.		0.562	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
IFRD2	7866	hgsc.bcm.edu	37	3	50328069	50328069	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:50328069C>G	ENST00000429673.2	-	2	291	c.292G>C	c.(292-294)Gat>Cat	p.D98H	IFRD2_ENST00000336089.4_Missense_Mutation_p.D200H|IFRD2_ENST00000436390.1_Missense_Mutation_p.D34H|IFRD2_ENST00000417626.2_Missense_Mutation_p.D34H|IFRD2_ENST00000484043.1_5'UTR			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	98						nucleus (GO:0005634)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GCTGCCTCATCGTCACTGGAA	0.607																																					p.D98H		Atlas-SNP	.											.	IFRD2	34	.	0			c.G292C						.						38.0	44.0	42.0					3																	50328069		2184	4283	6467	SO:0001583	missense	7866	exon2			CCTCATCGTCACT	U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.292G>C	chr3.hg19:g.50328069C>G	ENSP00000398971:p.Asp98His	79.0	0.0		51.0	12.0	NM_006764	Q9BVB4|Q9UJ88	Missense_Mutation	SNP	ENST00000429673.2	hg19	CCDS46831.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.355933	0.41700	.	.	ENSG00000214706	ENST00000417626;ENST00000436390;ENST00000336089;ENST00000429673	T;T;T;T	0.52983	0.72;0.72;0.64;0.68	5.09	5.09	0.68999	Interferon-related developmental regulator, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.75531	-0.3285	10	0.87932	D	0	-19.5283	15.9842	0.80138	0.0:1.0:0.0:0.0	.	98;200	Q12894;Q9UJ88	IFRD2_HUMAN;.	H	34;34;200;98	ENSP00000402849:D34H;ENSP00000392316:D34H;ENSP00000336936:D200H;ENSP00000398971:D98H	ENSP00000336936:D200H	D	-	1	0	IFRD2	50303073	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.676000	0.61627	2.344000	0.79699	0.655000	0.94253	GAT	.	.		0.607	IFRD2-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006764	
TLR9	54106	hgsc.bcm.edu	37	3	52255747	52255747	+	Missense_Mutation	SNP	C	C	A	rs148303873	byFrequency	TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:52255747C>A	ENST00000360658.2	-	2	3218	c.2585G>T	c.(2584-2586)gGg>gTg	p.G862V	TLR9_ENST00000494383.1_Missense_Mutation_p.W1015C|TLR9_ENST00000597542.1_Missense_Mutation_p.G886V	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	862					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CTCATCTCGCCCACTTTGCCG	0.642																																					p.G862V		Atlas-SNP	.											.	TLR9	72	.	0			c.G2585T						.						64.0	64.0	64.0					3																	52255747		2203	4300	6503	SO:0001583	missense	54106	exon2			TCTCGCCCACTTT	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2585G>T	chr3.hg19:g.52255747C>A	ENSP00000353874:p.Gly862Val	141.0	0.0		65.0	27.0	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	hg19	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.016|0.016	-1.533658|-1.533658	0.00951|0.00951	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.02606|.	4.23|.	1.03|1.03	1.03|1.03	0.20045|0.20045	.|.	.|.	.|.	.|.	.|.	T|T	0.19287|0.19287	0.0463|0.0463	N|N	0.14661|0.14661	0.345|0.345	0.20764|0.20764	N|N	0.999855|0.999855	B;P|.	0.37233|.	0.209;0.588|.	B;B|.	0.21708|.	0.011;0.036|.	T|T	0.26087|0.26087	-1.0113|-1.0113	9|5	0.49607|.	T|.	0.09|.	.|.	5.6834|5.6834	0.17788|0.17788	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	959;862|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	V|C	862|1015	ENSP00000353874:G862V|.	ENSP00000353874:G862V|.	G|W	-|-	2|3	0|0	TLR9|RP11-330H6.5	52230787|52230787	0.000000|0.000000	0.05858|0.05858	0.007000|0.007000	0.13788|0.13788	0.008000|0.008000	0.06430|0.06430	-1.722000|-1.722000	0.01868|0.01868	0.308000|0.308000	0.22923|0.22923	0.313000|0.313000	0.20887|0.20887	GGG|TGG	.	C|0.998;T|0.002		0.642	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
FLNB	2317	hgsc.bcm.edu	37	3	58121724	58121724	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:58121724A>C	ENST00000295956.4	+	28	4855	c.4690A>C	c.(4690-4692)Aaa>Caa	p.K1564Q	FLNB_ENST00000358537.3_Missense_Mutation_p.K1564Q|FLNB_ENST00000357272.4_Missense_Mutation_p.K1564Q|FLNB_ENST00000348383.5_Missense_Mutation_p.K1564Q|FLNB_ENST00000419752.2_Missense_Mutation_p.K1395Q|FLNB_ENST00000429972.2_Missense_Mutation_p.K1564Q|FLNB_ENST00000490882.1_Missense_Mutation_p.K1595Q|FLNB_ENST00000493452.1_Missense_Mutation_p.K1395Q	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1564					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		AGGAAAACCCAAAAGAGCCAT	0.433																																					p.K1595Q		Atlas-SNP	.											.	FLNB	430	.	0			c.A4783C						.						76.0	68.0	71.0					3																	58121724		2203	4300	6503	SO:0001583	missense	2317	exon29			AAACCCAAAAGAG	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4690A>C	chr3.hg19:g.58121724A>C	ENSP00000295956:p.Lys1564Gln	191.0	0.0		151.0	43.0	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	hg19	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.105480	0.77096	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85	6.1	4.93	0.64822	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.082859	0.85682	N	0.000000	D	0.88235	0.6382	L	0.42529	1.33	0.48087	D	0.999589	D;B;P;P;D;D	0.60575	0.975;0.035;0.926;0.722;0.988;0.988	P;B;P;P;D;D	0.64877	0.757;0.391;0.848;0.449;0.93;0.93	D	0.87978	0.2741	10	0.52906	T	0.07	.	13.3249	0.60454	0.8637:0.1363:0.0:0.0	.	1564;1595;1395;1395;1564;1564	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	Q	1564;1595;1564;1564;1564;1564;1395;1395	ENSP00000295956:K1564Q;ENSP00000420213:K1595Q;ENSP00000351339:K1564Q;ENSP00000415599:K1564Q;ENSP00000232447:K1564Q;ENSP00000349819:K1564Q;ENSP00000418510:K1395Q;ENSP00000414532:K1395Q	ENSP00000295956:K1564Q	K	+	1	0	FLNB	58096764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.034000	0.70933	1.108000	0.41662	0.528000	0.53228	AAA	.	.		0.433	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
ARL13B	200894	hgsc.bcm.edu	37	3	93762021	93762021	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:93762021A>T	ENST00000394222.3	+	7	1236	c.961A>T	c.(961-963)Aag>Tag	p.K321*	ARL13B_ENST00000471138.1_Nonsense_Mutation_p.K321*|ARL13B_ENST00000535334.1_Nonsense_Mutation_p.K218*|ARL13B_ENST00000303097.7_Nonsense_Mutation_p.K214*|ARL13B_ENST00000539730.1_Nonsense_Mutation_p.K42*	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	321					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						AGAAAATTATAAGGAGGCATT	0.343																																					p.K321X		Atlas-SNP	.											.	ARL13B	52	.	0			c.A961T						.						78.0	79.0	78.0					3																	93762021		2203	4300	6503	SO:0001587	stop_gained	200894	exon7			AATTATAAGGAGG	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.961A>T	chr3.hg19:g.93762021A>T	ENSP00000377769:p.Lys321*	691.0	0.0		448.0	142.0	NM_182896	D3DN29|G3V1S8|Q504W8|Q8TCL5	Nonsense_Mutation	SNP	ENST00000394222.3	hg19	CCDS2925.1	.	.	.	.	.	.	.	.	.	.	A	37	6.139759	0.97320	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138;ENST00000539730	.	.	.	5.33	1.57	0.23409	.	0.599838	0.18355	N	0.143756	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3737	5.6445	0.17582	0.712:0.1445:0.1436:0.0	.	.	.	.	X	218;214;321;321;42	.	ENSP00000306225:K214X	K	+	1	0	ARL13B	95244711	0.994000	0.37717	0.869000	0.34112	0.827000	0.46813	2.545000	0.45769	0.098000	0.17522	0.533000	0.62120	AAG	.	.		0.343	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896	
POPDC2	64091	hgsc.bcm.edu	37	3	119378986	119378986	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:119378986C>T	ENST00000264231.3	-	1	451	c.285G>A	c.(283-285)ctG>ctA	p.L95L	POPDC2_ENST00000538678.1_Silent_p.L95L|POPDC2_ENST00000468801.1_Silent_p.L95L|POPDC2_ENST00000493094.1_Silent_p.L95L|POPDC2_ENST00000474523.1_Intron	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	95					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GGCGGTATACCAGGTGTGCCA	0.597																																					p.L95L		Atlas-SNP	.											.	POPDC2	36	.	0			c.G285A						.						130.0	113.0	119.0					3																	119378986		2203	4300	6503	SO:0001819	synonymous_variant	64091	exon1			GTATACCAGGTGT	AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.285G>A	chr3.hg19:g.119378986C>T		106.0	0.0		87.0	22.0	NM_022135	Q86UE7	Silent	SNP	ENST00000264231.3	hg19	CCDS2992.1																																																																																			.	.		0.597	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1	NM_022135	
RAB43	339122	hgsc.bcm.edu	37	3	128813830	128813830	+	Splice_Site	SNP	G	G	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:128813830G>C	ENST00000315150.5	-	2	687	c.387C>G	c.(385-387)atC>atG	p.I129M	ISY1-RAB43_ENST00000418265.1_3'UTR|RAB43_ENST00000393308.1_Splice_Site_p.I129M|RAB43_ENST00000393305.1_Splice_Site_p.I129M|RAB43_ENST00000476465.1_Splice_Site_p.I129M|RAB43_ENST00000393307.1_Splice_Site_p.I129M|RAB43_ENST00000393304.1_Splice_Site_p.I129M	NM_001204888.1|NM_198490.2	NP_001191817.1|NP_940892.1	Q86YS6	RAB43_HUMAN	RAB43, member RAS oncogene family	129					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|retrograde transport, plasma membrane to Golgi (GO:0035526)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(2)|liver(1)|lung(2)|skin(1)	6						CCAACTCACCGATCAGCAGCT	0.537																																					p.I129M		Atlas-SNP	.											.	RAB43	13	.	0			c.C387G						.						146.0	114.0	125.0					3																	128813830		2203	4300	6503	SO:0001630	splice_region_variant	339122	exon3			CTCACCGATCAGC	AY166852	CCDS33850.1, CCDS56275.1	3q21.3	2010-03-30			ENSG00000172780	ENSG00000172780		"""RAB, member RAS oncogene"""	19983	protein-coding gene	gene with protein product						15018353	Standard	NM_198490		Approved	RAB41, RAB11B, ISY1	uc021xdp.1	Q86YS6	OTTHUMG00000137364	ENST00000315150.5:c.388+1C>G	chr3.hg19:g.128813830G>C		54.0	0.0		32.0	10.0	NM_001204886	A8K4P9|E9PBQ0	Missense_Mutation	SNP	ENST00000315150.5	hg19	CCDS33850.1	.	.	.	.	.	.	.	.	.	.	G	9.496	1.101877	0.20632	.	.	ENSG00000172780	ENST00000315150;ENST00000393304;ENST00000393308;ENST00000393307;ENST00000393305;ENST00000476465	T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;4.93	4.59	-6.45	0.01914	Small GTP-binding protein domain (1);	.	.	.	.	D	0.87943	0.6305	M	0.84511	2.7	0.80722	D	1	P;P	0.48764	0.723;0.915	D;D	0.63597	0.915;0.916	D	0.89033	0.3443	9	0.72032	D	0.01	.	15.3967	0.74801	0.6546:0.0:0.3454:0.0	.	129;129	E9PBQ0;Q86YS6	.;RAB43_HUMAN	M	129	ENSP00000319781:I129M;ENSP00000376981:I129M;ENSP00000376985:I129M;ENSP00000376984:I129M;ENSP00000376982:I129M;ENSP00000427632:I129M	ENSP00000319781:I129M	I	-	3	3	RAB43	130296520	0.000000	0.05858	0.602000	0.28890	0.243000	0.25628	-2.462000	0.00997	-1.910000	0.01083	-1.583000	0.00853	ATC	.	.		0.537	RAB43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267849.1	XM_290714	Missense_Mutation
BDH1	622	hgsc.bcm.edu	37	3	197238829	197238829	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:197238829C>A	ENST00000392378.2	-	7	1279	c.969G>T	c.(967-969)tgG>tgT	p.W323C	BDH1_ENST00000392379.1_Missense_Mutation_p.W323C|BDH1_ENST00000441275.1_Missense_Mutation_p.W236C|BDH1_ENST00000358186.2_Missense_Mutation_p.W323C	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	323					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		GCATTCGCAGCCACCAGTAGT	0.602																																					p.W323C		Atlas-SNP	.											.	BDH1	24	.	0			c.G969T						.						133.0	124.0	127.0					3																	197238829		2203	4300	6503	SO:0001583	missense	622	exon7			TCGCAGCCACCAG	M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.969G>T	chr3.hg19:g.197238829C>A	ENSP00000376183:p.Trp323Cys	119.0	0.0		92.0	29.0	NM_004051	D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	ENST00000392378.2	hg19	CCDS3328.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528445	0.85706	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000441275	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.85	5.85	0.93711	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96632	0.8901	M	0.83774	2.66	0.80722	D	1	D	0.71674	0.998	D	0.64144	0.922	D	0.96505	0.9374	10	0.66056	D	0.02	.	18.0364	0.89305	0.0:1.0:0.0:0.0	.	323	Q02338	BDH_HUMAN	C	323;323;323;236	ENSP00000376183:W323C;ENSP00000350914:W323C;ENSP00000376184:W323C;ENSP00000411014:W236C	ENSP00000350914:W323C	W	-	3	0	BDH1	198723226	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	TGG	.	.		0.602	BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340267.1	NM_004051	
JAKMIP1	152789	hgsc.bcm.edu	37	4	6052342	6052342	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr4:6052342C>A	ENST00000409021.3	-	14	2320	c.1871G>T	c.(1870-1872)aGc>aTc	p.S624I	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.S439I	NM_001099433.1	NP_001092903.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	0	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTGGAGAGCGCTGCTGTGGTT	0.562																																					p.S624I		Atlas-SNP	.											.	JAKMIP1	250	.	0			c.G1871T						.						85.0	93.0	91.0					4																	6052342		2034	4164	6198	SO:0001583	missense	152789	exon14			AGAGCGCTGCTGT	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000409021.3:c.1871G>T	chr4.hg19:g.6052342C>A	ENSP00000386711:p.Ser624Ile	116.0	0.0		91.0	64.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000409021.3	hg19	CCDS47005.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457624	0.84317	.	.	ENSG00000152969	ENST00000409021;ENST00000409371	T;T	0.51325	1.15;0.71	5.1	5.1	0.69264	.	.	.	.	.	T	0.59891	0.2227	.	.	.	0.80722	D	1	P;D	0.54964	0.693;0.969	P;P	0.52424	0.588;0.698	T	0.63431	-0.6639	8	0.52906	T	0.07	.	17.5397	0.87843	0.0:1.0:0.0:0.0	.	439;624	Q96N16-5;Q96N16-2	.;.	I	624;439	ENSP00000386711:S624I;ENSP00000387042:S439I	ENSP00000386711:S624I	S	-	2	0	JAKMIP1	6103243	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.374000	0.73132	2.375000	0.81037	0.555000	0.69702	AGC	.	.		0.562	JAKMIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329747.1	NM_144720	
TLL1	7092	hgsc.bcm.edu	37	4	167020562	167020562	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr4:167020562A>T	ENST00000061240.2	+	20	3437	c.2790A>T	c.(2788-2790)gaA>gaT	p.E930D	TLL1_ENST00000507499.1_Missense_Mutation_p.E953D	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	930	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTCGACTTGAATTATCCTTCC	0.463																																					p.E930D		Atlas-SNP	.											.	TLL1	194	.	0			c.A2790T						.						206.0	196.0	199.0					4																	167020562		2203	4300	6503	SO:0001583	missense	7092	exon20			ACTTGAATTATCC	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2790A>T	chr4.hg19:g.167020562A>T	ENSP00000061240:p.Glu930Asp	228.0	1.0		193.0	127.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	hg19	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	A	14.58	2.578925	0.46006	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.18960	2.18;2.18	5.76	-4.91	0.03085	CUB (5);	0.000000	0.85682	U	0.000000	T	0.47507	0.1449	M	0.91196	3.185	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.992	T	0.59220	-0.7495	10	0.36615	T	0.2	.	15.0015	0.71476	0.6781:0.0:0.3219:0.0	.	953;930	E9PD25;O43897	.;TLL1_HUMAN	D	930;953	ENSP00000061240:E930D;ENSP00000426082:E953D	ENSP00000061240:E930D	E	+	3	2	TLL1	167240012	0.988000	0.35896	0.245000	0.24217	0.000000	0.00434	0.319000	0.19522	-0.830000	0.04262	-1.782000	0.00648	GAA	.	.		0.463	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
SLC9A3	6550	hgsc.bcm.edu	37	5	484645	484645	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:484645C>T	ENST00000264938.3	-	5	931	c.922G>A	c.(922-924)Gcc>Acc	p.A308T	SLC9A3_ENST00000514375.1_Missense_Mutation_p.A308T	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	308					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GCGAGGATGGCCGACAGCGAC	0.642																																					p.A308T		Atlas-SNP	.											.	SLC9A3	89	.	0			c.G922A						.						143.0	107.0	119.0					5																	484645		2201	4300	6501	SO:0001583	missense	6550	exon5			GGATGGCCGACAG		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.922G>A	chr5.hg19:g.484645C>T	ENSP00000264938:p.Ala308Thr	131.0	0.0		152.0	72.0	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	hg19	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026719	0.54683	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.16897	2.31;2.31	4.31	-0.023	0.13945	Cation/H+ exchanger (1);	0.389797	0.27807	N	0.017780	T	0.35970	0.0950	M	0.81497	2.545	0.25061	N	0.991064	D;P	0.55605	0.972;0.698	P;P	0.57679	0.825;0.451	T	0.36432	-0.9748	10	0.72032	D	0.01	.	14.1259	0.65219	0.6891:0.3109:0.0:0.0	.	308;308	E9PF67;P48764	.;SL9A3_HUMAN	T	308	ENSP00000264938:A308T;ENSP00000422983:A308T	ENSP00000264938:A308T	A	-	1	0	SLC9A3	537645	0.710000	0.27896	0.126000	0.21872	0.391000	0.30476	1.401000	0.34589	-0.433000	0.07286	0.561000	0.74099	GCC	.	.		0.642	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
MYO10	4651	hgsc.bcm.edu	37	5	16701801	16701801	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:16701801C>T	ENST00000513610.1	-	25	3157	c.2703G>A	c.(2701-2703)caG>caA	p.Q901Q	MYO10_ENST00000505695.1_Silent_p.Q240Q|MYO10_ENST00000512061.1_5'Flank|MYO10_ENST00000274203.9_Silent_p.Q258Q|MYO10_ENST00000427430.2_Silent_p.Q258Q|MYO10_ENST00000515803.1_Silent_p.Q240Q	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	901	Mediates antiparallel dimerization.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CCTTCATGCGCTGCAGGTCCT	0.587																																					p.Q901Q		Atlas-SNP	.											.	MYO10	198	.	0			c.G2703A						.						42.0	46.0	44.0					5																	16701801		2117	4252	6369	SO:0001819	synonymous_variant	4651	exon25			CATGCGCTGCAGG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2703G>A	chr5.hg19:g.16701801C>T		62.0	0.0		66.0	17.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	hg19	CCDS54834.1																																																																																			.	.		0.587	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
CAST	831	hgsc.bcm.edu	37	5	96100971	96100971	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:96100971G>A	ENST00000341926.3	+	24	1892	c.1730G>A	c.(1729-1731)aGt>aAt	p.S577N	CAST_ENST00000359176.4_Missense_Mutation_p.S641N|CAST_ENST00000509903.1_Missense_Mutation_p.S542N|CAST_ENST00000395813.1_Missense_Mutation_p.S660N|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000508608.1_Missense_Mutation_p.S623N|CAST_ENST00000338252.3_Missense_Mutation_p.S564N|CAST_ENST00000325674.7_Missense_Mutation_p.S625N|CAST_ENST00000395812.2_Missense_Mutation_p.S619N|CAST_ENST00000508579.1_Missense_Mutation_p.S292N|CAST_ENST00000511049.1_Missense_Mutation_p.S562N|CAST_ENST00000309190.5_Missense_Mutation_p.S555N|CAST_ENST00000510756.1_Missense_Mutation_p.S638N|ERAP1_ENST00000296754.3_Intron|CAST_ENST00000515663.1_Missense_Mutation_p.S300N|CAST_ENST00000511782.1_Missense_Mutation_p.S563N|CAST_ENST00000504465.1_Missense_Mutation_p.S505N|CAST_ENST00000508830.1_Missense_Mutation_p.S660N			P20810	ICAL_HUMAN	calpastatin	577					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		CTCTCTGACAGTCTAGGACAA	0.353																																					p.S619N		Atlas-SNP	.											.	CAST	58	.	0			c.G1856A						.						134.0	135.0	135.0					5																	96100971		2203	4300	6503	SO:0001583	missense	831	exon24			CTGACAGTCTAGG	AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.1730G>A	chr5.hg19:g.96100971G>A	ENSP00000339914:p.Ser577Asn	208.0	0.0		288.0	103.0	NM_001042440	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	ENST00000341926.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.38|19.38	3.817343|3.817343	0.70912|0.70912	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000338252;ENST00000508830;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508579;ENST00000515663|ENST00000437034	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.30182|.	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54|.	5.8|5.8	4.89|4.89	0.63831|0.63831	.|.	0.231496|.	0.42682|.	D|.	0.000667|.	T|T	0.80037|0.80037	0.4550|0.4550	M|M	0.88105|0.88105	2.93|2.93	0.80722|0.80722	D|D	1|1	P;P;D;D;D;P;D;P;P;D;P;D;P;P;D;P|.	0.76494|.	0.88;0.837;0.999;0.996;0.999;0.929;0.961;0.855;0.915;0.999;0.855;0.998;0.944;0.804;0.999;0.855|.	P;P;D;D;D;P;P;P;P;D;P;D;P;P;D;P|.	0.91635|.	0.745;0.692;0.979;0.93;0.979;0.889;0.889;0.69;0.628;0.999;0.697;0.998;0.842;0.566;0.998;0.69|.	T|T	0.82859|0.82859	-0.0249|-0.0249	10|5	0.54805|.	T|.	0.06|.	-9.419|-9.419	14.674|14.674	0.68964|0.68964	0.0:0.245:0.755:0.0|0.0:0.245:0.755:0.0	.|.	505;623;300;328;299;562;542;555;536;577;625;619;641;638;660;564|.	E9PDE4;B7Z468;E7EQA0;Q86YM9;E7EPY6;E7EVY3;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2|.	.;.;.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.|.	N|I	564;660;660;641;625;619;638;623;577;562;555;577;505;542;563;292;300|329	ENSP00000343421:S564N;ENSP00000425721:S660N;ENSP00000379158:S660N;ENSP00000352098:S641N;ENSP00000320319:S625N;ENSP00000379157:S619N;ENSP00000422176:S638N;ENSP00000422677:S623N;ENSP00000339914:S577N;ENSP00000421130:S562N;ENSP00000312523:S555N;ENSP00000422325:S577N;ENSP00000425670:S505N;ENSP00000426946:S542N;ENSP00000423638:S563N;ENSP00000425787:S292N;ENSP00000422929:S300N|.	ENSP00000312523:S555N|.	S|V	+|+	2|1	0|0	CAST|CAST	96126727|96126727	0.989000|0.989000	0.36119|0.36119	1.000000|1.000000	0.80357|0.80357	0.888000|0.888000	0.51559|0.51559	2.257000|2.257000	0.43240|0.43240	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	AGT|GTC	.	.		0.353	CAST-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000250199.2	NM_173062	
TSLP	85480	hgsc.bcm.edu	37	5	110409265	110409265	+	Silent	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:110409265G>T	ENST00000344895.3	+	3	472	c.273G>T	c.(271-273)gcG>gcT	p.A91A	TSLP_ENST00000420978.2_Silent_p.A91A|TSLP_ENST00000379706.4_5'UTR	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	91						extracellular space (GO:0005615)				breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		CCGGCTGCGCGTCGCTCGCCA	0.522																																					p.A91A		Atlas-SNP	.											.	TSLP	22	.	0			c.G273T						.						144.0	153.0	150.0					5																	110409265		2202	4300	6502	SO:0001819	synonymous_variant	85480	exon3			CTGCGCGTCGCTC	BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.273G>T	chr5.hg19:g.110409265G>T		213.0	0.0		287.0	122.0	NM_033035	Q8IW99	Silent	SNP	ENST00000344895.3	hg19	CCDS4101.1																																																																																			.	.		0.522	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250717.1	NM_033035	
PCDHGA9	56107	hgsc.bcm.edu	37	5	140782595	140782595	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:140782595G>T	ENST00000573521.1	+	1	76	c.76G>T	c.(76-78)Gcc>Tcc	p.A26S	PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	26					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTATGGGAGGCCAGGGCCAG	0.562																																					p.A26S		Atlas-SNP	.											.	PCDHGA9	110	.	0			c.G76T						.						48.0	55.0	53.0					5																	140782595		2074	4241	6315	SO:0001583	missense	56107	exon1			TGGGAGGCCAGGG	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.76G>T	chr5.hg19:g.140782595G>T	ENSP00000460274:p.Ala26Ser	92.0	0.0		148.0	52.0	NM_032089	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	hg19	CCDS58981.1																																																																																			.	.		0.562	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921	
FCHSD1	89848	hgsc.bcm.edu	37	5	141021270	141021270	+	Splice_Site	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:141021270G>A	ENST00000435817.2	-	19	2056	c.2006C>T	c.(2005-2007)cCg>cTg	p.P669L	FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522126.1_3'UTR|FCHSD1_ENST00000522783.1_3'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	669	Pro-rich.								FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCCTTACCGGCCTGAGTCG	0.502																																					p.P669L		Atlas-SNP	.											.	FCHSD1	51	.	0			c.C2006T						.						75.0	78.0	77.0					5																	141021270		1908	4138	6046	SO:0001630	splice_region_variant	89848	exon19			CTTACCGGCCTGA	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.2007+1C>T	chr5.hg19:g.141021270G>A		107.0	0.0		132.0	55.0	NM_033449	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	ENST00000435817.2	hg19	CCDS47295.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164558	0.57476	.	.	ENSG00000197948	ENST00000435817	T	0.33865	1.39	5.2	5.2	0.72013	.	0.074967	0.53938	D	0.000052	T	0.48295	0.1492	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.31052	-0.9957	10	0.42905	T	0.14	0.012	14.4281	0.67230	0.0:0.0:1.0:0.0	.	349;669	Q86WN1-2;Q86WN1	.;FCSD1_HUMAN	L	669	ENSP00000399259:P669L	ENSP00000399259:P669L	P	-	2	0	FCHSD1	141001454	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	2.978000	0.49305	2.861000	0.98227	0.655000	0.94253	CCG	.	.		0.502	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	NM_033449	Missense_Mutation
DPYSL3	1809	hgsc.bcm.edu	37	5	146777290	146777290	+	Missense_Mutation	SNP	C	C	A	rs377459296		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr5:146777290C>A	ENST00000398514.3	-	12	1771	c.1400G>T	c.(1399-1401)cGc>cTc	p.R467L	DPYSL3_ENST00000343218.5_Missense_Mutation_p.R581L|DPYSL3_ENST00000534907.1_Missense_Mutation_p.R93L	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	467					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTATGAAGCGGCCAGCCCC	0.567																																					p.R581L		Atlas-SNP	.											.	DPYSL3	58	.	0			c.G1742T						.						80.0	86.0	84.0					5																	146777290		2040	4184	6224	SO:0001583	missense	1809	exon12			ATGAAGCGGCCAG	D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1400G>T	chr5.hg19:g.146777290C>A	ENSP00000381526:p.Arg467Leu	44.0	0.0		45.0	23.0	NM_001197294	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	hg19	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	C	35	5.532479	0.96446	.	.	ENSG00000113657	ENST00000398514;ENST00000343218;ENST00000534907	T;T;T	0.76839	-1.05;-1.05;-1.05	6.03	6.03	0.97812	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.90943	0.7153	M	0.93808	3.46	0.80722	D	1	D;D	0.69078	0.997;0.994	P;P	0.61533	0.89;0.663	D	0.92247	0.5805	10	0.87932	D	0	-15.4814	20.5753	0.99366	0.0:1.0:0.0:0.0	.	581;467	B3SXQ8;Q14195	.;DPYL3_HUMAN	L	467;581;93	ENSP00000381526:R467L;ENSP00000343690:R581L;ENSP00000441819:R93L	ENSP00000343690:R581L	R	-	2	0	DPYSL3	146757483	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	6.046000	0.71029	2.868000	0.98415	0.557000	0.71058	CGC	.	.		0.567	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387	
ALDH5A1	7915	hgsc.bcm.edu	37	6	24495386	24495386	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr6:24495386C>T	ENST00000357578.3	+	1	307	c.162C>T	c.(160-162)ctC>ctT	p.L54L	GPLD1_ENST00000474784.1_5'UTR|ALDH5A1_ENST00000491546.1_Silent_p.L54L|ALDH5A1_ENST00000546278.1_Intron|ALDH5A1_ENST00000348925.2_Silent_p.L54L	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	54					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	TGGCGGGCCTCTCTGCGGCGC	0.816																																					p.L54L		Atlas-SNP	.											.	ALDH5A1	42	.	0			c.C162T						.						1.0	1.0	1.0					6																	24495386		249	517	766	SO:0001819	synonymous_variant	7915	exon1			GGGCCTCTCTGCG	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.162C>T	chr6.hg19:g.24495386C>T		51.0	0.0		82.0	31.0	NM_001080	B2RD26|G5E949|Q546H9|Q8N3W6	Silent	SNP	ENST00000357578.3	hg19	CCDS4555.1																																																																																			.	.		0.816	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2		
HIST1H2BC	8347	hgsc.bcm.edu	37	6	26123951	26123951	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr6:26123951C>A	ENST00000314332.5	-	1	187	c.182G>T	c.(181-183)gGc>gTc	p.G61V	HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.G61V|HIST1H2AC_ENST00000377791.2_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	61					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G61D(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						ATTCATGATGCCCATGGCCTT	0.552																																					p.G61V		Atlas-SNP	.											HIST1H2BC,tonsil,lymphoid_neoplasm,0,1	HIST1H2BC	35	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G182T						.						173.0	161.0	165.0					6																	26123951		2203	4300	6503	SO:0001583	missense	8347	exon1			ATGATGCCCATGG	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.182G>T	chr6.hg19:g.26123951C>A	ENSP00000321744:p.Gly61Val	104.0	0.0		98.0	49.0	NM_003526	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000314332.5	hg19	CCDS4584.1	.	.	.	.	.	.	.	.	.	.	.	19.20	3.781435	0.70222	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.21543	2.0;2.0	5.61	5.61	0.85477	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.38374	0.1038	.	.	.	0.58432	D	0.999999	P	0.49783	0.928	P	0.59703	0.862	T	0.10200	-1.0640	8	0.66056	D	0.02	.	18.9929	0.92801	0.0:1.0:0.0:0.0	.	61	P62807	H2B1C_HUMAN	V	61	ENSP00000321744:G61V;ENSP00000380180:G61V	ENSP00000321744:G61V	G	-	2	0	HIST1H2BC	26231930	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	5.828000	0.69307	2.799000	0.96334	0.650000	0.86243	GGC	.	.		0.552	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526	
HIST1H2AK	8330	hgsc.bcm.edu	37	6	27805803	27805803	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr6:27805803C>A	ENST00000330180.2	-	1	314	c.315G>T	c.(313-315)caG>caT	p.Q105H	HIST1H2BN_ENST00000606613.1_5'Flank|HIST1H2BN_ENST00000396980.3_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	105						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						GGACACCACCCTGGGCGATGG	0.587																																					p.Q105H		Atlas-SNP	.											.	HIST1H2AK	28	.	0			c.G315T						.						112.0	111.0	112.0					6																	27805803		2203	4300	6503	SO:0001583	missense	8330	exon1			ACCACCCTGGGCG	Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.315G>T	chr6.hg19:g.27805803C>A	ENSP00000330307:p.Gln105His	133.0	0.0		164.0	75.0	NM_003510	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000330180.2	hg19	CCDS4632.1	.	.	.	.	.	.	.	.	.	.	.	13.85	2.359331	0.41801	.	.	ENSG00000184348	ENST00000330180	T	0.43688	0.94	4.28	4.28	0.50868	.	0.000000	0.30168	U	0.010251	T	0.51686	0.1689	.	.	.	0.44000	D	0.996701	.	.	.	.	.	.	T	0.57207	-0.7851	7	0.62326	D	0.03	.	16.5671	0.84601	0.0:1.0:0.0:0.0	.	.	.	.	H	105	ENSP00000330307:Q105H	ENSP00000330307:Q105H	Q	-	3	2	HIST1H2AK	27913782	1.000000	0.71417	1.000000	0.80357	0.094000	0.18550	3.823000	0.55715	2.295000	0.77249	0.555000	0.69702	CAG	.	.		0.587	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043814.1	NM_003510	
ZSCAN23	222696	hgsc.bcm.edu	37	6	28402493	28402493	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr6:28402493A>G	ENST00000289788.4	-	4	1064	c.919T>C	c.(919-921)Tgc>Cgc	p.C307R	ZSCAN23_ENST00000486481.1_5'Flank	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	307					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						CAAACACTGCACTGGTAGCGC	0.532																																					p.C307R		Atlas-SNP	.											.	ZSCAN23	18	.	0			c.T919C						.						71.0	63.0	66.0					6																	28402493		692	1591	2283	SO:0001583	missense	222696	exon4			CACTGCACTGGTA	AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.919T>C	chr6.hg19:g.28402493A>G	ENSP00000289788:p.Cys307Arg	61.0	0.0		90.0	20.0	NM_001012455	Q96KV9	Missense_Mutation	SNP	ENST00000289788.4	hg19	CCDS47393.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.085953	0.76642	.	.	ENSG00000187987	ENST00000289788	D	0.85258	-1.96	4.32	4.32	0.51571	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43747	D	0.000528	D	0.93609	0.7959	H	0.96916	3.905	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.94922	0.8074	10	0.87932	D	0	.	11.4771	0.50304	1.0:0.0:0.0:0.0	.	307	Q3MJ62	ZSC23_HUMAN	R	307	ENSP00000289788:C307R	ENSP00000289788:C307R	C	-	1	0	ZSCAN23	28510472	1.000000	0.71417	0.956000	0.39512	0.976000	0.68499	8.593000	0.90832	1.801000	0.52704	0.528000	0.53228	TGC	.	.		0.532	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043751.2	XM_167147	
PKHD1	5314	hgsc.bcm.edu	37	6	51907825	51907825	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr6:51907825T>C	ENST00000371117.3	-	27	3204	c.2929A>G	c.(2929-2931)Aac>Gac	p.N977D	PKHD1_ENST00000340994.4_Missense_Mutation_p.N977D	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	977	IPT/TIG 4.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTGGTCTGGTTTGAGAAAATA	0.448																																					p.N977D		Atlas-SNP	.											.	PKHD1	927	.	0			c.A2929G						.						112.0	106.0	108.0					6																	51907825		2203	4300	6503	SO:0001583	missense	5314	exon27			TCTGGTTTGAGAA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2929A>G	chr6.hg19:g.51907825T>C	ENSP00000360158:p.Asn977Asp	94.0	0.0		116.0	27.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.412681	0.62511	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.78707	-1.2;-1.2	5.98	5.98	0.97165	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73345	0.3575	M	0.74881	2.28	0.33698	D	0.614125	B;P	0.48162	0.084;0.906	B;P	0.50754	0.1;0.649	T	0.73585	-0.3936	10	0.12103	T	0.63	.	13.9016	0.63806	0.0:0.0:0.0:1.0	.	977;977	P08F94-2;P08F94	.;PKHD1_HUMAN	D	977	ENSP00000360158:N977D;ENSP00000341097:N977D	ENSP00000341097:N977D	N	-	1	0	PKHD1	52015784	0.998000	0.40836	1.000000	0.80357	0.860000	0.49131	3.350000	0.52224	2.307000	0.77673	0.529000	0.55759	AAC	.	.		0.448	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
REV3L	5980	hgsc.bcm.edu	37	6	111680114	111680114	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr6:111680114A>T	ENST00000358835.3	-	18	7437	c.6983T>A	c.(6982-6984)aTc>aAc	p.I2328N	REV3L_ENST00000368805.1_Missense_Mutation_p.I2328N|REV3L_ENST00000435970.1_Missense_Mutation_p.I2250N|REV3L_ENST00000368802.3_Missense_Mutation_p.I2328N|REV3L-IT1_ENST00000411895.1_RNA			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2328					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GTCAGATGAGATGCAGTAGAA	0.418								DNA polymerases (catalytic subunits)																													p.I2328N		Atlas-SNP	.											.	REV3L	386	.	0			c.T6983A						.						162.0	150.0	154.0					6																	111680114		2203	4300	6503	SO:0001583	missense	5980	exon17			GATGAGATGCAGT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6983T>A	chr6.hg19:g.111680114A>T	ENSP00000351697:p.Ile2328Asn	115.0	0.0		124.0	65.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	hg19	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653588	0.88056	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	5.65	5.65	0.86999	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.253058	0.33772	N	0.004563	T	0.19208	0.0461	L	0.55834	1.745	0.50313	D	0.999863	D	0.55385	0.971	D	0.65323	0.934	T	0.00482	-1.1713	10	0.87932	D	0	.	15.883	0.79216	1.0:0.0:0.0:0.0	.	2328	O60673	DPOLZ_HUMAN	N	2328;2328;2328;2250;401	ENSP00000357792:I2328N;ENSP00000357795:I2328N;ENSP00000351697:I2328N;ENSP00000402003:I2250N	ENSP00000351697:I2328N	I	-	2	0	REV3L	111786807	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.721000	0.91446	2.150000	0.67090	0.455000	0.32223	ATC	.	.		0.418	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
ABCA13	154664	hgsc.bcm.edu	37	7	48428794	48428794	+	Silent	SNP	C	C	T	rs374031988		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr7:48428794C>T	ENST00000435803.1	+	37	11655	c.11631C>T	c.(11629-11631)aaC>aaT	p.N3877N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3877	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N3822N(1)|p.N3877N(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGGGGACAAACGGTGCCGGGA	0.493																																					p.N3877N		Atlas-SNP	.											ABCA13_ENST00000435803,caecum,carcinoma,0,2	ABCA13	1192	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C11631T						.	C		0,3780		0,0,1890	48.0	50.0	49.0		11631	-8.5	0.0	7		49	1,8251		0,1,4125	no	coding-synonymous	ABCA13	NM_152701.3		0,1,6015	TT,TC,CC		0.0121,0.0,0.0083		3877/5059	48428794	1,12031	1890	4126	6016	SO:0001819	synonymous_variant	154664	exon37			GACAAACGGTGCC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11631C>T	chr7.hg19:g.48428794C>T		150.0	0.0		172.0	59.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	hg19	CCDS47584.1																																																																																			.	.		0.493	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PRRT4	401399	hgsc.bcm.edu	37	7	127992475	127992475	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr7:127992475A>C	ENST00000446477.2	-	6	1448	c.1135T>G	c.(1135-1137)Ttg>Gtg	p.L379V	PRRT4_ENST00000489835.2_Intron|PRRT4_ENST00000535159.1_Missense_Mutation_p.L379V|PRRT4_ENST00000435512.1_Intron	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	379	Leu-rich.					integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						AGCGCCAGCAAGGCAACCAGG	0.751																																					p.L379V		Atlas-SNP	.											.	PRRT4	31	.	0			c.T1135G						.						14.0	28.0	24.0					7																	127992475		691	1590	2281	SO:0001583	missense	401399	exon6			CCAGCAAGGCAAC	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.1135T>G	chr7.hg19:g.127992475A>C	ENSP00000415026:p.Leu379Val	47.0	0.0		85.0	15.0	NM_001174164	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	hg19	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	A	8.386	0.838734	0.16891	.	.	ENSG00000224940	ENST00000446477;ENST00000535159;ENST00000489517	.	.	.	3.97	-3.9	0.04181	.	.	.	.	.	T	0.41511	0.1162	L	0.42245	1.32	0.48901	D	0.999722	B	0.30709	0.291	B	0.28916	0.096	T	0.09037	-1.0693	8	0.41790	T	0.15	-3.3447	6.9665	0.24625	0.5063:0.1222:0.3715:0.0	.	379	C9JH25	PRRT4_HUMAN	V	379	.	ENSP00000415026:L379V	L	-	1	2	PRRT4	127779711	0.008000	0.16893	0.783000	0.31826	0.406000	0.30931	-0.457000	0.06745	-0.794000	0.04468	-1.765000	0.00666	TTG	.	.		0.751	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
EZH2	2146	hgsc.bcm.edu	37	7	148515060	148515060	+	Silent	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr7:148515060T>A	ENST00000460911.1	-	10	1222	c.1134A>T	c.(1132-1134)acA>acT	p.T378T	EZH2_ENST00000476773.1_Silent_p.T369T|EZH2_ENST00000541220.1_Silent_p.T369T|EZH2_ENST00000350995.2_Silent_p.T339T|EZH2_ENST00000478654.1_Silent_p.T369T|EZH2_ENST00000483967.1_Silent_p.T369T|EZH2_ENST00000320356.2_Silent_p.T383T			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	378	Interaction with CDYL.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TATCACTGTCTGTATCCTTTG	0.507			Mis		DLBCL																																p.T383T		Atlas-SNP	.		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	EZH2	823	.	0			c.A1149T						.						173.0	141.0	152.0					7																	148515060		2203	4300	6503	SO:0001819	synonymous_variant	2146	exon10			ACTGTCTGTATCC		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1134A>T	chr7.hg19:g.148515060T>A		95.0	0.0		139.0	58.0	NM_004456	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Silent	SNP	ENST00000460911.1	hg19	CCDS56516.1																																																																																			.	.		0.507	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456	
TMEM176B	28959	hgsc.bcm.edu	37	7	150488705	150488705	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr7:150488705C>A	ENST00000447204.2	-	7	1099	c.727G>T	c.(727-729)Gaa>Taa	p.E243*	TMEM176B_ENST00000434545.1_Nonsense_Mutation_p.E243*|TMEM176B_ENST00000450753.2_Nonsense_Mutation_p.E206*|TMEM176B_ENST00000492607.1_Nonsense_Mutation_p.E243*|TMEM176B_ENST00000429904.2_Nonsense_Mutation_p.E243*|TMEM176B_ENST00000326442.5_Nonsense_Mutation_p.E243*	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	243					cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTGATCCTTCCTCATTCTGG	0.488																																					p.E243X		Atlas-SNP	.											.	TMEM176B	36	.	0			c.G727T						.						40.0	45.0	43.0					7																	150488705		2203	4300	6503	SO:0001587	stop_gained	28959	exon7			ATCCTTCCTCATT	AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.727G>T	chr7.hg19:g.150488705C>A	ENSP00000410269:p.Glu243*	51.0	0.0		43.0	14.0	NM_014020	B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Nonsense_Mutation	SNP	ENST00000447204.2	hg19	CCDS5908.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327588	0.60743	.	.	ENSG00000106565	ENST00000492607;ENST00000326442;ENST00000447204;ENST00000434545;ENST00000429904;ENST00000450753;ENST00000528038	.	.	.	3.8	2.91	0.33838	.	0.964414	0.08446	N	0.944640	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-4.3687	7.2132	0.25945	0.0:0.8769:0.0:0.1231	.	.	.	.	X	243;243;243;243;243;206;243	.	ENSP00000318409:E243X	E	-	1	0	TMEM176B	150119638	0.017000	0.18338	0.006000	0.13384	0.019000	0.09904	0.273000	0.18662	0.950000	0.37743	0.557000	0.71058	GAA	.	.		0.488	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349204.1	NM_014020	
ADAM32	203102	hgsc.bcm.edu	37	8	39022641	39022641	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr8:39022641A>C	ENST00000379907.4	+	9	886	c.759A>C	c.(757-759)gaA>gaC	p.E253D	ADAM32_ENST00000437682.2_Missense_Mutation_p.E260D|ADAM32_ENST00000519315.1_Missense_Mutation_p.E253D	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	253	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			AGGCAGATGAATTATTGCAAA	0.303																																					p.E253D		Atlas-SNP	.											.	ADAM32	70	.	0			c.A759C						.						109.0	102.0	104.0					8																	39022641		1802	4076	5878	SO:0001583	missense	203102	exon9			AGATGAATTATTG	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.759A>C	chr8.hg19:g.39022641A>C	ENSP00000369238:p.Glu253Asp	66.0	0.0		50.0	31.0	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	hg19	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	A	13.83	2.352992	0.41700	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907;ENST00000399826	T;T;T	0.63580	-0.05;-0.05;-0.05	5.09	2.63	0.31362	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.240568	0.21441	N	0.074483	T	0.44414	0.1292	N	0.05510	-0.035	0.23950	N	0.996379	B;B;B	0.28880	0.226;0.226;0.176	B;B;B	0.43386	0.262;0.418;0.267	T	0.41484	-0.9506	10	0.21540	T	0.41	.	4.5445	0.12074	0.7374:0.0:0.0929:0.1697	.	260;253;253	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	D	260;253;253;254	ENSP00000405978:E260D;ENSP00000429422:E253D;ENSP00000369238:E253D	ENSP00000369238:E253D	E	+	3	2	ADAM32	39141798	0.121000	0.22262	0.678000	0.29963	0.709000	0.40893	0.013000	0.13310	0.332000	0.23536	-0.379000	0.06801	GAA	.	.		0.303	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
ADAM32	203102	hgsc.bcm.edu	37	8	39022655	39022655	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr8:39022655T>C	ENST00000379907.4	+	9	900	c.773T>C	c.(772-774)tTt>tCt	p.F258S	ADAM32_ENST00000437682.2_Missense_Mutation_p.F265S|ADAM32_ENST00000519315.1_Missense_Mutation_p.F258S	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	258	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TTGCAAAAATTTTTAGAATGG	0.303																																					p.F258S		Atlas-SNP	.											.	ADAM32	70	.	0			c.T773C						.						94.0	88.0	90.0					8																	39022655		1794	4070	5864	SO:0001583	missense	203102	exon9			AAAAATTTTTAGA	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.773T>C	chr8.hg19:g.39022655T>C	ENSP00000369238:p.Phe258Ser	57.0	0.0		51.0	32.0	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	hg19	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.627337	0.66901	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907;ENST00000399826	T;T;T	0.73575	-0.76;-0.76;-0.76	5.09	5.09	0.68999	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.34291	N	0.004082	D	0.89347	0.6689	H	0.95574	3.69	0.39990	D	0.975028	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.92086	0.5676	10	0.87932	D	0	.	11.5338	0.50626	0.0:0.0:0.0:1.0	.	265;258;258	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	S	265;258;258;259	ENSP00000405978:F265S;ENSP00000429422:F258S;ENSP00000369238:F258S	ENSP00000369238:F258S	F	+	2	0	ADAM32	39141812	1.000000	0.71417	0.920000	0.36463	0.818000	0.46254	4.155000	0.58131	2.041000	0.60428	0.459000	0.35465	TTT	.	.		0.303	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
NUDCD1	84955	hgsc.bcm.edu	37	8	110305580	110305580	+	Missense_Mutation	SNP	T	T	G	rs150705202	byFrequency	TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr8:110305580T>G	ENST00000239690.4	-	4	1007	c.633A>C	c.(631-633)aaA>aaC	p.K211N	NUDCD1_ENST00000427660.2_Missense_Mutation_p.K182N	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			TACCTTGATTTTTCTTACTGA	0.358																																					p.K211N		Atlas-SNP	.											.	NUDCD1	58	.	0			c.A633C						.						92.0	97.0	95.0					8																	110305580		2203	4300	6503	SO:0001583	missense	84955	exon4			TTGATTTTTCTTA	AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.633A>C	chr8.hg19:g.110305580T>G	ENSP00000239690:p.Lys211Asn	57.0	0.0		101.0	16.0	NM_032869		Missense_Mutation	SNP	ENST00000239690.4	hg19	CCDS6312.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.467557	0.26335	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.18338	2.22;2.22	5.93	4.79	0.61399	.	0.263954	0.43579	D	0.000543	T	0.17408	0.0418	L	0.57536	1.79	0.31128	N	0.708077	B;B;B	0.22346	0.05;0.068;0.005	B;B;B	0.25884	0.064;0.019;0.005	T	0.12502	-1.0545	10	0.22706	T	0.39	-7.7157	9.3449	0.38102	0.0:0.1502:0.0:0.8498	.	124;211;182	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	N	211;182	ENSP00000239690:K211N;ENSP00000410707:K182N	ENSP00000239690:K211N	K	-	3	2	NUDCD1	110374756	0.996000	0.38824	1.000000	0.80357	0.990000	0.78478	1.164000	0.31810	1.094000	0.41399	0.533000	0.62120	AAA	.	T|1.000;C|0.000		0.358	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380996.1	NM_032869	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110520397	110520397	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr8:110520397G>T	ENST00000378402.5	+	70	11403	c.11299G>T	c.(11299-11301)Gca>Tca	p.A3767S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3767					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GATGGAATATGCAATGATGGT	0.383										HNSCC(38;0.096)																											p.A3767S		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G11299T						.						179.0	175.0	176.0					8																	110520397		1863	4103	5966	SO:0001583	missense	93035	exon70			GAATATGCAATGA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11299G>T	chr8.hg19:g.110520397G>T	ENSP00000367655:p.Ala3767Ser	89.0	0.0		121.0	5.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.586805	0.28268	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85955	-2.05;-1.9	6.17	6.17	0.99709	.	0.190262	0.47093	D	0.000250	T	0.79759	0.4501	L	0.43152	1.355	0.25558	N	0.987014	B	0.29716	0.255	B	0.26969	0.075	T	0.64080	-0.6491	10	0.09843	T	0.71	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	3767	Q86WI1	PKHL1_HUMAN	S	3767;695	ENSP00000367655:A3767S;ENSP00000437376:A695S	ENSP00000367655:A3767S	A	+	1	0	PKHD1L1	110589573	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.373000	0.44266	2.941000	0.99782	0.655000	0.94253	GCA	.	.		0.383	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
TBC1D31	93594	hgsc.bcm.edu	37	8	124089437	124089437	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr8:124089437A>C	ENST00000287380.1	+	2	254	c.164A>C	c.(163-165)gAc>gCc	p.D55A	TBC1D31_ENST00000378080.2_5'UTR|TBC1D31_ENST00000521676.1_5'UTR|TBC1D31_ENST00000327098.5_Missense_Mutation_p.D55A|TBC1D31_ENST00000309336.3_Missense_Mutation_p.D55A|TBC1D31_ENST00000522420.1_5'UTR	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	55						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										GGCACAGGCGACTGCTTAATT	0.358																																					p.D55A		Atlas-SNP	.											.	WDR67	97	.	0			c.A164C						.						137.0	130.0	132.0					8																	124089437		2203	4300	6503	SO:0001583	missense	93594	exon2			CAGGCGACTGCTT	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.164A>C	chr8.hg19:g.124089437A>C	ENSP00000287380:p.Asp55Ala	62.0	0.0		79.0	36.0	NM_001145088	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	ENST00000287380.1	hg19	CCDS6338.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.985612	0.53934	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522276	T;T;T;T	0.71579	-0.25;1.51;1.51;-0.58	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78298	0.4261	M	0.62723	1.935	0.80722	D	1	B;D;P	0.55800	0.087;0.973;0.842	B;P;B	0.55055	0.05;0.767;0.324	T	0.79422	-0.1810	10	0.49607	T	0.09	-27.8003	15.6607	0.77186	1.0:0.0:0.0:0.0	.	55;55;55	B7ZL19;Q96DN5;Q3KRB0	.;WDR67_HUMAN;.	A	55;55;55;45	ENSP00000287380:D55A;ENSP00000308358:D55A;ENSP00000312701:D55A;ENSP00000428891:D45A	ENSP00000287380:D55A	D	+	2	0	WDR67	124158618	1.000000	0.71417	0.218000	0.23776	0.715000	0.41141	8.384000	0.90160	2.106000	0.64143	0.528000	0.53228	GAC	.	.		0.358	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647	
TG	7038	hgsc.bcm.edu	37	8	134147018	134147018	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr8:134147018T>A	ENST00000220616.4	+	48	8327	c.8287T>A	c.(8287-8289)Tct>Act	p.S2763T	TG_ENST00000377869.1_Missense_Mutation_p.S2706T|TG_ENST00000542445.1_Missense_Mutation_p.S1133T|TG_ENST00000519543.1_Missense_Mutation_p.S896T	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2763					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGAACCAGGCTCTAAGACCTA	0.532																																					p.S2763T		Atlas-SNP	.											.	TG	416	.	0			c.T8287A						.						90.0	77.0	81.0					8																	134147018		2203	4300	6503	SO:0001583	missense	7038	exon48			CCAGGCTCTAAGA	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.8287T>A	chr8.hg19:g.134147018T>A	ENSP00000220616:p.Ser2763Thr	61.0	0.0		76.0	26.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.61|14.61	2.586793|2.586793	0.46110|0.46110	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000519178|ENST00000377869;ENST00000543313;ENST00000220616;ENST00000535932;ENST00000542445;ENST00000519543;ENST00000521107	.|T;T;T;T;T	.|0.68025	.|-0.08;-0.08;-0.29;-0.3;0.88	4.16|4.16	-2.6|-2.6	0.06190|0.06190	.|.	.|1.631640	.|0.03633	.|N	.|0.238144	T|T	0.49745|0.49745	0.1575|0.1575	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.45827	.|0.651;0.867;0.651	.|B;B;B	.|0.39027	.|0.15;0.288;0.15	T|T	0.49652|0.49652	-0.8917|-0.8917	5|10	.|0.52906	.|T	.|0.07	.|.	5.5132|5.5132	0.16892|0.16892	0.0:0.5016:0.1797:0.3186|0.0:0.5016:0.1797:0.3186	.|.	.|896;1133;2763	.|E7EVM0;F5GWW5;P01266	.|.;.;THYG_HUMAN	H|T	1218|2706;1569;2763;882;1133;896;167	.|ENSP00000367100:S2706T;ENSP00000220616:S2763T;ENSP00000441693:S1133T;ENSP00000430430:S896T;ENSP00000430161:S167T	.|ENSP00000220616:S2763T	L|S	+|+	2|1	0|0	TG|TG	134216200|134216200	0.031000|0.031000	0.19500|0.19500	0.203000|0.203000	0.23512|0.23512	0.449000|0.449000	0.32228|0.32228	-0.081000|-0.081000	0.11321|0.11321	-0.325000|-0.325000	0.08577|0.08577	0.172000|0.172000	0.16884|0.16884	CTC|TCT	.	.		0.532	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
WNK2	65268	hgsc.bcm.edu	37	9	96024181	96024181	+	Missense_Mutation	SNP	C	C	T	rs370654793		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr9:96024181C>T	ENST00000297954.4	+	12	3152	c.3152C>T	c.(3151-3153)tCg>tTg	p.S1051L	WNK2_ENST00000349097.3_Missense_Mutation_p.S663L|WNK2_ENST00000395477.2_Missense_Mutation_p.S1051L|WNK2_ENST00000427277.2_Missense_Mutation_p.S663L|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000356055.3_5'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1051					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						GCGGTCCTCTCGCCGCCTCTG	0.697																																					p.S1051L		Atlas-SNP	.											.	WNK2	277	.	0			c.C3152T						.	C	LEU/SER	0,4404		0,0,2202	38.0	35.0	36.0		3152	5.2	1.0	9		36	1,8593	1.2+/-3.3	0,1,4296	no	missense	WNK2	NM_006648.3	145	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1051/2218	96024181	1,12997	2202	4297	6499	SO:0001583	missense	65268	exon12			TCCTCTCGCCGCC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.3152C>T	chr9.hg19:g.96024181C>T	ENSP00000297954:p.Ser1051Leu	42.0	0.0		32.0	7.0	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.04|15.04	2.714816|2.714816	0.48622|0.48622	0.0|0.0	1.16E-4|1.16E-4	ENSG00000165238|ENSG00000165238	ENST00000432730|ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277	.|T;T;T;T	.|0.72615	.|-0.64;-0.67;-0.03;-0.02	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.307026	.|0.30890	.|N	.|0.008662	T|T	0.77432|0.77432	0.4129|0.4129	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.999	.|D;D;D;D	.|0.81914	.|0.99;0.991;0.995;0.978	T|T	0.79332|0.79332	-0.1847|-0.1847	5|10	.|0.59425	.|D	.|0.04	.|.	16.4324|16.4324	0.83853|0.83853	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1051;654;1051;1051	.|Q9Y3S1-2;A6PVR4;F8W9F9;Q9Y3S1	.|.;.;.;WNK2_HUMAN	C|L	1047|1051;1051;663;663	.|ENSP00000297954:S1051L;ENSP00000378860:S1051L;ENSP00000297876:S663L;ENSP00000411181:S663L	.|ENSP00000297954:S1051L	R|S	+|+	1|2	0|0	WNK2|WNK2	95064002|95064002	0.975000|0.975000	0.34042|0.34042	0.992000|0.992000	0.48379|0.48379	0.517000|0.517000	0.34286|0.34286	4.459000|4.459000	0.60102|0.60102	2.405000|2.405000	0.81733|0.81733	0.313000|0.313000	0.20887|0.20887	CGC|TCG	.	.		0.697	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
SETX	23064	hgsc.bcm.edu	37	9	135202688	135202688	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr9:135202688T>G	ENST00000224140.5	-	10	4479	c.4297A>C	c.(4297-4299)Act>Cct	p.T1433P	SETX_ENST00000393220.1_Missense_Mutation_p.T1433P|SETX_ENST00000372169.2_Missense_Mutation_p.T1433P	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1433					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GCATCATCAGTTGCTGGAGAC	0.418																																					p.T1433P		Atlas-SNP	.											.	SETX	234	.	0			c.A4297C						.						234.0	207.0	216.0					9																	135202688		2203	4300	6503	SO:0001583	missense	23064	exon10			CATCAGTTGCTGG	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4297A>C	chr9.hg19:g.135202688T>G	ENSP00000224140:p.Thr1433Pro	100.0	0.0		85.0	58.0	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	hg19	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	0.263	-0.997949	0.02145	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.86694	-2.06;-2.16;-1.77	5.43	-9.64	0.00541	.	1.135150	0.06451	N	0.727751	T	0.71204	0.3312	N	0.25144	0.715	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.09377	0.004;0.001;0.004	T	0.54944	-0.8217	10	0.33940	T	0.23	.	4.668	0.12675	0.1478:0.3876:0.3252:0.1394	.	1433;1433;1433	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	P	1433	ENSP00000224140:T1433P;ENSP00000361242:T1433P;ENSP00000376913:T1433P	ENSP00000224140:T1433P	T	-	1	0	SETX	134192509	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.767000	0.01795	-1.407000	0.02043	0.533000	0.62120	ACT	.	.		0.418	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
SUV39H2	79723	hgsc.bcm.edu	37	10	14923615	14923615	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:14923615G>T	ENST00000354919.6	+	2	148	c.148G>T	c.(148-150)Gaa>Taa	p.E50*	SUV39H2_ENST00000313519.5_Intron|RP11-398C13.6_ENST00000609399.1_lincRNA|SUV39H2_ENST00000378325.3_Nonsense_Mutation_p.E50*	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	50	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						TTATGAGGTGGAATACTTGTG	0.348																																					p.E50X		Atlas-SNP	.											.	SUV39H2	72	.	0			c.G148T						.						175.0	165.0	168.0					10																	14923615		876	1991	2867	SO:0001587	stop_gained	79723	exon2			GAGGTGGAATACT	AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	ENST00000354919.6:c.148G>T	chr10.hg19:g.14923615G>T	ENSP00000346997:p.Glu50*	105.0	0.0		130.0	43.0	NM_001193426	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Nonsense_Mutation	SNP	ENST00000354919.6	hg19	CCDS53494.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	5.984220|5.984220	0.97173|0.97173	.|.	.|.	ENSG00000152455|ENSG00000152455	ENST00000378325;ENST00000354919|ENST00000358298	.|.	.|.	.|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76601	.|0.4010	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73500	.|-0.3963	.|4	0.87932|.	D|.	0|.	.|.	19.5478|19.5478	0.95307|0.95307	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|C	50|39	.|.	ENSP00000346997:E50X|.	E|W	+|+	1|3	0|0	SUV39H2|SUV39H2	14963621|14963621	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.537000|6.537000	0.73847|0.73847	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	GAA|TGG	.	.		0.348	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670	
PCDH15	65217	hgsc.bcm.edu	37	10	55955617	55955617	+	Silent	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:55955617G>A	ENST00000320301.6	-	11	1525	c.1131C>T	c.(1129-1131)gcC>gcT	p.A377A	PCDH15_ENST00000395432.2_Silent_p.A340A|PCDH15_ENST00000373957.3_Silent_p.A355A|PCDH15_ENST00000395446.1_Silent_p.A377A|PCDH15_ENST00000395430.1_Silent_p.A377A|PCDH15_ENST00000373955.1_Silent_p.A377A|PCDH15_ENST00000373965.2_Silent_p.A377A|PCDH15_ENST00000395438.1_Silent_p.A377A|PCDH15_ENST00000414778.1_Silent_p.A382A|PCDH15_ENST00000395433.1_Silent_p.A355A|PCDH15_ENST00000409834.1_5'UTR|PCDH15_ENST00000361849.3_Silent_p.A377A|PCDH15_ENST00000395440.1_Silent_p.A377A|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Silent_p.A377A|PCDH15_ENST00000437009.1_Silent_p.A377A	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	377	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GACCGGCAAAGGCAGGAAGAG	0.373										HNSCC(58;0.16)																											p.A382A		Atlas-SNP	.											.	PCDH15	1715	.	0			c.C1146T						.						121.0	116.0	118.0					10																	55955617		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon12			GGCAAAGGCAGGA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1131C>T	chr10.hg19:g.55955617G>A		92.0	0.0		103.0	32.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	hg19	CCDS7248.1																																																																																			.	.		0.373	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
SLC16A9	220963	hgsc.bcm.edu	37	10	61413702	61413702	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:61413702C>T	ENST00000395348.3	-	5	1718	c.1082G>A	c.(1081-1083)gGg>gAg	p.G361E	SLC16A9_ENST00000395347.1_Missense_Mutation_p.G361E	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	361					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						AGCCAGTATCCCTAAAAGCAG	0.383																																					p.G361E		Atlas-SNP	.											.	SLC16A9	58	.	0			c.G1082A						.						108.0	102.0	104.0					10																	61413702		2203	4300	6503	SO:0001583	missense	220963	exon5			AGTATCCCTAAAA	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1082G>A	chr10.hg19:g.61413702C>T	ENSP00000378757:p.Gly361Glu	60.0	0.0		73.0	31.0	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	hg19	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.197422	0.79015	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.70749	-0.51;-0.51	4.93	4.93	0.64822	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.86924	0.6050	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89792	0.3969	10	0.87932	D	0	.	18.134	0.89612	0.0:1.0:0.0:0.0	.	361	Q7RTY1	MOT9_HUMAN	E	361	ENSP00000378757:G361E;ENSP00000378756:G361E	ENSP00000378756:G361E	G	-	2	0	SLC16A9	61083708	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.487000	0.81328	2.265000	0.75225	0.591000	0.81541	GGG	.	.		0.383	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
TET1	80312	hgsc.bcm.edu	37	10	70406241	70406241	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:70406241A>T	ENST00000373644.4	+	4	3964	c.3755A>T	c.(3754-3756)gAg>gTg	p.E1252V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1252					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GAATCAGCAGAGGAAAAGGTG	0.398																																					p.E1252V		Atlas-SNP	.											.	TET1	255	.	0			c.A3755T						.						75.0	72.0	73.0					10																	70406241		2203	4300	6503	SO:0001583	missense	80312	exon4			CAGCAGAGGAAAA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.3755A>T	chr10.hg19:g.70406241A>T	ENSP00000362748:p.Glu1252Val	140.0	0.0		178.0	83.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	8.572	0.880217	0.17467	.	.	ENSG00000138336	ENST00000373644	T	0.07444	3.19	5.25	4.04	0.47022	.	2.332980	0.01849	N	0.035799	T	0.06917	0.0176	N	0.08118	0	0.25671	N	0.985892	B	0.22276	0.067	B	0.18263	0.021	T	0.16719	-1.0393	10	0.59425	D	0.04	.	10.5843	0.45273	0.8388:0.1612:0.0:0.0	.	1252	Q8NFU7	TET1_HUMAN	V	1252	ENSP00000362748:E1252V	ENSP00000362748:E1252V	E	+	2	0	TET1	70076247	1.000000	0.71417	0.857000	0.33713	0.115000	0.19883	3.261000	0.51530	1.975000	0.57531	0.460000	0.39030	GAG	.	.		0.398	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
OPALIN	93377	hgsc.bcm.edu	37	10	98105735	98105735	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:98105735C>G	ENST00000371172.3	-	6	794	c.389G>C	c.(388-390)gGa>gCa	p.G130A	OPALIN_ENST00000393870.2_Missense_Mutation_p.G119A|OPALIN_ENST00000393871.1_Missense_Mutation_p.G107A|OPALIN_ENST00000419479.1_Missense_Mutation_p.G120A|OPALIN_ENST00000536387.1_Missense_Mutation_p.G120A	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	130						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						CCACCACAATCCCCTCCTTCT	0.522																																					p.G130A		Atlas-SNP	.											.	OPALIN	31	.	0			c.G389C						.						156.0	135.0	142.0					10																	98105735		2203	4300	6503	SO:0001583	missense	93377	exon6			CACAATCCCCTCC	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.389G>C	chr10.hg19:g.98105735C>G	ENSP00000360214:p.Gly130Ala	36.0	0.0		86.0	19.0	NM_033207	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	ENST00000371172.3	hg19	CCDS7448.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604345	0.46423	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.12	2.17	0.27698	.	0.474665	0.18221	N	0.147886	T	0.50017	0.1591	L	0.34521	1.04	0.09310	N	1	D;D;B	0.76494	0.999;0.999;0.015	D;D;B	0.87578	0.998;0.998;0.018	T	0.37549	-0.9701	9	0.87932	D	0	-12.9564	10.3513	0.43937	0.0:0.611:0.389:0.0	.	107;130;120	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	A	130;107;120;119;120	.	ENSP00000360214:G130A	G	-	2	0	OPALIN	98095725	0.002000	0.14202	0.055000	0.19348	0.836000	0.47400	0.621000	0.24418	0.459000	0.27016	0.650000	0.86243	GGA	.	.		0.522	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049606.1	NM_033207	
FGF8	2253	hgsc.bcm.edu	37	10	103535640	103535640	+	Silent	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:103535640G>A	ENST00000344255.3	-	1	17	c.18C>T	c.(16-18)tcC>tcT	p.S6S	FGF8_ENST00000347978.2_Silent_p.S6S|FGF8_ENST00000320185.2_Silent_p.S6S|FGF8_ENST00000485728.1_5'UTR|FGF8_ENST00000346714.3_Silent_p.S6S			P55075	FGF8_HUMAN	fibroblast growth factor 8 (androgen-induced)	6					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in mesendoderm migration (GO:0090134)|cell proliferation in forebrain (GO:0021846)|corticotropin hormone secreting cell differentiation (GO:0060128)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral axon guidance (GO:0033563)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|forebrain neuron development (GO:0021884)|gastrulation (GO:0007369)|gonad development (GO:0008406)|heart looping (GO:0001947)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lung morphogenesis (GO:0060425)|male genitalia development (GO:0030539)|MAPK cascade (GO:0000165)|mesodermal cell migration (GO:0008078)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|midbrain-hindbrain boundary development (GO:0030917)|motor neuron axon guidance (GO:0008045)|negative regulation of cardiac muscle tissue development (GO:0055026)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate morphogenesis (GO:0001839)|neuroepithelial cell differentiation (GO:0060563)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|pallium development (GO:0021543)|patterning of blood vessels (GO:0001569)|pharyngeal system development (GO:0060037)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitosis (GO:0045840)|positive regulation of organ growth (GO:0046622)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)|signal transduction involved in regulation of gene expression (GO:0023019)|subpallium development (GO:0021544)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(2)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		AGCTCAGCGCGGAGCGGGGGC	0.811																																					p.S6S		Atlas-SNP	.											.	FGF8	23	.	0			c.C18T						.						1.0	1.0	1.0					10																	103535640		210	476	686	SO:0001819	synonymous_variant	2253	exon1			CAGCGCGGAGCGG	D38752	CCDS7515.1, CCDS7516.1, CCDS7517.1, CCDS7518.1, CCDS73185.1	10q25-q26	2014-01-30			ENSG00000107831	ENSG00000107831		"""Endogenous ligands"""	3686	protein-coding gene	gene with protein product		600483				8595889	Standard	NM_033164		Approved	AIGF	uc001ktq.2	P55075	OTTHUMG00000018940	ENST00000344255.3:c.18C>T	chr10.hg19:g.103535640G>A		198.0	0.0		250.0	52.0	NM_033164	A1A514|Q14915|Q15766	Silent	SNP	ENST00000344255.3	hg19	CCDS7517.1																																																																																			.	.		0.811	FGF8-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049999.1	NM_006119, NM_033165	
FANK1	92565	hgsc.bcm.edu	37	10	127685132	127685132	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:127685132G>T	ENST00000368693.1	+	5	516	c.412G>T	c.(412-414)Gat>Tat	p.D138Y	FANK1_ENST00000368695.1_Missense_Mutation_p.D132Y			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	138						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				TGTTAAGGTTGATGTTCCCAA	0.458																																					p.D138Y		Atlas-SNP	.											.	FANK1	46	.	0			c.G412T						.						250.0	237.0	241.0					10																	127685132		2203	4300	6503	SO:0001583	missense	92565	exon5			AAGGTTGATGTTC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.412G>T	chr10.hg19:g.127685132G>T	ENSP00000357682:p.Asp138Tyr	85.0	0.0		58.0	38.0	NM_145235	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	hg19	CCDS31309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.50|15.50	2.851790|2.851790	0.51270|0.51270	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692|ENST00000456942	T;T;T|.	0.56103|.	0.48;0.48;0.48|.	5.02|5.02	5.02|5.02	0.67125|0.67125	Ankyrin repeat-containing domain (4);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.68054|0.68054	0.2959|0.2959	M|M	0.77486|0.77486	2.375|2.375	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.76071|.	0.964;0.964;0.987|.	T|T	0.68868|0.68868	-0.5295|-0.5295	10|5	0.87932|.	D|.	0|.	-33.5661|-33.5661	8.9647|8.9647	0.35869|0.35869	0.0816:0.1519:0.7665:0.0|0.0816:0.1519:0.7665:0.0	.|.	164;138;138|.	Q8TC84-3;Q8TC84-2;Q8TC84|.	.;.;FANK1_HUMAN|.	Y|F	132;138;138;164|32	ENSP00000357684:D132Y;ENSP00000357682:D138Y;ENSP00000357680:D138Y|.	ENSP00000357680:D138Y|.	D|L	+|+	1|3	0|2	FANK1|FANK1	127675122|127675122	0.999000|0.999000	0.42202|0.42202	0.950000|0.950000	0.38849|0.38849	0.707000|0.707000	0.40811|0.40811	3.310000|3.310000	0.51911|0.51911	2.628000|2.628000	0.89032|0.89032	0.650000|0.650000	0.86243|0.86243	GAT|TTG	.	.		0.458	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
SLC5A12	159963	hgsc.bcm.edu	37	11	26743147	26743147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:26743147G>A	ENST00000396005.3	-	1	424	c.115C>T	c.(115-117)Cga>Tga	p.R39*	SLC5A12_ENST00000280467.6_Nonsense_Mutation_p.R39*	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	39					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AGGAACTCTCGGGAAGTTGCC	0.502																																					p.R39X		Atlas-SNP	.											.	SLC5A12	134	.	0			c.C115T						.						72.0	74.0	73.0					11																	26743147		2203	4299	6502	SO:0001587	stop_gained	159963	exon1			ACTCTCGGGAAGT	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.115C>T	chr11.hg19:g.26743147G>A	ENSP00000379326:p.Arg39*	211.0	0.0		257.0	16.0	NM_178498	Q86UC7	Nonsense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	38	6.792305	0.97841	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	.	.	.	5.59	-1.02	0.10135	.	0.130324	0.48767	D	0.000172	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	7.7191	0.28721	0.0:0.2948:0.2871:0.4181	.	.	.	.	X	39	.	ENSP00000280467:R39X	R	-	1	2	SLC5A12	26699723	0.012000	0.17670	0.014000	0.15608	0.981000	0.71138	1.284000	0.33249	-0.416000	0.07473	0.585000	0.79938	CGA	.	.		0.502	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
OR5D14	219436	hgsc.bcm.edu	37	11	55563231	55563231	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:55563231A>G	ENST00000335605.1	+	1	200	c.200A>G	c.(199-201)cAc>cGc	p.H67R		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TTCCTTAGTCACCTCTCTTTT	0.383																																					p.H67R		Atlas-SNP	.											.	OR5D14	116	.	0			c.A200G						.						220.0	198.0	206.0					11																	55563231		2200	4296	6496	SO:0001583	missense	219436	exon1			TTAGTCACCTCTC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.200A>G	chr11.hg19:g.55563231A>G	ENSP00000334456:p.His67Arg	51.0	0.0		71.0	18.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	hg19	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	a	3.513	-0.099367	0.07010	.	.	ENSG00000186113	ENST00000335605	T	0.12465	2.68	5.08	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000233	T	0.19446	0.0467	M	0.89414	3.03	0.09310	N	1	B	0.24533	0.105	B	0.20767	0.031	T	0.24835	-1.0149	10	0.72032	D	0.01	-12.2834	5.8009	0.18414	0.7686:0.0:0.0831:0.1483	.	67	Q8NGL3	OR5DE_HUMAN	R	67	ENSP00000334456:H67R	ENSP00000334456:H67R	H	+	2	0	OR5D14	55319807	0.003000	0.15002	0.234000	0.24042	0.016000	0.09150	2.096000	0.41738	0.792000	0.33850	-0.263000	0.10527	CAC	.	.		0.383	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
OR5D14	219436	hgsc.bcm.edu	37	11	55563576	55563576	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:55563576A>G	ENST00000335605.1	+	1	545	c.545A>G	c.(544-546)gAg>gGg	p.E182G		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TTCTTTTGTGAGTATACTGCT	0.468																																					p.E182G		Atlas-SNP	.											.	OR5D14	116	.	0			c.A545G						.						219.0	217.0	218.0					11																	55563576		2200	4296	6496	SO:0001583	missense	219436	exon1			TTTGTGAGTATAC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.545A>G	chr11.hg19:g.55563576A>G	ENSP00000334456:p.Glu182Gly	85.0	0.0		80.0	14.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	hg19	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	a	13.33	2.205426	0.39003	.	.	ENSG00000186113	ENST00000335605	T	0.00227	8.5	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000276	T	0.00845	0.0028	H	0.95816	3.725	0.38932	D	0.957962	D	0.67145	0.996	D	0.70016	0.967	T	0.52472	-0.8571	10	0.87932	D	0	-17.3985	13.7086	0.62654	1.0:0.0:0.0:0.0	.	182	Q8NGL3	OR5DE_HUMAN	G	182	ENSP00000334456:E182G	ENSP00000334456:E182G	E	+	2	0	OR5D14	55320152	1.000000	0.71417	0.839000	0.33178	0.004000	0.04260	4.390000	0.59646	1.916000	0.55485	0.523000	0.50628	GAG	.	.		0.468	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
OR5W2	390148	hgsc.bcm.edu	37	11	55681236	55681236	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:55681236A>T	ENST00000344514.1	-	1	822	c.823T>A	c.(823-825)Tca>Aca	p.S275T		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TAAAACAATGAGGTCATTTTA	0.408																																					p.S275T	Melanoma(48;171 1190 15239 43886 49348)	Atlas-SNP	.											.	OR5W2	112	.	0			c.T823A						.						64.0	71.0	69.0					11																	55681236		2201	4296	6497	SO:0001583	missense	390148	exon1			ACAATGAGGTCAT	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.823T>A	chr11.hg19:g.55681236A>T	ENSP00000342448:p.Ser275Thr	186.0	0.0		209.0	47.0	NM_001001960		Missense_Mutation	SNP	ENST00000344514.1	hg19	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.759001	0.31137	.	.	ENSG00000187612	ENST00000344514	T	0.00235	8.48	5.01	3.87	0.44632	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34268	N	0.004119	T	0.00468	0.0015	M	0.74389	2.26	0.09310	N	1	D	0.71674	0.998	D	0.75484	0.986	T	0.43163	-0.9408	10	0.56958	D	0.05	.	8.9155	0.35579	0.91:0.0:0.09:0.0	.	275	Q8NH69	OR5W2_HUMAN	T	275	ENSP00000342448:S275T	ENSP00000342448:S275T	S	-	1	0	OR5W2	55437812	0.537000	0.26386	0.023000	0.16930	0.375000	0.29983	1.313000	0.33585	0.748000	0.32831	0.448000	0.29417	TCA	.	.		0.408	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
OR8J3	81168	hgsc.bcm.edu	37	11	55904552	55904552	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:55904552G>T	ENST00000301529.1	-	1	642	c.643C>A	c.(643-645)Cta>Ata	p.L215I		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TAAGATACTAGAACTGTAATC	0.363																																					p.L215I		Atlas-SNP	.											OR8J3,NS,carcinoma,0,1	OR8J3	112	.	0			c.C643A						.						94.0	96.0	95.0					11																	55904552		2201	4296	6497	SO:0001583	missense	81168	exon1			ATACTAGAACTGT		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.643C>A	chr11.hg19:g.55904552G>T	ENSP00000301529:p.Leu215Ile	54.0	1.0		44.0	10.0	NM_001004064	Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	hg19	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	G	7.010	0.556557	0.13436	.	.	ENSG00000167822	ENST00000301529	T	0.00235	8.48	3.27	-2.52	0.06346	GPCR, rhodopsin-like superfamily (1);	0.982347	0.08299	N	0.967222	T	0.00144	0.0004	L	0.28556	0.865	0.09310	N	1	B	0.17465	0.022	B	0.26969	0.075	T	0.12578	-1.0542	10	0.44086	T	0.13	.	2.663	0.05032	0.0958:0.2364:0.1955:0.4722	.	215	Q8NGG0	OR8J3_HUMAN	I	215	ENSP00000301529:L215I	ENSP00000301529:L215I	L	-	1	2	OR8J3	55661128	0.000000	0.05858	0.048000	0.18961	0.728000	0.41692	-2.323000	0.01117	-0.912000	0.03837	0.297000	0.19635	CTA	.	.		0.363	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	
SLC22A25	387601	hgsc.bcm.edu	37	11	62984853	62984853	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:62984853T>C	ENST00000306494.6	-	4	762	c.763A>G	c.(763-765)Att>Gtt	p.I255V	SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron|SLC22A25_ENST00000403374.2_Missense_Mutation_p.I89V	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						TGGTCTCGAATGACAAAAGCC	0.443																																					p.I255V		Atlas-SNP	.											.	SLC22A25	87	.	0			c.A763G						.						144.0	130.0	134.0					11																	62984853		2201	4298	6499	SO:0001583	missense	387601	exon4			CTCGAATGACAAA	AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.763A>G	chr11.hg19:g.62984853T>C	ENSP00000307443:p.Ile255Val	97.0	0.0		117.0	28.0	NM_199352		Missense_Mutation	SNP	ENST00000306494.6	hg19	CCDS31592.1	.	.	.	.	.	.	.	.	.	.	T	7.578	0.668168	0.14710	.	.	ENSG00000196600	ENST00000306494;ENST00000403374	T;T	0.60171	0.26;0.21	3.49	-4.23	0.03789	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.279859	0.34178	N	0.004181	T	0.42966	0.1226	L	0.51914	1.62	0.09310	N	1	B;B	0.28026	0.047;0.198	B;B	0.31016	0.123;0.123	T	0.30995	-0.9959	10	0.25751	T	0.34	.	8.3022	0.32021	0.6482:0.0:0.0:0.3518	.	253;255	A4IF29;Q6T423	.;S22AP_HUMAN	V	255;89	ENSP00000307443:I255V;ENSP00000384208:I89V	ENSP00000307443:I255V	I	-	1	0	SLC22A25	62741429	0.014000	0.17966	0.000000	0.03702	0.012000	0.07955	-0.099000	0.11007	-1.369000	0.02147	0.432000	0.28606	ATT	.	.		0.443	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352	
TENM4	26011	hgsc.bcm.edu	37	11	78369713	78369713	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:78369713C>T	ENST00000278550.7	-	34	8162	c.7700G>A	c.(7699-7701)gGc>gAc	p.G2567D		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2567					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GACCCCCTTGCCAAAGACTGA	0.537																																					p.G2567D		Atlas-SNP	.											.	.	.	.	0			c.G7700A						.						46.0	48.0	47.0					11																	78369713		2031	4182	6213	SO:0001583	missense	26011	exon34			CCCTTGCCAAAGA	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7700G>A	chr11.hg19:g.78369713C>T	ENSP00000278550:p.Gly2567Asp	67.0	0.0		84.0	41.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	hg19	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599009	0.87055	.	.	ENSG00000149256	ENST00000278550	D	0.91631	-2.88	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.96002	0.8698	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94941	0.8091	9	.	.	.	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	2567	Q6N022	TEN4_HUMAN	D	2567	ENSP00000278550:G2567D	.	G	-	2	0	ODZ4	78047361	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.609000	0.82925	2.941000	0.99782	0.655000	0.94253	GGC	.	.		0.537	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
GPR83	10888	hgsc.bcm.edu	37	11	94113805	94113805	+	Missense_Mutation	SNP	C	C	T	rs139287789		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:94113805C>T	ENST00000243673.2	-	4	953	c.782G>A	c.(781-783)cGt>cAt	p.R261H	GPR83_ENST00000539203.2_Missense_Mutation_p.R219H	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	261					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CTTGGCCACACGAGCGTAGGC	0.527																																					p.R261H		Atlas-SNP	.											.	GPR83	47	.	0			c.G782A						.	C	HIS/ARG	0,4402		0,0,2201	72.0	64.0	67.0		782	4.4	0.4	11	dbSNP_134	67	1,8595	1.2+/-3.3	0,1,4297	no	missense	GPR83	NM_016540.3	29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	benign	261/424	94113805	1,12997	2201	4298	6499	SO:0001583	missense	10888	exon4			GCCACACGAGCGT	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.782G>A	chr11.hg19:g.94113805C>T	ENSP00000243673:p.Arg261His	78.0	0.0		102.0	30.0	NM_016540	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	ENST00000243673.2	hg19	CCDS8297.1	.	.	.	.	.	.	.	.	.	.	C	9.499	1.102782	0.20632	0.0	1.16E-4	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.39056	1.1;1.1	5.41	4.44	0.53790	GPCR, rhodopsin-like superfamily (1);	0.258283	0.36703	N	0.002441	T	0.27524	0.0676	L	0.33093	0.98	0.23411	N	0.997737	B	0.18461	0.028	B	0.15870	0.014	T	0.09930	-1.0652	10	0.15499	T	0.54	.	8.617	0.33838	0.1509:0.586:0.2631:0.0	.	261	Q9NYM4	GPR83_HUMAN	H	261;219	ENSP00000243673:R261H;ENSP00000441550:R219H	ENSP00000243673:R261H	R	-	2	0	GPR83	93753453	0.995000	0.38212	0.363000	0.25875	0.982000	0.71751	2.604000	0.46274	2.535000	0.85469	0.655000	0.94253	CGT	.	C|1.000;T|0.000		0.527	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396232.1	NM_016540	
MTMR2	8898	hgsc.bcm.edu	37	11	95595469	95595469	+	Silent	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:95595469C>A	ENST00000346299.5	-	4	664	c.324G>T	c.(322-324)acG>acT	p.T108T	MTMR2_ENST00000484818.1_5'UTR|MTMR2_ENST00000393223.3_Silent_p.T36T|MTMR2_ENST00000409459.1_Silent_p.T36T|MTMR2_ENST00000352297.7_Silent_p.T36T	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	108	GRAM.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACCTATAATTCGTGACAGTCA	0.358																																					p.T108T		Atlas-SNP	.											.	MTMR2	79	.	0			c.G324T	GRCh37	CD013478	MTMR2	D		.						74.0	73.0	73.0					11																	95595469		2201	4298	6499	SO:0001819	synonymous_variant	8898	exon4			ATAATTCGTGACA	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.324G>T	chr11.hg19:g.95595469C>A		77.0	0.0		60.0	7.0	NM_016156	A6NN98|Q9UPS9	Silent	SNP	ENST00000346299.5	hg19	CCDS8305.1																																																																																			.	.		0.358	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
CHEK1	1111	hgsc.bcm.edu	37	11	125513708	125513708	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:125513708C>T	ENST00000534070.1	+	9	1091	c.836C>T	c.(835-837)aCt>aTt	p.T279I	CHEK1_ENST00000427383.2_Missense_Mutation_p.T295I|CHEK1_ENST00000544373.1_Missense_Mutation_p.T279I|CHEK1_ENST00000532449.1_3'UTR|CHEK1_ENST00000524737.1_Missense_Mutation_p.T279I|CHEK1_ENST00000428830.2_Missense_Mutation_p.T279I|CHEK1_ENST00000278916.3_Missense_Mutation_p.T279I|CHEK1_ENST00000438015.1_Missense_Mutation_p.T279I	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	279					cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		CCCCGAGTCACTTCAGGTGGT	0.393								Other conserved DNA damage response genes																													p.T279I		Atlas-SNP	.											.	CHEK1	44	.	0			c.C836T						.						85.0	85.0	85.0					11																	125513708		2201	4299	6500	SO:0001583	missense	1111	exon9			GAGTCACTTCAGG	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.836C>T	chr11.hg19:g.125513708C>T	ENSP00000435371:p.Thr279Ile	54.0	0.0		45.0	9.0	NM_001244846	A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Missense_Mutation	SNP	ENST00000534070.1	hg19	CCDS8459.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855337	0.32791	.	.	ENSG00000149554	ENST00000438015;ENST00000427383;ENST00000428830;ENST00000544373;ENST00000534070;ENST00000524737;ENST00000278916	T;T;T;T;T;T;T	0.72835	-0.69;-0.36;-0.69;-0.68;-0.69;-0.69;-0.68	5.26	4.34	0.51931	Protein kinase-like domain (1);	0.643479	0.16320	N	0.219599	T	0.49184	0.1542	N	0.04959	-0.14	0.41567	D	0.988666	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.0	T	0.38929	-0.9638	10	0.21014	T	0.42	-2.7108	13.4504	0.61167	0.0:0.8423:0.1577:0.0	.	279;295;279;279	F5H7S4;E7EPP6;B5BTY6;O14757	.;.;.;CHK1_HUMAN	I	279;295;279;279;279;279;279	ENSP00000388648:T279I;ENSP00000391090:T295I;ENSP00000412504:T279I;ENSP00000442317:T279I;ENSP00000435371:T279I;ENSP00000432890:T279I;ENSP00000278916:T279I	ENSP00000278916:T279I	T	+	2	0	CHEK1	125018918	0.979000	0.34478	0.990000	0.47175	0.976000	0.68499	2.468000	0.45102	1.356000	0.45884	0.655000	0.94253	ACT	.	.		0.393	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274	
TSPAN9	10867	hgsc.bcm.edu	37	12	3390913	3390913	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr12:3390913A>C	ENST00000011898.5	+	8	739	c.578A>C	c.(577-579)aAg>aCg	p.K193T	TSPAN9_ENST00000537971.1_Missense_Mutation_p.K193T|TSPAN9_ENST00000407263.1_Missense_Mutation_p.K193T	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	193						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			TGCTATGAAAAGGTGAAGATG	0.622																																					p.K193T		Atlas-SNP	.											.	TSPAN9	20	.	0			c.A578C						.						128.0	101.0	110.0					12																	3390913		2203	4300	6503	SO:0001583	missense	10867	exon8			ATGAAAAGGTGAA	AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.578A>C	chr12.hg19:g.3390913A>C	ENSP00000011898:p.Lys193Thr	86.0	0.0		103.0	22.0	NM_006675	D3DUQ7|Q53FV2|Q6FGJ8	Missense_Mutation	SNP	ENST00000011898.5	hg19	CCDS8520.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.462408	0.63513	.	.	ENSG00000011105	ENST00000537971;ENST00000011898;ENST00000407263	D;D;D	0.88664	-2.41;-2.41;-2.41	4.42	4.42	0.53409	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	D	0.85894	0.5803	L	0.41573	1.285	0.80722	D	1	B	0.27732	0.187	B	0.38880	0.284	T	0.81611	-0.0854	10	0.26408	T	0.33	.	11.6265	0.51149	1.0:0.0:0.0:0.0	.	193	O75954	TSN9_HUMAN	T	193	ENSP00000444799:K193T;ENSP00000011898:K193T;ENSP00000384488:K193T	ENSP00000011898:K193T	K	+	2	0	TSPAN9	3261174	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.525000	0.53502	1.640000	0.50565	0.459000	0.35465	AAG	.	.		0.622	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317606.2	NM_006675	
ACRBP	84519	hgsc.bcm.edu	37	12	6756045	6756045	+	Silent	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr12:6756045G>A	ENST00000229243.2	-	2	270	c.177C>T	c.(175-177)acC>acT	p.T59T	ACRBP_ENST00000414226.2_Silent_p.T59T|ACRBP_ENST00000536350.1_Silent_p.T59T	NM_032489.2	NP_115878.2			acrosin binding protein											NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						GGAGACGGCAGGTAGTCTCTG	0.587																																					p.T59T		Atlas-SNP	.											.	ACRBP	52	.	0			c.C177T						.						98.0	91.0	93.0					12																	6756045		2203	4300	6503	SO:0001819	synonymous_variant	84519	exon2			ACGGCAGGTAGTC	AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.177C>T	chr12.hg19:g.6756045G>A		86.0	0.0		119.0	54.0	NM_032489		Silent	SNP	ENST00000229243.2	hg19	CCDS8554.1																																																																																			.	.		0.587	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400703.1	NM_032489	
CNOT2	4848	hgsc.bcm.edu	37	12	70726591	70726591	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr12:70726591A>G	ENST00000418359.3	+	8	1065	c.614A>G	c.(613-615)aAt>aGt	p.N205S	CNOT2_ENST00000229195.3_Missense_Mutation_p.N205S|CNOT2_ENST00000551483.1_5'Flank|CNOT2_ENST00000548230.1_3'UTR	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	205					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TTTGGAATGAATAACTCCTTA	0.313																																					p.N205S		Atlas-SNP	.											.	CNOT2	53	.	0			c.A614G						.						127.0	133.0	131.0					12																	70726591		2203	4298	6501	SO:0001583	missense	4848	exon8			GAATGAATAACTC	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.614A>G	chr12.hg19:g.70726591A>G	ENSP00000412091:p.Asn205Ser	59.0	0.0		87.0	45.0	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	hg19	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614160	0.46631	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000552915;ENST00000550641;ENST00000548159;ENST00000551043;ENST00000551873;ENST00000550194;ENST00000550155	T;T;T;T;T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	5.68	5.68	0.88126	.	0.081932	0.85682	D	0.000000	T	0.60586	0.2280	L	0.44542	1.39	0.48571	D	0.999679	B	0.20887	0.049	B	0.14023	0.01	T	0.56637	-0.7946	10	0.09590	T	0.72	-7.1856	14.5043	0.67743	1.0:0.0:0.0:0.0	.	205	Q9NZN8	CNOT2_HUMAN	S	205;205;205;144;185;196;205;120;197;15	ENSP00000450318:N205S;ENSP00000229195:N205S;ENSP00000412091:N205S;ENSP00000447497:N144S;ENSP00000448024:N185S;ENSP00000449659:N196S;ENSP00000449260:N205S;ENSP00000450090:N120S;ENSP00000449446:N197S;ENSP00000448499:N15S	ENSP00000229195:N205S	N	+	2	0	CNOT2	69012858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.044000	0.57361	2.164000	0.68074	0.477000	0.44152	AAT	.	.		0.313	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
RAB21	23011	hgsc.bcm.edu	37	12	72164380	72164380	+	Silent	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr12:72164380A>T	ENST00000261263.3	+	3	484	c.228A>T	c.(226-228)gcA>gcT	p.A76A		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	76					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						AGGATACGGCAGGTCAAGAGA	0.338																																					p.A76A		Atlas-SNP	.											.	RAB21	17	.	0			c.A228T						.						72.0	77.0	75.0					12																	72164380		2203	4300	6503	SO:0001819	synonymous_variant	23011	exon3			TACGGCAGGTCAA	AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	ENST00000261263.3:c.228A>T	chr12.hg19:g.72164380A>T		67.0	0.0		95.0	37.0	NM_014999	Q14466|Q569H3	Silent	SNP	ENST00000261263.3	hg19	CCDS9003.1																																																																																			.	.		0.338	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404855.1		
APPL2	55198	hgsc.bcm.edu	37	12	105591692	105591692	+	Silent	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr12:105591692A>G	ENST00000258530.3	-	11	1128	c.903T>C	c.(901-903)taT>taC	p.Y301Y	APPL2_ENST00000549573.1_Intron|APPL2_ENST00000551662.1_Silent_p.Y307Y|APPL2_ENST00000539978.2_Silent_p.Y258Y	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GGGTGAAGAAATAAAGCCTCT	0.542																																					p.Y307Y		Atlas-SNP	.											.	APPL2	69	.	0			c.T921C						.						84.0	85.0	85.0					12																	105591692		2203	4300	6503	SO:0001819	synonymous_variant	55198	exon11			GAAGAAATAAAGC	AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.903T>C	chr12.hg19:g.105591692A>G		140.0	0.0		166.0	63.0	NM_001251904	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	ENST00000258530.3	hg19	CCDS9101.1																																																																																			.	.		0.542	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406238.3	NM_018171	
MICU2	221154	hgsc.bcm.edu	37	13	22084242	22084242	+	Splice_Site	SNP	T	T	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr13:22084242T>G	ENST00000382374.4	-	8	729		c.e8-2			NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2						mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TATTGCTTCCtattaaaaaaa	0.259																																					.		Atlas-SNP	.											.	EFHA1	33	.	0			c.664-2A>C						.						35.0	38.0	37.0					13																	22084242		2183	4279	6462	SO:0001630	splice_region_variant	221154	exon9			GCTTCCTATTAAA	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.664-2A>C	chr13.hg19:g.22084242T>G		256.0	0.0		190.0	66.0	NM_152726	Q8N0T6|Q8NAX8	Splice_Site	SNP	ENST00000382374.4	hg19	CCDS9297.1																																																																																			.	.		0.259	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	Intron
PDS5B	23047	hgsc.bcm.edu	37	13	33241961	33241961	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr13:33241961A>G	ENST00000315596.10	+	7	871	c.685A>G	c.(685-687)Att>Gtt	p.I229V		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	229					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AGCTCAAGCTATTGAGCCATA	0.303																																					p.I229V		Atlas-SNP	.											.	PDS5B	141	.	0			c.A685G						.						53.0	50.0	51.0					13																	33241961		1823	4065	5888	SO:0001583	missense	23047	exon7			CAAGCTATTGAGC	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.685A>G	chr13.hg19:g.33241961A>G	ENSP00000313851:p.Ile229Val	346.0	0.0		225.0	163.0	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	hg19	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524974	0.85600	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	4.63	4.63	0.57726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	M	0.66939	2.045	0.80722	D	1	P;P	0.50369	0.934;0.816	P;B	0.55871	0.786;0.384	T	0.73585	-0.3936	9	0.44086	T	0.13	-0.6757	14.4151	0.67145	1.0:0.0:0.0:0.0	.	229;229	Q9NTI5;Q9NTI5-3	PDS5B_HUMAN;.	V	229	.	ENSP00000313851:I229V	I	+	1	0	PDS5B	32139961	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.178000	0.94855	1.854000	0.53819	0.529000	0.55759	ATT	.	.		0.303	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
NHLRC3	387921	hgsc.bcm.edu	37	13	39621235	39621235	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr13:39621235A>T	ENST00000379600.3	+	6	1059	c.737A>T	c.(736-738)gAg>gTg	p.E246V	NHLRC3_ENST00000379599.2_Missense_Mutation_p.E179V|NHLRC3_ENST00000470258.1_Missense_Mutation_p.E49V	NM_001012754.3	NP_001012772.1	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3	246						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|skin(2)	11		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		GACACTGGGGAGTGGTTAGGA	0.363																																					p.E246V		Atlas-SNP	.											.	NHLRC3	35	.	0			c.A737T						.						149.0	151.0	150.0					13																	39621235		2203	4300	6503	SO:0001583	missense	387921	exon6			CTGGGGAGTGGTT		CCDS31961.1, CCDS31962.1	13q13.3	2007-12-18			ENSG00000188811	ENSG00000188811			33751	protein-coding gene	gene with protein product							Standard	NM_001017370		Approved		uc001uxc.4	Q5JS37	OTTHUMG00000016765	ENST00000379600.3:c.737A>T	chr13.hg19:g.39621235A>T	ENSP00000368920:p.Glu246Val	85.0	0.0		69.0	54.0	NM_001012754	B2RTZ2|B4DTL0|Q69YI9	Missense_Mutation	SNP	ENST00000379600.3	hg19	CCDS31961.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703164	0.68501	.	.	ENSG00000188811	ENST00000470258;ENST00000379600;ENST00000379599	D;D;D	0.90504	-2.68;-2.68;-2.68	5.68	4.48	0.54585	Six-bladed beta-propeller, TolB-like (1);	0.222920	0.45606	D	0.000342	D	0.88713	0.6511	L	0.55481	1.735	0.45015	D	0.998035	P;P	0.48089	0.883;0.905	B;P	0.45119	0.368;0.47	D	0.86539	0.1827	9	.	.	.	-16.8343	11.6371	0.51211	0.8668:0.0:0.0:0.1331	.	179;246	B4DTL0;Q5JS37	.;NHLC3_HUMAN	V	49;246;179	ENSP00000418127:E49V;ENSP00000368920:E246V;ENSP00000368919:E179V	.	E	+	2	0	NHLRC3	38519235	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.899000	0.75682	1.052000	0.40392	0.460000	0.39030	GAG	.	.		0.363	NHLRC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044616.2	NM_001012754	
KTN1	3895	hgsc.bcm.edu	37	14	56079290	56079290	+	Splice_Site	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr14:56079290G>A	ENST00000395314.3	+	2	591		c.e2+1		KTN1_ENST00000395308.1_Splice_Site|KTN1_ENST00000438792.2_Splice_Site|KTN1_ENST00000395309.3_Splice_Site|KTN1_ENST00000413890.2_Splice_Site|KTN1_ENST00000416613.1_Splice_Site|KTN1_ENST00000395311.1_Splice_Site	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)						microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						AATGGAAGCGGTATTGTAATC	0.368			T	RET	papillary thryoid																																.		Atlas-SNP	.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1	147	.	0			c.523+1G>A						.						40.0	47.0	45.0					14																	56079290		2203	4299	6502	SO:0001630	splice_region_variant	3895	exon2			GAAGCGGTATTGT		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.523+1G>A	chr14.hg19:g.56079290G>A		155.0	0.0		176.0	98.0	NM_001079521	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Splice_Site	SNP	ENST00000395314.3	hg19	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740146	0.49045	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2704	0.98474	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KTN1	55149043	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	7.215000	0.77966	2.793000	0.96121	0.591000	0.81541	.	.	.		0.368	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		Intron
FAM189A1	23359	hgsc.bcm.edu	37	15	29428590	29428590	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:29428590C>T	ENST00000261275.4	-	7	905	c.906G>A	c.(904-906)gtG>gtA	p.V302V		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	302	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						GGGGCTGGCCCACCACCGCCT	0.657																																					p.V302V		Atlas-SNP	.											.	FAM189A1	20	.	0			c.G906A						.						13.0	15.0	14.0					15																	29428590		691	1587	2278	SO:0001819	synonymous_variant	23359	exon7			CTGGCCCACCACC		CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.906G>A	chr15.hg19:g.29428590C>T		36.0	0.0		25.0	8.0	NM_015307	A0PK09	Silent	SNP	ENST00000261275.4	hg19	CCDS45198.1																																																																																			.	.		0.657	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417254.1	NM_015307	
RYR3	6263	hgsc.bcm.edu	37	15	34065806	34065806	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:34065806T>C	ENST00000389232.4	+	64	9197	c.9127T>C	c.(9127-9129)Tat>Cat	p.Y3043H	RYR3_ENST00000415757.3_Missense_Mutation_p.Y3043H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3043					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAAGAACATTTATGTTGAAAG	0.373																																					p.Y3043H		Atlas-SNP	.											.	RYR3	760	.	0			c.T9127C						.						98.0	86.0	90.0					15																	34065806		1915	4129	6044	SO:0001583	missense	6263	exon64			AACATTTATGTTG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9127T>C	chr15.hg19:g.34065806T>C	ENSP00000373884:p.Tyr3043His	46.0	0.0		51.0	18.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.053465	0.75960	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96802	-4.12;-4.13	6.17	6.17	0.99709	.	0.144186	0.48286	D	0.000182	D	0.96510	0.8861	L	0.33753	1.03	0.58432	D	0.999996	D;D	0.76494	0.986;0.999	P;D	0.68483	0.742;0.958	D	0.96017	0.9006	10	0.33940	T	0.23	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	3043;3043	Q15413-2;Q15413	.;RYR3_HUMAN	H	3043	ENSP00000373884:Y3043H;ENSP00000399610:Y3043H	ENSP00000354735:Y3043H	Y	+	1	0	RYR3	31853098	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.841000	0.86834	2.371000	0.80710	0.533000	0.62120	TAT	.	.		0.373	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
CASC5	57082	hgsc.bcm.edu	37	15	40914304	40914304	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:40914304A>C	ENST00000346991.5	+	11	2310	c.1920A>C	c.(1918-1920)gaA>gaC	p.E640D	CASC5_ENST00000399668.2_Missense_Mutation_p.E614D|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	640	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AATGTGAAGAAATTACCAAAA	0.408																																					p.E640D		Atlas-SNP	.											.	CASC5	269	.	0			c.A1920C						.						60.0	57.0	58.0					15																	40914304		1884	4108	5992	SO:0001583	missense	57082	exon11			TGAAGAAATTACC	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1920A>C	chr15.hg19:g.40914304A>C	ENSP00000335463:p.Glu640Asp	107.0	0.0		80.0	29.0	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	hg19	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	A	0.081	-1.183850	0.01620	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.18502	2.21;2.21	3.92	2.75	0.32379	.	1.862450	0.02677	N	0.109237	T	0.20577	0.0495	L	0.51422	1.61	0.09310	N	1	B;B;B	0.27932	0.115;0.053;0.194	B;B;B	0.26864	0.064;0.031;0.074	T	0.28586	-1.0039	10	0.52906	T	0.07	.	8.3673	0.32393	0.6868:0.0:0.0:0.3132	.	614;640;614	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	D	640;614;614	ENSP00000335463:E640D;ENSP00000382576:E614D	ENSP00000260369:E614D	E	+	3	2	CASC5	38701596	0.907000	0.30839	0.007000	0.13788	0.016000	0.09150	1.120000	0.31271	0.532000	0.28657	0.455000	0.32223	GAA	.	.		0.408	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
UNC13C	440279	hgsc.bcm.edu	37	15	54305560	54305560	+	Silent	SNP	A	A	C	rs201347376		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:54305560A>C	ENST00000260323.11	+	1	460	c.460A>C	c.(460-462)Aga>Cga	p.R154R	UNC13C_ENST00000545554.1_Silent_p.R154R|UNC13C_ENST00000537900.1_Silent_p.R154R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	154					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TAGACGCAACAGAAAGAGTTC	0.458																																					p.R154R		Atlas-SNP	.											.	UNC13C	674	.	0			c.A460C						.						88.0	89.0	89.0					15																	54305560		2022	4183	6205	SO:0001819	synonymous_variant	440279	exon1			CGCAACAGAAAGA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.460A>C	chr15.hg19:g.54305560A>C		120.0	0.0		107.0	33.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	hg19	CCDS45264.1																																																																																			.	.		0.458	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
MYO1E	4643	hgsc.bcm.edu	37	15	59445837	59445837	+	Missense_Mutation	SNP	G	G	A	rs546147455		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:59445837G>A	ENST00000288235.4	-	26	3431	c.3032C>T	c.(3031-3033)aCg>aTg	p.T1011M	AC092757.1_ENST00000408169.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	1011					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		GCTCTCTGGCGTCTGTGACAC	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18279	0.0		0.0	False		,,,				2504	0.0				p.T1011M		Atlas-SNP	.											.	MYO1E	99	.	0			c.C3032T						.						89.0	87.0	87.0					15																	59445837		2191	4291	6482	SO:0001583	missense	4643	exon26			TCTGGCGTCTGTG	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.3032C>T	chr15.hg19:g.59445837G>A	ENSP00000288235:p.Thr1011Met	95.0	0.0		79.0	24.0	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	hg19	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298887	0.23650	.	.	ENSG00000157483	ENST00000288235	D	0.87029	-2.2	5.54	2.4	0.29515	.	0.860605	0.10774	N	0.635629	T	0.78978	0.4369	L	0.34521	1.04	0.20975	N	0.999817	B	0.12013	0.005	B	0.08055	0.003	T	0.66352	-0.5945	10	0.45353	T	0.12	.	6.3791	0.21523	0.172:0.0:0.5869:0.2411	.	1011	Q12965	MYO1E_HUMAN	M	1011	ENSP00000288235:T1011M	ENSP00000288235:T1011M	T	-	2	0	MYO1E	57233129	0.022000	0.18835	0.049000	0.19019	0.325000	0.28411	0.935000	0.28924	0.711000	0.32018	0.655000	0.94253	ACG	.	.		0.582	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
LMAN1L	79748	hgsc.bcm.edu	37	15	75113449	75113449	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:75113449G>C	ENST00000309664.5	+	9	1080	c.941G>C	c.(940-942)gGc>gCc	p.G314A	LMAN1L_ENST00000379709.3_Missense_Mutation_p.G302A|RP11-414J4.2_ENST00000564823.1_RNA	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	314						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GAGACGCTGGGCAGACACCGC	0.627																																					p.G314A		Atlas-SNP	.											.	LMAN1L	43	.	0			c.G941C						.						17.0	19.0	18.0					15																	75113449		2187	4276	6463	SO:0001583	missense	79748	exon9			CGCTGGGCAGACA	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.941G>C	chr15.hg19:g.75113449G>C	ENSP00000310431:p.Gly314Ala	348.0	0.0		229.0	86.0	NM_021819	Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	hg19	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	4.582	0.108145	0.08780	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.37915	1.21;1.17	5.43	-0.965	0.10323	.	1.447880	0.03887	N	0.277976	T	0.30885	0.0779	L	0.39898	1.24	0.09310	N	0.999999	B;B	0.27068	0.167;0.104	B;B	0.28011	0.085;0.039	T	0.29458	-1.0011	10	0.33141	T	0.24	.	8.6091	0.33791	0.5407:0.0:0.4593:0.0	.	302;314	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	A	314;302	ENSP00000310431:G314A;ENSP00000369031:G302A	ENSP00000310431:G314A	G	+	2	0	LMAN1L	72900502	0.015000	0.18098	0.002000	0.10522	0.001000	0.01503	0.243000	0.18106	-0.123000	0.11745	-0.812000	0.03155	GGC	.	.		0.627	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4		
IREB2	3658	hgsc.bcm.edu	37	15	78732183	78732183	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:78732183T>G	ENST00000258886.8	+	2	215	c.66T>G	c.(64-66)caT>caG	p.H22Q	IREB2_ENST00000560440.1_Missense_Mutation_p.H22Q	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	22					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		ACAGTTCACATAAGAAGTTCT	0.299																																					p.H22Q	NSCLC(200;764 2208 35157 49871 50830)	Atlas-SNP	.											.	IREB2	106	.	0			c.T66G						.						137.0	116.0	123.0					15																	78732183		2196	4293	6489	SO:0001583	missense	3658	exon2			TTCACATAAGAAG	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.66T>G	chr15.hg19:g.78732183T>G	ENSP00000258886:p.His22Gln	55.0	0.0		27.0	7.0	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	hg19	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	T	7.383	0.629125	0.14257	.	.	ENSG00000136381	ENST00000258886	T	0.16073	2.37	4.72	-0.922	0.10468	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	2.372550	0.01391	N	0.013258	T	0.04363	0.0120	N	0.00729	-1.24	0.18873	N	0.999988	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26710	-1.0095	10	0.13108	T	0.6	.	1.8901	0.03246	0.1539:0.0956:0.3396:0.4109	.	22;22	P48200;Q8WVK6	IREB2_HUMAN;.	Q	22	ENSP00000258886:H22Q	ENSP00000258886:H22Q	H	+	3	2	IREB2	76519238	0.747000	0.28283	0.892000	0.35008	0.971000	0.66376	-0.223000	0.09177	-0.096000	0.12329	0.383000	0.25322	CAT	.	.		0.299	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
ADAMTSL3	57188	hgsc.bcm.edu	37	15	84639291	84639291	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr15:84639291T>A	ENST00000286744.5	+	20	2770	c.2546T>A	c.(2545-2547)cTg>cAg	p.L849Q	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.L849Q|ADAMTSL3_ENST00000567716.1_3'UTR	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	849	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGTCAAAGGCTGGCAGCCAAA	0.517																																					p.L849Q		Atlas-SNP	.											.	ADAMTSL3	290	.	0			c.T2546A						.						176.0	157.0	164.0					15																	84639291		2203	4300	6503	SO:0001583	missense	57188	exon20			AAAGGCTGGCAGC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2546T>A	chr15.hg19:g.84639291T>A	ENSP00000286744:p.Leu849Gln	74.0	0.0		80.0	17.0	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	hg19	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.033030	0.35893	.	.	ENSG00000156218	ENST00000286744	T	0.50277	0.75	4.39	4.39	0.52855	.	0.502098	0.15040	N	0.283925	T	0.50548	0.1622	L	0.32530	0.975	0.35576	D	0.805862	B;D	0.58268	0.415;0.982	B;P	0.60473	0.142;0.875	T	0.51710	-0.8671	10	0.22109	T	0.4	.	10.5206	0.44916	0.0:0.0:0.1619:0.838	.	849;849	P82987-2;P82987	.;ATL3_HUMAN	Q	849	ENSP00000286744:L849Q	ENSP00000286744:L849Q	L	+	2	0	ADAMTSL3	82430295	1.000000	0.71417	0.997000	0.53966	0.698000	0.40448	3.475000	0.53136	1.830000	0.53286	0.528000	0.53228	CTG	.	.		0.517	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
CDH8	1006	hgsc.bcm.edu	37	16	61689556	61689556	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr16:61689556G>T	ENST00000577390.1	-	11	2678	c.1724C>A	c.(1723-1725)cCa>cAa	p.P575Q	CDH8_ENST00000299345.6_Missense_Mutation_p.P575Q|CDH8_ENST00000577730.1_Missense_Mutation_p.P575Q	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	575	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GATTATGATTGGTAAAAGATA	0.413																																					p.P575Q		Atlas-SNP	.											.	CDH8	273	.	0			c.C1724A						.						141.0	129.0	133.0					16																	61689556		2203	4300	6503	SO:0001583	missense	1006	exon11			ATGATTGGTAAAA	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1724C>A	chr16.hg19:g.61689556G>T	ENSP00000462701:p.Pro575Gln	145.0	0.0		136.0	90.0	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	hg19	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941676	0.92526	.	.	ENSG00000150394	ENST00000299345	T	0.49720	0.77	5.65	5.65	0.86999	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.72179	0.3428	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75326	-0.3357	10	0.87932	D	0	.	18.7203	0.91691	0.0:0.0:1.0:0.0	.	575	P55286	CADH8_HUMAN	Q	575	ENSP00000299345:P575Q	ENSP00000299345:P575Q	P	-	2	0	CDH8	60247057	1.000000	0.71417	0.959000	0.39883	0.968000	0.65278	9.414000	0.97362	2.668000	0.90789	0.655000	0.94253	CCA	.	.		0.413	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
ATXN1L	342371	hgsc.bcm.edu	37	16	71885144	71885144	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr16:71885144G>A	ENST00000427980.2	+	3	1794	c.1501G>A	c.(1501-1503)Ggg>Agg	p.G501R	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	501	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						CGAAGTGAGCGGGGGGCTGAA	0.562																																					p.G501R		Atlas-SNP	.											.	ATXN1L	18	.	0			c.G1501A						.						89.0	91.0	90.0					16																	71885144		692	1591	2283	SO:0001583	missense	342371	exon3			GTGAGCGGGGGGC		CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1501G>A	chr16.hg19:g.71885144G>A	ENSP00000415822:p.Gly501Arg	78.0	0.0		61.0	39.0	NM_001137675		Missense_Mutation	SNP	ENST00000427980.2	hg19	CCDS45523.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902807	0.72754	.	.	ENSG00000224470	ENST00000427980	T	0.32988	1.43	5.54	5.54	0.83059	Ataxin-1/HBP1 module (AXH) (3);	.	.	.	.	T	0.49795	0.1578	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.39187	-0.9626	9	0.51188	T	0.08	-0.6064	19.8662	0.96804	0.0:0.0:1.0:0.0	.	501	P0C7T5	ATX1L_HUMAN	R	501	ENSP00000415822:G501R	ENSP00000415822:G501R	G	+	1	0	ATXN1L	70442645	1.000000	0.71417	0.983000	0.44433	0.959000	0.62525	6.416000	0.73332	2.787000	0.95880	0.555000	0.69702	GGG	.	.		0.562	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434171.1	NM_001137675.2	
CDH13	1012	hgsc.bcm.edu	37	16	83636063	83636063	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr16:83636063T>C	ENST00000566620.1	+	8	1255	c.965T>C	c.(964-966)cTg>cCg	p.L322P	CDH13_ENST00000428848.3_Missense_Mutation_p.L283P|CDH13_ENST00000268613.10_Missense_Mutation_p.L369P	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	322	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		TTGTAGACTCTGGAAAATCCC	0.473																																					p.L369P		Atlas-SNP	.											.	CDH13	97	.	0			c.T1106C						.						249.0	249.0	249.0					16																	83636063		1954	4164	6118	SO:0001583	missense	1012	exon9			AGACTCTGGAAAA	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.965T>C	chr16.hg19:g.83636063T>C	ENSP00000454435:p.Leu322Pro	91.0	0.0		76.0	28.0	NM_001220488	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	hg19	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.234272	0.58886	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000540531	T	0.51325	0.71	6.02	6.02	0.97574	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45478	0.1344	L	0.48174	1.505	0.80722	D	1	B;B;B	0.22541	0.027;0.003;0.071	B;B;B	0.24848	0.04;0.025;0.056	T	0.36648	-0.9739	9	0.56958	D	0.05	.	15.3796	0.74645	0.0:0.0:0.0:1.0	.	283;369;322	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	P	369;322;283;24;12	ENSP00000268613:L369P	ENSP00000268613:L369P	L	+	2	0	CDH13	82193564	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.225000	0.72271	2.311000	0.77944	0.533000	0.62120	CTG	.	.		0.473	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
ADAD2	161931	hgsc.bcm.edu	37	16	84229176	84229176	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr16:84229176C>T	ENST00000315906.5	+	6	977	c.925C>T	c.(925-927)Ccc>Tcc	p.P309S	RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.P391S|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	309	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						ACAGGGGGGCCCCAAGGGCAA	0.652																																					p.P391S		Atlas-SNP	.											.	ADAD2	46	.	0			c.C1171T						.						23.0	29.0	27.0					16																	84229176		2200	4297	6497	SO:0001583	missense	161931	exon7			GGGGGCCCCAAGG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.925C>T	chr16.hg19:g.84229176C>T	ENSP00000325153:p.Pro309Ser	101.0	0.0		83.0	63.0	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	hg19	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	C	6.164	0.398482	0.11696	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.92858	-3.12;-3.12	5.22	-0.288	0.12855	Adenosine deaminase/editase (2);	0.433630	0.24226	N	0.040396	D	0.88731	0.6516	L	0.48642	1.525	0.19945	N	0.99994	B;B	0.25048	0.117;0.096	B;B	0.37198	0.243;0.169	T	0.79902	-0.1607	10	0.48119	T	0.1	-5.9549	8.4731	0.32997	0.0:0.5012:0.3528:0.146	.	309;391	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	S	309;391	ENSP00000325153:P309S;ENSP00000268624:P391S	ENSP00000268624:P391S	P	+	1	0	ADAD2	82786677	0.720000	0.27996	0.000000	0.03702	0.001000	0.01503	1.172000	0.31908	-0.457000	0.07033	-0.810000	0.03169	CCC	.	.		0.652	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
PMP22	5376	hgsc.bcm.edu	37	17	15134247	15134247	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:15134247C>T	ENST00000395938.2	-	5	664	c.470G>A	c.(469-471)cGg>cAg	p.R157Q	PMP22_ENST00000494511.1_Silent_p.A97A|PMP22_ENST00000312280.3_Missense_Mutation_p.R157Q|PMP22_ENST00000395936.1_3'UTR	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	157			R -> G (in dbSNP:rs28936682). {ECO:0000269|PubMed:10632107}.|R -> W (in DSS; dbSNP:rs28936682). {ECO:0000269|PubMed:10211478}.		cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		TTCGCGTTTCCGCAAGATCAC	0.542																																					p.R157Q		Atlas-SNP	.											.	PMP22	18	.	0			c.G470A						.						83.0	79.0	80.0					17																	15134247		2203	4300	6503	SO:0001583	missense	5376	exon4			CGTTTCCGCAAGA	D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.470G>A	chr17.hg19:g.15134247C>T	ENSP00000379269:p.Arg157Gln	94.0	0.0		123.0	49.0	NM_153322	Q8WV01	Missense_Mutation	SNP	ENST00000395938.2	hg19	CCDS11168.1	.	.	.	.	.	.	.	.	.	.	C	33	5.254022	0.95336	.	.	ENSG00000109099	ENST00000395938;ENST00000312280;ENST00000426385	D;D	0.96856	-4.15;-4.15	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.98298	0.9436	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99222	1.0879	10	0.87932	D	0	-46.1731	18.1907	0.89806	0.0:1.0:0.0:0.0	.	157	Q01453	PMP22_HUMAN	Q	157;157;146	ENSP00000379269:R157Q;ENSP00000308937:R157Q	ENSP00000308937:R157Q	R	-	2	0	PMP22	15074972	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.507000	0.81676	2.630000	0.89119	0.563000	0.77884	CGG	.	.		0.542	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130378.1	NM_000304	
TBC1D26	353149	hgsc.bcm.edu	37	17	15638739	15638739	+	Splice_Site	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:15638739T>A	ENST00000437605.2	+	3	325		c.e3+2		ZNF286A_ENST00000413242.2_Intron|AC005324.6_ENST00000434017.1_RNA|ZNF286A_ENST00000593105.1_Splice_Site|TBC1D26_ENST00000579428.1_Splice_Site	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26								Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		TATGAGCAGGTACAAGTTGGG	0.582																																					.		Atlas-SNP	.											.	TBC1D26	16	.	0			c.75+2T>A						.						75.0	77.0	76.0					17																	15638739		1889	4102	5991	SO:0001630	splice_region_variant	353149	exon3			AGCAGGTACAAGT		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.75+2T>A	chr17.hg19:g.15638739T>A		243.0	0.0		226.0	82.0	NM_178571	A8K929|Q4G172	Splice_Site	SNP	ENST00000437605.2	hg19	CCDS42265.1	.	.	.	.	.	.	.	.	.	.	.	2.413	-0.334811	0.05278	.	.	ENSG00000214946	ENST00000437605	.	.	.	0.632	-0.951	0.10369	.	.	.	.	.	.	.	.	.	.	.	0.21861	N	0.999507	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D26	15579464	0.148000	0.22702	0.019000	0.16419	0.051000	0.14879	1.007000	0.29860	-0.400000	0.07656	0.378000	0.23410	.	.	.		0.582	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178571	Intron
TMEM98	26022	hgsc.bcm.edu	37	17	31258571	31258571	+	Missense_Mutation	SNP	A	A	G	rs142287076		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:31258571A>G	ENST00000579849.1	+	3	456	c.25A>G	c.(25-27)Ata>Gta	p.I9V	TMEM98_ENST00000394642.3_Missense_Mutation_p.I9V|TMEM98_ENST00000578289.1_Missense_Mutation_p.I9V	NM_015544.2	NP_056359.2	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	9						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)	3		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			GATTGTTGCCATAGGTGTGCT	0.567																																					p.I9V		Atlas-SNP	.											.	TMEM98	23	.	0			c.A25G						.	A	VAL/ILE,VAL/ILE	2,4404	4.2+/-10.8	0,2,2201	142.0	114.0	124.0		25,25	4.9	1.0	17	dbSNP_134	124	0,8600		0,0,4300	no	missense,missense	TMEM98	NM_001033504.1,NM_015544.2	29,29	0,2,6501	GG,GA,AA		0.0,0.0454,0.0154	benign,benign	9/227,9/227	31258571	2,13004	2203	4300	6503	SO:0001583	missense	26022	exon2			GTTGCCATAGGTG	CR605381	CCDS11274.1	17q11.2	2005-12-16			ENSG00000006042	ENSG00000006042			24529	protein-coding gene	gene with protein product		615949				11230166	Standard	NM_001301746		Approved	DKFZP564K1964	uc002hhr.3	Q9Y2Y6	OTTHUMG00000132882	ENST00000579849.1:c.25A>G	chr17.hg19:g.31258571A>G	ENSP00000463245:p.Ile9Val	44.0	0.0		61.0	20.0	NM_001033504	E1P631|Q9UFK2	Missense_Mutation	SNP	ENST00000579849.1	hg19	CCDS11274.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.613331	0.46631	4.54E-4	0.0	ENSG00000006042	ENST00000394642;ENST00000261713;ENST00000395149;ENST00000439138	T;T;T;T	0.47177	0.85;0.86;0.86;0.86	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.31949	0.0813	L	0.29908	0.895	0.53005	D	0.999962	B	0.29862	0.259	B	0.19666	0.026	T	0.11348	-1.0591	10	0.17369	T	0.5	-10.05	12.5519	0.56231	1.0:0.0:0.0:0.0	.	9	Q9Y2Y6	TMM98_HUMAN	V	9	ENSP00000378138:I9V;ENSP00000261713:I9V;ENSP00000398446:I9V;ENSP00000406394:I9V	ENSP00000261713:I9V	I	+	1	0	TMEM98	28282684	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.376000	0.90138	2.055000	0.61198	0.529000	0.55759	ATA	.	A|1.000;G|0.000		0.567	TMEM98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256372.2	NM_015544	
SLFN11	91607	hgsc.bcm.edu	37	17	33679831	33679831	+	Silent	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:33679831A>G	ENST00000394566.1	-	7	2522	c.2250T>C	c.(2248-2250)agT>agC	p.S750S	SLFN11_ENST00000308377.4_Silent_p.S750S	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	750					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATGAAGGATTACTTCTAATTA	0.423																																					p.S750S		Atlas-SNP	.											.	SLFN11	112	.	0			c.T2250C						.						98.0	91.0	93.0					17																	33679831		2203	4300	6503	SO:0001819	synonymous_variant	91607	exon5			AGGATTACTTCTA	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2250T>C	chr17.hg19:g.33679831A>G		68.0	0.0		112.0	49.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	hg19	CCDS11294.1																																																																																			.	.		0.423	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
FAM171A2	284069	hgsc.bcm.edu	37	17	42432445	42432445	+	Silent	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:42432445C>A	ENST00000293443.7	-	8	1297	c.1137G>T	c.(1135-1137)ggG>ggT	p.G379G		NM_198475.2	NP_940877.2	A8MVW0	F1712_HUMAN	family with sequence similarity 171, member A2	379						integral component of membrane (GO:0016021)											CCAGGGGTCCCCCACAGATGA	0.701																																					p.G379G		Atlas-SNP	.											.	FAM171A2	13	.	0			c.G1137T						.						22.0	22.0	22.0					17																	42432445		692	1591	2283	SO:0001819	synonymous_variant	284069	exon8			GGGTCCCCCACAG		CCDS45701.1	17q21.31	2008-06-16			ENSG00000161682	ENSG00000161682			30480	protein-coding gene	gene with protein product						12477932	Standard	NM_198475		Approved	MGC34829	uc002igs.2	A8MVW0	OTTHUMG00000132421	ENST00000293443.7:c.1137G>T	chr17.hg19:g.42432445C>A		169.0	0.0		182.0	37.0	NM_198475	A8MQB4	Silent	SNP	ENST00000293443.7	hg19	CCDS45701.1																																																																																			.	.		0.701	FAM171A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255559.2	NM_198475	
SRSF1	6426	hgsc.bcm.edu	37	17	56082903	56082903	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:56082903C>T	ENST00000258962.4	-	4	819	c.611G>A	c.(610-612)aGa>aAa	p.R204K	SRSF1_ENST00000584773.1_Missense_Mutation_p.R204K|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000582730.2_3'UTR|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000585096.1_Intron	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	204	Arg/Ser-rich (RS domain).|Interacts with SAFB1.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGATCGAGATCTTCCATAACT	0.483																																					p.R204K		Atlas-SNP	.											.	SRSF1	41	.	0			c.G611A						.						140.0	134.0	136.0					17																	56082903		2203	4300	6503	SO:0001583	missense	6426	exon4			CGAGATCTTCCAT		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.611G>A	chr17.hg19:g.56082903C>T	ENSP00000258962:p.Arg204Lys	143.0	0.0		142.0	24.0	NM_006924	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	ENST00000258962.4	hg19	CCDS11600.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151069	0.38021	.	.	ENSG00000136450	ENST00000258962	T	0.15487	2.42	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);	3.278820	0.01640	N	0.023995	T	0.27731	0.0682	L	0.39245	1.2	0.80722	D	1	B	0.22746	0.074	B	0.36719	0.231	T	0.50294	-0.8845	10	0.08381	T	0.77	.	20.1057	0.97893	0.0:1.0:0.0:0.0	.	204	Q07955	SRSF1_HUMAN	K	204	ENSP00000258962:R204K	ENSP00000258962:R204K	R	-	2	0	SRSF1	53437902	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.339000	0.79282	2.827000	0.97445	0.650000	0.86243	AGA	.	.		0.483	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
CELF4	56853	hgsc.bcm.edu	37	18	34855176	34855176	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr18:34855176T>C	ENST00000591282.1	-	4	478	c.479A>G	c.(478-480)aAc>aGc	p.N160S	CELF4_ENST00000334919.5_Missense_Mutation_p.N150S|CELF4_ENST00000412753.1_Missense_Mutation_p.N160S|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000588597.1_Missense_Mutation_p.N149S|CELF4_ENST00000603232.1_Missense_Mutation_p.N160S|CELF4_ENST00000420428.2_Missense_Mutation_p.N160S|CELF4_ENST00000601019.1_Missense_Mutation_p.N159S|RP11-797E24.3_ENST00000586610.1_RNA|CELF4_ENST00000361795.5_Missense_Mutation_p.N159S|CELF4_ENST00000591287.1_Missense_Mutation_p.N159S			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	160	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						CTGTTGCTTGTTGAGCATGCC	0.607																																					p.N160S		Atlas-SNP	.											.	CELF4	90	.	0			c.A479G						.						63.0	65.0	64.0					18																	34855176		2203	4300	6503	SO:0001583	missense	56853	exon4			TGCTTGTTGAGCA	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.479A>G	chr18.hg19:g.34855176T>C	ENSP00000464794:p.Asn160Ser	181.0	0.0		154.0	127.0	NM_001025087	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	ENST00000591282.1	hg19	CCDS32818.1	.	.	.	.	.	.	.	.	.	.	T	7.522	0.656849	0.14580	.	.	ENSG00000101489	ENST00000361795;ENST00000412753;ENST00000420428;ENST00000334919;ENST00000361683	T;T	0.05025	3.51;3.51	4.38	4.38	0.52667	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.02727	0.0082	N	0.00972	-1.085	0.49130	D	0.999752	B;P;B;B;B	0.36183	0.063;0.542;0.226;0.028;0.036	B;B;B;B;B	0.42959	0.053;0.403;0.08;0.053;0.06	T	0.48625	-0.9019	10	0.02654	T	1	-12.1704	14.0379	0.64656	0.0:0.0:0.0:1.0	.	159;149;150;159;160	Q9BZC1-3;B4DHA8;Q9BZC1-5;Q9BZC1-2;Q9BZC1	.;.;.;.;CELF4_HUMAN	S	160;160;159;150;43	ENSP00000406823:N160S;ENSP00000335631:N150S	ENSP00000335631:N150S	N	-	2	0	CELF4	33109174	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.031000	0.41117	1.960000	0.56953	0.533000	0.62120	AAC	.	.		0.607	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180	
DENND1C	79958	hgsc.bcm.edu	37	19	6475892	6475892	+	Silent	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr19:6475892G>A	ENST00000381480.2	-	11	847	c.735C>T	c.(733-735)caC>caT	p.H245H	DENND1C_ENST00000591030.1_5'Flank|DENND1C_ENST00000543576.1_Silent_p.H201H	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	245	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						GGATCAGCACGTGCTCCCAGC	0.721																																					p.H245H		Atlas-SNP	.											.	DENND1C	93	.	0			c.C735T						.						9.0	11.0	10.0					19																	6475892		2142	4233	6375	SO:0001819	synonymous_variant	79958	exon11			CAGCACGTGCTCC	AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.735C>T	chr19.hg19:g.6475892G>A		89.0	0.0		67.0	30.0	NM_024898	B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Silent	SNP	ENST00000381480.2	hg19	CCDS45938.1																																																																																			.	.		0.721	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453332.2	NM_024898	
ARMC6	93436	hgsc.bcm.edu	37	19	19162935	19162935	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr19:19162935G>A	ENST00000535612.1	+	5	1216	c.784G>A	c.(784-786)Gcc>Acc	p.A262T	ARMC6_ENST00000269932.6_Missense_Mutation_p.A237T|ARMC6_ENST00000392335.2_Missense_Mutation_p.A237T|ARMC6_ENST00000392336.3_Missense_Mutation_p.A262T|ARMC6_ENST00000546344.1_Missense_Mutation_p.A169T	NM_001199196.1	NP_001186125.1	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	262					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|prostate(1)	14			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			CTTTGGCCATGCCCACAACCA	0.582																																					p.A262T		Atlas-SNP	.											.	ARMC6	56	.	0			c.G784A						.						76.0	46.0	56.0					19																	19162935		2203	4300	6503	SO:0001583	missense	93436	exon5			GGCCATGCCCACA	BX648486	CCDS32965.1, CCDS56089.1	19p13	2013-02-14				ENSG00000105676		"""Armadillo repeat containing"""	25049	protein-coding gene	gene with protein product						12477932	Standard	NM_033415		Approved	MGC19595	uc002nlc.3	Q6NXE6		ENST00000535612.1:c.784G>A	chr19.hg19:g.19162935G>A	ENSP00000444156:p.Ala262Thr	40.0	0.0		37.0	18.0	NM_001199196	B4DI98|O94999|Q9BTH5	Missense_Mutation	SNP	ENST00000535612.1	hg19	CCDS56089.1	.	.	.	.	.	.	.	.	.	.	G	32	5.121373	0.94385	.	.	ENSG00000105676	ENST00000392335;ENST00000535612;ENST00000537263;ENST00000269932;ENST00000546344;ENST00000541898;ENST00000545190;ENST00000379532;ENST00000392336	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70701	0.3254	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70561	-0.4838	10	0.45353	T	0.12	-31.8184	18.5631	0.91108	0.0:0.0:1.0:0.0	.	262	Q6NXE6	ARMC6_HUMAN	T	237;262;237;237;169;237;173;173;262	ENSP00000376147:A237T;ENSP00000444156:A262T;ENSP00000441948:A237T;ENSP00000269932:A237T;ENSP00000444341:A169T;ENSP00000446037:A237T;ENSP00000376148:A262T	ENSP00000269932:A237T	A	+	1	0	ARMC6	19023935	1.000000	0.71417	0.871000	0.34182	0.678000	0.39670	7.687000	0.84139	2.637000	0.89404	0.555000	0.69702	GCC	.	.		0.582	ARMC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403226.1	NM_033415	
MEGF8	1954	hgsc.bcm.edu	37	19	42880376	42880376	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr19:42880376C>G	ENST00000251268.6	+	42	7987	c.7987C>G	c.(7987-7989)Ctc>Gtc	p.L2663V	MEGF8_ENST00000334370.4_Missense_Mutation_p.L2596V|MEGF8_ENST00000378073.4_Missense_Mutation_p.L257V	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2663					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				cttcctcttcctctCACTCTG	0.612																																					p.L2663V		Atlas-SNP	.											.	MEGF8	358	.	0			c.C7987G						.						26.0	24.0	25.0					19																	42880376		2195	4296	6491	SO:0001583	missense	1954	exon42			CTCTTCCTCTCAC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7987C>G	chr19.hg19:g.42880376C>G	ENSP00000251268:p.Leu2663Val	108.0	0.0		93.0	22.0	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	C	17.39	3.378110	0.61735	.	.	ENSG00000105429	ENST00000334370;ENST00000251268;ENST00000378073	T;T;T	0.53206	0.95;0.94;0.63	4.14	4.14	0.48551	.	0.000000	0.51477	D	0.000098	T	0.67998	0.2953	M	0.75085	2.285	0.80722	D	1	D;D;D	0.67145	0.988;0.993;0.996	D;D;D	0.80764	0.992;0.987;0.994	T	0.73493	-0.3965	10	0.87932	D	0	-17.9535	15.741	0.77894	0.0:1.0:0.0:0.0	.	257;2663;2596	F5GZG7;Q7Z7M0;Q7Z7M0-2	.;MEGF8_HUMAN;.	V	2596;2663;257	ENSP00000334219:L2596V;ENSP00000251268:L2663V;ENSP00000367313:L257V	ENSP00000251268:L2663V	L	+	1	0	MEGF8	47572216	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	2.683000	0.46943	2.326000	0.78906	0.462000	0.41574	CTC	.	.		0.612	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
NSFL1C	55968	hgsc.bcm.edu	37	20	1447368	1447368	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr20:1447368C>T	ENST00000216879.4	-	1	969	c.102G>A	c.(100-102)ttG>ttA	p.L34L	NSFL1C_ENST00000381658.4_5'UTR|NSFL1C_ENST00000353088.2_Silent_p.L34L|NSFL1C_ENST00000350991.4_Silent_p.L34L|NSFL1C_ENST00000476071.1_Silent_p.L34L	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	34						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						GCGCTACCTGCAAGTCCCAGC	0.741																																					p.L34L		Atlas-SNP	.											.	NSFL1C	38	.	0			c.G102A						.						5.0	7.0	6.0					20																	1447368		1943	3904	5847	SO:0001819	synonymous_variant	55968	exon1			TACCTGCAAGTCC	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.102G>A	chr20.hg19:g.1447368C>T		101.0	0.0		155.0	75.0	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Silent	SNP	ENST00000216879.4	hg19	CCDS13015.1																																																																																			.	.		0.741	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
THBD	7056	hgsc.bcm.edu	37	20	23029882	23029882	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr20:23029882C>T	ENST00000377103.2	-	1	496	c.260G>A	c.(259-261)tGg>tAg	p.W87*		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	87	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	CAGGCCGATCCAGAGGCGCCG	0.682																																					p.W87X		Atlas-SNP	.											.	THBD	26	.	0			c.G260A						.						4.0	3.0	4.0					20																	23029882		1859	3652	5511	SO:0001587	stop_gained	7056	exon1			CCGATCCAGAGGC		CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.260G>A	chr20.hg19:g.23029882C>T	ENSP00000366307:p.Trp87*	138.0	0.0		199.0	39.0	NM_000361	Q8IV29|Q9UC32	Nonsense_Mutation	SNP	ENST00000377103.2	hg19	CCDS13148.1	.	.	.	.	.	.	.	.	.	.	C	38	6.957767	0.97964	.	.	ENSG00000178726	ENST00000377103	.	.	.	5.82	4.87	0.63330	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.6675	15.3253	0.74157	0.1408:0.8592:0.0:0.0	.	.	.	.	X	87	.	ENSP00000366307:W87X	W	-	2	0	THBD	22977882	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	3.931000	0.56529	1.446000	0.47643	0.549000	0.68633	TGG	.	.		0.682	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2		
ASXL1	171023	hgsc.bcm.edu	37	20	31016225	31016225	+	Splice_Site	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr20:31016225G>A	ENST00000375687.4	+	6	895	c.471G>A	c.(469-471)caG>caA	p.Q157Q	ASXL1_ENST00000306058.5_Splice_Site_p.Q152Q|ASXL1_ENST00000470145.1_3'UTR|ASXL1_ENST00000542461.1_3'UTR	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	157					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CTTCCTCACAGGTAAGGAAGA	0.483			"""F, N, Mis"""		"""MDS, CMML"""																																p.Q157Q		Atlas-SNP	.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114	.	0			c.G471A						.						106.0	99.0	102.0					20																	31016225		2203	4300	6503	SO:0001630	splice_region_variant	171023	exon5			CTCACAGGTAAGG	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.471+1G>A	chr20.hg19:g.31016225G>A		116.0	0.0		159.0	13.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	ENST00000375687.4	hg19	CCDS13201.1																																																																																			.	.		0.483	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	Silent
B4GALT5	9334	hgsc.bcm.edu	37	20	48252994	48252994	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr20:48252994T>A	ENST00000371711.4	-	9	1209	c.1022A>T	c.(1021-1023)tAt>tTt	p.Y341F		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	341					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CAGCAGAGCATACCTGTTTAG	0.517																																					p.Y341F		Atlas-SNP	.											.	B4GALT5	40	.	0			c.A1022T						.						148.0	128.0	135.0					20																	48252994		2203	4300	6503	SO:0001583	missense	9334	exon9			AGAGCATACCTGT	AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.1022A>T	chr20.hg19:g.48252994T>A	ENSP00000360776:p.Tyr341Phe	117.0	0.0		130.0	47.0	NM_004776	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	hg19	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.075870	0.36662	.	.	ENSG00000158470	ENST00000371711	T	0.34472	1.36	5.43	5.43	0.79202	.	0.109041	0.64402	D	0.000004	T	0.29588	0.0738	L	0.42581	1.335	0.80722	D	1	B	0.20052	0.041	B	0.20184	0.028	T	0.10636	-1.0621	10	0.06494	T	0.89	-21.5454	15.4778	0.75497	0.0:0.0:0.0:1.0	.	341	O43286	B4GT5_HUMAN	F	341	ENSP00000360776:Y341F	ENSP00000360776:Y341F	Y	-	2	0	B4GALT5	47686401	1.000000	0.71417	0.983000	0.44433	0.947000	0.59692	7.841000	0.86834	2.050000	0.60909	0.460000	0.39030	TAT	.	.		0.517	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	
ZNF831	128611	hgsc.bcm.edu	37	20	57769575	57769575	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr20:57769575C>T	ENST00000371030.2	+	1	3501	c.3501C>T	c.(3499-3501)ccC>ccT	p.P1167P		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1167							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCCGCAGTCCCCACAGCACCC	0.667																																					p.P1167P		Atlas-SNP	.											.	ZNF831	287	.	0			c.C3501T						.						48.0	55.0	53.0					20																	57769575		2066	4173	6239	SO:0001819	synonymous_variant	128611	exon1			CAGTCCCCACAGC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3501C>T	chr20.hg19:g.57769575C>T		98.0	0.0		119.0	36.0	NM_178457	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	hg19	CCDS42894.1																																																																																			.	.		0.667	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
RBBP8NL	140893	hgsc.bcm.edu	37	20	60987760	60987760	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr20:60987760C>T	ENST00000252998.1	-	13	1952	c.1796G>A	c.(1795-1797)gGg>gAg	p.G599E		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	599						extracellular space (GO:0005615)											GCACTCAGGCCCCTCCCCGGT	0.697																																					p.G599E		Atlas-SNP	.											.	.	.	.	0			c.G1796A						.						61.0	60.0	60.0					20																	60987760		2202	4300	6502	SO:0001583	missense	140893	exon13			TCAGGCCCCTCCC	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.1796G>A	chr20.hg19:g.60987760C>T	ENSP00000252998:p.Gly599Glu	27.0	0.0		43.0	18.0	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	hg19	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417755	0.25552	.	.	ENSG00000130701	ENST00000252998	T	0.19669	2.13	3.52	0.643	0.17770	.	0.808221	0.10407	N	0.678451	T	0.14184	0.0343	L	0.50333	1.59	0.09310	N	1	B	0.28900	0.227	B	0.22152	0.038	T	0.34625	-0.9821	10	0.10377	T	0.69	-18.1535	4.869	0.13622	0.0:0.5739:0.0:0.4261	.	599	Q8NC74	CT151_HUMAN	E	599	ENSP00000252998:G599E	ENSP00000252998:G599E	G	-	2	0	C20orf151	60421155	0.000000	0.05858	0.001000	0.08648	0.051000	0.14879	0.230000	0.17852	0.274000	0.22072	0.491000	0.48974	GGG	.	.		0.697	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
CLDN17	26285	hgsc.bcm.edu	37	21	31538490	31538490	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr21:31538490T>C	ENST00000286808.3	-	1	481	c.446A>G	c.(445-447)tAc>tGc	p.Y149C		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	149					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						GGCTGGGTTGTAGAAATCTCT	0.522																																					p.Y149C		Atlas-SNP	.											.	CLDN17	61	.	0			c.A446G						.						78.0	76.0	76.0					21																	31538490		2203	4300	6503	SO:0001583	missense	26285	exon1			GGGTTGTAGAAAT	AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.446A>G	chr21.hg19:g.31538490T>C	ENSP00000286808:p.Tyr149Cys	74.0	0.0		55.0	35.0	NM_012131	Q3MJB5|Q6UY37	Missense_Mutation	SNP	ENST00000286808.3	hg19	CCDS13586.1	.	.	.	.	.	.	.	.	.	.	T	17.75	3.465356	0.63513	.	.	ENSG00000156282	ENST00000286808	D	0.89196	-2.48	4.54	4.54	0.55810	.	0.064498	0.64402	D	0.000005	D	0.96122	0.8736	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97306	0.9934	10	0.87932	D	0	.	14.5833	0.68308	0.0:0.0:0.0:1.0	.	149	P56750	CLD17_HUMAN	C	149	ENSP00000286808:Y149C	ENSP00000286808:Y149C	Y	-	2	0	CLDN17	30460361	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	6.010000	0.70753	2.266000	0.75297	0.533000	0.62120	TAC	.	.		0.522	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182261.1	NM_012131	
TRAPPC10	7109	hgsc.bcm.edu	37	21	45507598	45507598	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr21:45507598C>T	ENST00000291574.4	+	17	2733	c.2558C>T	c.(2557-2559)gCg>gTg	p.A853V		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	853					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						TCTGAGGCCGCGCTCCGGATT	0.517																																					p.A853V		Atlas-SNP	.											.	TRAPPC10	109	.	0			c.C2558T						.						75.0	72.0	73.0					21																	45507598		2203	4300	6503	SO:0001583	missense	7109	exon17			AGGCCGCGCTCCG	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.2558C>T	chr21.hg19:g.45507598C>T	ENSP00000291574:p.Ala853Val	45.0	0.0		22.0	12.0	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	hg19	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	C	6.958	0.546617	0.13312	.	.	ENSG00000160218	ENST00000291574	T	0.21932	1.98	5.33	-3.33	0.04958	.	1.301150	0.05013	N	0.471366	T	0.09862	0.0242	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31558	-0.9939	10	0.27082	T	0.32	.	6.6749	0.23087	0.0:0.4266:0.1157:0.4577	.	853	P48553	TPC10_HUMAN	V	853	ENSP00000291574:A853V	ENSP00000291574:A853V	A	+	2	0	TRAPPC10	44332026	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.027000	0.13621	-1.165000	0.02786	-0.140000	0.14226	GCG	.	.		0.517	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
MCM3AP	8888	hgsc.bcm.edu	37	21	47666731	47666731	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr21:47666731T>A	ENST00000397708.1	-	22	4614	c.4360A>T	c.(4360-4362)Agt>Tgt	p.S1454C	MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000455567.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.S1454C|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1454					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ATGAGCCCACTGGCTCCCAGG	0.577																																					p.S1454C		Atlas-SNP	.											.	MCM3AP	146	.	0			c.A4360T						.						121.0	117.0	119.0					21																	47666731		2203	4300	6503	SO:0001583	missense	8888	exon21			GCCCACTGGCTCC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4360A>T	chr21.hg19:g.47666731T>A	ENSP00000380820:p.Ser1454Cys	157.0	0.0		123.0	87.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	hg19	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	18.26	3.584902	0.65992	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.05382	3.45;3.45	5.68	5.68	0.88126	.	0.128488	0.64402	D	0.000001	T	0.25975	0.0633	M	0.73598	2.24	0.44345	D	0.997232	D	0.89917	1.0	D	0.76071	0.987	T	0.00688	-1.1609	10	0.87932	D	0	-19.436	15.9289	0.79644	0.0:0.0:0.0:1.0	.	1454	O60318	MCM3A_HUMAN	C	1454	ENSP00000380820:S1454C;ENSP00000291688:S1454C	ENSP00000291688:S1454C	S	-	1	0	MCM3AP	46491159	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	3.192000	0.50989	2.173000	0.68751	0.528000	0.53228	AGT	.	.		0.577	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
C22orf29	79680	hgsc.bcm.edu	37	22	19839277	19839277	+	Missense_Mutation	SNP	G	G	A	rs144116940		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr22:19839277G>A	ENST00000405640.1	-	2	1176	c.508C>T	c.(508-510)Ctc>Ttc	p.L170F	GNB1L_ENST00000405009.1_Intron|C22orf29_ENST00000328554.4_Missense_Mutation_p.L170F|C22orf29_ENST00000484072.1_Intron|GNB1L_ENST00000403325.1_Intron|GNB1L_ENST00000460402.1_Intron|GNB1L_ENST00000329517.6_Intron|C22orf29_ENST00000407472.1_Missense_Mutation_p.L170F			Q7L3V2	BOP_HUMAN	chromosome 22 open reading frame 29	170					mitochondrial outer membrane permeabilization (GO:0097345)|regulation of mitochondrial membrane potential (GO:0051881)	mitochondrion (GO:0005739)				NS(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	7	Colorectal(54;0.0993)					TGGCAGAAGAGCTCGTAATCG	0.612																																					p.L170F		Atlas-SNP	.											.	C22orf29	23	.	0			c.C508T						.	G	PHE/LEU,	0,4406		0,0,2203	69.0	69.0	69.0		508,	1.5	0.2	22	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	GNB1L,C22orf29	NM_024627.5,NM_053004.2	22,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,	170/365,	19839277	1,13005	2203	4300	6503	SO:0001583	missense	79680	exon3			AGAAGAGCTCGTA	BX640998	CCDS13769.1	22q11.21	2006-07-05			ENSG00000215012	ENSG00000215012			26112	protein-coding gene	gene with protein product						12477932	Standard	NM_024627		Approved	FLJ21125	uc002zqh.3	Q7L3V2	OTTHUMG00000030314	ENST00000405640.1:c.508C>T	chr22.hg19:g.19839277G>A	ENSP00000384924:p.Leu170Phe	69.0	0.0		92.0	32.0	NM_024627	A8K5E7|D3DX21|Q6MZM8|Q6N000|Q9H7A0	Missense_Mutation	SNP	ENST00000405640.1	hg19	CCDS13769.1	.	.	.	.	.	.	.	.	.	.	G	8.506	0.865382	0.17250	0.0	1.16E-4	ENSG00000215012	ENST00000407472;ENST00000328554;ENST00000405640	T;T;T	0.30981	1.51;1.51;1.51	3.68	1.5	0.22942	.	0.305062	0.16490	U	0.212122	T	0.17280	0.0415	N	0.22421	0.69	0.09310	N	0.999997	B	0.27498	0.18	B	0.26310	0.068	T	0.16158	-1.0412	10	0.56958	D	0.05	.	4.2931	0.10888	0.1192:0.0:0.6561:0.2247	.	170	Q7L3V2	CV029_HUMAN	F	170	ENSP00000386111:L170F;ENSP00000330596:L170F;ENSP00000384924:L170F	ENSP00000330596:L170F	L	-	1	0	C22orf29	18219277	0.001000	0.12720	0.236000	0.24074	0.248000	0.25809	0.126000	0.15769	0.498000	0.27948	0.655000	0.94253	CTC	.	G|1.000;A|0.000		0.612	C22orf29-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317290.2	NM_024627	
SUSD2	56241	hgsc.bcm.edu	37	22	24583203	24583203	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr22:24583203T>C	ENST00000358321.3	+	11	1937	c.1676T>C	c.(1675-1677)gTc>gCc	p.V559A		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	559	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						GGGGACAGGGTCTCCATCATG	0.652																																					p.V559A		Atlas-SNP	.											.	SUSD2	68	.	0			c.T1676C						.						97.0	85.0	89.0					22																	24583203		2203	4300	6503	SO:0001583	missense	56241	exon11			ACAGGGTCTCCAT	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1676T>C	chr22.hg19:g.24583203T>C	ENSP00000351075:p.Val559Ala	44.0	0.0		43.0	23.0	NM_019601	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	hg19	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083533	0.36758	.	.	ENSG00000099994	ENST00000358321	T	0.58652	0.32	4.5	3.44	0.39384	von Willebrand factor, type D domain (3);	0.062758	0.64402	D	0.000007	T	0.49047	0.1534	L	0.51422	1.61	0.45076	D	0.998095	B	0.14805	0.011	B	0.19946	0.027	T	0.41645	-0.9497	10	0.44086	T	0.13	-16.9332	8.6327	0.33928	0.0:0.0954:0.0:0.9046	.	559	Q9UGT4	SUSD2_HUMAN	A	559	ENSP00000351075:V559A	ENSP00000351075:V559A	V	+	2	0	SUSD2	22913203	0.995000	0.38212	0.019000	0.16419	0.476000	0.33039	0.903000	0.28475	0.668000	0.31126	0.369000	0.22263	GTC	.	.		0.652	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
MN1	4330	hgsc.bcm.edu	37	22	28195917	28195917	+	Silent	SNP	G	G	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr22:28195917G>C	ENST00000302326.4	-	1	1569	c.615C>G	c.(613-615)ggC>ggG	p.G205G		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	205					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						AGGACGGCAGGCCGTGGAAGG	0.672			T	ETV6	"""AML, meningioma"""																																p.G205G		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122	.	0			c.C615G						.						15.0	18.0	17.0					22																	28195917		1996	4161	6157	SO:0001819	synonymous_variant	4330	exon1			CGGCAGGCCGTGG	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.615C>G	chr22.hg19:g.28195917G>C		74.0	0.0		112.0	6.0	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	hg19	CCDS42998.1																																																																																			.	.		0.672	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
SEPT3	55964	hgsc.bcm.edu	37	22	42387581	42387581	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr22:42387581G>A	ENST00000396426.3	+	7	929	c.674G>A	c.(673-675)cGc>cAc	p.R225H	SEPT3_ENST00000396425.3_Missense_Mutation_p.R225H|SEPT3_ENST00000291236.11_Missense_Mutation_p.R161H|SEPT3_ENST00000406029.1_Missense_Mutation_p.R161H|SEPT3_ENST00000328414.8_3'UTR	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	225	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						CTCTAGGTTCGCAAGGAGCTT	0.493																																					p.R225H		Atlas-SNP	.											.	SEPT3	53	.	0			c.G674A						.						106.0	99.0	101.0					22																	42387581		2203	4300	6503	SO:0001583	missense	55964	exon7			AGGTTCGCAAGGA	AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.674G>A	chr22.hg19:g.42387581G>A	ENSP00000379704:p.Arg225His	100.0	0.0		93.0	49.0	NM_019106	B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Missense_Mutation	SNP	ENST00000396426.3	hg19	CCDS14026.2	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904679	0.92035	.	.	ENSG00000100167	ENST00000396426;ENST00000406029;ENST00000396425;ENST00000291236	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.38	5.38	0.77491	.	0.049025	0.85682	D	0.000000	T	0.59595	0.2205	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.69078	0.994;0.997;0.997;0.997	P;D;P;P	0.68765	0.71;0.96;0.775;0.899	T	0.57528	-0.7796	10	0.46703	T	0.11	.	19.5313	0.95230	0.0:0.0:1.0:0.0	.	161;161;225;225	B7Z686;B1AHR1;Q9UH03-2;Q9UH03	.;.;.;SEPT3_HUMAN	H	225;161;225;161	ENSP00000379704:R225H;ENSP00000383956:R161H;ENSP00000379703:R225H;ENSP00000291236:R161H	ENSP00000291236:R161H	R	+	2	0	SEPT3	40717527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.950000	0.87804	2.694000	0.91930	0.655000	0.94253	CGC	.	.		0.493	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322051.1	NM_145734	
CRELD2	79174	hgsc.bcm.edu	37	22	50316312	50316312	+	Silent	SNP	C	C	T			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr22:50316312C>T	ENST00000328268.4	+	6	719	c.645C>T	c.(643-645)ggC>ggT	p.G215G	CRELD2_ENST00000403427.3_Silent_p.G215G|CRELD2_ENST00000407217.3_Silent_p.G215G|CRELD2_ENST00000404488.3_Silent_p.G264G|CRELD2_ENST00000444954.1_3'UTR	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2	215						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GAGACTGCGGCGAGTGTGAAG	0.677																																					p.G264G		Atlas-SNP	.											.	CRELD2	57	.	0			c.C792T						.						45.0	33.0	37.0					22																	50316312		2185	4283	6468	SO:0001819	synonymous_variant	79174	exon7			CTGCGGCGAGTGT	BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.645C>T	chr22.hg19:g.50316312C>T		82.0	0.0		56.0	11.0	NM_001135101	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Silent	SNP	ENST00000328268.4	hg19	CCDS14082.1																																																																																			.	.		0.677	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317409.1	NM_024324	
FRMPD4	9758	hgsc.bcm.edu	37	X	12736481	12736481	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chrX:12736481A>G	ENST00000380682.1	+	16	4042	c.3536A>G	c.(3535-3537)aAg>aGg	p.K1179R		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1179					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CATCCTTCCAAGCTTCCTGAG	0.547																																					p.K1179R		Atlas-SNP	.											.	FRMPD4	214	.	0			c.A3536G						.						140.0	125.0	130.0					X																	12736481		2203	4300	6503	SO:0001583	missense	9758	exon16			CTTCCAAGCTTCC	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3536A>G	chrX.hg19:g.12736481A>G	ENSP00000370057:p.Lys1179Arg	81.0	0.0		92.0	75.0	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	hg19	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.004015	0.54254	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.07327	3.2	5.5	5.5	0.81552	.	0.173518	0.50627	D	0.000120	T	0.13841	0.0335	M	0.67953	2.075	0.39915	D	0.974071	P;P	0.43857	0.819;0.819	B;B	0.41374	0.355;0.355	T	0.01767	-1.1278	10	0.62326	D	0.03	-14.0447	14.6325	0.68666	1.0:0.0:0.0:0.0	.	1171;1179	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	R	1179;1170;1168	ENSP00000370057:K1179R	ENSP00000304583:K1168R	K	+	2	0	FRMPD4	12646402	1.000000	0.71417	0.988000	0.46212	0.936000	0.57629	7.020000	0.76419	1.836000	0.53414	0.486000	0.48141	AAG	.	.		0.547	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20179839	20179839	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chrX:20179839C>A	ENST00000379565.3	-	20	2089	c.1882G>T	c.(1882-1884)Gaa>Taa	p.E628*	RPS6KA3_ENST00000544447.1_Nonsense_Mutation_p.E600*|RPS6KA3_ENST00000379548.4_Nonsense_Mutation_p.E598*|RPS6KA3_ENST00000540702.1_Nonsense_Mutation_p.E599*|RPS6KA3_ENST00000479809.1_5'UTR	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	628	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GCCAATATTTCCTCTGGTGTA	0.323																																					p.E628X		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.G1882T						.						142.0	111.0	122.0					X																	20179839		2203	4300	6503	SO:0001587	stop_gained	6197	exon20			ATATTTCCTCTGG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1882G>T	chrX.hg19:g.20179839C>A	ENSP00000368884:p.Glu628*	27.0	0.0		35.0	28.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Nonsense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	39	7.594497	0.98378	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	18.8899	0.92395	0.0:1.0:0.0:0.0	.	.	.	.	X	628;600;598;599	.	ENSP00000368865:E598X	E	-	1	0	RPS6KA3	20089760	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.409000	0.81822	0.513000	0.50165	GAA	.	.		0.323	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
DACH2	117154	hgsc.bcm.edu	37	X	85403711	85403711	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chrX:85403711C>A	ENST00000373125.4	+	1	87	c.87C>A	c.(85-87)taC>taA	p.Y29*	DACH2_ENST00000373131.1_Nonsense_Mutation_p.Y29*	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	29					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						AACCCCTGTACTCGACTCCCA	0.592																																					p.Y29X		Atlas-SNP	.											.	DACH2	263	.	0			c.C87A						.						25.0	24.0	24.0					X																	85403711		2203	4300	6503	SO:0001587	stop_gained	117154	exon1			CCTGTACTCGACT	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.87C>A	chrX.hg19:g.85403711C>A	ENSP00000362217:p.Tyr29*	114.0	0.0		152.0	129.0	NM_001139514	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Nonsense_Mutation	SNP	ENST00000373125.4	hg19	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353874	0.82243	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	.	.	.	4.64	1.03	0.20045	.	0.000000	0.46145	D	0.000315	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.8598	0.13577	0.0:0.5164:0.1445:0.3391	.	.	.	.	X	29	.	ENSP00000345134:Y29X	Y	+	3	2	DACH2	85290367	0.990000	0.36364	0.679000	0.29978	0.027000	0.11550	0.572000	0.23684	0.159000	0.19401	0.538000	0.68166	TAC	.	.		0.592	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
NAP1L3	4675	hgsc.bcm.edu	37	X	92928252	92928252	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chrX:92928252C>A	ENST00000373079.3	-	1	315	c.52G>T	c.(52-54)Gcc>Tcc	p.A18S	NAP1L3_ENST00000475430.2_Missense_Mutation_p.A11S|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	18					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TCCTCTTCGGCAACCCCATGG	0.547																																					p.A18S		Atlas-SNP	.											.	NAP1L3	81	.	0			c.G52T						.						55.0	51.0	52.0					X																	92928252		2203	4300	6503	SO:0001583	missense	4675	exon1			CTTCGGCAACCCC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.52G>T	chrX.hg19:g.92928252C>A	ENSP00000362171:p.Ala18Ser	76.0	0.0		99.0	83.0	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	hg19	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.946511	0.34377	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.34859	1.34	3.65	2.79	0.32731	.	0.309642	0.30329	N	0.009880	T	0.18299	0.0439	N	0.19112	0.55	0.21553	N	0.999646	P	0.37061	0.58	B	0.32090	0.14	T	0.12268	-1.0554	10	0.20519	T	0.43	.	8.6193	0.33851	0.0:0.8802:0.0:0.1198	.	18	Q99457	NP1L3_HUMAN	S	18;11	ENSP00000362171:A18S	ENSP00000362171:A18S	A	-	1	0	NAP1L3	92814908	0.987000	0.35691	0.312000	0.25196	0.538000	0.34931	1.533000	0.36040	0.922000	0.37019	0.529000	0.55759	GCC	.	.		0.547	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
KDM5D	8284	hgsc.bcm.edu	37	Y	21871366	21871366	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chrY:21871366T>A	ENST00000317961.4	-	20	3184	c.2913A>T	c.(2911-2913)gaA>gaT	p.E971D	KDM5D_ENST00000541639.1_Missense_Mutation_p.E1002D|KDM5D_ENST00000382806.2_Missense_Mutation_p.E914D	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	971					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	GAGCCTTTTCTTCCCAGCGCT	0.527																																					p.E1002D		Atlas-SNP	.											.	KDM5D	40	.	0			c.A3006T						.						34.0	34.0	34.0					Y																	21871366		582	1915	2497	SO:0001583	missense	8284	exon21			CTTTTCTTCCCAG	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.2913A>T	chrY.hg19:g.21871366T>A	ENSP00000322408:p.Glu971Asp	36.0	0.0		70.0	30.0	NM_001146705	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	ENST00000317961.4	hg19	CCDS14794.1																																																																																			.	.		0.527	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
COL18A1	80781	hgsc.bcm.edu	37	21	46875463	46875472	+	Frame_Shift_Del	DEL	GGCTGCCACA	GGCTGCCACA	-			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	GGCTGCCACA	GGCTGCCACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr21:46875463_46875472delGGCTGCCACA	ENST00000359759.4	+	1	40_49	c.19_28delGGCTGCCACA	c.(19-30)ggctgccacatcfs	p.GCHI7fs	COL18A1_ENST00000400337.2_Intron|COL18A1_ENST00000355480.5_Frame_Shift_Del_p.GCHI7fs			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	7					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)	p.G7S(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTACCCCTGTGGCTGCCACATCCTGCTGCT	0.667																																					p.6_9del		Atlas-Indel,Pindel	.											.	COL18A1	129	.	1	Substitution - Missense(1)	lung(1)	c.18_27del						.																																			SO:0001589	frameshift_variant	80781	exon1			.		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.19_28delGGCTGCCACA	chr21.hg19:g.46875463_46875472delGGCTGCCACA	ENSP00000352798:p.Gly7fs	73.0	0.0		43.0	29.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Frame_Shift_Del	DEL	ENST00000359759.4	hg19																																																																																				.	.		0.667	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
BSN	8927	hgsc.bcm.edu	37	3	49700524	49700524	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr3:49700524delC	ENST00000296452.4	+	7	11047	c.10933delC	c.(10933-10935)cacfs	p.H3645fs		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3645					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AGCCAAGGAACACCGGCACGG	0.677																																					p.E3644fs		Atlas-Indel,Pindel	.											.	BSN	272	.	0			c.10932delA						.						25.0	25.0	25.0					3																	49700524		2202	4299	6501	SO:0001589	frameshift_variant	8927	exon7			.	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10933delC	chr3.hg19:g.49700524delC	ENSP00000296452:p.His3645fs	41.0	0.0		34.0	13.0	NM_003458	O43161|Q7LGH3	Frame_Shift_Del	DEL	ENST00000296452.4	hg19	CCDS2800.1																																																																																			.	.		0.677	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643054	1643055	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr11:1643054_1643055insC	ENST00000399682.1	-	1	313_314	c.269_270insG	c.(268-270)ggcfs	p.G90fs		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGGAGACACAGCCCCCCTTGGA	0.668																																					p.G90fs		Atlas-INDEL	.											KRTAP5-4,NS,carcinoma,0,1	KRTAP5-4	78	.	0			c.270_271insG						.																																			SO:0001589	frameshift_variant	387267	exon1			.	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.270dupG	chr11.hg19:g.1643060_1643060dupC	ENSP00000382590:p.Gly90fs	269.0	0.0		267.0	22.0	NM_001012709		Frame_Shift_Ins	INS	ENST00000399682.1	hg19																																																																																				.	.		0.668	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
TRIM13	10206	hgsc.bcm.edu	37	13	50588478	50588479	+	3'UTR	INS	-	-	TATAT	rs372866076		TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr13:50588478_50588479insTATAT	ENST00000378182.3	+	0	3140_3141				KCNRG_ENST00000312942.1_5'Flank|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		aaaaaaaaaaaaaatatatata	0.302																																					.		Atlas-INDEL	.											.	TRIM13	30	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			.	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1179->TATAT	chr13.hg19:g.50588478_50588479insTATAT		19.0	0.0		26.0	12.0	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	INS	ENST00000378182.3	hg19	CCDS9423.1																																																																																			.	.		0.302	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
GRIK3	2899	hgsc.bcm.edu	37	1	37291402	37291403	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr1:37291402_37291403insG	ENST00000373091.3	-	11	1571_1572	c.1555_1556insC	c.(1555-1557)ctgfs	p.L519fs	GRIK3_ENST00000373093.4_Frame_Shift_Ins_p.L519fs	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	519					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGTGATGGTCAGGGGGGCCACG	0.54																																					p.L519fs		Atlas-Indel,Pindel	.											.	GRIK3	195	.	0			c.1556_1557insC						.																																			SO:0001589	frameshift_variant	2899	exon11			.	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1556dupC	chr1.hg19:g.37291408_37291408dupG	ENSP00000362183:p.Leu519fs	106.0	0.0		57.0	18.0	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Frame_Shift_Ins	INS	ENST00000373091.3	hg19	CCDS416.1																																																																																			.	.		0.540	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
GGCX	2677	hgsc.bcm.edu	37	2	85779044	85779059	+	Frame_Shift_Del	DEL	GGATGTGCGCTGAAAG	GGATGTGCGCTGAAAG	-	rs146811957|rs41290033|rs146758153|rs372161185	byFrequency	TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	GGATGTGCGCTGAAAG	GGATGTGCGCTGAAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr2:85779044_85779059delGGATGTGCGCTGAAAG	ENST00000233838.4	-	11	1565_1580	c.1485_1500delCTTTCAGCGCACATCC	c.(1483-1500)ccctttcagcgcacatccfs	p.PFQRTS495fs	GGCX_ENST00000430215.3_Frame_Shift_Del_p.PFQRTS438fs|GGCX_ENST00000473665.1_5'Flank	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	495					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	GTTGCACCCAGGATGTGCGCTGAAAGGGTGACCAAG	0.528											OREG0014747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.496_501del		Atlas-Indel,Pindel	.											.	GGCX	44	.	0			c.1486_1501del						.																																			SO:0001589	frameshift_variant	2677	exon11			.		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.1485_1500delCTTTCAGCGCACATCC	chr2.hg19:g.85779044_85779059delGGATGTGCGCTGAAAG	ENSP00000233838:p.Pro495fs	99.0	0.0	1239	76.0	22.0	NM_000821	B4DMC5|E9PEE1|Q14415|Q6GU45	Frame_Shift_Del	DEL	ENST00000233838.4	hg19	CCDS1978.1																																																																																			.	.		0.528	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252490.3	NM_000821	
COL18A1	80781	hgsc.bcm.edu	37	21	46888580	46888597	+	In_Frame_Del	DEL	CGTGGACTGTGAGGAGTT	CGTGGACTGTGAGGAGTT	-			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	CGTGGACTGTGAGGAGTT	CGTGGACTGTGAGGAGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr21:46888580_46888597delCGTGGACTGTGAGGAGTT	ENST00000359759.4	+	2	1797_1814	c.1776_1793delCGTGGACTGTGAGGAGTT	c.(1774-1794)tacgtggactgtgaggagttc>tac	p.VDCEEF593del	COL18A1_ENST00000400337.2_In_Frame_Del_p.VDCEEF178del|COL18A1_ENST00000355480.5_In_Frame_Del_p.VDCEEF358del			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	593	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TGGCCCTCTACGTGGACTGTGAGGAGTTCCAGAGAATG	0.67																																					p.357_363del		Atlas-Indel,Pindel	.											.	COL18A1	129	.	0			c.1070_1087del						.																																			SO:0001651	inframe_deletion	80781	exon2			.		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1776_1793delCGTGGACTGTGAGGAGTT	chr21.hg19:g.46888580_46888597delCGTGGACTGTGAGGAGTT	ENSP00000352798:p.Val593_Phe598del	59.0	0.0		30.0	12.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	In_Frame_Del	DEL	ENST00000359759.4	hg19																																																																																				.	.		0.670	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
SPATA32	124783	hgsc.bcm.edu	37	17	43332844	43332845	+	Frame_Shift_Ins	INS	-	-	GGTGGCGGGAGATCTGAGGACAGGAGGGGGCTTGGTGCCT			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr17:43332844_43332845insGGTGGCGGGAGATCTGAGGACAGGAGGGGGCTTGGTGCCT	ENST00000331780.4	-	4	799_800	c.704_705insAGGCACCAAGCCCCCTCCTGTCCTCAGATCTCCCGCCACC	c.(703-705)cccfs	p.-235fs	MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|SPATA32_ENST00000543122.1_Frame_Shift_Ins_p.-214fs|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32						spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)											TCAGGTCAATGGGTGGCGGGAG	0.589																																					p.P235fs		Pindel	.											.	.	.	.	0			c.705_706insAGGCACCAAGCCCCCTCCTGTCCTCAGATCTCCCGCCACC						.																																			SO:0001589	frameshift_variant	124783	exon4			.	AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.665_704dupAGGCACCAAGCCCCCTCCTGTCCTCAGATCTCCCGCCACC	chr17.hg19:g.43332844_43332845insGGTGGCGGGAGATCTGAGGACAGGAGGGGGCTTGGTGCCT	ENSP00000331532:p.Pro235fs	95.0	0.0		114.0	11.0	NM_152343	Q7Z4U1|Q8N6V6	Frame_Shift_Ins	INS	ENST00000331780.4	hg19	CCDS32669.1																																																																																			.	.		0.589	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450946.1	NM_152343	
AGAP4	119016	hgsc.bcm.edu	37	10	51370883	51370883	+	5'UTR	DEL	C	C	-			TCGA-CC-A9FW-01A-11D-A36X-10	TCGA-CC-A9FW-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8da84d1c-a7dd-4e0f-82e8-abbcd33c5261	ffe29f46-9b5c-47f4-98bf-390f2183b420	g.chr10:51370883delC	ENST00000602930.1	-	0	438				RP11-592B15.3_ENST00000432221.2_RNA|TIMM23B_ENST00000451577.2_5'Flank|TIMM23B_ENST00000478381.1_5'Flank	NM_001276343.1	NP_001263272.1	Q5SRD3	AGAP8_HUMAN							regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(2)|ovary(2)	6						TCTGTGCTGTCCCGCCTGCCC	0.632																																					p.G63fs		Pindel	.											.	PARG	46	.	0			c.189delA						.						2.0	1.0	2.0					10																	51370883		225	461	686	SO:0001623	5_prime_UTR_variant	8505	exon1			.																												ENST00000602930.1:c.-112G>-	chr10.hg19:g.51370883delC		165.0	0.0		189.0	29.0	NM_003631		Frame_Shift_Del	DEL	ENST00000602930.1	hg19																																																																																				.	.		0.632	AGAP8-006	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000467541.1		
