#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF25	8718	hgsc.bcm.edu	37	1	6522204	6522204	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:6522204G>A	ENST00000356876.3	-	9	862	c.775C>T	c.(775-777)Cac>Tac	p.H259Y	TNFRSF25_ENST00000377782.3_Missense_Mutation_p.H268Y|TNFRSF25_ENST00000351748.3_Missense_Mutation_p.H76Y|TNFRSF25_ENST00000351959.5_Missense_Mutation_p.H222Y|TNFRSF25_ENST00000461703.2_5'Flank|TNFRSF25_ENST00000348333.3_Missense_Mutation_p.H214Y	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	259					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		AGAAGGGTGTGGGCGCTGTCC	0.637																																					p.H268Y		Atlas-SNP	.											.	TNFRSF25	22	.	0			c.C802T						.						128.0	132.0	130.0					1																	6522204		2203	4300	6503	SO:0001583	missense	8718	exon9			GGGTGTGGGCGCT	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.775C>T	chr1.hg19:g.6522204G>A	ENSP00000349341:p.His259Tyr	146.0	0.0		102.0	35.0	NM_148965	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	ENST00000356876.3	hg19	CCDS71.1	.	.	.	.	.	.	.	.	.	.	G	3.260	-0.151332	0.06585	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000351748;ENST00000348333	D;D;D;T;D	0.92965	-2.96;-3.14;-3.05;2.5;-2.01	4.89	1.93	0.25924	.	688.334000	0.00447	U	0.000093	D	0.93609	0.7959	M	0.64997	1.995	0.09310	N	1	D;D;D;P;D;D	0.67145	0.996;0.969;0.986;0.947;0.975;0.962	P;P;P;P;P;P	0.53450	0.726;0.656;0.656;0.454;0.726;0.67	T	0.79960	-0.1583	10	0.56958	D	0.05	0.8416	7.6734	0.28471	0.2917:0.0:0.7083:0.0	.	268;214;222;259;260;76	Q93038-11;Q93038-9;Q93038-10;Q93038;Q93038-2;Q93038-8	.;.;.;TNR25_HUMAN;.;.	Y	259;268;222;76;214	ENSP00000349341:H259Y;ENSP00000367013:H268Y;ENSP00000337713:H222Y;ENSP00000326762:H76Y;ENSP00000314451:H214Y	ENSP00000314451:H214Y	H	-	1	0	TNFRSF25	6444791	0.116000	0.22171	0.003000	0.11579	0.075000	0.17131	0.987000	0.29603	0.563000	0.29222	0.655000	0.94253	CAC	.	.		0.637	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965	
SF3A3	10946	hgsc.bcm.edu	37	1	38453345	38453345	+	Missense_Mutation	SNP	C	C	T	rs372195588		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:38453345C>T	ENST00000373019.4	-	4	1158	c.203G>A	c.(202-204)cGa>cAa	p.R68Q	SF3A3_ENST00000489537.1_5'UTR|SF3A3_ENST00000448721.2_Intron	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	68					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTCCTCCTTTCGTAATCTGCA	0.423																																					p.R68Q		Atlas-SNP	.											.	SF3A3	37	.	0			c.G203A						.	C	GLN/ARG	0,4406		0,0,2203	104.0	105.0	105.0		203	5.6	1.0	1		105	1,8599	1.2+/-3.3	0,1,4299	no	missense	SF3A3	NM_006802.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	68/502	38453345	1,13005	2203	4300	6503	SO:0001583	missense	10946	exon4			TCCTTTCGTAATC	U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.203G>A	chr1.hg19:g.38453345C>T	ENSP00000362110:p.Arg68Gln	220.0	0.0		131.0	54.0	NM_006802	D3DPT5|Q15460|Q5VT87	Missense_Mutation	SNP	ENST00000373019.4	hg19	CCDS428.1	.	.	.	.	.	.	.	.	.	.	C	36	5.708777	0.96821	0.0	1.16E-4	ENSG00000183431	ENST00000373019	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.86351	0.5912	M	0.92604	3.325	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.88495	0.3078	9	0.56958	D	0.05	-7.9523	19.6316	0.95708	0.0:1.0:0.0:0.0	.	68	Q12874	SF3A3_HUMAN	Q	68	.	ENSP00000362110:R68Q	R	-	2	0	SF3A3	38225932	1.000000	0.71417	0.995000	0.50966	0.936000	0.57629	7.684000	0.84104	2.642000	0.89623	0.557000	0.71058	CGA	.	.		0.423	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012976.1	NM_006802	
SMAP2	64744	hgsc.bcm.edu	37	1	40839819	40839819	+	IGR	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:40839819G>A								COL9A2 (56853 upstream) : SMAP2 (22687 downstream)																							TGAAGGACGTGGATCGGTACC	0.652																																					p.V9V		Atlas-SNP	.											.	SMAP2	48	.	0			c.G27A						.						66.0	57.0	60.0					1																	40839819		2203	4300	6503	SO:0001628	intergenic_variant	64744	exon1			GGACGTGGATCGG																													chr1.hg19:g.40839819G>A		198.0	0.0		124.0	47.0	NM_022733		Silent	SNP		hg19																																																																																				.	.	0	0.652								
MKNK1	8569	hgsc.bcm.edu	37	1	47028365	47028365	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:47028365C>T	ENST00000371946.4	-	11	1082	c.919G>A	c.(919-921)Gcc>Acc	p.A307T	MKNK1-AS1_ENST00000602433.1_RNA|MKNK1_ENST00000371944.4_Missense_Mutation_p.A171T|MKNK1_ENST00000428112.2_Missense_Mutation_p.A266T|MKNK1_ENST00000371945.4_Missense_Mutation_p.A266T|MKNK1_ENST00000341183.5_Missense_Mutation_p.A266T	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	307	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					CCACAGTCGGCCCCGCAGTGA	0.657																																					p.A307T		Atlas-SNP	.											.	MKNK1	36	.	0			c.G919A						.						28.0	25.0	26.0					1																	47028365		2200	4286	6486	SO:0001583	missense	8569	exon11			AGTCGGCCCCGCA	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.919G>A	chr1.hg19:g.47028365C>T	ENSP00000361014:p.Ala307Thr	77.0	0.0		59.0	11.0	NM_003684	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	hg19	CCDS538.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807832	0.31961	.	.	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1	5.42	1.26	0.21427	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.356802	0.34986	N	0.003538	T	0.09949	0.0244	N	0.12611	0.24	0.80722	D	1	B;B;B;B;B;B	0.10296	0.003;0.003;0.0;0.0;0.0;0.002	B;B;B;B;B;B	0.14023	0.01;0.01;0.004;0.002;0.003;0.006	T	0.17961	-1.0352	10	0.25751	T	0.34	.	8.0312	0.30465	0.0:0.5842:0.0:0.4158	.	171;171;266;266;266;307	B4DQK5;Q7Z319;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;.;.;MKNK1_HUMAN	T	307;266;171;266;266	ENSP00000361014:A307T;ENSP00000361013:A266T;ENSP00000361012:A171T;ENSP00000339573:A266T;ENSP00000411135:A266T	ENSP00000339573:A266T	A	-	1	0	MKNK1	46800952	1.000000	0.71417	0.929000	0.37066	0.564000	0.35744	1.333000	0.33816	0.424000	0.26061	0.563000	0.77884	GCC	.	.		0.657	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684	
ZBTB7B	51043	hgsc.bcm.edu	37	1	154988092	154988092	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:154988092G>A	ENST00000368426.3	+	3	1093	c.956G>A	c.(955-957)aGc>aAc	p.S319N	ZBTB7B_ENST00000292176.2_Missense_Mutation_p.S319N|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.S319N|ZBTB7B_ENST00000417934.2_Missense_Mutation_p.S353N	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	319					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCCTACCTAAGCTCCCTGCAC	0.657																																					p.S353N		Atlas-SNP	.											.	ZBTB7B	69	.	0			c.G1058A						.						44.0	43.0	43.0					1																	154988092		2203	4300	6503	SO:0001583	missense	51043	exon4			ACCTAAGCTCCCT	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.956G>A	chr1.hg19:g.154988092G>A	ENSP00000357411:p.Ser319Asn	91.0	0.0		93.0	16.0	NM_001252406	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	ENST00000368426.3	hg19	CCDS1081.1	.	.	.	.	.	.	.	.	.	.	g	14.18	2.459273	0.43634	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.10477	2.89;2.89;2.87;2.89	4.08	4.08	0.47627	.	0.187911	0.30969	N	0.008506	T	0.02119	0.0066	N	0.14661	0.345	0.28989	N	0.888149	B;B;B	0.21225	0.053;0.053;0.053	B;B;B	0.17722	0.019;0.01;0.019	T	0.38286	-0.9668	10	0.44086	T	0.13	.	7.6015	0.28079	0.115:0.0:0.885:0.0	.	319;319;353	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	N	319;319;353;319	ENSP00000438647:S319N;ENSP00000357411:S319N;ENSP00000406286:S353N;ENSP00000292176:S319N	ENSP00000292176:S319N	S	+	2	0	ZBTB7B	153254716	0.953000	0.32496	0.988000	0.46212	0.972000	0.66771	2.260000	0.43267	2.109000	0.64355	0.462000	0.41574	AGC	.	.		0.657	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161017651	161017651	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:161017651A>T	ENST00000368013.3	-	12	3480	c.3160T>A	c.(3160-3162)Tct>Act	p.S1054T	USF1_ENST00000435396.1_5'Flank|USF1_ENST00000368020.1_5'Flank|USF1_ENST00000368021.3_5'Flank|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.S877T|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.S843T	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	1054					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GCACCTTCAGATGGGAGCTCC	0.592																																					p.S1054T		Atlas-SNP	.											.	ARHGAP30	105	.	0			c.T3160A						.						76.0	76.0	76.0					1																	161017651		2203	4300	6503	SO:0001583	missense	257106	exon12			CTTCAGATGGGAG	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.3160T>A	chr1.hg19:g.161017651A>T	ENSP00000356992:p.Ser1054Thr	114.0	0.0		79.0	35.0	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	hg19	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	A	1.347	-0.592555	0.03799	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368015	T;T;T	0.30182	3.07;3.07;1.54	3.89	-3.82	0.04281	.	1.419890	0.04833	N	0.439041	T	0.07999	0.0200	L	0.36672	1.1	0.09310	N	1	B;B	0.18610	0.01;0.029	B;B	0.12156	0.007;0.006	T	0.33523	-0.9865	10	0.49607	T	0.09	.	6.4205	0.21740	0.5708:0.1497:0.2795:0.0	.	1054;843	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	T	843;1054;877	ENSP00000356995:S843T;ENSP00000356992:S1054T;ENSP00000356994:S877T	ENSP00000356992:S1054T	S	-	1	0	ARHGAP30	159284275	0.012000	0.17670	0.018000	0.16275	0.020000	0.10135	-0.680000	0.05197	-1.463000	0.01904	-1.815000	0.00603	TCT	.	.		0.592	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
OBSCN	84033	hgsc.bcm.edu	37	1	228487124	228487124	+	Intron	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:228487124G>A	ENST00000422127.1	+	43	11703				OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000366709.4_Intron|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.V4459M|OBSCN_ENST00000366707.4_Missense_Mutation_p.V1149M|OBSCN_ENST00000359599.6_3'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGACGGGGCTGTGTGTGAGCT	0.567																																					p.V4459M		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G13375A						.						150.0	127.0	134.0					1																	228487124		876	1991	2867	SO:0001627	intron_variant	84033	exon50			GGGGCTGTGTGTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+4380G>A	chr1.hg19:g.228487124G>A		217.0	0.0		90.0	32.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518730	0.27211	.	.	ENSG00000154358	ENST00000366707	T	0.67345	-0.26	4.66	-2.87	0.05700	.	.	.	.	.	T	0.47078	0.1426	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35798	-0.9774	6	0.30078	T	0.28	.	2.2618	0.04068	0.4845:0.1056:0.2319:0.178	.	.	.	.	M	1149	ENSP00000355668:V1149M	ENSP00000355668:V1149M	V	+	1	0	OBSCN	226553747	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-5.658000	0.00106	-0.831000	0.04256	-0.459000	0.05422	GTG	.	.		0.567	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2B11	127623	hgsc.bcm.edu	37	1	247615107	247615108	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:247615107_247615108GG>TT	ENST00000318749.6	-	1	200_201	c.177_178CC>AA	c.(175-180)ctCCac>ctAAac	p.H60N		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			ATGGGGCTGTGGAGTTGAGGAT	0.579																																					p.H60N|p.L59L		Atlas-SNP	.											.	OR2B11	102	.	0			c.C178A|c.C177A						.																																			SO:0001583	missense	127623	exon1			GGCTGTGGAGTTG|GCTGTGGAGTTGA		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.177_178delinsTT	chr1.hg19:g.247615107_247615108delinsTT	ENSP00000325682:p.His60Asn	124.0	0.0		88.0|87.0	34.0|32.0	NM_001004492	B2RP03	Missense_Mutation|Silent	SNP	ENST00000318749.6	hg19	CCDS31090.1																																																																																			.	.		0.579	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
MYT1L	23040	hgsc.bcm.edu	37	2	1946920	1946920	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:1946920G>A	ENST00000399161.2	-	9	1086	c.339C>T	c.(337-339)gaC>gaT	p.D113D	MYT1L_ENST00000428368.2_Silent_p.D113D	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	113	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTCATCATTGTCCTCGGAGT	0.587																																					p.D113D		Atlas-SNP	.											.	MYT1L	241	.	0			c.C339T						.						112.0	111.0	111.0					2																	1946920		2091	4109	6200	SO:0001819	synonymous_variant	23040	exon9			ATCATTGTCCTCG	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.339C>T	chr2.hg19:g.1946920G>A		555.0	0.0		509.0	26.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	hg19																																																																																				.	.		0.587	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
PPP1R21	129285	hgsc.bcm.edu	37	2	48718183	48718183	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:48718183G>A	ENST00000294952.8	+	15	1630	c.1473G>A	c.(1471-1473)ttG>ttA	p.L491L	PPP1R21_ENST00000449090.2_Silent_p.L491L|PPP1R21_ENST00000281394.4_Silent_p.L491L	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	491						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						GCAACAATTTGGACTACTTCA	0.343																																					p.L491L		Atlas-SNP	.											.	PPP1R21	47	.	0			c.G1473A						.						135.0	128.0	130.0					2																	48718183		2203	4300	6503	SO:0001819	synonymous_variant	129285	exon15			CAATTTGGACTAC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1473G>A	chr2.hg19:g.48718183G>A		218.0	0.0		134.0	9.0	NM_152994	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Silent	SNP	ENST00000294952.8	hg19	CCDS46278.1																																																																																			.	.		0.343	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
PCBP1	5093	hgsc.bcm.edu	37	2	70315174	70315174	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:70315174T>A	ENST00000303577.5	+	1	590	c.299T>A	c.(298-300)cTg>cAg	p.L100Q	PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	100	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L100P(1)|p.L100Q(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						CCGGTCACCCTGAGGCTGGTG	0.602																																					p.L100Q	Colon(85;1146 1307 3484 18706 25380)	Atlas-SNP	.											PCBP1,rectum,carcinoma,0,6	PCBP1	28	.	2	Substitution - Missense(2)	large_intestine(2)	c.T299A						.						59.0	73.0	68.0					2																	70315174		2201	4300	6501	SO:0001583	missense	5093	exon1			TCACCCTGAGGCT		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.299T>A	chr2.hg19:g.70315174T>A	ENSP00000305556:p.Leu100Gln	57.0	0.0		30.0	10.0	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	hg19	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.551119	0.65311	.	.	ENSG00000169564	ENST00000303577	T	0.30714	1.52	4.16	4.16	0.48862	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.168590	0.40469	U	0.001094	T	0.60573	0.2279	M	0.91459	3.21	0.54753	D	0.999986	D	0.71674	0.998	D	0.70487	0.969	T	0.69781	-0.5052	10	0.87932	D	0	.	11.8577	0.52449	0.0:0.0:0.0:1.0	.	100	Q15365	PCBP1_HUMAN	Q	100	ENSP00000305556:L100Q	ENSP00000305556:L100Q	L	+	2	0	PCBP1	70168678	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	5.884000	0.69729	2.120000	0.65058	0.477000	0.44152	CTG	.	.		0.602	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
CLEC4F	165530	hgsc.bcm.edu	37	2	71043634	71043634	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:71043634C>G	ENST00000272367.2	-	4	955	c.879G>C	c.(877-879)caG>caC	p.Q293H	CLEC4F_ENST00000426626.1_Missense_Mutation_p.Q293H	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	293					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CATTTGTGTTCTGCAAATTTT	0.408																																					p.Q293H	Colon(107;10 2157 6841 26035)	Atlas-SNP	.											.	CLEC4F	95	.	0			c.G879C						.						91.0	96.0	94.0					2																	71043634		2203	4299	6502	SO:0001583	missense	165530	exon4			TGTGTTCTGCAAA	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.879G>C	chr2.hg19:g.71043634C>G	ENSP00000272367:p.Gln293His	428.0	0.0		297.0	19.0	NM_173535	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	hg19	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082720	0.55861	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.79554	-1.28;-1.28	4.19	-0.85	0.10720	.	0.178344	0.27223	N	0.020352	D	0.83751	0.5322	M	0.61703	1.905	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.68192	0.956;0.956	T	0.74847	-0.3525	10	0.87932	D	0	.	7.336	0.26609	0.0:0.4908:0.0:0.5092	.	293;293	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	H	293	ENSP00000272367:Q293H;ENSP00000390581:Q293H	ENSP00000272367:Q293H	Q	-	3	2	CLEC4F	70897142	0.000000	0.05858	0.001000	0.08648	0.652000	0.38707	-0.120000	0.10660	-0.237000	0.09739	0.313000	0.20887	CAG	.	.		0.408	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
TEX261	113419	hgsc.bcm.edu	37	2	71215838	71215838	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:71215838G>A	ENST00000272438.4	-	6	670	c.483C>T	c.(481-483)gtC>gtT	p.V161V	AC007040.11_ENST00000606025.1_Intron|TEX261_ENST00000466731.1_5'UTR	NM_144582.2	NP_653183.2	Q6UWH6	TX261_HUMAN	testis expressed 261	161						integral component of membrane (GO:0016021)				NS(1)|breast(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						AATTGGAGACGACATCATCTG	0.512																																					p.V161V		Atlas-SNP	.											.	TEX261	11	.	0			c.C483T						.						99.0	92.0	94.0					2																	71215838		2203	4300	6503	SO:0001819	synonymous_variant	113419	exon6			GGAGACGACATCA	AL832385	CCDS1914.1	2p13.3	2013-09-24	2007-03-13		ENSG00000144043	ENSG00000144043			30712	protein-coding gene	gene with protein product			"""testis expressed sequence 261"""			9464256	Standard	NM_144582		Approved	MGC32043, TEG-261	uc002shn.3	Q6UWH6	OTTHUMG00000129708	ENST00000272438.4:c.483C>T	chr2.hg19:g.71215838G>A		101.0	0.0		68.0	27.0	NM_144582	A1A587|D6W5G9|Q8WUJ5	Silent	SNP	ENST00000272438.4	hg19	CCDS1914.1																																																																																			.	.		0.512	TEX261-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251916.1	NM_144582	
NPAS2	4862	hgsc.bcm.edu	37	2	101580593	101580593	+	Silent	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:101580593T>C	ENST00000335681.5	+	8	957	c.672T>C	c.(670-672)gtT>gtC	p.V224V	NPAS2_ENST00000542504.1_Silent_p.V289V|NPAS2_ENST00000486017.1_3'UTR	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	224					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAAAGGAGGTTTGCTTCATTG	0.502																																					p.V224V		Atlas-SNP	.											.	NPAS2	88	.	0			c.T672C						.						129.0	120.0	123.0					2																	101580593		2203	4300	6503	SO:0001819	synonymous_variant	4862	exon8			GGAGGTTTGCTTC	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.672T>C	chr2.hg19:g.101580593T>C		138.0	0.0		88.0	31.0	NM_002518	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Silent	SNP	ENST00000335681.5	hg19	CCDS2048.1																																																																																			.	.		0.502	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
CACNB4	785	hgsc.bcm.edu	37	2	152732958	152732958	+	Missense_Mutation	SNP	C	C	G	rs376364352		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:152732958C>G	ENST00000539935.1	-	5	570	c.503G>C	c.(502-504)aGa>aCa	p.R168T	CACNB4_ENST00000397327.2_Missense_Mutation_p.R121T|CACNB4_ENST00000360283.6_Missense_Mutation_p.R134T|CACNB4_ENST00000201943.5_Missense_Mutation_p.R168T|CACNB4_ENST00000534999.1_Missense_Mutation_p.R134T|CACNB4_ENST00000427385.1_Missense_Mutation_p.R150T	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	168					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AAAACGTCCTCTTTTTTGTTC	0.418																																					p.R168T		Atlas-SNP	.											.	CACNB4	108	.	0			c.G503C						.	C	THR/ARG,THR/ARG,THR/ARG,THR/ARG	1,3793		0,1,1896	139.0	131.0	134.0		503,449,401,503	5.6	1.0	2		134	0,8242		0,0,4121	no	missense,missense,missense,missense	CACNB4	NM_000726.3,NM_001005746.2,NM_001005747.2,NM_001145798.1	71,71,71,71	0,1,6017	GG,GC,CC		0.0,0.0264,0.0083	benign,benign,benign,benign	168/521,150/503,134/487,168/459	152732958	1,12035	1897	4121	6018	SO:0001583	missense	785	exon5			CGTCCTCTTTTTT	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.503G>C	chr2.hg19:g.152732958C>G	ENSP00000438949:p.Arg168Thr	279.0	0.0		63.0	28.0	NM_001145798	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	ENST00000539935.1	hg19	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.731069	0.48939	2.64E-4	0.0	ENSG00000182389	ENST00000539935;ENST00000360283;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943;ENST00000339254	D;D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.63	5.63	0.86233	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	L	0.28115	0.83	0.58432	D	0.999999	P;B;P;B;P	0.38922	0.651;0.129;0.561;0.418;0.554	B;B;B;B;B	0.39419	0.212;0.071;0.157;0.157;0.299	T	0.72228	-0.4354	10	0.15952	T	0.53	-17.4098	20.0499	0.97621	0.0:1.0:0.0:0.0	.	168;134;168;150;134	A7BJ74;E7DBM8;O00305;B4DG40;O00305-2	.;.;CACB4_HUMAN;.;.	T	168;134;125;163;134;121;150;168;168	ENSP00000438949:R168T;ENSP00000353425:R134T;ENSP00000390161:R163T;ENSP00000443893:R134T;ENSP00000380490:R121T;ENSP00000410978:R150T;ENSP00000201943:R168T	ENSP00000201943:R168T	R	-	2	0	CACNB4	152441204	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.847000	0.69451	2.798000	0.96311	0.655000	0.94253	AGA	.	.		0.418	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
SLC25A12	8604	hgsc.bcm.edu	37	2	172691267	172691267	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:172691267C>A	ENST00000422440.2	-	7	758	c.721G>T	c.(721-723)Ggc>Tgc	p.G241C	SLC25A12_ENST00000392592.4_Missense_Mutation_p.G134C	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	241					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TTCCTTGTGCCAGCTAGAGTG	0.363																																					p.G241C		Atlas-SNP	.											.	SLC25A12	59	.	0			c.G721T						.						132.0	124.0	127.0					2																	172691267		2203	4300	6503	SO:0001583	missense	8604	exon7			TTGTGCCAGCTAG	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.721G>T	chr2.hg19:g.172691267C>A	ENSP00000388658:p.Gly241Cys	112.0	0.0		47.0	8.0	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	hg19	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817550	0.90790	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;T	0.80214	-1.35;-1.19	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89577	0.6755	M	0.81682	2.555	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61800	0.894;0.894	D	0.90304	0.4332	10	0.72032	D	0.01	-10.0474	19.7609	0.96316	0.0:1.0:0.0:0.0	.	134;241	B3KR64;O75746	.;CMC1_HUMAN	C	241;134	ENSP00000388658:G241C;ENSP00000376371:G134C	ENSP00000376371:G134C	G	-	1	0	SLC25A12	172399513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.729000	0.84864	2.741000	0.93983	0.563000	0.77884	GGC	.	.		0.363	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
ALS2	57679	hgsc.bcm.edu	37	2	202633600	202633600	+	Silent	SNP	T	T	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:202633600T>G	ENST00000264276.6	-	2	381	c.9A>C	c.(7-9)tcA>tcC	p.S3S	ALS2_ENST00000467448.1_Silent_p.S3S|ALS2_ENST00000496244.1_5'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	3					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTCTCTTCTTTGAGTCCATCG	0.368																																					p.S3S		Atlas-SNP	.											.	ALS2	172	.	0			c.A9C						.						137.0	129.0	131.0					2																	202633600		1862	4102	5964	SO:0001819	synonymous_variant	57679	exon2			CTTCTTTGAGTCC	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.9A>C	chr2.hg19:g.202633600T>G		140.0	0.0		72.0	22.0	NM_001135745	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.		0.368	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
FARP2	9855	hgsc.bcm.edu	37	2	242343251	242343251	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:242343251C>T	ENST00000264042.3	+	3	362	c.192C>T	c.(190-192)tgC>tgT	p.C64C	FARP2_ENST00000373287.4_Silent_p.C64C|FARP2_ENST00000545004.1_Silent_p.C64C	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	64	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.C64C(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		AGCCTAAATGCGATGGCCAGG	0.413																																					p.C64C		Atlas-SNP	.											FARP2,caecum,carcinoma,0,2	FARP2	92	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C192T						.						109.0	102.0	104.0					2																	242343251		2203	4300	6503	SO:0001819	synonymous_variant	9855	exon3			TAAATGCGATGGC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.192C>T	chr2.hg19:g.242343251C>T		192.0	0.0		100.0	20.0	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	hg19	CCDS33424.1																																																																																			.	.		0.413	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
TRIM71	131405	hgsc.bcm.edu	37	3	32915309	32915309	+	Splice_Site	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:32915309G>A	ENST00000383763.5	+	2	915		c.e2-1			NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase						fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTTGTCCCCAGGTGCTGCACC	0.592																																					.		Atlas-SNP	.											.	TRIM71	73	.	0			c.853-1G>A						.						301.0	312.0	308.0					3																	32915309		2116	4231	6347	SO:0001630	splice_region_variant	131405	exon2			TCCCCAGGTGCTG		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.853-1G>A	chr3.hg19:g.32915309G>A		299.0	0.0		199.0	32.0	NM_001039111		Splice_Site	SNP	ENST00000383763.5	hg19	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606327	0.87157	.	.	ENSG00000206557	ENST00000383763	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3848	0.90463	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIM71	32890313	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.751000	0.98889	2.769000	0.95229	0.655000	0.94253	.	.	.		0.592	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	Intron
TRMT10C	54931	hgsc.bcm.edu	37	3	101283884	101283884	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:101283884G>A	ENST00000309922.6	+	2	413	c.259G>A	c.(259-261)Gat>Aat	p.D87N		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	87					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										AAGCAGTAAGGATGAAGATCC	0.438																																					p.D87N		Atlas-SNP	.											.	.	.	.	0			c.G259A						.						117.0	108.0	111.0					3																	101283884		1907	4127	6034	SO:0001583	missense	54931	exon2			AGTAAGGATGAAG	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.259G>A	chr3.hg19:g.101283884G>A	ENSP00000312356:p.Asp87Asn	193.0	0.0		118.0	44.0	NM_017819	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	hg19	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673703	0.29693	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.54866	0.55;0.55	5.45	5.45	0.79879	.	0.854822	0.10779	N	0.635072	T	0.54598	0.1868	L	0.57536	1.79	0.32643	N	0.520404	B	0.27559	0.181	B	0.20767	0.031	T	0.57768	-0.7754	10	0.39692	T	0.17	-2.6616	20.1745	0.98175	0.0:0.0:1.0:0.0	.	87	Q7L0Y3	MRRP1_HUMAN	N	87	ENSP00000312356:D87N;ENSP00000419389:D87N	ENSP00000312356:D87N	D	+	1	0	RG9MTD1	102766574	1.000000	0.71417	0.943000	0.38184	0.644000	0.38419	3.148000	0.50647	2.941000	0.99782	0.655000	0.94253	GAT	.	.		0.438	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
GTF2E1	2960	hgsc.bcm.edu	37	3	120469757	120469757	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:120469757G>A	ENST00000283875.5	+	2	451	c.358G>A	c.(358-360)Gat>Aat	p.D120N		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	120					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		CGATGAGAGAGATTCGACCAA	0.403																																					p.D120N		Atlas-SNP	.											.	GTF2E1	52	.	0			c.G358A						.						81.0	82.0	82.0					3																	120469757		2203	4300	6503	SO:0001583	missense	2960	exon2			GAGAGAGATTCGA	S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.358G>A	chr3.hg19:g.120469757G>A	ENSP00000283875:p.Asp120Asn	155.0	0.0		116.0	61.0	NM_005513	Q16103	Missense_Mutation	SNP	ENST00000283875.5	hg19	CCDS3002.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973662	0.53720	.	.	ENSG00000153767	ENST00000283875;ENST00000492959	T	0.47528	0.84	6.06	5.18	0.71444	Zinc finger, RING/FYVE/PHD-type (1);TFIIEalpha/SarR/Rpc3 HTH domain (1);	0.042733	0.85682	N	0.000000	T	0.49115	0.1538	M	0.68593	2.085	0.80722	D	1	B;B	0.16166	0.002;0.016	B;B	0.29077	0.047;0.098	T	0.43130	-0.9410	9	.	.	.	-8.7497	13.5627	0.61799	0.075:0.0:0.925:0.0	.	120;120	P29083;Q53F88	T2EA_HUMAN;.	N	120	ENSP00000283875:D120N	.	D	+	1	0	GTF2E1	121952447	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.905000	0.87416	1.547000	0.49401	0.655000	0.94253	GAT	.	.		0.403	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513	
PLXND1	23129	hgsc.bcm.edu	37	3	129275500	129275500	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:129275500A>G	ENST00000324093.4	-	35	5799	c.5621T>C	c.(5620-5622)aTg>aCg	p.M1874T	PLXND1_ENST00000393239.1_3'UTR|PLXND1_ENST00000504689.1_Missense_Mutation_p.M30T	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1874					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						AATCTCTGCCATGGCCACATT	0.552																																					p.M1874T	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.T5621C						.						158.0	142.0	147.0					3																	129275500		2203	4300	6503	SO:0001583	missense	23129	exon35			TCTGCCATGGCCA	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5621T>C	chr3.hg19:g.129275500A>G	ENSP00000317128:p.Met1874Thr	179.0	0.0		148.0	55.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	hg19	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.636703	0.47049	.	.	ENSG00000004399	ENST00000324093;ENST00000504689	T;T	0.11930	2.73;2.73	5.11	3.96	0.45880	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.103102	0.64402	D	0.000004	T	0.09905	0.0243	N	0.14661	0.345	0.80722	D	1	B;P	0.38677	0.017;0.642	B;B	0.39971	0.018;0.315	T	0.14559	-1.0468	10	0.87932	D	0	.	10.902	0.47058	0.9258:0.0:0.0742:0.0	.	470;1874	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	T	1874;30	ENSP00000317128:M1874T;ENSP00000426162:M30T	ENSP00000317128:M1874T	M	-	2	0	PLXND1	130758190	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	5.168000	0.64978	0.786000	0.33708	-0.609000	0.04063	ATG	.	.		0.552	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
NAAA	27163	hgsc.bcm.edu	37	4	76861223	76861223	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr4:76861223C>A	ENST00000286733.4	-	2	403	c.302G>T	c.(301-303)gGc>gTc	p.G101V	NAAA_ENST00000507187.2_Missense_Mutation_p.G101V|NAAA_ENST00000399497.3_Missense_Mutation_p.G101V|NAAA_ENST00000507956.1_Missense_Mutation_p.G101V|NAAA_ENST00000505594.1_5'UTR	NM_014435.3	NP_055250.2	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase	101					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	11						GTCACACATGCCGCGGATCTC	0.622																																					p.G101V		Atlas-SNP	.											.	NAAA	26	.	0			c.G302T						.						52.0	60.0	57.0					4																	76861223		2029	4183	6212	SO:0001583	missense	27163	exon2			CACATGCCGCGGA	M92449	CCDS43239.1	4q21.1	2011-09-23	2008-04-24	2008-04-24	ENSG00000138744	ENSG00000138744	3.5.1.-		736	protein-coding gene	gene with protein product		607469	"""N-acylsphingosine amidohydrolase (acid ceramidase)-like"""	ASAHL		10610717, 1446826	Standard	NM_001042402		Approved		uc003hjb.3	Q02083	OTTHUMG00000160855	ENST00000286733.4:c.302G>T	chr4.hg19:g.76861223C>A	ENSP00000286733:p.Gly101Val	121.0	0.0		57.0	22.0	NM_014435	Q5KTF2|Q96EY2|Q9BRA8	Missense_Mutation	SNP	ENST00000286733.4	hg19	CCDS43239.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262281	0.80358	.	.	ENSG00000138744	ENST00000399497;ENST00000286733;ENST00000507956;ENST00000399490;ENST00000507187	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.1	5.1	0.69264	.	0.055581	0.64402	D	0.000001	T	0.77130	0.4085	M	0.73217	2.22	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.985	T	0.79249	-0.1881	10	0.87932	D	0	-19.6079	13.8776	0.63662	0.0:1.0:0.0:0.0	.	101;101	D6R9S9;Q02083	.;NAAA_HUMAN	V	101	ENSP00000382420:G101V;ENSP00000286733:G101V;ENSP00000427641:G101V;ENSP00000423142:G101V	ENSP00000286733:G101V	G	-	2	0	NAAA	77080247	0.937000	0.31787	0.992000	0.48379	0.693000	0.40251	5.302000	0.65733	2.655000	0.90218	0.585000	0.79938	GGC	.	.		0.622	NAAA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362843.4		
FAM47E-STBD1	100631383	hgsc.bcm.edu	37	4	77230589	77230589	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr4:77230589G>T	ENST00000237642.6	+	2	1257	c.513G>T	c.(511-513)gaG>gaT	p.E171D	FAM47E_ENST00000515604.1_3'UTR|FAM47E-STBD1_ENST00000539752.1_Missense_Mutation_p.E22D	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough																		GTTTTGCAGAGAAGTTGCCTT	0.443																																					p.E171D		Atlas-SNP	.											.	STBD1	22	.	0			c.G513T						.						52.0	54.0	54.0					4																	77230589		2203	4300	6503	SO:0001583	missense	8987	exon2			TGCAGAGAAGTTG		CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.513G>T	chr4.hg19:g.77230589G>T	ENSP00000237642:p.Glu171Asp	146.0	0.0		109.0	42.0	NM_003943		Missense_Mutation	SNP	ENST00000237642.6	hg19	CCDS3578.1	.	.	.	.	.	.	.	.	.	.	G	2.139	-0.397246	0.04899	.	.	ENSG00000118804	ENST00000539752;ENST00000237642	.	.	.	4.73	-1.64	0.08318	.	0.933364	0.08922	N	0.874297	T	0.23926	0.0579	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.21930	-1.0231	9	0.30078	T	0.28	-0.6048	1.7559	0.02982	0.3423:0.1295:0.3961:0.132	.	171	O95210	STBD1_HUMAN	D	22;171	.	ENSP00000237642:E171D	E	+	3	2	STBD1	77449613	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.073000	0.11468	-0.250000	0.09555	-0.165000	0.13383	GAG	.	.		0.443	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
ANXA3	306	hgsc.bcm.edu	37	4	79503384	79503384	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr4:79503384G>A	ENST00000264908.6	+	5	631	c.252G>A	c.(250-252)atG>atA	p.M84I	ANXA3_ENST00000512884.1_Missense_Mutation_p.M45I|ANXA3_ENST00000503570.2_Missense_Mutation_p.M45I	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	84					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AGCATCTCATGGTGGCCCTAG	0.453																																					p.M84I	GBM(2;126 157 27790 28920 42492)	Atlas-SNP	.											.	ANXA3	35	.	0			c.G252A						.						87.0	84.0	85.0					4																	79503384		2203	4300	6503	SO:0001583	missense	306	exon5			TCTCATGGTGGCC	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.252G>A	chr4.hg19:g.79503384G>A	ENSP00000264908:p.Met84Ile	304.0	0.0		157.0	62.0	NM_005139	B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	hg19	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	G	8.570	0.879933	0.17467	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000512373;ENST00000514171;ENST00000508214	T;T;T;T;T;T	0.03181	4.02;4.02;4.02;4.02;4.02;4.02	5.16	5.16	0.70880	Annexin repeat, conserved site (1);	0.146214	0.64402	D	0.000009	T	0.03220	0.0094	N	0.16066	0.365	0.51233	D	0.999914	B	0.27117	0.168	B	0.34346	0.18	T	0.32268	-0.9913	10	0.02654	T	1	.	17.5603	0.87905	0.0:0.0:1.0:0.0	.	84	P12429	ANXA3_HUMAN	I	84;45;45;84;84;84	ENSP00000264908:M84I;ENSP00000423068:M45I;ENSP00000421015:M45I;ENSP00000424584:M84I;ENSP00000421512:M84I;ENSP00000422281:M84I	ENSP00000264908:M84I	M	+	3	0	ANXA3	79722408	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.792000	0.38754	2.674000	0.91012	0.591000	0.81541	ATG	.	.		0.453	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139	
GHR	2690	hgsc.bcm.edu	37	5	42713546	42713546	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:42713546G>A	ENST00000230882.4	+	8	990	c.800G>A	c.(799-801)tGg>tAg	p.W267*	GHR_ENST00000537449.1_Nonsense_Mutation_p.W80*|GHR_ENST00000357703.3_Nonsense_Mutation_p.W245*	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	267					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TACTTTCCATGGCTCTTAATT	0.328																																					p.W274X		Atlas-SNP	.											.	GHR	94	.	0			c.G821A						.						181.0	186.0	184.0					5																	42713546		2202	4295	6497	SO:0001587	stop_gained	2690	exon8			TTCCATGGCTCTT		CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.800G>A	chr5.hg19:g.42713546G>A	ENSP00000230882:p.Trp267*	425.0	0.0		158.0	49.0	NM_001242399	Q9HCX2	Nonsense_Mutation	SNP	ENST00000230882.4	hg19	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	G	39	7.446990	0.98289	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000356276;ENST00000537449	.	.	.	5.43	5.43	0.79202	.	0.224065	0.39341	N	0.001389	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-5.871	17.4237	0.87521	0.0:0.0:1.0:0.0	.	.	.	.	X	267;245;267;80	.	ENSP00000230882:W267X	W	+	2	0	GHR	42749303	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.594000	0.61041	2.550000	0.86006	0.591000	0.81541	TGG	.	.		0.328	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
ARHGEF28	64283	hgsc.bcm.edu	37	5	73168941	73168941	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:73168941C>T	ENST00000426542.2	+	21	2704	c.2684C>T	c.(2683-2685)cCc>cTc	p.P895L	ARHGEF28_ENST00000545377.1_Missense_Mutation_p.P895L|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.P895L|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.P582L|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.P895L|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.P895L|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.P895L			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	895	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										AAAATTTTCCCCTGTTTAGAT	0.468																																					p.P895L		Atlas-SNP	.											.	.	.	.	0			c.C2684T						.						58.0	58.0	58.0					5																	73168941		1937	4140	6077	SO:0001583	missense	64283	exon22			TTTTCCCCTGTTT		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2684C>T	chr5.hg19:g.73168941C>T	ENSP00000412175:p.Pro895Leu	172.0	0.0		158.0	50.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	hg19	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970568	0.92919	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.24	5.24	0.73138	Dbl homology (DH) domain (5);	.	.	.	.	D	0.84401	0.5464	M	0.85041	2.73	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;D	0.97110	1.0;0.99;0.99;0.986	D	0.86711	0.1936	9	0.87932	D	0	.	19.1848	0.93639	0.0:1.0:0.0:0.0	.	582;895;895;895	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	L	895;895;895;895;895;895;582	ENSP00000296794:P895L;ENSP00000441913:P895L;ENSP00000441436:P895L;ENSP00000287898:P895L;ENSP00000411459:P895L;ENSP00000412175:P895L;ENSP00000296799:P582L	ENSP00000287898:P895L	P	+	2	0	RP11-428C6.1	73204697	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.729000	0.84864	2.610000	0.88304	0.650000	0.86243	CCC	.	.		0.468	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
PSD2	84249	hgsc.bcm.edu	37	5	139193051	139193051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:139193051G>T	ENST00000274710.3	+	3	734	c.529G>T	c.(529-531)Gag>Tag	p.E177*		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	177					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCAGCTTCGAGGCCCCCCT	0.662																																					p.E177X		Atlas-SNP	.											.	PSD2	88	.	0			c.G529T						.						37.0	41.0	39.0					5																	139193051		2203	4300	6503	SO:0001587	stop_gained	84249	exon3			AGCTTCGAGGCCC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.529G>T	chr5.hg19:g.139193051G>T	ENSP00000274710:p.Glu177*	144.0	0.0		97.0	51.0	NM_032289	D3DQD3|Q8N3J8	Nonsense_Mutation	SNP	ENST00000274710.3	hg19	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	G	38	7.037932	0.98021	.	.	ENSG00000146005	ENST00000274710	.	.	.	3.99	3.99	0.46301	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.7866	0.69808	0.0:0.0:1.0:0.0	.	.	.	.	X	177	.	ENSP00000274710:E177X	E	+	1	0	PSD2	139173235	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.484000	0.90445	2.214000	0.71695	0.462000	0.41574	GAG	.	.		0.662	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHA11	56138	hgsc.bcm.edu	37	5	140249239	140249239	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:140249239C>T	ENST00000398640.2	+	1	551	c.551C>T	c.(550-552)aCa>aTa	p.T184I	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T184I(2)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATTCACCAACAAATGGTAAG	0.383																																					p.T184I		Atlas-SNP	.											PCDHA11_ENST00000398640,NS,carcinoma,0,2	PCDHA11	209	.	2	Substitution - Missense(2)	lung(2)	c.C551T						.						68.0	75.0	73.0					5																	140249239		2000	4181	6181	SO:0001583	missense	56138	exon1			CACCAACAAATGG	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.551C>T	chr5.hg19:g.140249239C>T	ENSP00000381636:p.Thr184Ile	58.0	0.0		58.0	9.0	NM_018902	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	hg19	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	C	0.427	-0.905228	0.02453	.	.	ENSG00000249158	ENST00000398640	T	0.58060	0.36	5.71	0.824	0.18818	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44265	0.1285	M	0.66297	2.02	0.09310	N	1	B;B	0.17852	0.024;0.017	B;B	0.21151	0.019;0.033	T	0.44298	-0.9337	9	0.44086	T	0.13	.	1.251	0.01982	0.202:0.3351:0.2615:0.2014	.	184;184	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	I	184	ENSP00000381636:T184I	ENSP00000381636:T184I	T	+	2	0	PCDHA11	140229423	0.000000	0.05858	0.029000	0.17559	0.175000	0.22909	-3.644000	0.00405	-0.129000	0.11620	-0.122000	0.15005	ACA	.	.		0.383	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
TENM2	57451	hgsc.bcm.edu	37	5	166711893	166711893	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:166711893C>T	ENST00000518659.1	+	1	90	c.51C>T	c.(49-51)ggC>ggT	p.G17G	CTB-180C19.1_ENST00000521697.1_RNA|TENM2_ENST00000545108.1_Silent_p.G17G	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	17	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GACGCTGTGGCAAAGAGTGTC	0.527																																					p.G17G		Atlas-SNP	.											.	.	.	.	0			c.C51T						.						66.0	63.0	64.0					5																	166711893		692	1591	2283	SO:0001819	synonymous_variant	57451	exon1			CTGTGGCAAAGAG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.51C>T	chr5.hg19:g.166711893C>T		85.0	0.0		72.0	22.0	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	hg19																																																																																				.	.		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
SYCP2L	221711	hgsc.bcm.edu	37	6	10894136	10894136	+	Nonsense_Mutation	SNP	G	G	T	rs529185874		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:10894136G>T	ENST00000283141.6	+	3	411	c.115G>T	c.(115-117)Gga>Tga	p.G39*	SYCP2L_ENST00000543878.1_5'UTR|RP11-637O19.3_ENST00000480294.1_3'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	39						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CCATGATAAAGGATTTCAGAA	0.294																																					p.G39X		Atlas-SNP	.											.	SYCP2L	101	.	0			c.G115T						.						34.0	33.0	33.0					6																	10894136		1798	4060	5858	SO:0001587	stop_gained	221711	exon3			GATAAAGGATTTC	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.115G>T	chr6.hg19:g.10894136G>T	ENSP00000283141:p.Gly39*	285.0	0.0		173.0	70.0	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Nonsense_Mutation	SNP	ENST00000283141.6	hg19	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585750	0.86748	.	.	ENSG00000153157	ENST00000283141	.	.	.	5.66	1.91	0.25777	.	0.456218	0.21304	N	0.076756	.	.	.	.	.	.	0.24096	N	0.995895	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.7238	6.7655	0.23564	0.2148:0.1279:0.6572:0.0	.	.	.	.	X	39	.	ENSP00000283141:G39X	G	+	1	0	SYCP2L	11002122	1.000000	0.71417	0.053000	0.19242	0.184000	0.23303	2.359000	0.44142	0.063000	0.16370	-0.878000	0.02970	GGA	.	.		0.294	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
OR2H2	7932	hgsc.bcm.edu	37	6	29556102	29556102	+	Silent	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:29556102C>A	ENST00000383640.2	+	1	420	c.381C>A	c.(379-381)ccC>ccA	p.P127P	GABBR1_ENST00000355973.3_Intron	NM_007160.3	NP_009091.3	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H, member 2	127					defense response (GO:0006952)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|mating (GO:0007618)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	14						TCTGCCAGCCCCTCCACTATG	0.577																																					p.P127P		Atlas-SNP	.											.	OR2H2	29	.	0			c.C381A						.						124.0	128.0	126.0					6																	29556102		1509	2709	4218	SO:0001819	synonymous_variant	7932	exon1			CCAGCCCCTCCAC		CCDS34365.1	6p22.2-p21.31	2012-08-09				ENSG00000204657		"""GPCR / Class A : Olfactory receptors"""	8253	protein-coding gene	gene with protein product		600578					Standard	XM_005249407		Approved	hs6M1-12	uc003nmr.1	O95918		ENST00000383640.2:c.381C>A	chr6.hg19:g.29556102C>A		180.0	0.0		122.0	40.0	NM_007160	Q15062|Q2M1Y3|Q5STL8|Q5SUK1|Q6IFN7|Q6NTB7|Q96R14	Silent	SNP	ENST00000383640.2	hg19	CCDS34365.1																																																																																			.	.		0.577	OR2H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076057.2		
FRS3	10817	hgsc.bcm.edu	37	6	41738386	41738386	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:41738386G>C	ENST00000373018.3	-	7	1701	c.1450C>G	c.(1450-1452)Cgg>Ggg	p.R484G	FRS3_ENST00000259748.2_Missense_Mutation_p.R484G	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	484					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTGTTGTGCCGGGTTTTCCTG	0.602																																					p.R484G		Atlas-SNP	.											.	FRS3	53	.	0			c.C1450G						.						109.0	100.0	103.0					6																	41738386		2203	4300	6503	SO:0001583	missense	10817	exon7			TGTGCCGGGTTTT	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1450C>G	chr6.hg19:g.41738386G>C	ENSP00000362109:p.Arg484Gly	151.0	0.0		82.0	29.0	NM_006653	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	hg19	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494080	0.64186	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.62639	0.01;0.01	5.8	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.71643	0.3364	M	0.73598	2.24	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.76767	-0.2838	10	0.87932	D	0	-31.9543	13.9088	0.63853	0.0:0.0:0.6035:0.3965	.	484	O43559	FRS3_HUMAN	G	484	ENSP00000362109:R484G;ENSP00000259748:R484G	ENSP00000259748:R484G	R	-	1	2	FRS3	41846364	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	2.681000	0.46926	0.776000	0.33473	0.655000	0.94253	CGG	.	.		0.602	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653	
PLA2G7	7941	hgsc.bcm.edu	37	6	46672428	46672428	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:46672428G>C	ENST00000274793.7	-	12	1391	c.1195C>G	c.(1195-1197)Cat>Gat	p.H399D	PLA2G7_ENST00000537365.1_Missense_Mutation_p.H399D	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	399					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			AAATCTTTATGAAGTCCTATA	0.338																																					p.H399D		Atlas-SNP	.											.	PLA2G7	49	.	0			c.C1195G						.						72.0	67.0	69.0					6																	46672428		2202	4298	6500	SO:0001583	missense	7941	exon12			CTTTATGAAGTCC	U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.1195C>G	chr6.hg19:g.46672428G>C	ENSP00000274793:p.His399Asp	385.0	0.0		275.0	144.0	NM_005084	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Missense_Mutation	SNP	ENST00000274793.7	hg19	CCDS4917.1	.	.	.	.	.	.	.	.	.	.	G	9.263	1.043790	0.19748	.	.	ENSG00000146070	ENST00000274793;ENST00000537365	T;T	0.39406	1.08;1.08	5.5	2.48	0.30137	.	0.960419	0.08735	N	0.901426	T	0.09598	0.0236	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31447	-0.9943	10	0.13853	T	0.58	.	9.9133	0.41419	0.0:0.1357:0.5908:0.2735	.	399	Q13093	PAFA_HUMAN	D	399	ENSP00000274793:H399D;ENSP00000445666:H399D	ENSP00000274793:H399D	H	-	1	0	PLA2G7	46780387	0.995000	0.38212	0.982000	0.44146	0.966000	0.64601	0.383000	0.20651	0.254000	0.21573	0.561000	0.74099	CAT	.	.		0.338	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040802.1		
PGK2	5232	hgsc.bcm.edu	37	6	49753721	49753721	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:49753721T>A	ENST00000304801.3	-	1	1332	c.1180A>T	c.(1180-1182)Act>Tct	p.T394S		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	394					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CCGCCTCCAGTGCTGACATGG	0.483																																					p.T394S		Atlas-SNP	.											.	PGK2	87	.	0			c.A1180T						.						114.0	110.0	112.0					6																	49753721		2203	4300	6503	SO:0001583	missense	5232	exon1			CTCCAGTGCTGAC	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.1180A>T	chr6.hg19:g.49753721T>A	ENSP00000305995:p.Thr394Ser	153.0	0.0		109.0	54.0	NM_138733	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	hg19	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388149	0.82902	.	.	ENSG00000170950	ENST00000304801	D	0.94330	-3.4	4.19	4.19	0.49359	Phosphoglycerate kinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96337	0.8805	M	0.92691	3.335	0.58432	D	0.999997	P	0.51537	0.946	P	0.61275	0.886	D	0.96806	0.9593	10	0.72032	D	0.01	-20.2441	11.8373	0.52333	0.0:0.0:0.0:1.0	.	394	P07205	PGK2_HUMAN	S	394	ENSP00000305995:T394S	ENSP00000305995:T394S	T	-	1	0	PGK2	49861680	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.565000	0.67365	2.115000	0.64714	0.477000	0.44152	ACT	.	.		0.483	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
ABCA13	154664	hgsc.bcm.edu	37	7	48311639	48311639	+	Silent	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr7:48311639A>G	ENST00000435803.1	+	17	2400	c.2376A>G	c.(2374-2376)aaA>aaG	p.K792K		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	792					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATGCTCAGAAACTCTTGGAAT	0.383																																					p.K792K		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A2376G						.						41.0	41.0	41.0					7																	48311639		1835	4093	5928	SO:0001819	synonymous_variant	154664	exon17			TCAGAAACTCTTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2376A>G	chr7.hg19:g.48311639A>G		159.0	0.0		81.0	11.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	hg19	CCDS47584.1																																																																																			.	.		0.383	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
TAS2R39	259285	hgsc.bcm.edu	37	7	142881187	142881187	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr7:142881187C>A	ENST00000446620.1	+	1	676	c.676C>A	c.(676-678)Ctg>Atg	p.L226M		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	226					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					CATGTTCATCCTGACAGCCAC	0.507																																					p.L226M		Atlas-SNP	.											.	TAS2R39	42	.	0			c.C676A						.						135.0	124.0	128.0					7																	142881187		1989	4154	6143	SO:0001583	missense	259285	exon1			TTCATCCTGACAG	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.676C>A	chr7.hg19:g.142881187C>A	ENSP00000405095:p.Leu226Met	260.0	0.0		181.0	12.0	NM_176881	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	ENST00000446620.1	hg19	CCDS47729.1	.	.	.	.	.	.	.	.	.	.	C	8.827	0.938867	0.18281	.	.	ENSG00000236398	ENST00000446620	T	0.39592	1.07	4.45	-0.668	0.11392	.	.	.	.	.	T	0.24470	0.0593	L	0.28504	0.86	0.09310	N	1	B	0.31256	0.316	B	0.30646	0.118	T	0.18999	-1.0319	9	0.24483	T	0.36	.	4.097	0.09995	0.1009:0.1888:0.4806:0.2297	.	226	P59534	T2R39_HUMAN	M	226	ENSP00000405095:L226M	ENSP00000405095:L226M	L	+	1	2	TAS2R39	142591309	0.000000	0.05858	0.025000	0.17156	0.934000	0.57294	-1.823000	0.01710	-0.248000	0.09583	-0.143000	0.13931	CTG	.	.		0.507	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881	
SLC10A5	347051	hgsc.bcm.edu	37	8	82606130	82606130	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr8:82606130G>A	ENST00000518568.1	-	1	2279	c.1078C>T	c.(1078-1080)Ctg>Ttg	p.L360L		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	360						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)	p.L360L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						GGAAGAGGCAGCGTACAAACT	0.408																																					p.L360L		Atlas-SNP	.											SLC10A5,NS,carcinoma,0,1	SLC10A5	35	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1078T						.						76.0	73.0	74.0					8																	82606130		2203	4300	6503	SO:0001819	synonymous_variant	347051	exon1			GAGGCAGCGTACA		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.1078C>T	chr8.hg19:g.82606130G>A		130.0	0.0		47.0	13.0	NM_001010893	B2RN26	Silent	SNP	ENST00000518568.1	hg19	CCDS34915.1																																																																																			.	.		0.408	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493	
YWHAZ	7534	hgsc.bcm.edu	37	8	101960838	101960838	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr8:101960838A>T	ENST00000395957.2	-	3	621	c.280T>A	c.(280-282)Tgc>Agc	p.C94S	YWHAZ_ENST00000353245.3_Missense_Mutation_p.C94S|YWHAZ_ENST00000395948.2_Missense_Mutation_p.C17S|YWHAZ_ENST00000395951.3_Missense_Mutation_p.C94S|YWHAZ_ENST00000395958.2_Missense_Mutation_p.C94S|YWHAZ_ENST00000522542.1_5'Flank|YWHAZ_ENST00000457309.1_Missense_Mutation_p.C94S|YWHAZ_ENST00000521309.1_Intron|YWHAZ_ENST00000419477.2_Missense_Mutation_p.C94S|YWHAZ_ENST00000395956.3_Missense_Mutation_p.C94S|YWHAZ_ENST00000395953.2_Missense_Mutation_p.C94S			P63104	1433Z_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta	94					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|gene expression (GO:0010467)|histamine secretion by mast cell (GO:0002553)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting to mitochondrion (GO:0006626)|response to drug (GO:0042493)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mast cell granule (GO:0042629)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			large_intestine(1)|lung(2)	3	all_cancers(14;7.43e-06)|all_epithelial(15;2.77e-08)|Lung NSC(17;6.08e-05)|all_lung(17;0.000197)		Epithelial(11;2.79e-11)|all cancers(13;5.45e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.75e-05)			ACATCATTGCAGATATCTCTT	0.393																																					p.C94S		Atlas-SNP	.											.	YWHAZ	23	.	0			c.T280A						.						297.0	311.0	306.0					8																	101960838		2203	4300	6503	SO:0001583	missense	7534	exon2			CATTGCAGATATC	U28964	CCDS6290.1	8q22.3	2013-12-03	2013-12-03		ENSG00000164924	ENSG00000164924			12855	protein-coding gene	gene with protein product	"""14-3-3 zeta"", ""14-3-3 delta"""	601288	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide"", ""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide"""	YWHAD		8617504, 7890696	Standard	NM_003406		Approved	KCIP-1, 14-3-3-zeta	uc010mbr.2	P63104	OTTHUMG00000134291	ENST00000395957.2:c.280T>A	chr8.hg19:g.101960838A>T	ENSP00000379287:p.Cys94Ser	286.0	0.0		158.0	12.0	NM_145690	A8K1N0|B7Z465|P29213|P29312|Q32P43|Q5XJ08|Q6GPI2|Q6IN74|Q6NUR9|Q6P3U9|Q86V33	Missense_Mutation	SNP	ENST00000395957.2	hg19	CCDS6290.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.881205	0.91740	.	.	ENSG00000164924	ENST00000395957;ENST00000457309;ENST00000395958;ENST00000395956;ENST00000353245;ENST00000517797;ENST00000395953;ENST00000395948;ENST00000395951;ENST00000419477;ENST00000521607;ENST00000521328;ENST00000418997	T;T;T;T;T;T;T;T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	5.68	5.68	0.88126	14-3-3 domain (4);	0.144262	0.49305	D	0.000147	D	0.83422	0.5251	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.87247	0.2270	10	0.72032	D	0.01	.	15.9332	0.79683	1.0:0.0:0.0:0.0	.	94;94	D0PNI1;P63104	.;1433Z_HUMAN	S	94;94;94;94;94;17;94;17;94;94;94;94;94	ENSP00000379287:C94S;ENSP00000398599:C94S;ENSP00000379288:C94S;ENSP00000379286:C94S;ENSP00000309503:C94S;ENSP00000379283:C94S;ENSP00000379278:C17S;ENSP00000379281:C94S;ENSP00000395114:C94S;ENSP00000430058:C94S;ENSP00000429041:C94S;ENSP00000416551:C94S	ENSP00000309503:C94S	C	-	1	0	YWHAZ	102030014	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.172000	0.68678	0.533000	0.62120	TGC	.	.		0.393	YWHAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259017.2	NM_145690	
LINGO2	158038	hgsc.bcm.edu	37	9	27949442	27949442	+	Missense_Mutation	SNP	G	G	T	rs199551773		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr9:27949442G>T	ENST00000379992.2	-	6	1677	c.1228C>A	c.(1228-1230)Ccc>Acc	p.P410T	LINGO2_ENST00000308675.3_Missense_Mutation_p.P410T	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	410	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.P410T(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CGGATTTTGGGTTTTTTGCAG	0.488																																					p.P410T		Atlas-SNP	.											LINGO2_ENST00000379992,NS,carcinoma,0,2	LINGO2	244	.	2	Substitution - Missense(2)	prostate(2)	c.C1228A						.						97.0	93.0	94.0					9																	27949442		2203	4300	6503	SO:0001583	missense	158038	exon7			TTTTGGGTTTTTT	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1228C>A	chr9.hg19:g.27949442G>T	ENSP00000369328:p.Pro410Thr	192.0	0.0		108.0	16.0	NM_001258282	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	hg19	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400240	0.62177	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	D;D	0.99789	-6.75;-6.75	6.16	6.16	0.99307	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.93550	3.43	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	D	0.97341	0.9957	9	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	410	Q7L985	LIGO2_HUMAN	T	410	ENSP00000369328:P410T;ENSP00000310126:P410T	.	P	-	1	0	LINGO2	27939442	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.837000	0.99465	2.937000	0.99478	0.650000	0.86243	CCC	.	G|0.999;A|0.001		0.488	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
ANKRD26	22852	hgsc.bcm.edu	37	10	27352965	27352965	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:27352965C>A	ENST00000376087.4	-	12	1480	c.1315G>T	c.(1315-1317)Ggg>Tgg	p.G439W	ANKRD26_ENST00000436985.2_Missense_Mutation_p.G488W	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	439					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TCTGCAGCCCCAGCTAAAGGA	0.308																																					p.G439W		Atlas-SNP	.											.	ANKRD26	179	.	0			c.G1315T						.						92.0	82.0	85.0					10																	27352965		1791	4063	5854	SO:0001583	missense	22852	exon12			CAGCCCCAGCTAA	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1315G>T	chr10.hg19:g.27352965C>A	ENSP00000365255:p.Gly439Trp	211.0	0.0		122.0	45.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	hg19	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028967	0.35797	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.35973	1.37;1.28	4.16	3.23	0.37069	.	.	.	.	.	T	0.56156	0.1966	M	0.71036	2.16	0.27959	N	0.936847	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.74674	0.984;0.964;0.976	T	0.48210	-0.9055	9	0.66056	D	0.02	.	10.4564	0.44553	0.0:0.8008:0.1992:0.0	.	439;439;488	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	W	439;488	ENSP00000365255:G439W;ENSP00000405112:G488W	ENSP00000365255:G439W	G	-	1	0	ANKRD26	27392971	0.526000	0.26298	0.034000	0.17996	0.001000	0.01503	1.865000	0.39479	1.022000	0.39626	-0.305000	0.09177	GGG	.	.		0.308	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
WDFY4	57705	hgsc.bcm.edu	37	10	49939462	49939462	+	Silent	SNP	G	G	T	rs372273417	byFrequency	TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:49939462G>T	ENST00000325239.5	+	8	1464	c.1437G>T	c.(1435-1437)ggG>ggT	p.G479G	WDFY4_ENST00000413659.2_Silent_p.G479G|WDFY4_ENST00000360890.2_Silent_p.G479G	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	479						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGAGCCCTGGGCCATCCTGCA	0.602																																					p.G479G		Atlas-SNP	.											.	WDFY4	205	.	0			c.G1437T						.						57.0	56.0	56.0					10																	49939462		692	1591	2283	SO:0001819	synonymous_variant	57705	exon9			CCCTGGGCCATCC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.1437G>T	chr10.hg19:g.49939462G>T		56.0	0.0		41.0	12.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	hg19	CCDS44385.1																																																																																			.	.		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
STOX1	219736	hgsc.bcm.edu	37	10	70652470	70652470	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:70652470T>C	ENST00000298596.6	+	4	3031	c.2948T>C	c.(2947-2949)cTa>cCa	p.L983P	STOX1_ENST00000399165.4_3'UTR|STOX1_ENST00000421961.2_Missense_Mutation_p.L873P|STOX1_ENST00000399169.4_Missense_Mutation_p.L983P|STOX1_ENST00000399162.2_3'UTR	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	983						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TTACTACCGCTAACTCCAGTC	0.333																																					p.L983P		Atlas-SNP	.											.	STOX1	75	.	0			c.T2948C						.						111.0	115.0	113.0					10																	70652470		1984	4191	6175	SO:0001583	missense	219736	exon4			TACCGCTAACTCC	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.2948T>C	chr10.hg19:g.70652470T>C	ENSP00000298596:p.Leu983Pro	303.0	0.0		180.0	77.0	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	ENST00000298596.6	hg19	CCDS41535.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.712971	0.48517	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	D;D;T	0.84146	-1.81;-1.81;-1.48	5.83	5.83	0.93111	.	0.171834	0.38837	N	0.001547	D	0.91683	0.7371	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.92517	0.6021	10	0.87932	D	0	.	15.8862	0.79251	0.0:0.0:0.0:1.0	.	983	Q6ZVD7	STOX1_HUMAN	P	983;983;873	ENSP00000382121:L983P;ENSP00000298596:L983P;ENSP00000394509:L873P	ENSP00000298596:L983P	L	+	2	0	STOX1	70322476	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	5.045000	0.64220	2.236000	0.73375	0.533000	0.62120	CTA	.	.		0.333	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
CFAP46	54777	hgsc.bcm.edu	37	10	134751175	134751175	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:134751175G>T	ENST00000368586.5	-	6	641	c.541C>A	c.(541-543)Ctt>Att	p.L181I	TTC40_ENST00000368585.3_Missense_Mutation_p.L181I|TTC40_ENST00000368582.2_Missense_Mutation_p.L181I	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CACTCCAGAAGTTCCCTGGAT	0.448																																					p.L181I		Atlas-SNP	.											.	TTC40	100	.	0			c.C541A						.						95.0	102.0	100.0					10																	134751175		2203	4300	6503	SO:0001583	missense	54777	exon6			CCAGAAGTTCCCT																												ENST00000368586.5:c.541C>A	chr10.hg19:g.134751175G>T	ENSP00000357575:p.Leu181Ile	98.0	0.0		44.0	30.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510690	0.64522	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	D;D;D	0.82619	-1.63;-1.63;-1.63	4.74	4.74	0.60224	.	0.204737	0.30556	N	0.009374	D	0.90215	0.6941	M	0.80183	2.485	0.29567	N	0.850207	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	D	0.86489	0.1796	10	0.87932	D	0	.	11.2452	0.48993	0.091:0.0:0.909:0.0	.	181;181	Q5SR76-2;Q5SR76-1	.;.	I	181	ENSP00000357575:L181I;ENSP00000357571:L181I;ENSP00000357574:L181I	ENSP00000357571:L181I	L	-	1	0	C10orf93	134601165	1.000000	0.71417	0.991000	0.47740	0.753000	0.42808	2.650000	0.46665	2.336000	0.79503	0.650000	0.86243	CTT	.	.		0.448	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
OR51E2	81285	hgsc.bcm.edu	37	11	4703712	4703712	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:4703712A>T	ENST00000396950.3	-	2	469	c.230T>A	c.(229-231)aTg>aAg	p.M77K		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	77					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GATCTTAGGCATGGTGGATGT	0.502																																					p.M77K		Atlas-SNP	.											.	OR51E2	77	.	0			c.T230A						.						101.0	85.0	90.0					11																	4703712		2201	4298	6499	SO:0001583	missense	81285	exon2			TTAGGCATGGTGG	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.230T>A	chr11.hg19:g.4703712A>T	ENSP00000380153:p.Met77Lys	94.0	0.0		34.0	15.0	NM_030774	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	hg19	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.945756	0.73672	.	.	ENSG00000167332	ENST00000396950;ENST00000532598	T;T	0.03035	4.07;4.07	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000027	T	0.15869	0.0382	M	0.82193	2.58	0.42787	D	0.993881	D	0.55172	0.97	P	0.57324	0.818	T	0.00411	-1.1756	10	0.87932	D	0	.	13.681	0.62484	1.0:0.0:0.0:0.0	.	77	Q9H255	O51E2_HUMAN	K	77	ENSP00000380153:M77K;ENSP00000432644:M77K	ENSP00000380153:M77K	M	-	2	0	OR51E2	4660288	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.718000	0.68455	2.112000	0.64535	0.533000	0.62120	ATG	.	.		0.502	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
DPP3	10072	hgsc.bcm.edu	37	11	66249912	66249912	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:66249912G>T	ENST00000360510.2	+	2	306	c.241G>T	c.(241-243)Gct>Tct	p.A81S	CTD-3074O7.5_ENST00000527092.1_RNA|DPP3_ENST00000453114.1_Missense_Mutation_p.A81S|CTD-3074O7.5_ENST00000525142.1_RNA|DPP3_ENST00000530165.1_Missense_Mutation_p.A81S|CTD-3074O7.5_ENST00000533502.1_RNA|DPP3_ENST00000541961.1_Missense_Mutation_p.A81S|DPP3_ENST00000531863.1_Missense_Mutation_p.A101S|DPP3_ENST00000532677.1_Missense_Mutation_p.A100S|CTD-3074O7.5_ENST00000527274.2_RNA			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	81					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						ACATGCCCTGGCTGAAGGCCT	0.592																																					p.A81S		Atlas-SNP	.											.	DPP3	61	.	0			c.G241T						.						41.0	43.0	42.0					11																	66249912		2200	4295	6495	SO:0001583	missense	10072	exon2			GCCCTGGCTGAAG	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.241G>T	chr11.hg19:g.66249912G>T	ENSP00000353701:p.Ala81Ser	36.0	0.0		44.0	9.0	NM_001256670	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	hg19	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494377	0.26774	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000526515;ENST00000530165;ENST00000347422;ENST00000531314;ENST00000531354	T;T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.71	3.59	0.41128	.	0.553031	0.19477	N	0.113320	T	0.22399	0.0540	N	0.17278	0.47	0.29919	N	0.82289	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.03384	-1.1042	10	0.38643	T	0.18	.	4.3711	0.11247	0.1748:0.2096:0.6156:0.0	.	100;81	G3V1D3;Q9NY33	.;DPP3_HUMAN	S	101;100;81;81;81;81;81;81;81;81	ENSP00000432782:A101S;ENSP00000435284:A100S;ENSP00000353701:A81S;ENSP00000389943:A81S;ENSP00000440502:A81S;ENSP00000431606:A81S;ENSP00000436941:A81S;ENSP00000436820:A81S;ENSP00000432618:A81S	ENSP00000309957:A81S	A	+	1	0	DPP3	66006488	0.999000	0.42202	1.000000	0.80357	0.978000	0.69477	1.588000	0.36633	2.691000	0.91804	0.563000	0.77884	GCT	.	.		0.592	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
MYO7A	4647	hgsc.bcm.edu	37	11	76858899	76858899	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:76858899C>G	ENST00000409709.3	+	4	460	c.188C>G	c.(187-189)tCg>tGg	p.S63W	MYO7A_ENST00000409619.2_Missense_Mutation_p.S52W|MYO7A_ENST00000458637.2_Missense_Mutation_p.S63W|MYO7A_ENST00000409893.1_Missense_Mutation_p.S63W	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	63					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CACCCCACGTCGGTCCACGGC	0.637																																					p.S63W		Atlas-SNP	.											.	MYO7A	164	.	0			c.C188G						.						32.0	37.0	35.0					11																	76858899		2102	4217	6319	SO:0001583	missense	4647	exon4			CCACGTCGGTCCA	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.188C>G	chr11.hg19:g.76858899C>G	ENSP00000386331:p.Ser63Trp	69.0	0.0		54.0	24.0	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195496	0.94960	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67	4.86	4.86	0.63082	Myosin head, motor domain (1);	0.000000	0.64402	D	0.000001	D	0.86855	0.6033	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89341	0.3654	10	0.72032	D	0.01	.	18.1904	0.89805	0.0:1.0:0.0:0.0	.	63;63;63	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	W	63;63;63;52;62;62;62;62	ENSP00000386331:S63W;ENSP00000386689:S63W;ENSP00000392185:S63W;ENSP00000386635:S52W	ENSP00000345075:S62W	S	+	2	0	MYO7A	76536547	1.000000	0.71417	0.969000	0.41365	0.986000	0.74619	4.730000	0.62015	2.523000	0.85059	0.455000	0.32223	TCG	.	.		0.637	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
ATM	472	hgsc.bcm.edu	37	11	108172499	108172499	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:108172499A>G	ENST00000452508.2	+	36	5491	c.5302A>G	c.(5302-5304)Aga>Gga	p.R1768G	ATM_ENST00000278616.4_Missense_Mutation_p.R1768G			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1768					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACAGCCTTTTAGAACATCAAG	0.353			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.R1768G		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.A5302G						.						85.0	88.0	87.0					11																	108172499		2201	4298	6499	SO:0001583	missense	472	exon35	Familial Cancer Database	AT, Louis-Bar syndrome	CCTTTTAGAACAT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5302A>G	chr11.hg19:g.108172499A>G	ENSP00000388058:p.Arg1768Gly	180.0	0.0		113.0	15.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196148	0.58126	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.83506	-1.73;-1.73	4.8	2.41	0.29592	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88043	0.6331	M	0.73598	2.24	0.40800	D	0.983336	D	0.69078	0.997	P	0.61003	0.882	D	0.87215	0.2250	10	0.52906	T	0.07	.	12.038	0.53435	0.6669:0.3331:0.0:0.0	.	1768	Q13315	ATM_HUMAN	G	1768	ENSP00000278616:R1768G;ENSP00000388058:R1768G	ENSP00000278616:R1768G	R	+	1	2	ATM	107677709	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.034000	0.49751	0.274000	0.22072	0.377000	0.23210	AGA	.	.		0.353	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
SLC2A3	6515	hgsc.bcm.edu	37	12	8086448	8086448	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:8086448G>T	ENST00000075120.7	-	2	306	c.66C>A	c.(64-66)ttC>ttA	p.F22L		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	22					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AGCCAAATTGGAAAGAGCCGA	0.443											OREG0021656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F22L	Colon(96;424 1461 14416 20933 23688)	Atlas-SNP	.											.	SLC2A3	83	.	0			c.C66A						.						97.0	94.0	95.0					12																	8086448		2203	4300	6503	SO:0001583	missense	6515	exon2			AAATTGGAAAGAG	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.66C>A	chr12.hg19:g.8086448G>T	ENSP00000075120:p.Phe22Leu	211.0	0.0	646	143.0	47.0	NM_006931	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	hg19	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870476	0.72065	.	.	ENSG00000059804	ENST00000075120	D	0.82167	-1.58	4.23	3.33	0.38152	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.062472	0.64402	D	0.000003	T	0.60689	0.2288	N	0.05534	-0.03	0.45216	D	0.998223	B	0.10296	0.003	B	0.20184	0.028	T	0.53989	-0.8360	10	0.12430	T	0.62	.	5.4377	0.16490	0.1094:0.2076:0.6829:0.0	.	22	P11169	GTR3_HUMAN	L	22	ENSP00000075120:F22L	ENSP00000075120:F22L	F	-	3	2	SLC2A3	7977715	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	1.215000	0.32431	2.370000	0.80446	0.543000	0.68304	TTC	.	.		0.443	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931	
CDKN1B	1027	hgsc.bcm.edu	37	12	12871889	12871889	+	Splice_Site	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:12871889G>A	ENST00000228872.4	+	2	1321		c.e2+1		CDKN1B_ENST00000477087.1_Splice_Site|CDKN1B_ENST00000396340.1_Intron	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		AAACAGCTCGGTGGGTTGATC	0.512																																					.		Atlas-SNP	.											.	CDKN1B	48	.	0			c.605+1G>A						.						59.0	63.0	62.0					12																	12871889		2203	4300	6503	SO:0001630	splice_region_variant	1027	exon2			AGCTCGGTGGGTT	AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.594+1G>A	chr12.hg19:g.12871889G>A		40.0	0.0		32.0	16.0	NM_004064	Q16307|Q5U0H2|Q9BUS6	Splice_Site	SNP	ENST00000228872.4	hg19	CCDS8653.1																																																																																			.	.		0.512	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064	Intron
CNPY2	10330	hgsc.bcm.edu	37	12	56708752	56708752	+	Splice_Site	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:56708752T>C	ENST00000273308.4	-	3	629		c.e3-2		RP11-977G19.11_ENST00000549860.1_RNA|RP11-977G19.10_ENST00000549318.1_Splice_Site|CNPY2_ENST00000551720.1_Splice_Site|RP11-977G19.11_ENST00000549565.1_RNA|PAN2_ENST00000549090.1_5'Flank	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2						negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						CCCTGCATGCTGGTGGAAGAG	0.537																																					.		Atlas-SNP	.											.	CNPY2	16	.	0			c.89-2A>G						.						71.0	66.0	68.0					12																	56708752		2203	4300	6503	SO:0001630	splice_region_variant	10330	exon4			GCATGCTGGTGGA	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.89-2A>G	chr12.hg19:g.56708752T>C		129.0	0.0		82.0	32.0	NM_014255	B2R7B9|Q9UHE9	Splice_Site	SNP	ENST00000273308.4	hg19	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937588	0.52972	.	.	ENSG00000144785;ENSG00000144785;ENSG00000144785;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000547423;ENST00000548360;ENST00000273308;ENST00000551475	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9233	0.70856	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP11-977G19.10;CNPY2	54995019	1.000000	0.71417	0.999000	0.59377	0.575000	0.36095	7.848000	0.86902	2.231000	0.72958	0.533000	0.62120	.	.	.		0.537	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	Intron
PTPRB	5787	hgsc.bcm.edu	37	12	70960239	70960239	+	Missense_Mutation	SNP	C	C	G	rs374292920		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:70960239C>G	ENST00000261266.5	-	13	3255	c.3226G>C	c.(3226-3228)Gaa>Caa	p.E1076Q	PTPRB_ENST00000550358.1_Missense_Mutation_p.E1206Q|PTPRB_ENST00000451516.2_Missense_Mutation_p.E986Q|PTPRB_ENST00000551525.1_Missense_Mutation_p.E1293Q|PTPRB_ENST00000334414.6_Missense_Mutation_p.E1294Q|PTPRB_ENST00000550857.1_Missense_Mutation_p.E986Q|PTPRB_ENST00000538708.1_Intron	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1076	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GTCTGGGCTTCCTTGCTAAAG	0.453																																					p.E1294Q		Atlas-SNP	.											.	PTPRB	676	.	0			c.G3880C						.						162.0	152.0	155.0					12																	70960239		2012	4159	6171	SO:0001583	missense	5787	exon15			GGGCTTCCTTGCT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3226G>C	chr12.hg19:g.70960239C>G	ENSP00000261266:p.Glu1076Gln	543.0	0.0		349.0	142.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	C	8.361	0.833091	0.16820	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T	0.04406	3.63;3.63;3.63;3.63;3.63;3.63;3.63	5.37	3.05	0.35203	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.649807	0.15086	N	0.281376	T	0.03011	0.0089	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.19445	0.016;0.036;0.027;0.021;0.011;0.033	B;B;B;B;B;B	0.25405	0.02;0.06;0.015;0.034;0.021;0.059	T	0.45906	-0.9229	10	0.17369	T	0.5	.	7.7889	0.29108	0.0:0.5497:0.3184:0.1319	.	986;1173;1293;1294;1076;1206	P23467-2;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;PTPRB_HUMAN;.	Q	1294;986;1206;986;1076;1293;1173	ENSP00000334928:E1294Q;ENSP00000393028:E986Q;ENSP00000448058:E1206Q;ENSP00000447302:E986Q;ENSP00000261266:E1076Q;ENSP00000448349:E1293Q;ENSP00000446982:E1173Q	ENSP00000261266:E1076Q	E	-	1	0	PTPRB	69246506	0.219000	0.23619	0.990000	0.47175	0.708000	0.40852	1.169000	0.31871	2.515000	0.84797	0.655000	0.94253	GAA	.	.		0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
GCN1L1	10985	hgsc.bcm.edu	37	12	120602144	120602144	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:120602144T>C	ENST00000300648.6	-	18	1856	c.1844A>G	c.(1843-1845)cAc>cGc	p.H615R		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	615					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTCACCTTGTGAGAACTGAG	0.582																																					p.H615R		Atlas-SNP	.											.	GCN1L1	207	.	0			c.A1844G						.						101.0	105.0	104.0					12																	120602144		1968	4141	6109	SO:0001583	missense	10985	exon18			ACCTTGTGAGAAC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1844A>G	chr12.hg19:g.120602144T>C	ENSP00000300648:p.His615Arg	96.0	0.0		85.0	32.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	hg19	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.017799	0.35606	.	.	ENSG00000089154	ENST00000300648	T	0.04551	3.6	5.83	5.83	0.93111	Armadillo-like helical (1);Domain of unknown function DUF3554 (1);Armadillo-type fold (1);	0.048650	0.85682	D	0.000000	T	0.08582	0.0213	M	0.69823	2.125	0.80722	D	1	B	0.30973	0.302	B	0.30855	0.121	T	0.21827	-1.0234	10	0.14656	T	0.56	.	16.2009	0.82078	0.0:0.0:0.0:1.0	.	615	Q92616	GCN1L_HUMAN	R	615	ENSP00000300648:H615R	ENSP00000300648:H615R	H	-	2	0	GCN1L1	119086527	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.403000	0.79983	2.235000	0.73313	0.533000	0.62120	CAC	.	.		0.582	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
RNF10	9921	hgsc.bcm.edu	37	12	121013648	121013648	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:121013648A>T	ENST00000325954.4	+	16	2715	c.2254A>T	c.(2254-2256)Aat>Tat	p.N752Y	RNF10_ENST00000413266.2_Missense_Mutation_p.N757Y|RNF10_ENST00000542701.1_3'UTR	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	752					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGAGAGTGATAATTCAGACCG	0.443																																					p.N752Y		Atlas-SNP	.											.	RNF10	75	.	0			c.A2254T						.						178.0	183.0	181.0					12																	121013648		2203	4300	6503	SO:0001583	missense	9921	exon16			AGTGATAATTCAG	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.2254A>T	chr12.hg19:g.121013648A>T	ENSP00000322242:p.Asn752Tyr	187.0	0.0		115.0	13.0	NM_014868	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	hg19	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027270	0.35797	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000538254	D;D	0.89681	-2.55;-2.54	5.39	5.39	0.77823	.	0.338826	0.36200	N	0.002732	D	0.89663	0.6780	L	0.40543	1.245	0.40164	D	0.977097	D;D	0.61080	0.989;0.976	P;P	0.59546	0.859;0.556	D	0.90106	0.4188	10	0.54805	T	0.06	.	10.6496	0.45640	0.8572:0.0:0.0:0.1428	.	757;752	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	Y	752;752;757;87	ENSP00000322242:N752Y;ENSP00000415682:N757Y	ENSP00000322242:N752Y	N	+	1	0	RNF10	119498031	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.487000	0.60293	2.054000	0.61138	0.533000	0.62120	AAT	.	.		0.443	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
MLXIP	22877	hgsc.bcm.edu	37	12	122623457	122623457	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:122623457G>A	ENST00000319080.7	+	15	2612	c.2480G>A	c.(2479-2481)cGg>cAg	p.R827Q	MLXIP_ENST00000538698.1_Missense_Mutation_p.R434Q					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GTGAAAACCCGGACCTTGCAG	0.532																																					p.R827Q	Esophageal Squamous(105;787 1493 16200 18566 52466)	Atlas-SNP	.											.	MLXIP	46	.	0			c.G2480A						.						78.0	80.0	80.0					12																	122623457		1885	4099	5984	SO:0001583	missense	22877	exon15			AAACCCGGACCTT	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2480G>A	chr12.hg19:g.122623457G>A	ENSP00000312834:p.Arg827Gln	389.0	0.0		210.0	12.0	NM_014938		Missense_Mutation	SNP	ENST00000319080.7	hg19		.	.	.	.	.	.	.	.	.	.	G	25.7	4.664907	0.88251	.	.	ENSG00000175727	ENST00000319080;ENST00000538698;ENST00000366272	T;T;T	0.53206	2.27;1.52;0.63	5.45	5.45	0.79879	.	0.241216	0.42420	D	0.000710	T	0.35770	0.0943	.	.	.	0.80722	D	1	D	0.53312	0.959	B	0.35607	0.206	T	0.26643	-1.0097	9	0.39692	T	0.17	-28.5222	14.5441	0.68015	0.0721:0.0:0.9279:0.0	.	827	Q9HAP2	MLXIP_HUMAN	Q	827;434;298	ENSP00000312834:R827Q;ENSP00000440769:R434Q;ENSP00000445891:R298Q	ENSP00000312834:R827Q	R	+	2	0	MLXIP	121189410	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.772000	0.62324	2.549000	0.85964	0.655000	0.94253	CGG	.	.		0.532	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
CCDC168	643677	hgsc.bcm.edu	37	13	103381888	103381888	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr13:103381888C>T	ENST00000322527.2	-	1	7271	c.7272G>A	c.(7270-7272)aaG>aaA	p.K2424K		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2424																	AACTTGAAATCTTTGCCACTA	0.448																																					p.K7053K		Atlas-SNP	.											.	.	.	.	0			c.G21159A						.						55.0	57.0	57.0					13																	103381888		692	1591	2283	SO:0001819	synonymous_variant	643677	exon4			TGAAATCTTTGCC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7272G>A	chr13.hg19:g.103381888C>T		190.0	0.0		119.0	9.0	NM_001146197	Q8N800	Silent	SNP	ENST00000322527.2	hg19																																																																																				.	.		0.448	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
DHRS4L1	728635	hgsc.bcm.edu	37	14	24517998	24517998	+	RNA	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr14:24517998T>C	ENST00000558293.1	+	0	646					NR_102693.1																						CCTGGACTTATCAAGACTAGC	0.522																																					p.I218T		Atlas-SNP	.											.	.	.	.	0			c.T653C						.						141.0	137.0	139.0					14																	24517998		2203	4298	6501			728635	exon8			GACTTATCAAGAC																													chr14.hg19:g.24517998T>C		818.0	2.0		502.0	180.0	NM_001082488		Missense_Mutation	SNP	ENST00000558293.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.56	1.384474	0.25031	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.67	4.67	0.58626	NAD(P)-binding domain (1);	.	.	.	.	T	0.70360	0.3215	L	0.60455	1.87	0.50813	D	0.999890	D	0.89917	1.0	D	0.97110	1.0	T	0.76694	-0.2865	7	0.46703	T	0.11	.	12.0988	0.53772	0.0:0.0:0.0:1.0	.	218	P0CG22	DR4L1_HUMAN	T	218	.	ENSP00000380255:I218T	I	+	2	0	AL136295.1	23587838	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	6.335000	0.72949	1.958000	0.56883	0.329000	0.21502	ATC	.	.		0.522	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
DYNC1H1	1778	hgsc.bcm.edu	37	14	102466376	102466376	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr14:102466376G>A	ENST00000360184.4	+	17	4019	c.3855G>A	c.(3853-3855)ggG>ggA	p.G1285G		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1285	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TATATGAGGGGAAGTTTGGTA	0.532																																					p.G1285G		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.G3855A						.						103.0	94.0	97.0					14																	102466376		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon17			TGAGGGGAAGTTT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.3855G>A	chr14.hg19:g.102466376G>A		116.0	0.0		65.0	25.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	hg19	CCDS9966.1																																																																																			.	.		0.532	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
EIF2AK4	440275	hgsc.bcm.edu	37	15	40268641	40268641	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:40268641C>T	ENST00000263791.5	+	12	1888	c.1845C>T	c.(1843-1845)tgC>tgT	p.C615C	EIF2AK4_ENST00000382727.2_Silent_p.C615C	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	615	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ACGGCTGCTGCTACGCAGTGA	0.622																																					p.C615C		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.C1845T						.						32.0	34.0	34.0					15																	40268641		2090	4211	6301	SO:0001819	synonymous_variant	440275	exon12			CTGCTGCTACGCA	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1845C>T	chr15.hg19:g.40268641C>T		87.0	0.0		62.0	34.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Silent	SNP	ENST00000263791.5	hg19	CCDS42016.1																																																																																			.	.		0.622	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
HERC1	8925	hgsc.bcm.edu	37	15	63991120	63991120	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:63991120T>C	ENST00000443617.2	-	26	4799	c.4712A>G	c.(4711-4713)aAc>aGc	p.N1571S	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1571					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ATAGGAGGAGTTGCATAACCA	0.413																																					p.N1571S		Atlas-SNP	.											.	HERC1	624	.	0			c.A4712G						.						145.0	139.0	141.0					15																	63991120		1857	4106	5963	SO:0001583	missense	8925	exon26			GAGGAGTTGCATA	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4712A>G	chr15.hg19:g.63991120T>C	ENSP00000390158:p.Asn1571Ser	158.0	0.0		93.0	17.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	4.091	0.014801	0.07959	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	T	0.21543	2.0	5.54	1.4	0.22301	.	0.368782	0.24154	N	0.041047	T	0.05456	0.0144	N	0.02539	-0.55	0.27402	N	0.954825	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39057	-0.9632	10	0.06625	T	0.88	.	4.6136	0.12415	0.0:0.314:0.3802:0.3058	.	555;1571	B4DKS2;Q15751	.;HERC1_HUMAN	S	1571;555	ENSP00000390158:N1571S	ENSP00000389613:N555S	N	-	2	0	HERC1	61778173	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	1.607000	0.36836	0.933000	0.37291	0.482000	0.46254	AAC	.	.		0.413	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
SCAPER	49855	hgsc.bcm.edu	37	15	77134131	77134131	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:77134131C>T	ENST00000563290.1	-	5	432	c.337G>A	c.(337-339)Gca>Aca	p.A113T	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000324767.7_Missense_Mutation_p.A113T			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	113						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TCATCTACTGCTCGGCGAAGA	0.393																																					p.A113T		Atlas-SNP	.											.	SCAPER	160	.	0			c.G337A						.						132.0	118.0	123.0					15																	77134131		1837	4078	5915	SO:0001583	missense	49855	exon4			CTACTGCTCGGCG	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.337G>A	chr15.hg19:g.77134131C>T	ENSP00000454973:p.Ala113Thr	271.0	0.0		151.0	87.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	36	5.657937	0.96734	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.54866	0.55	5.14	5.14	0.70334	.	0.115428	0.64402	D	0.000016	T	0.68952	0.3057	L	0.49640	1.575	0.58432	D	0.999999	D;P	0.89917	1.0;0.935	D;P	0.91635	0.999;0.847	T	0.71337	-0.4623	10	0.66056	D	0.02	.	18.6068	0.91270	0.0:1.0:0.0:0.0	.	113;128	Q6NSF1;Q9BY12-2	.;.	T	113;129	ENSP00000326924:A113T	ENSP00000303560:A129T	A	-	1	0	SCAPER	74921186	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.412000	0.81896	0.655000	0.94253	GCA	.	.		0.393	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
ABCC6	368	hgsc.bcm.edu	37	16	16244451	16244451	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:16244451C>A	ENST00000205557.7	-	30	4416	c.4387G>T	c.(4387-4389)Gtg>Ttg	p.V1463L		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1463	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CAGTCCATCACGGAGCGCAGG	0.682																																					p.V1463L		Atlas-SNP	.											.	ABCC6	110	.	0			c.G4387T						.						36.0	30.0	32.0					16																	16244451		2197	4298	6495	SO:0001583	missense	368	exon30			CCATCACGGAGCG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4387G>T	chr16.hg19:g.16244451C>A	ENSP00000205557:p.Val1463Leu	89.0	0.0		57.0	24.0	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	hg19	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673134	0.29693	.	.	ENSG00000091262	ENST00000205557;ENST00000205558	T	0.70164	-0.46	4.38	4.38	0.52667	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.187888	0.25086	U	0.033253	T	0.42832	0.1220	N	0.16903	0.455	0.80722	D	1	P;P	0.42961	0.795;0.795	B;B	0.35073	0.195;0.195	T	0.47407	-0.9120	10	0.62326	D	0.03	.	5.1143	0.14825	0.0:0.6404:0.1828:0.1768	.	1463;1463	O95255;A8Y988	MRP6_HUMAN;.	L	1463;401	ENSP00000205557:V1463L	ENSP00000205557:V1463L	V	-	1	0	ABCC6	16151952	0.905000	0.30787	0.868000	0.34077	0.300000	0.27592	1.567000	0.36407	2.164000	0.68074	0.561000	0.74099	GTG	.	.		0.682	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
GTF3C1	2975	hgsc.bcm.edu	37	16	27517278	27517278	+	Missense_Mutation	SNP	G	G	T	rs140459536		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:27517278G>T	ENST00000356183.4	-	10	1727	c.1712C>A	c.(1711-1713)gCg>gAg	p.A571E	GTF3C1_ENST00000561623.1_Missense_Mutation_p.A571E	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	571					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GTTGCTGTCCGCACAGTGGGA	0.567																																					p.A571E		Atlas-SNP	.											.	GTF3C1	210	.	0			c.C1712A						.						139.0	115.0	123.0					16																	27517278		2197	4300	6497	SO:0001583	missense	2975	exon10			CTGTCCGCACAGT	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1712C>A	chr16.hg19:g.27517278G>T	ENSP00000348510:p.Ala571Glu	148.0	0.0		105.0	41.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	hg19	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	G	0.498	-0.872140	0.02570	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.22539	1.95	5.39	2.83	0.33086	.	1.419090	0.03886	N	0.277842	T	0.12050	0.0293	N	0.19112	0.55	0.09310	N	1	B;B	0.18610	0.001;0.029	B;B	0.12156	0.0;0.007	T	0.28427	-1.0044	10	0.02654	T	1	-4.6393	5.1223	0.14867	0.7147:0.0:0.2853:0.0	.	571;571	Q12789;Q12789-3	TF3C1_HUMAN;.	E	571;569	ENSP00000348510:A571E	ENSP00000348510:A571E	A	-	2	0	GTF3C1	27424779	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.574000	0.23714	0.984000	0.38629	-0.302000	0.09304	GCG	.	G|1.000;A|0.000		0.567	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
AP1G1	164	hgsc.bcm.edu	37	16	71823203	71823204	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:71823203_71823204GC>AA	ENST00000299980.4	-	2	620_621	c.179_180GC>TT	c.(178-180)gGC>gTT	p.G60V	AP1G1_ENST00000433195.2_Missense_Mutation_p.G83V|AP1G1_ENST00000569748.1_Missense_Mutation_p.G60V|AP1G1_ENST00000393512.3_Missense_Mutation_p.G60V|AP1G1_ENST00000423132.2_Missense_Mutation_p.G60V|AP1G1_ENST00000570297.1_5'Flank	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	60					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				GAGCAGGGTAGCCCAGCATGTG	0.45																																					p.G60G|p.G60V		Atlas-SNP	.											.	AP1G1	83	.	0			c.C180T|c.G179T						.																																			SO:0001583	missense	164	exon2			AGGGTAGCCCAGC|GGGTAGCCCAGCA	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.179_180delinsAA	chr16.hg19:g.71823203_71823204delinsAA	ENSP00000299980:p.Gly60Val	169.0|172.0	0.0		111.0|113.0	52.0|51.0	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Silent|Missense_Mutation	SNP	ENST00000299980.4	hg19	CCDS32480.1																																																																																			.	.		0.450	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
TBC1D26	353149	hgsc.bcm.edu	37	17	15642100	15642100	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:15642100C>T	ENST00000437605.2	+	8	703	c.453C>T	c.(451-453)caC>caT	p.H151H	ZNF286A_ENST00000413242.2_3'UTR|TBC1D26_ENST00000579428.1_Silent_p.H151H|AC005324.6_ENST00000580194.1_RNA|AC005324.6_ENST00000434017.1_RNA|AC005324.6_ENST00000433873.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	151	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		ATGTCAGCCACACCCTGCAGA	0.537																																					p.H151H		Atlas-SNP	.											.	TBC1D26	16	.	0			c.C453T						.						108.0	99.0	102.0					17																	15642100		2154	4235	6389	SO:0001819	synonymous_variant	353149	exon8			CAGCCACACCCTG		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.453C>T	chr17.hg19:g.15642100C>T		585.0	2.0		222.0	94.0	NM_178571	A8K929|Q4G172	Silent	SNP	ENST00000437605.2	hg19	CCDS42265.1																																																																																			.	.		0.537	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178571	
MPO	4353	hgsc.bcm.edu	37	17	56355395	56355395	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:56355395G>A	ENST00000225275.3	-	7	1173	c.997C>T	c.(997-999)Ctc>Ttc	p.L333F	MPO_ENST00000578493.1_5'UTR|MPO_ENST00000340482.3_Missense_Mutation_p.L365F	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	333					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	AAGGAAGTGAGCGCGTTGATC	0.637																																					p.L333F		Atlas-SNP	.											.	MPO	114	.	0			c.C997T						.						114.0	98.0	103.0					17																	56355395		2203	4300	6503	SO:0001583	missense	4353	exon7			AAGTGAGCGCGTT		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.997C>T	chr17.hg19:g.56355395G>A	ENSP00000225275:p.Leu333Phe	61.0	0.0		54.0	23.0	NM_000250	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	hg19	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187934	0.78789	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.70164	-0.46;-0.46	5.32	4.35	0.52113	.	0.060693	0.64402	D	0.000003	D	0.84338	0.5450	M	0.92555	3.32	0.58432	D	0.999994	D	0.89917	1.0	D	0.80764	0.994	D	0.87509	0.2438	10	0.87932	D	0	-37.0231	12.4835	0.55859	0.0802:0.0:0.9198:0.0	.	333	P05164	PERM_HUMAN	F	365;333	ENSP00000344419:L365F;ENSP00000225275:L333F	ENSP00000225275:L333F	L	-	1	0	MPO	53710394	1.000000	0.71417	0.996000	0.52242	0.909000	0.53808	3.253000	0.51469	2.518000	0.84900	0.561000	0.74099	CTC	.	.		0.637	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
RPS6KB1	6198	hgsc.bcm.edu	37	17	58013587	58013587	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:58013587A>T	ENST00000225577.4	+	11	1011	c.990A>T	c.(988-990)agA>agT	p.R330S	RPS6KB1_ENST00000393021.3_Missense_Mutation_p.R277S|RPS6KB1_ENST00000443572.2_Missense_Mutation_p.R307S|RPS6KB1_ENST00000406116.3_Missense_Mutation_p.R330S	NM_001272042.1|NM_001272044.1|NM_001272060.1|NM_003161.2	NP_001258971.1|NP_001258973.1|NP_001258989.1|NP_003152.1	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 1	330	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				aging (GO:0007568)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell development (GO:0007281)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue growth (GO:0048633)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of glucose import (GO:0046324)|response to drug (GO:0042493)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to leucine (GO:0043201)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|response to tumor necrosis factor (GO:0034612)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			TGCTGAAAAGAAATGCTGCTT	0.408																																					p.R330S		Atlas-SNP	.											.	RPS6KB1	43	.	0			c.A990T						.						110.0	110.0	110.0					17																	58013587		2203	4300	6503	SO:0001583	missense	6198	exon11			GAAAAGAAATGCT	M60724	CCDS11621.1, CCDS62271.1, CCDS62272.1, CCDS62273.1	17q23.1	2011-04-05	2002-08-29		ENSG00000108443	ENSG00000108443			10436	protein-coding gene	gene with protein product		608938	"""ribosomal protein S6 kinase, 70kD, polypeptide 1"""	STK14A		1922062	Standard	NM_003161		Approved	S6K1, p70(S6K)-alpha, PS6K	uc002ixy.4	P23443	OTTHUMG00000150642	ENST00000225577.4:c.990A>T	chr17.hg19:g.58013587A>T	ENSP00000225577:p.Arg330Ser	302.0	1.0		257.0	155.0	NM_001272043	B2R779|B4DLT4|B4DTG1|E7ESB8|F6UYM1|Q7Z721	Missense_Mutation	SNP	ENST00000225577.4	hg19	CCDS11621.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716500	0.89205	.	.	ENSG00000108443	ENST00000443572;ENST00000406116;ENST00000225577;ENST00000393021	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.55	3.35	0.38373	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62648	0.2445	L	0.33710	1.025	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.78314	0.991;0.978;0.987	T	0.63849	-0.6544	10	0.87932	D	0	.	9.3291	0.38010	0.8551:0.0:0.1449:0.0	.	307;330;330	F6UYM1;Q7Z721;P23443	.;.;KS6B1_HUMAN	S	307;330;330;277	ENSP00000441993:R307S;ENSP00000384335:R330S;ENSP00000225577:R330S;ENSP00000376744:R277S	ENSP00000225577:R330S	R	+	3	2	RPS6KB1	55368369	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.090000	0.57693	0.941000	0.37499	0.524000	0.50904	AGA	.	.		0.408	RPS6KB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319324.1	NM_003161	
MRC2	9902	hgsc.bcm.edu	37	17	60743465	60743465	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:60743465C>T	ENST00000303375.5	+	3	933	c.531C>T	c.(529-531)acC>acT	p.T177T		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	177					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						AGGTCTACACCATCCAGGGAA	0.617																																					p.T177T		Atlas-SNP	.											.	MRC2	126	.	0			c.C531T						.						58.0	43.0	49.0					17																	60743465		2199	4294	6493	SO:0001819	synonymous_variant	9902	exon3			CTACACCATCCAG	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.531C>T	chr17.hg19:g.60743465C>T		76.0	0.0		50.0	33.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	ENST00000303375.5	hg19	CCDS11634.1																																																																																			.	.		0.617	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MAP2K6	5608	hgsc.bcm.edu	37	17	67521065	67521065	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:67521065C>T	ENST00000590474.1	+	9	974	c.687C>T	c.(685-687)ctC>ctT	p.L229L	MAP2K6_ENST00000589647.1_Silent_p.L173L	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					ACCCAGAGCTCAACCAGAAGG	0.438																																					p.L229L		Atlas-SNP	.											.	MAP2K6	41	.	0			c.C687T						.						105.0	94.0	98.0					17																	67521065		2203	4300	6503	SO:0001819	synonymous_variant	5608	exon9			AGAGCTCAACCAG	U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.687C>T	chr17.hg19:g.67521065C>T		150.0	0.0		150.0	86.0	NM_002758		Silent	SNP	ENST00000590474.1	hg19	CCDS11686.1																																																																																			.	.		0.438	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450689.1	NM_002758	
GAA	2548	hgsc.bcm.edu	37	17	78091993	78091993	+	Splice_Site	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:78091993G>T	ENST00000302262.3	+	18	2702	c.2483G>T	c.(2482-2484)gGc>gTc	p.G828V	GAA_ENST00000390015.3_Splice_Site_p.G828V	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	828					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	CCTTTCCAGGGCCCTGGCCTC	0.667																																					p.G828V		Atlas-SNP	.											.	GAA	66	.	0			c.G2483T						.						44.0	46.0	45.0					17																	78091993		2203	4300	6503	SO:0001630	splice_region_variant	2548	exon19			TCCAGGGCCCTGG		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2482-1G>T	chr17.hg19:g.78091993G>T		72.0	0.0		70.0	27.0	NM_001079803	Q09GN4|Q14351|Q16302|Q8IWE7	Missense_Mutation	SNP	ENST00000302262.3	hg19	CCDS32760.1	.	.	.	.	.	.	.	.	.	.	G	9.396	1.076732	0.20227	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	D;D	0.89810	-2.57;-2.57	5.51	1.96	0.26148	.	0.464777	0.24020	N	0.042294	T	0.78635	0.4314	L	0.37850	1.14	0.58432	D	0.999996	B	0.09022	0.002	B	0.09377	0.004	T	0.69888	-0.5023	10	0.34782	T	0.22	-33.8352	2.0092	0.03484	0.1276:0.3792:0.2986:0.1945	.	828	P10253	LYAG_HUMAN	V	828	ENSP00000305692:G828V;ENSP00000374665:G828V	ENSP00000305692:G828V	G	+	2	0	GAA	75706588	0.950000	0.32346	0.985000	0.45067	0.615000	0.37417	1.871000	0.39539	1.267000	0.44247	0.655000	0.94253	GGC	.	.		0.667	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		Missense_Mutation
FUT3	2525	hgsc.bcm.edu	37	19	5844841	5844841	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:5844841G>A	ENST00000303225.6	-	3	644	c.10C>T	c.(10-12)Ctg>Ttg	p.L4L	FUT3_ENST00000458379.2_Silent_p.L4L|FUT3_ENST00000589918.1_Silent_p.L4L|AC024592.9_ENST00000589276.1_RNA|FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000589620.1_Silent_p.L4L	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	4					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						GCTGCACCCAGGGGATCCATG	0.572																																					p.L4L	Esophageal Squamous(82;745 1728 24593 44831)	Atlas-SNP	.											.	FUT3	30	.	0			c.C10T						.						23.0	22.0	22.0					19																	5844841		2203	4300	6503	SO:0001819	synonymous_variant	2525	exon3			CACCCAGGGGATC		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.10C>T	chr19.hg19:g.5844841G>A		173.0	0.0		102.0	13.0	NM_001097640	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Silent	SNP	ENST00000303225.6	hg19	CCDS12153.1																																																																																			.	.		0.572	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
CPAMD8	27151	hgsc.bcm.edu	37	19	17038989	17038989	+	Missense_Mutation	SNP	G	G	A	rs200032712		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:17038989G>A	ENST00000443236.1	-	25	3372	c.3341C>T	c.(3340-3342)cCg>cTg	p.P1114L		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1067						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGGTGGCCTCGGGAGGGTCCA	0.582																																					p.P1114L		Atlas-SNP	.											.	CPAMD8	192	.	0			c.C3341T						.						44.0	49.0	47.0					19																	17038989		1933	4133	6066	SO:0001583	missense	27151	exon25			GGCCTCGGGAGGG	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3341C>T	chr19.hg19:g.17038989G>A	ENSP00000402505:p.Pro1114Leu	46.0	0.0		59.0	23.0	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	hg19	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.094|8.094	0.775190|0.775190	0.16051|0.16051	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	3.02|3.02	-0.754|-0.754	0.11065|0.11065	Farnesoic acid O-methyl transferase (1);|.	0.630912|.	0.14270|.	N|.	0.330240|.	T|.	0.46483|.	0.1395|.	M|M	0.81682|0.81682	2.555|2.555	0.09310|0.09310	N|N	0.999994|0.999994	D|.	0.53151|.	0.958|.	B|.	0.43680|.	0.427|.	T|.	0.45498|.	-0.9257|.	9|.	0.33141|.	T|.	0.24|.	.|.	2.7214|2.7214	0.05202|0.05202	0.0941:0.1586:0.4216:0.3257|0.0941:0.1586:0.4216:0.3257	.|.	1067|.	Q8IZJ3|.	CPMD8_HUMAN|.	L|X	1114|1125	.|.	ENSP00000291440:P1114L|.	P|R	-|-	2|1	0|2	CPAMD8|CPAMD8	16899989|16899989	1.000000|1.000000	0.71417|0.71417	0.026000|0.026000	0.17262|0.17262	0.000000|0.000000	0.00434|0.00434	1.685000|1.685000	0.37659|0.37659	-0.498000|-0.498000	0.06632|0.06632	-1.802000|-1.802000	0.00618|0.00618	CCG|CGA	.	G|0.999;A|0.001		0.582	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52001391	52001391	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:52001391C>A	ENST00000291707.3	-	5	1341	c.1286G>T	c.(1285-1287)gGg>gTg	p.G429V	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.G311V	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	429	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CTCCAGCACCCCAAGGTTCGA	0.617																																					p.G429V		Atlas-SNP	.											.	SIGLEC12	243	.	0			c.G1286T						.						50.0	49.0	49.0					19																	52001391		2203	4300	6503	SO:0001583	missense	89858	exon5			AGCACCCCAAGGT	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1286G>T	chr19.hg19:g.52001391C>A	ENSP00000291707:p.Gly429Val	86.0	0.0		66.0	17.0	NM_053003	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	hg19	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	9.204	1.029301	0.19512	.	.	ENSG00000254521	ENST00000291707	T	0.15718	2.4	1.39	-2.77	0.05877	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.198493	0.24779	U	0.035667	T	0.41673	0.1169	H	0.95402	3.665	0.09310	N	0.999998	D;D	0.69078	0.997;0.99	D;D	0.76071	0.987;0.929	T	0.33394	-0.9870	10	0.72032	D	0.01	.	2.2019	0.03926	0.2445:0.4208:0.0:0.3347	.	429;311	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	V	429	ENSP00000291707:G429V	ENSP00000291707:G429V	G	-	2	0	SIGLEC12	56693203	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.240000	0.18042	-0.859000	0.04105	-0.784000	0.03344	GGG	.	.		0.617	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
ZNF432	9668	hgsc.bcm.edu	37	19	52538685	52538685	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:52538685C>T	ENST00000594154.1	-	5	459	c.247G>A	c.(247-249)Gaa>Aaa	p.E83K	ZNF432_ENST00000221315.5_Missense_Mutation_p.E83K			O94892	ZN432_HUMAN	zinc finger protein 432	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TCATCAACTTCGTTGTTTTCT	0.343																																					p.E83K		Atlas-SNP	.											.	ZNF432	172	.	0			c.G247A						.						58.0	56.0	57.0					19																	52538685		2202	4300	6502	SO:0001583	missense	9668	exon5			CAACTTCGTTGTT	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.247G>A	chr19.hg19:g.52538685C>T	ENSP00000470488:p.Glu83Lys	246.0	0.0		163.0	61.0	NM_014650		Missense_Mutation	SNP	ENST00000594154.1	hg19	CCDS12848.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.015319	0.00042	.	.	ENSG00000256087	ENST00000221315	T	0.05258	3.47	3.32	1.14	0.20703	.	.	.	.	.	T	0.02156	0.0067	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46638	-0.9177	9	0.02654	T	1	.	4.1709	0.10329	0.0:0.2106:0.1774:0.612	.	83	O94892	ZN432_HUMAN	K	83	ENSP00000221315:E83K	ENSP00000221315:E83K	E	-	1	0	ZNF432	57230497	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.266000	0.18534	-0.095000	0.12351	-0.332000	0.08345	GAA	.	.		0.343	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650	
SIRPD	128646	hgsc.bcm.edu	37	20	1532400	1532400	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:1532400A>G	ENST00000381623.3	-	2	1547	c.358T>C	c.(358-360)Ttc>Ctc	p.F120L	SIRPD_ENST00000381621.1_Missense_Mutation_p.F120L			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	120	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CCTTTTATGAACTTCACGCAG	0.488																																					p.F120L		Atlas-SNP	.											.	SIRPD	34	.	0			c.T358C						.						149.0	143.0	145.0					20																	1532400		2203	4300	6503	SO:0001583	missense	128646	exon2			TTATGAACTTCAC	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.358T>C	chr20.hg19:g.1532400A>G	ENSP00000371036:p.Phe120Leu	137.0	0.0		79.0	24.0	NM_178460	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	hg19	CCDS13018.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.272461	0.40194	.	.	ENSG00000125900	ENST00000381623;ENST00000381621	T;T	0.64991	-0.13;-0.13	4.02	1.74	0.24563	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.680568	0.12147	N	0.495245	T	0.44973	0.1319	L	0.33753	1.03	0.24203	N	0.995501	P	0.34587	0.458	B	0.29077	0.098	T	0.32188	-0.9916	10	0.59425	D	0.04	.	5.698	0.17867	0.7725:0.0:0.2275:0.0	.	120	Q9H106	SIRPD_HUMAN	L	120	ENSP00000371036:F120L;ENSP00000371034:F120L	ENSP00000371034:F120L	F	-	1	0	SIRPD	1480400	1.000000	0.71417	0.776000	0.31678	0.180000	0.23129	2.564000	0.45931	0.235000	0.21160	-0.394000	0.06481	TTC	.	.		0.488	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
PLCB4	5332	hgsc.bcm.edu	37	20	9401994	9401994	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:9401994G>T	ENST00000378493.1	+	23	2184	c.2169G>T	c.(2167-2169)gaG>gaT	p.E723D	PLCB4_ENST00000414679.2_Missense_Mutation_p.E735D|PLCB4_ENST00000378473.3_Missense_Mutation_p.E735D|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.E723D|PLCB4_ENST00000278655.4_Missense_Mutation_p.E723D|PLCB4_ENST00000334005.3_Missense_Mutation_p.E723D			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	723	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CCTACGTAGAGGTGGATATGT	0.418																																					p.E735D		Atlas-SNP	.											.	PLCB4	204	.	0			c.G2205T						.						116.0	106.0	109.0					20																	9401994		2203	4300	6503	SO:0001583	missense	5332	exon26			CGTAGAGGTGGAT		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2169G>T	chr20.hg19:g.9401994G>T	ENSP00000367754:p.Glu723Asp	168.0	0.0		116.0	48.0	NM_001172646	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	hg19	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605140	0.66445	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48;-0.48	5.68	2.21	0.28008	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.86301	0.5900	H	0.94658	3.565	0.80722	D	1	D;P;D;D	0.89917	1.0;0.913;0.962;0.983	D;P;D;P	0.91635	0.999;0.549;0.957;0.826	D	0.85773	0.1356	10	0.87932	D	0	.	9.7585	0.40517	0.7336:0.0:0.2664:0.0	.	735;570;723;723	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	D	723;735;723;723;723;571	ENSP00000334105:E723D;ENSP00000367734:E735D;ENSP00000278655:E723D;ENSP00000367754:E723D;ENSP00000367762:E723D;ENSP00000390616:E571D	ENSP00000278655:E723D	E	+	3	2	PLCB4	9349994	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	1.150000	0.31639	0.119000	0.18210	-0.483000	0.04790	GAG	.	.		0.418	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
ATP9A	10079	hgsc.bcm.edu	37	20	50346419	50346419	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:50346419T>A	ENST00000338821.5	-	2	431	c.167A>T	c.(166-168)aAt>aTt	p.N56I	ATP9A_ENST00000477492.1_5'UTR|ATP9A_ENST00000311637.5_Missense_Mutation_p.N41I|ATP9A_ENST00000402822.1_Missense_Mutation_p.N56I	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	56					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GTTGATGACATTCCGAGGATA	0.547																																					p.N56I		Atlas-SNP	.											.	ATP9A	135	.	0			c.A167T						.						155.0	133.0	140.0					20																	50346419		2203	4300	6503	SO:0001583	missense	10079	exon2			ATGACATTCCGAG	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.167A>T	chr20.hg19:g.50346419T>A	ENSP00000342481:p.Asn56Ile	140.0	0.0		74.0	23.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	hg19	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.980823	0.92982	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.98762	-5.12;-5.12;-5.12	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	M	0.85041	2.73	0.33794	D	0.625851	B;P	0.49862	0.054;0.929	B;P	0.54815	0.055;0.761	D	0.99978	1.2344	10	0.87932	D	0	-20.706	15.4675	0.75412	0.0:0.0:0.0:1.0	.	56;56	O75110-2;O75110	.;ATP9A_HUMAN	I	41;56;56	ENSP00000309086:N41I;ENSP00000342481:N56I;ENSP00000385875:N56I	ENSP00000309086:N41I	N	-	2	0	ATP9A	49779826	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.461000	0.80834	2.107000	0.64212	0.460000	0.39030	AAT	.	.		0.547	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
KCNJ6	3763	hgsc.bcm.edu	37	21	39086700	39086700	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr21:39086700G>A	ENST00000609713.1	-	3	1349	c.760C>T	c.(760-762)Ccg>Tcg	p.P254S	KCNJ6_ENST00000288309.6_Missense_Mutation_p.P254S|KCNJ6-IT1_ENST00000435001.1_RNA	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	254					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	TGGTTCAACGGGATGAACTCC	0.502																																					p.P254S	Pancreas(48;379 1118 2936 19024 28214)	Atlas-SNP	.											.	KCNJ6	58	.	0			c.C760T						.						108.0	109.0	109.0					21																	39086700		1909	4143	6052	SO:0001583	missense	3763	exon3			TCAACGGGATGAA	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.760C>T	chr21.hg19:g.39086700G>A	ENSP00000477437:p.Pro254Ser	321.0	0.0		179.0	33.0	NM_002240	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	hg19	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585385	0.86748	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.91996	-2.95;-2.95	6.17	6.17	0.99709	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.96839	0.8968	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95956	0.8958	10	0.52906	T	0.07	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	254	P48051	IRK6_HUMAN	S	254	ENSP00000383330:P254S;ENSP00000288309:P254S	ENSP00000288309:P254S	P	-	1	0	KCNJ6	38008570	1.000000	0.71417	0.993000	0.49108	0.883000	0.51084	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	CCG	.	.		0.502	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
EWSR1	2130	hgsc.bcm.edu	37	22	29694814	29694814	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr22:29694814G>A	ENST00000397938.2	+	14	1828	c.1509G>A	c.(1507-1509)cgG>cgA	p.R503R	EWSR1_ENST00000332050.6_Silent_p.R430R|EWSR1_ENST00000414183.2_Silent_p.R508R|EWSR1_ENST00000331029.7_Silent_p.R465R|EWSR1_ENST00000332035.6_Silent_p.R447R|EWSR1_ENST00000406548.1_Silent_p.R502R	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	503	Arg/Gly/Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAGGACCCCGGGGTTCCCGAG	0.607			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.R508R		Atlas-SNP	.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	.	EWSR1	104	.	0			c.G1524A						.						56.0	65.0	62.0					22																	29694814		2203	4300	6503	SO:0001819	synonymous_variant	2130	exon15			ACCCCGGGGTTCC		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1509G>A	chr22.hg19:g.29694814G>A		73.0	0.0		61.0	23.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Silent	SNP	ENST00000397938.2	hg19	CCDS13851.1	.	.	.	.	.	.	.	.	.	.	G	4.311	0.056969	0.08339	.	.	ENSG00000182944	ENST00000360091	.	.	.	5.52	-1.92	0.07618	.	.	.	.	.	T	0.38558	0.1045	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28138	-1.0053	4	.	.	.	.	0.704	0.00913	0.3743:0.1243:0.2641:0.2373	.	.	.	.	R	159	.	.	G	+	1	0	EWSR1	28024814	0.897000	0.30589	0.828000	0.32881	0.332000	0.28634	-0.043000	0.12043	-0.501000	0.06605	-0.379000	0.06801	GGG	.	.		0.607	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
TAF1	6872	hgsc.bcm.edu	37	X	70680629	70680629	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chrX:70680629A>G	ENST00000373790.4	+	37	5423	c.5372A>G	c.(5371-5373)cAt>cGt	p.H1791R	TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000276072.3_Missense_Mutation_p.H1812R|TAF1_ENST00000449580.1_Missense_Mutation_p.H1825R|TAF1_ENST00000423759.1_Missense_Mutation_p.H1814R	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1791	Asp/Glu-rich (acidic tail).|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GAGGCTTCCCATGGTTTGGAG	0.507																																					p.H1812R		Atlas-SNP	.											.	TAF1	439	.	0			c.A5435G						.						117.0	81.0	93.0					X																	70680629		2201	4299	6500	SO:0001583	missense	6872	exon37			CTTCCCATGGTTT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.5372A>G	chrX.hg19:g.70680629A>G	ENSP00000362895:p.His1791Arg	146.0	0.0		90.0	67.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	hg19	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.11|10.11	1.259763|1.259763	0.23051|0.23051	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000276072|ENST00000437147	T;T;T;T|.	0.08370|.	3.1;3.14;3.16;3.1|.	4.76|4.76	-0.271|-0.271	0.12922|0.12922	.|.	0.662303|.	0.16392|.	N|.	0.216437|.	T|T	0.22704|0.22704	0.0548|0.0548	N|N	0.19112|0.19112	0.55|0.55	0.20873|0.20873	N|N	0.999833|0.999833	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.04013|.	0.001;0.001;0.0;0.001|.	T|T	0.29701|0.29701	-1.0003|-1.0003	10|5	0.11485|.	T|.	0.65|.	.|.	8.3625|8.3625	0.32367|0.32367	0.6661:0.0:0.3339:0.0|0.6661:0.0:0.3339:0.0	.|.	481;1825;1791;1812|.	A5CVC9;P21675-4;P21675;P21675-2|.	.;.;TAF1_HUMAN;.|.	R|V	1791;1825;1814;533;1812|480	ENSP00000362895:H1791R;ENSP00000389000:H1825R;ENSP00000406549:H1814R;ENSP00000276072:H1812R|.	ENSP00000276072:H1812R|.	H|M	+|+	2|1	0|0	TAF1|TAF1	70597354|70597354	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.997000|0.997000	0.91878|0.91878	1.978000|1.978000	0.40598|0.40598	-0.324000|-0.324000	0.08589|0.08589	0.430000|0.430000	0.28490|0.28490	CAT|ATG	.	.		0.507	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
MT-CO3	4514	hgsc.bcm.edu	37	M	9925	9925	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chrM:9925G>A	ENST00000362079.2	+	1	719	c.719G>A	c.(718-720)tGa>tAa	p.*240*	MT-ND3_ENST00000361227.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-ND5_ENST00000361567.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TH_ENST00000387441.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	240					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AGCCGCCGCCTGATACTGGCA	0.398																																					p.W240X		Atlas-SNP	.											.	.	.	.	0			c.G719A						.																																			SO:0001819	synonymous_variant	5742	exon1			CCGCCTGATACTG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.719G>A	chrM.hg19:g.9925G>A		81.0	0.0		289.0	12.0	ENST00000362079	Q14Y83	Nonsense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.398	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
TIMP4	7079	hgsc.bcm.edu	37	3	12195189	12195189	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:12195189delG	ENST00000287814.4	-	5	1011	c.501delC	c.(499-501)cccfs	p.P167fs	SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4	167					central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						AGATGGTACAGGGTACTGTGT	0.488																																					p.C168fs	Melanoma(199;1446 2144 30617 38794 51714)	Atlas-INDEL	.											.	TIMP4	21	.	0			c.502delT						.						134.0	124.0	127.0					3																	12195189		2203	4300	6503	SO:0001589	frameshift_variant	7079	exon5			.	U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763	ENST00000287814.4:c.501delC	chr3.hg19:g.12195189delG	ENSP00000287814:p.Pro167fs	201.0	0.0		102.0	23.0	NM_003256	B2R7K6	Frame_Shift_Del	DEL	ENST00000287814.4	hg19	CCDS2608.1																																																																																			.	.		0.488	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251978.1	NM_003256	
MTF2	22823	hgsc.bcm.edu	37	1	93599749	93599749	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:93599749delA	ENST00000370298.4	+	14	1710	c.1421delA	c.(1420-1422)tatfs	p.Y474fs	MTF2_ENST00000545708.1_Frame_Shift_Del_p.Y372fs|MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000540243.1_Frame_Shift_Del_p.Y372fs|MTF2_ENST00000370303.4_Frame_Shift_Del_p.Y417fs	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	474					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		TCCAGGCATTATGGGTAGATA	0.338																																					p.Y474fs		Atlas-Indel,Pindel	.											.	MTF2	51	.	0			c.1420delT						.						64.0	68.0	66.0					1																	93599749		2201	4299	6500	SO:0001589	frameshift_variant	22823	exon14			.	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1421delA	chr1.hg19:g.93599749delA	ENSP00000359321:p.Tyr474fs	183.0	0.0		121.0	50.0	NM_007358	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Frame_Shift_Del	DEL	ENST00000370298.4	hg19	CCDS742.1																																																																																			.	.		0.338	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358	
CEP97	79598	hgsc.bcm.edu	37	3	101481359	101481360	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:101481359_101481360insA	ENST00000341893.3	+	10	2600_2601	c.1848_1849insA	c.(1849-1851)aaafs	p.K617fs	CEP97_ENST00000494050.1_Frame_Shift_Ins_p.K558fs|CEP97_ENST00000327230.4_Frame_Shift_Ins_p.K617fs			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	617	CCP110-binding.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						AAGAACGTATTAAAAAATTTGT	0.337																																					p.I616fs		Atlas-Indel,Pindel	.											.	CEP97	122	.	0			c.1848_1849insA						.																																			SO:0001589	frameshift_variant	79598	exon10			.	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1854dupA	chr3.hg19:g.101481365_101481365dupA	ENSP00000342510:p.Lys617fs	511.0	0.0		282.0	52.0	NM_024548	B5MDY8|Q8NA71|Q9H5T9	Frame_Shift_Ins	INS	ENST00000341893.3	hg19	CCDS2944.1																																																																																			.	.		0.337	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
GPR152	390212	hgsc.bcm.edu	37	11	67219120	67219121	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:67219120_67219121insG	ENST00000312457.2	-	1	1079_1080	c.1075_1076insC	c.(1075-1077)cagfs	p.Q359fs	CABP4_ENST00000438189.2_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	359						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GGGGTTCACCTGAGGCTGGGCC	0.634																																					p.Q359fs	Pancreas(102;800 1581 2723 7382 33622)	Atlas-INDEL	.											.	GPR152	41	.	0			c.1076_1077insC						.																																			SO:0001589	frameshift_variant	390212	exon1			.	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.1076dupC	chr11.hg19:g.67219121_67219121dupG	ENSP00000310255:p.Gln359fs	205.0	0.0		181.0	12.0	NM_206997	Q0VD88|Q86SM0	Frame_Shift_Ins	INS	ENST00000312457.2	hg19	CCDS8165.1																																																																																			.	.		0.634	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1		
SEC14L3	266629	hgsc.bcm.edu	37	22	30857663	30857664	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr22:30857663_30857664insC	ENST00000215812.4	-	10	879_880	c.789_790insG	c.(787-792)gagatcfs	p.I264fs	SEC14L3_ENST00000403066.1_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000402286.1_Frame_Shift_Ins_p.I187fs|SEC14L3_ENST00000540910.1_Frame_Shift_Ins_p.I187fs|SEC14L3_ENST00000539629.1_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000415957.2_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000401751.1_Frame_Shift_Ins_p.I205fs	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	264						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GACTTGGGGATCTCCCCGCCAT	0.54																																					p.I264fs	Esophageal Squamous(108;290 1516 3584 23771 37333)	Atlas-INDEL	.											.	SEC14L3	46	.	0			c.790_791insG						.																																			SO:0001589	frameshift_variant	266629	exon10			.	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.790dupG	chr22.hg19:g.30857664_30857664dupC	ENSP00000215812:p.Ile264fs	129.0	0.0		93.0	11.0	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Frame_Shift_Ins	INS	ENST00000215812.4	hg19	CCDS13877.1																																																																																			.	.		0.540	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
OR51A4	401666	hgsc.bcm.edu	37	11	4968139	4968139	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:4968139delA	ENST00000380373.2	-	1	217	c.192delT	c.(190-192)tttfs	p.F64fs	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACATGGAAAGAAAATAGTACA	0.418																																					p.L65fs		Atlas-Indel,Pindel	.											OR51A4,NS,carcinoma,0,1	OR51A4	73	.	0			c.193delC						.						163.0	147.0	153.0					11																	4968139		2198	4298	6496	SO:0001589	frameshift_variant	401666	exon1			.	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.192delT	chr11.hg19:g.4968139delA	ENSP00000369731:p.Phe64fs	1224.0	0.0		591.0	135.0	NM_001005329		Frame_Shift_Del	DEL	ENST00000380373.2	hg19	CCDS31367.1																																																																																			.	.		0.418	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
RAB40B	10966	hgsc.bcm.edu	37	17	80615904	80615904	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:80615904delG	ENST00000571995.1	-	6	803	c.672delC	c.(670-672)tccfs	p.S224fs	RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_Frame_Shift_Del_p.S45fs|RAB40B_ENST00000538809.2_3'UTR	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	224	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CCATCGAGAAGGACTTGAGGT	0.617																																					p.F225fs		Atlas-Indel,Pindel	.											.	RAB40B	24	.	0			c.673delT						.						159.0	143.0	149.0					17																	80615904		2203	4300	6503	SO:0001589	frameshift_variant	10966	exon6			.	U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.672delC	chr17.hg19:g.80615904delG	ENSP00000461785:p.Ser224fs	190.0	0.0		164.0	23.0	NM_006822	Q8WVG3	Frame_Shift_Del	DEL	ENST00000571995.1	hg19	CCDS11816.1																																																																																			.	.		0.617	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
