#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AJAP1	55966	hgsc.bcm.edu	37	1	4772503	4772503	+	Silent	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:4772503C>G	ENST00000378191.4	+	2	954	c.573C>G	c.(571-573)gcC>gcG	p.A191A	AJAP1_ENST00000378190.3_Silent_p.A191A	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	191	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ACGAGGAGGCCCTGGAGTCCA	0.647																																					p.A191A		Atlas-SNP	.											.	AJAP1	68	.	0			c.C573G						.						27.0	26.0	26.0					1																	4772503		2201	4299	6500	SO:0001819	synonymous_variant	55966	exon2			GGAGGCCCTGGAG	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.573C>G	chr1.hg19:g.4772503C>G		10.0	0.0		29.0	11.0	NM_018836	Q9Y229	Silent	SNP	ENST00000378191.4	hg19	CCDS54.1																																																																																			.	.		0.647	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
MTOR	2475	hgsc.bcm.edu	37	1	11169374	11169374	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:11169374T>A	ENST00000361445.4	-	56	7577	c.7501A>T	c.(7501-7503)Att>Ttt	p.I2501F	MTOR_ENST00000376838.1_Missense_Mutation_p.I706F	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2501	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ACCCTGTTAATAATCTGGATA	0.413																																					p.I2501F		Atlas-SNP	.											.	MTOR	327	.	0			c.A7501T						.						177.0	156.0	163.0					1																	11169374		2203	4300	6503	SO:0001583	missense	2475	exon56			TGTTAATAATCTG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7501A>T	chr1.hg19:g.11169374T>A	ENSP00000354558:p.Ile2501Phe	92.0	0.0		119.0	9.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	hg19	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.180381	0.78677	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.28454	3.1;2.84;1.61	5.82	5.82	0.92795	Phosphatidylinositol 3-/4-kinase, catalytic (2);	0.000000	0.85682	D	0.000000	T	0.52741	0.1753	M	0.85197	2.74	0.80722	D	1	D	0.62365	0.991	P	0.54924	0.764	T	0.61178	-0.7115	10	0.72032	D	0.01	-1.8424	13.9151	0.63893	0.0:0.0:0.0:1.0	.	2501	P42345	MTOR_HUMAN	F	2501;706;157	ENSP00000354558:I2501F;ENSP00000366034:I706F;ENSP00000398745:I157F	ENSP00000354558:I2501F	I	-	1	0	MTOR	11091961	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.466000	0.80914	2.223000	0.72356	0.482000	0.46254	ATT	.	.		0.413	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907351	12907351	+	Silent	SNP	A	A	G	rs2359485		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:12907351A>G	ENST00000317869.6	-	2	1017	c.792T>C	c.(790-792)gaT>gaC	p.D264D		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	264						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CCAGCTGGTCATCCCCCTGAT	0.502																																					p.D264D		Atlas-SNP	.											.	HNRNPCL1	68	.	0			c.T792C						.						140.0	153.0	149.0					1																	12907351		2203	4300	6503	SO:0001819	synonymous_variant	343069	exon2			CTGGTCATCCCCC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.792T>C	chr1.hg19:g.12907351A>G		103.0	0.0		192.0	29.0	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	hg19	CCDS30591.1																																																																																			.	A|0.500;G|0.500		0.502	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
COL16A1	1307	hgsc.bcm.edu	37	1	32151735	32151735	+	Splice_Site	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:32151735C>T	ENST00000373672.3	-	28	2357	c.1841G>A	c.(1840-1842)gGg>gAg	p.G614E	COL16A1_ENST00000271069.6_Splice_Site_p.G613E|COL16A1_ENST00000373668.3_Splice_Site_p.G614E	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	614	Collagen-like 2.|Triple-helical region 7 (COL7) with 1 imperfection.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCCTGGTGGCCCCTGCATGTT	0.587																																					p.G614E	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.G1841A						.						100.0	111.0	107.0					1																	32151735		2120	4224	6344	SO:0001630	splice_region_variant	1307	exon28			GGTGGCCCCTGCA	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1840-1G>A	chr1.hg19:g.32151735C>T		85.0	0.0		126.0	70.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	hg19	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	13.56	2.273439	0.40194	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	D;D;D	0.99619	-6.28;-3.27;-6.28	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.99757	0.9902	H	0.95950	3.745	0.48395	D	0.999644	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97318	0.9942	10	0.87932	D	0	.	15.3516	0.74393	0.0:1.0:0.0:0.0	.	614;614;614	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	E	614;613;614	ENSP00000362776:G614E;ENSP00000271069:G613E;ENSP00000362772:G614E	ENSP00000271069:G613E	G	-	2	0	COL16A1	31924322	0.979000	0.34478	0.957000	0.39632	0.054000	0.15201	2.711000	0.47177	2.771000	0.95319	0.563000	0.77884	GGG	.	.		0.587	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	Missense_Mutation
ZMYM4	9202	hgsc.bcm.edu	37	1	35852772	35852772	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:35852772C>T	ENST00000314607.6	+	12	2085	c.2005C>T	c.(2005-2007)Ctc>Ttc	p.L669F	ZMYM4_ENST00000373297.2_Missense_Mutation_p.L580F	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	669					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCTCCAGCGTCTCGCTGCCCA	0.522																																					p.L669F		Atlas-SNP	.											.	ZMYM4	143	.	0			c.C2005T						.						94.0	72.0	79.0					1																	35852772		2203	4300	6503	SO:0001583	missense	9202	exon12			CAGCGTCTCGCTG	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2005C>T	chr1.hg19:g.35852772C>T	ENSP00000322915:p.Leu669Phe	68.0	0.0		87.0	8.0	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	hg19	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.39|12.39	1.923056|1.923056	0.33908|0.33908	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.25579|.	1.82;1.79|.	5.66|5.66	4.74|4.74	0.60224|0.60224	.|.	0.173360|.	0.36703|.	N|.	0.002444|.	T|T	0.65954|0.65954	0.2741|0.2741	M|M	0.70595|0.70595	2.14|2.14	0.38565|0.38565	D|D	0.949817|0.949817	D|.	0.69078|.	0.997|.	D|.	0.72075|.	0.976|.	T|T	0.68477|0.68477	-0.5398|-0.5398	10|5	0.24483|.	T|.	0.36|.	-10.598|-10.598	10.2861|10.2861	0.43568|0.43568	0.0:0.7901:0.0:0.2099|0.0:0.7901:0.0:0.2099	.|.	669|.	Q5VZL5|.	ZMYM4_HUMAN|.	F|F	669;580|328	ENSP00000322915:L669F;ENSP00000362394:L580F|.	ENSP00000322915:L669F|.	L|S	+|+	1|2	0|0	ZMYM4|ZMYM4	35625359|35625359	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.588000|0.588000	0.36517|0.36517	1.958000|1.958000	0.40402|0.40402	1.363000|1.363000	0.46019|0.46019	0.655000|0.655000	0.94253|0.94253	CTC|TCT	.	.		0.522	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
COL8A2	1296	hgsc.bcm.edu	37	1	36565805	36565805	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:36565805C>T	ENST00000397799.1	-	3	263	c.39G>A	c.(37-39)ctG>ctA	p.L13L	COL8A2_ENST00000303143.4_Silent_p.L13L|COL8A2_ENST00000481785.1_5'UTR			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	13					angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ccagtagcagcagcagcagcG	0.652											OREG0013361	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L13L		Atlas-SNP	.											.	COL8A2	41	.	0			c.G39A						.						10.0	10.0	10.0					1																	36565805		2191	4281	6472	SO:0001819	synonymous_variant	1296	exon1			TAGCAGCAGCAGC	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.39G>A	chr1.hg19:g.36565805C>T		9.0	0.0	863	25.0	14.0	NM_005202	Q5JV31|Q8TEJ5	Silent	SNP	ENST00000397799.1	hg19	CCDS403.1																																																																																			.	.		0.652	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
INSL5	10022	hgsc.bcm.edu	37	1	67266850	67266850	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:67266850C>A	ENST00000304526.2	-	1	89	c.55G>T	c.(55-57)Gaa>Taa	p.E19*		NM_005478.4	NP_005469.2	Q9Y5Q6	INSL5_HUMAN	insulin-like 5	19						extracellular region (GO:0005576)				breast(2)|endometrium(1)|lung(5)	8						CTCCGCACTTCTGAGATGGCA	0.443																																					p.E19X		Atlas-SNP	.											.	INSL5	26	.	0			c.G55T						.						81.0	80.0	81.0					1																	67266850		2203	4300	6503	SO:0001587	stop_gained	10022	exon1			GCACTTCTGAGAT	AF133816	CCDS634.1	1p31.3	2013-02-26			ENSG00000172410	ENSG00000172410		"""Endogenous ligands"""	6088	protein-coding gene	gene with protein product	"""prepro-INSL5"""	606413				10458910	Standard	NM_005478		Approved		uc001dcw.3	Q9Y5Q6	OTTHUMG00000009164	ENST00000304526.2:c.55G>T	chr1.hg19:g.67266850C>A	ENSP00000302724:p.Glu19*	64.0	0.0		58.0	25.0	NM_005478	Q3MIY4|Q5VYD8	Nonsense_Mutation	SNP	ENST00000304526.2	hg19	CCDS634.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014391	0.75161	.	.	ENSG00000172410	ENST00000304526	.	.	.	4.48	4.48	0.54585	.	0.189536	0.32852	N	0.005563	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-2.8317	14.7095	0.69218	0.0:1.0:0.0:0.0	.	.	.	.	X	19	.	ENSP00000302724:E19X	E	-	1	0	INSL5	67039438	0.182000	0.23173	0.033000	0.17914	0.081000	0.17604	2.127000	0.42035	2.296000	0.77279	0.655000	0.94253	GAA	.	.		0.443	INSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025403.1	NM_005478	
ANKRD13C	81573	hgsc.bcm.edu	37	1	70740488	70740488	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:70740488C>G	ENST00000370944.4	-	11	1622	c.1309G>C	c.(1309-1311)Ggt>Cgt	p.G437R	ANKRD13C_ENST00000262346.6_Missense_Mutation_p.G402R|ANKRD13C_ENST00000464236.1_5'UTR	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	437					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						AATTCTCTACCCAGATGAGGA	0.378																																					p.G437R		Atlas-SNP	.											.	ANKRD13C	36	.	0			c.G1309C						.						152.0	153.0	153.0					1																	70740488		2203	4300	6503	SO:0001583	missense	81573	exon11			CTCTACCCAGATG		CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.1309G>C	chr1.hg19:g.70740488C>G	ENSP00000359982:p.Gly437Arg	79.0	0.0		141.0	26.0	NM_030816	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Missense_Mutation	SNP	ENST00000370944.4	hg19	CCDS648.2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502021	0.85176	.	.	ENSG00000118454	ENST00000370944;ENST00000262346	T;T	0.53206	0.63;0.63	5.19	4.26	0.50523	.	0.047258	0.85682	D	0.000000	T	0.66587	0.2804	M	0.86651	2.83	0.80722	D	1	P;D	0.89917	0.936;1.0	P;D	0.77004	0.839;0.989	T	0.72571	-0.4253	10	0.87932	D	0	-2.7546	14.3123	0.66424	0.0:0.9233:0.0:0.0767	.	402;437	Q8N6S4-2;Q8N6S4	.;AN13C_HUMAN	R	437;402	ENSP00000359982:G437R;ENSP00000262346:G402R	ENSP00000262346:G402R	G	-	1	0	ANKRD13C	70513076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.613000	0.67688	2.593000	0.87608	0.563000	0.77884	GGT	.	.		0.378	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025903.1	NM_030816	
UBE2Q1	55585	hgsc.bcm.edu	37	1	154527970	154527970	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:154527970A>C	ENST00000292211.4	-	3	550	c.471T>G	c.(469-471)tgT>tgG	p.C157W	UBE2Q1-AS1_ENST00000441613.1_RNA|UBE2Q1_ENST00000497453.1_5'UTR	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	157					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TATAGAGTTTACACAGGTCGG	0.537																																					p.C157W		Atlas-SNP	.											.	UBE2Q1	35	.	0			c.T471G						.						151.0	144.0	147.0					1																	154527970		2203	4300	6503	SO:0001583	missense	55585	exon3			GAGTTTACACAGG	AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.471T>G	chr1.hg19:g.154527970A>C	ENSP00000292211:p.Cys157Trp	66.0	0.0		126.0	50.0	NM_017582	B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Missense_Mutation	SNP	ENST00000292211.4	hg19	CCDS1069.1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.423085	0.62733	.	.	ENSG00000160714	ENST00000292211	.	.	.	4.73	3.62	0.41486	.	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	L	0.52573	1.65	0.80722	D	1	D	0.55172	0.97	P	0.52031	0.688	T	0.50750	-0.8791	9	0.87932	D	0	-8.4796	4.549	0.12103	0.7564:0.0:0.2436:0.0	.	157	Q7Z7E8	UB2Q1_HUMAN	W	157	.	ENSP00000292211:C157W	C	-	3	2	UBE2Q1	152794594	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.214000	0.51161	2.123000	0.65237	0.374000	0.22700	TGT	.	.		0.537	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090704.1	NM_017582	
PBX1	5087	hgsc.bcm.edu	37	1	164781342	164781342	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:164781342C>A	ENST00000420696.2	+	6	1141	c.953C>A	c.(952-954)gCc>gAc	p.A318D	PBX1_ENST00000560641.1_Missense_Mutation_p.A213D|PBX1_ENST00000559240.1_Intron|PBX1_ENST00000367897.1_Missense_Mutation_p.A318D|PBX1_ENST00000401534.1_Missense_Mutation_p.A318D|PBX1_ENST00000540236.1_Missense_Mutation_p.A318D|PBX1_ENST00000540246.1_Missense_Mutation_p.A213D	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	318					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						AATGTGTCAGCCCATGGAAGC	0.443			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.A318D		Atlas-SNP	.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	60	.	0			c.C953A						.						113.0	92.0	99.0					1																	164781342		2203	4300	6503	SO:0001583	missense	5087	exon6			TGTCAGCCCATGG	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.953C>A	chr1.hg19:g.164781342C>A	ENSP00000405890:p.Ala318Asp	87.0	0.0		180.0	26.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	hg19	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.491971	0.64074	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	D;D;D;D;D	0.89617	-2.43;-2.34;-2.44;-2.34;-2.54	5.8	5.8	0.92144	.	0.049382	0.85682	D	0.000000	T	0.81559	0.4848	L	0.59436	1.845	.	.	.	B;B;B;B;B	0.26672	0.073;0.073;0.156;0.073;0.025	B;B;B;B;B	0.32022	0.044;0.04;0.139;0.027;0.045	T	0.77159	-0.2690	9	0.23891	T	0.37	-11.2817	12.9399	0.58337	0.0:0.9256:0.0:0.0744	.	213;318;318;318;318	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	D	318;318;318;318;213	ENSP00000405890:A318D;ENSP00000356872:A318D;ENSP00000439943:A318D;ENSP00000384856:A318D;ENSP00000440869:A213D	ENSP00000356872:A318D	A	+	2	0	PBX1	163047966	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.601000	0.61090	2.732000	0.93576	0.650000	0.86243	GCC	.	.		0.443	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
TDRD5	163589	hgsc.bcm.edu	37	1	179631316	179631316	+	Silent	SNP	T	T	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:179631316T>A	ENST00000367614.1	+	14	2597	c.2238T>A	c.(2236-2238)ccT>ccA	p.P746P	TDRD5_ENST00000294848.8_Silent_p.P746P|TDRD5_ENST00000444136.1_Silent_p.P800P	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	746					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						ACTGGTTACCTCTACAGGCTA	0.443																																					p.P800P		Atlas-SNP	.											.	TDRD5	149	.	0			c.T2400A						.						155.0	133.0	140.0					1																	179631316		2203	4300	6503	SO:0001819	synonymous_variant	163589	exon15			GTTACCTCTACAG	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2238T>A	chr1.hg19:g.179631316T>A		36.0	0.0		76.0	43.0	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	hg19	CCDS1332.1																																																																																			.	.		0.443	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
COLGALT2	23127	hgsc.bcm.edu	37	1	183944304	183944304	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:183944304C>T	ENST00000361927.4	-	3	790	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	COLGALT2_ENST00000546159.1_Missense_Mutation_p.R140Q	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	140					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										ATGGGCAAACCGGGAGGTTGG	0.433																																					p.R140Q		Atlas-SNP	.											GLT25D2,caecum,carcinoma,0,1	.	.	.	0			c.G419A						.						97.0	91.0	93.0					1																	183944304		2203	4300	6503	SO:0001583	missense	23127	exon3			GCAAACCGGGAGG	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.419G>A	chr1.hg19:g.183944304C>T	ENSP00000354960:p.Arg140Gln	23.0	0.0		60.0	12.0	NM_015101	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	hg19	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	C	36	5.848955	0.97023	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.24151	1.87;1.87	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.61800	0.2376	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.964;0.99	T	0.71474	-0.4582	10	0.87932	D	0	-33.9366	19.1269	0.93388	0.0:1.0:0.0:0.0	.	140;140	F5H3T5;Q8IYK4	.;GT252_HUMAN	Q	140	ENSP00000439112:R140Q;ENSP00000354960:R140Q	ENSP00000354960:R140Q	R	-	2	0	GLT25D2	182210927	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.531000	0.81973	2.583000	0.87209	0.650000	0.86243	CGG	.	.		0.433	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
CR1	1378	hgsc.bcm.edu	37	1	207789962	207789962	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:207789962A>T	ENST00000367049.4	+	41	6704	c.6704A>T	c.(6703-6705)cAc>cTc	p.H2235L	CR1_ENST00000400960.2_Missense_Mutation_p.H1785L|CR1_ENST00000367051.1_Missense_Mutation_p.H1785L|CR1_ENST00000367053.1_Missense_Mutation_p.H1785L|CR1_ENST00000367052.1_Missense_Mutation_p.H1785L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1785					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AATGGGAGACACACAGGAACT	0.413																																					p.H2235L		Atlas-SNP	.											.	CR1	354	.	0			c.A6704T						.						118.0	111.0	113.0					1																	207789962		1841	4084	5925	SO:0001583	missense	1378	exon41			GGAGACACACAGG	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6704A>T	chr1.hg19:g.207789962A>T	ENSP00000356016:p.His2235Leu	111.0	0.0		173.0	42.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	hg19	CCDS44308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.86|12.86	2.063506|2.063506	0.36373|0.36373	.|.	.|.	ENSG00000203710|ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049|ENST00000529814	T;T;T;T;T|.	0.60548|.	0.18;0.18;0.18;0.18;0.18|.	4.3|4.3	4.3|4.3	0.51218|0.51218	Complement control module (2);Sushi/SCR/CCP (3);|.	.|.	.|.	.|.	.|.	T|T	0.39989|0.39989	0.1099|0.1099	L|L	0.41710|0.41710	1.295|1.295	0.09310|0.09310	N|N	1|1	D;D|.	0.76494|.	0.989;0.999|.	P;D|.	0.85130|.	0.835;0.997|.	T|T	0.22382|0.22382	-1.0218|-1.0218	9|5	0.02654|.	T|.	1|.	.|.	10.1339|10.1339	0.42695|0.42695	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1785;2235|.	P17927;E9PDY4|.	CR1_HUMAN;.|.	L|S	1785;1785;1785;1785;2235|408	ENSP00000356019:H1785L;ENSP00000356018:H1785L;ENSP00000356020:H1785L;ENSP00000383744:H1785L;ENSP00000356016:H2235L|.	ENSP00000356016:H2235L|.	H|T	+|+	2|1	0|0	CR1|CR1	205856585|205856585	0.019000|0.019000	0.18553|0.18553	0.026000|0.026000	0.17262|0.17262	0.327000|0.327000	0.28475|0.28475	2.555000|2.555000	0.45854|0.45854	2.171000|2.171000	0.68590|0.68590	0.496000|0.496000	0.49642|0.49642	CAC|ACA	.	.		0.413	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
OBSCN	84033	hgsc.bcm.edu	37	1	228511096	228511096	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:228511096C>T	ENST00000422127.1	+	56	15485	c.15441C>T	c.(15439-15441)tgC>tgT	p.C5147C	OBSCN_ENST00000284548.11_Silent_p.C5147C|OBSCN_ENST00000366707.4_Silent_p.C2781C|OBSCN_ENST00000570156.2_Silent_p.C6104C|OBSCN_ENST00000366709.4_Silent_p.C2266C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5147	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTTTGACTGCGTGGTGACAG	0.532																																					p.C6104C		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C18312T						.						80.0	82.0	82.0					1																	228511096		2139	4244	6383	SO:0001819	synonymous_variant	84033	exon67			TGACTGCGTGGTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15441C>T	chr1.hg19:g.228511096C>T		54.0	0.0		141.0	27.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.		0.532	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
KIF26B	55083	hgsc.bcm.edu	37	1	245862258	245862258	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:245862258G>A	ENST00000407071.2	+	14	6537	c.6097G>A	c.(6097-6099)Gcg>Acg	p.A2033T	KIF26B_ENST00000366518.4_Missense_Mutation_p.A1652T	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2033					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAGGTCCGCGCGAAGTACGA	0.567																																					p.A2033T		Atlas-SNP	.											.	KIF26B	343	.	0			c.G6097A						.						73.0	80.0	78.0					1																	245862258		2105	4222	6327	SO:0001583	missense	55083	exon14			GTCCGCGCGAAGT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6097G>A	chr1.hg19:g.245862258G>A	ENSP00000385545:p.Ala2033Thr	46.0	0.0		97.0	72.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458239	0.84317	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.82433	-1.61;-1.6	5.82	5.82	0.92795	.	.	.	.	.	D	0.90352	0.6981	M	0.65975	2.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.66602	0.945	D	0.90525	0.4491	9	0.87932	D	0	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	2033	Q2KJY2	KI26B_HUMAN	T	2033;1652;1649	ENSP00000385545:A2033T;ENSP00000355475:A1652T	ENSP00000355475:A1652T	A	+	1	0	KIF26B	243928881	1.000000	0.71417	0.991000	0.47740	0.678000	0.39670	9.838000	0.99474	2.752000	0.94435	0.655000	0.94253	GCG	.	.		0.567	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
OR2L8	391190	hgsc.bcm.edu	37	1	248112614	248112614	+	Nonsense_Mutation	SNP	C	C	A	rs536751971		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:248112614C>A	ENST00000357191.3	+	1	455	c.455C>A	c.(454-456)tCg>tAg	p.S152*	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ATCATAGGCTCGATCAATGCT	0.438																																					p.S152X		Atlas-SNP	.											OR2L8,NS,carcinoma,0,1	OR2L8	92	.	0			c.C455A						.						245.0	190.0	208.0					1																	248112614		2203	4300	6503	SO:0001587	stop_gained	391190	exon1			TAGGCTCGATCAA	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.455C>A	chr1.hg19:g.248112614C>A	ENSP00000349719:p.Ser152*	156.0	0.0		529.0	117.0	NM_001001963	Q6IF03	Nonsense_Mutation	SNP	ENST00000357191.3	hg19	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	14.04	2.415572	0.42817	.	.	ENSG00000196936	ENST00000357191	.	.	.	1.64	1.64	0.23874	.	1.218230	0.06416	U	0.721499	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.6931	0.08354	0.0:0.5144:0.0:0.4856	.	.	.	.	X	152	.	ENSP00000349719:S152X	S	+	2	0	OR2L8	246179237	0.000000	0.05858	0.008000	0.14137	0.281000	0.26958	-0.605000	0.05661	0.905000	0.36596	0.479000	0.44913	TCG	.	.		0.438	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
OR2T33	391195	hgsc.bcm.edu	37	1	248436686	248436686	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:248436686A>G	ENST00000318021.2	-	1	452	c.431T>C	c.(430-432)aTg>aCg	p.M144T		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCAACACGACATGGTCATCCT	0.572																																					p.M144T		Atlas-SNP	.											.	OR2T33	133	.	0			c.T431C						.						143.0	136.0	138.0					1																	248436686		2203	4300	6503	SO:0001583	missense	391195	exon1			CACGACATGGTCA		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.431T>C	chr1.hg19:g.248436686A>G	ENSP00000324687:p.Met144Thr	175.0	0.0		650.0	177.0	NM_001004695	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	hg19	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	0.655	-0.807933	0.02819	.	.	ENSG00000177212	ENST00000318021	T	0.35973	1.28	2.7	-1.45	0.08828	GPCR, rhodopsin-like superfamily (1);	1.861850	0.03589	U	0.231619	T	0.14614	0.0353	N	0.02181	-0.65	0.09310	N	1	B	0.11235	0.004	B	0.19946	0.027	T	0.14839	-1.0458	10	0.29301	T	0.29	.	4.447	0.11602	0.4771:0.1676:0.3552:0.0	.	144	Q8NG76	O2T33_HUMAN	T	144	ENSP00000324687:M144T	ENSP00000324687:M144T	M	-	2	0	OR2T33	246503309	0.001000	0.12720	0.000000	0.03702	0.035000	0.12851	0.625000	0.24477	-0.348000	0.08286	0.404000	0.27445	ATG	.	.		0.572	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
GRHL1	29841	hgsc.bcm.edu	37	2	10132262	10132262	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:10132262G>A	ENST00000324907.9	+	11	1585	c.1449G>A	c.(1447-1449)caG>caA	p.Q483Q	GRHL1_ENST00000405379.2_Silent_p.Q483Q|GRHL1_ENST00000324883.5_Silent_p.Q294Q	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	483					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CCAACTTGCAGCGGGGCACTC	0.483																																					p.Q483Q		Atlas-SNP	.											.	GRHL1	95	.	0			c.G1449A						.						109.0	94.0	99.0					2																	10132262		2203	4300	6503	SO:0001819	synonymous_variant	29841	exon11			CTTGCAGCGGGGC	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1449G>A	chr2.hg19:g.10132262G>A		66.0	0.0		162.0	65.0	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Silent	SNP	ENST00000324907.9	hg19	CCDS33144.2																																																																																			.	.		0.483	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
NLRC4	58484	hgsc.bcm.edu	37	2	32466120	32466120	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:32466120C>G	ENST00000404025.2	-	6	2820	c.2332G>C	c.(2332-2334)Gaa>Caa	p.E778Q	NLRC4_ENST00000360906.5_Missense_Mutation_p.E778Q|NLRC4_ENST00000402280.1_Missense_Mutation_p.E778Q|NLRC4_ENST00000342905.6_Missense_Mutation_p.E113Q			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	778					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ATAGCATCTTCTTCATTCATC	0.358																																					p.E778Q		Atlas-SNP	.											.	NLRC4	165	.	0			c.G2332C						.						231.0	220.0	224.0					2																	32466120		2203	4300	6503	SO:0001583	missense	58484	exon5			CATCTTCTTCATT	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.2332G>C	chr2.hg19:g.32466120C>G	ENSP00000385090:p.Glu778Gln	54.0	0.0		130.0	14.0	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	hg19	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	C	6.492	0.459053	0.12342	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000342905;ENST00000404025	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	3.6	3.6	0.41247	.	0.000000	0.34628	N	0.003820	T	0.38268	0.1034	L	0.43152	1.355	0.26350	N	0.977228	P;B	0.40476	0.718;0.442	B;B	0.35688	0.208;0.103	T	0.50783	-0.8787	9	0.26408	T	0.33	-7.4064	8.9962	0.36055	0.0:0.892:0.0:0.108	.	113;778	Q9NPP4-2;Q9NPP4	.;NLRC4_HUMAN	Q	778;778;113;778	ENSP00000354159:E778Q;ENSP00000385428:E778Q;ENSP00000339666:E113Q;ENSP00000385090:E778Q	ENSP00000339666:E113Q	E	-	1	0	NLRC4	32319624	0.066000	0.20996	0.968000	0.41197	0.338000	0.28826	0.700000	0.25601	2.306000	0.77630	0.467000	0.42956	GAA	.	.		0.358	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
GLI2	2736	hgsc.bcm.edu	37	2	121726310	121726310	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:121726310C>T	ENST00000452319.1	+	6	724	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.R222W					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTCCAGCCCGCGGGTGACGCC	0.642																																					p.R222W		Atlas-SNP	.											.	GLI2	187	.	0			c.C664T						.						61.0	61.0	61.0					2																	121726310		2203	4300	6503	SO:0001583	missense	2736	exon5			AGCCCGCGGGTGA		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.664C>T	chr2.hg19:g.121726310C>T	ENSP00000390436:p.Arg222Trp	30.0	0.0		102.0	11.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	hg19	CCDS33283.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.82|16.82	3.228879|3.228879	0.58777|0.58777	.|.	.|.	ENSG00000074047|ENSG00000074047	ENST00000440937;ENST00000360874|ENST00000452319;ENST00000361492	.|T;T	.|0.71341	.|-0.56;-0.56	4.91|4.91	4.01|4.01	0.46588|0.46588	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84529|0.84529	0.5492|0.5492	M|M	0.85777|0.85777	2.775|2.775	0.80722|0.80722	D|D	1|1	B|D;D	0.26975|0.89917	0.165|1.0;1.0	B|D;D	0.22152|0.91635	0.038|0.999;0.998	D|D	0.86936|0.86936	0.2076|0.2076	8|10	0.72032|0.87932	D|D	0.01|0	.|.	13.1307|13.1307	0.59380|0.59380	0.3111:0.6889:0.0:0.0|0.3111:0.6889:0.0:0.0	.|.	92|222;222	F5H4D9|P10070;Q0VGA0	.|GLI2_HUMAN;.	V|W	92;84|222	.|ENSP00000390436:R222W;ENSP00000354586:R222W	ENSP00000441454:A84V|ENSP00000354586:R222W	A|R	+|+	2|1	0|2	GLI2|GLI2	121442780|121442780	0.058000|0.058000	0.20735|0.20735	0.713000|0.713000	0.30519|0.30519	0.597000|0.597000	0.36814|0.36814	0.436000|0.436000	0.21526|0.21526	1.250000|1.250000	0.43966|0.43966	-0.274000|-0.274000	0.10170|0.10170	GCG|CGG	.	.		0.642	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
LRP1B	53353	hgsc.bcm.edu	37	2	141264466	141264466	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:141264466T>G	ENST00000389484.3	-	53	9391	c.8420A>C	c.(8419-8421)gAa>gCa	p.E2807A		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2807	LDL-receptor class A 18. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAAAGCATTTTCATCACATGT	0.388										TSP Lung(27;0.18)																											p.E2807A	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A8420C						.						122.0	113.0	116.0					2																	141264466		2203	4300	6503	SO:0001583	missense	53353	exon53			GCATTTTCATCAC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8420A>C	chr2.hg19:g.141264466T>G	ENSP00000374135:p.Glu2807Ala	99.0	0.0		185.0	79.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123766	0.56613	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.40756	1.02	5.65	3.29	0.37713	.	0.067036	0.64402	D	0.000015	T	0.25232	0.0613	N	0.13235	0.315	0.43000	D	0.994512	B	0.31125	0.309	B	0.37550	0.253	T	0.03957	-1.0989	10	0.10111	T	0.7	.	9.6567	0.39930	0.0:0.1409:0.0:0.8591	.	2807	Q9NZR2	LRP1B_HUMAN	A	2807;2745	ENSP00000374135:E2807A	ENSP00000374135:E2807A	E	-	2	0	LRP1B	140980936	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	3.256000	0.51492	0.966000	0.38159	0.533000	0.62120	GAA	.	.		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
NEB	4703	hgsc.bcm.edu	37	2	152552146	152552146	+	Silent	SNP	G	G	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:152552146G>C	ENST00000172853.10	-	18	1767	c.1620C>G	c.(1618-1620)ccC>ccG	p.P540P	NEB_ENST00000409198.1_Silent_p.P540P|NEB_ENST00000427231.2_Silent_p.P540P|NEB_ENST00000603639.1_Silent_p.P540P|NEB_ENST00000604864.1_Silent_p.P540P|NEB_ENST00000397345.3_Silent_p.P540P			P20929	NEBU_HUMAN	nebulin	540					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GAGTATCAGGGGGGATATGGC	0.388																																					p.P540P		Atlas-SNP	.											.	NEB	1697	.	0			c.C1620G						.						132.0	129.0	130.0					2																	152552146		1906	4128	6034	SO:0001819	synonymous_variant	4703	exon18			ATCAGGGGGGATA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1620C>G	chr2.hg19:g.152552146G>C		111.0	0.0		167.0	16.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	hg19																																																																																				.	.		0.388	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TTN	7273	hgsc.bcm.edu	37	2	179588199	179588199	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:179588199C>T	ENST00000591111.1	-	72	20901	c.20677G>A	c.(20677-20679)Gtg>Atg	p.V6893M	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.V7210M|TTN_ENST00000342992.6_Missense_Mutation_p.V5966M|RP11-171I2.1_ENST00000590024.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12484	Ig-like 50.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAGAAACCACACAGGTGTAT	0.418																																					p.V7210M		Atlas-SNP	.											.	TTN	18412	.	0			c.G21628A						.						81.0	80.0	80.0					2																	179588199		1916	4137	6053	SO:0001583	missense	7273	exon74			AAACCACACAGGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20677G>A	chr2.hg19:g.179588199C>T	ENSP00000465570:p.Val6893Met	93.0	0.0		118.0	38.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	7.445	0.641575	0.14451	.	.	ENSG00000155657	ENST00000342992	T	0.68765	-0.35	6.06	4.21	0.49690	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67126	0.2860	L	0.59436	1.845	0.80722	D	1	B	0.33826	0.427	B	0.40782	0.34	T	0.70992	-0.4721	9	0.87932	D	0	.	12.0719	0.53622	0.0:0.7074:0.2235:0.0691	.	6893	Q8WZ42	TITIN_HUMAN	M	5966	ENSP00000343764:V5966M	ENSP00000343764:V5966M	V	-	1	0	TTN	179296444	0.881000	0.30235	1.000000	0.80357	0.802000	0.45316	0.181000	0.16880	1.574000	0.49760	0.650000	0.86243	GTG	.	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179638382	179638382	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:179638382C>A	ENST00000591111.1	-	32	7625	c.7401G>T	c.(7399-7401)aaG>aaT	p.K2467N	TTN_ENST00000359218.5_Missense_Mutation_p.K2421N|TTN_ENST00000460472.2_Missense_Mutation_p.K2421N|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K2421N|TTN_ENST00000589042.1_Missense_Mutation_p.K2467N|TTN_ENST00000342992.6_Missense_Mutation_p.K2467N|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.K2467N|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12789	Ig-like 14.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGACTGACACCTTACATTCAA	0.418																																					p.K2467N		Atlas-SNP	.											.	TTN	18412	.	0			c.G7401T						.						103.0	96.0	98.0					2																	179638382		2203	4300	6503	SO:0001583	missense	7273	exon32			TGACACCTTACAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7401G>T	chr2.hg19:g.179638382C>A	ENSP00000465570:p.Lys2467Asn	126.0	0.0		263.0	15.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	9.719	1.159063	0.21454	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.82	0.456	0.16655	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78362	0.4271	M	0.70595	2.14	0.25367	N	0.988738	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999	T	0.67608	-0.5627	9	0.87932	D	0	.	10.7519	0.46213	0.0:0.5099:0.0:0.4901	.	2421;2421;2421;2467;2467	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	2467;2421;2421;2421;2421;2467	ENSP00000343764:K2467N;ENSP00000434586:K2421N;ENSP00000340554:K2421N;ENSP00000352154:K2421N;ENSP00000354117:K2467N	ENSP00000340554:K2421N	K	-	3	2	TTN	179346627	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	1.156000	0.31712	0.126000	0.18424	-0.133000	0.14855	AAG	.	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179659228	179659228	+	Silent	SNP	G	G	C	rs549880126		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:179659228G>C	ENST00000591111.1	-	8	1520	c.1296C>G	c.(1294-1296)gcC>gcG	p.A432A	TTN_ENST00000359218.5_Silent_p.A432A|TTN_ENST00000460472.2_Silent_p.A432A|TTN_ENST00000342175.6_Silent_p.A432A|TTN_ENST00000589042.1_Silent_p.A432A|TTN_ENST00000342992.6_Silent_p.A432A|TTN_ENST00000360870.5_Silent_p.A432A			Q8WZ42	TITIN_HUMAN	titin	0	Ala-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCATATCAACGGCAGCAACAA	0.468																																					p.A432A		Atlas-SNP	.											.	TTN	18412	.	0			c.C1296G						.						147.0	134.0	138.0					2																	179659228		2203	4300	6503	SO:0001819	synonymous_variant	7273	exon8			ATCAACGGCAGCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1296C>G	chr2.hg19:g.179659228G>C		71.0	0.0		100.0	38.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TOP2B	7155	hgsc.bcm.edu	37	3	25665077	25665077	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:25665077G>A	ENST00000264331.4	-	21	2655	c.2656C>T	c.(2656-2658)Ccc>Tcc	p.P886S	TOP2B_ENST00000435706.2_Missense_Mutation_p.P881S	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	886					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TCATAGTTGGGTAGTTTACAA	0.388																																					p.P881S		Atlas-SNP	.											TOP2B,caecum,carcinoma,0,1	TOP2B	98	.	0			c.C2641T						.						121.0	115.0	117.0					3																	25665077		1921	4137	6058	SO:0001583	missense	7155	exon21			AGTTGGGTAGTTT	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.2656C>T	chr3.hg19:g.25665077G>A	ENSP00000264331:p.Pro886Ser	135.0	0.0		277.0	65.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	hg19		.	.	.	.	.	.	.	.	.	.	G	31	5.071559	0.93950	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.57907	0.37;0.37	5.64	5.64	0.86602	.	0.045861	0.85682	D	0.000000	T	0.75946	0.3919	M	0.89534	3.04	0.80722	D	1	D	0.60160	0.987	P	0.57846	0.828	T	0.80099	-0.1524	10	0.62326	D	0.03	-7.3621	20.0639	0.97700	0.0:0.0:1.0:0.0	.	881	Q02880-2	.	S	881;886;881	ENSP00000396704:P881S;ENSP00000264331:P886S	ENSP00000264331:P886S	P	-	1	0	TOP2B	25640081	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	9.766000	0.98957	2.817000	0.96982	0.557000	0.71058	CCC	.	.		0.388	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
OXSM	54995	hgsc.bcm.edu	37	3	25835782	25835782	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:25835782G>T	ENST00000280701.3	+	3	1276	c.1177G>T	c.(1177-1179)Gtc>Ttc	p.V393F	OXSM_ENST00000420173.2_Missense_Mutation_p.V310F	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	393					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						TGCAGGGGCAGTCGAGGCAGC	0.433																																					p.V393F		Atlas-SNP	.											.	OXSM	54	.	0			c.G1177T						.						99.0	99.0	99.0					3																	25835782		2203	4300	6503	SO:0001583	missense	54995	exon3			GGGGCAGTCGAGG	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.1177G>T	chr3.hg19:g.25835782G>T	ENSP00000280701:p.Val393Phe	89.0	0.0		122.0	18.0	NM_017897		Missense_Mutation	SNP	ENST00000280701.3	hg19	CCDS2643.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677468	0.47886	.	.	ENSG00000151093	ENST00000280701;ENST00000420173	.	.	.	5.52	1.6	0.23607	Beta-ketoacyl synthase, C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.545762	0.19448	N	0.114004	T	0.50343	0.1610	M	0.64260	1.97	0.09310	N	1	D;P	0.71674	0.998;0.65	D;P	0.67382	0.951;0.751	T	0.41052	-0.9530	9	0.72032	D	0.01	-4.6058	1.3158	0.02107	0.2565:0.2619:0.3475:0.1341	.	310;393	Q9NWU1-2;Q9NWU1	.;OXSM_HUMAN	F	393;310	.	ENSP00000280701:V393F	V	+	1	0	OXSM	25810786	0.018000	0.18449	0.000000	0.03702	0.573000	0.36030	1.037000	0.30241	0.299000	0.22661	0.655000	0.94253	GTC	.	.		0.433	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897	
PRSS50	29122	hgsc.bcm.edu	37	3	46755769	46755769	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:46755769G>A	ENST00000460241.1	-	9	2363	c.693C>T	c.(691-693)gaC>gaT	p.D231D	PRSS50_ENST00000315170.7_Silent_p.D231D			Q9UI38	TSP50_HUMAN	protease, serine, 50	231	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						TCAACACATAGTCCGTGCCAG	0.607																																					p.D231D	Pancreas(41;915 1239 11561 17469)	Atlas-SNP	.											.	PRSS50	35	.	0			c.C693T						.						124.0	93.0	103.0					3																	46755769		2203	4300	6503	SO:0001819	synonymous_variant	29122	exon4			CACATAGTCCGTG	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.693C>T	chr3.hg19:g.46755769G>A		50.0	0.0		86.0	61.0	NM_013270		Silent	SNP	ENST00000460241.1	hg19	CCDS2745.1																																																																																			.	.		0.607	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
KLHL18	23276	hgsc.bcm.edu	37	3	47371491	47371491	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:47371491T>C	ENST00000232766.5	+	4	472	c.452T>C	c.(451-453)aTg>aCg	p.M151T	KLHL18_ENST00000455924.2_Missense_Mutation_p.M39T	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	151	BACK.									endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GAGACAATGATGTGTGCTGTG	0.488																																					p.M151T		Atlas-SNP	.											.	KLHL18	46	.	0			c.T452C						.						120.0	118.0	119.0					3																	47371491		2203	4300	6503	SO:0001583	missense	23276	exon4			CAATGATGTGTGC	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.452T>C	chr3.hg19:g.47371491T>C	ENSP00000232766:p.Met151Thr	49.0	0.0		123.0	19.0	NM_025010	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	hg19	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617891	0.66787	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	T;T	0.67523	-0.27;-0.27	4.94	4.94	0.65067	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.64962	0.2646	N	0.25245	0.725	0.80722	D	1	D;P;P	0.58970	0.984;0.458;0.902	P;B;P	0.58620	0.842;0.183;0.52	T	0.61088	-0.7133	10	0.21014	T	0.42	.	13.5678	0.61828	0.0:0.0:0.0:1.0	.	2;151;86	Q647K1;O94889;O94889-2	.;KLH18_HUMAN;.	T	151;39	ENSP00000232766:M151T;ENSP00000405585:M39T	ENSP00000232766:M151T	M	+	2	0	KLHL18	47346495	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.903000	0.69877	2.085000	0.62840	0.383000	0.25322	ATG	.	.		0.488	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
MST1R	4486	hgsc.bcm.edu	37	3	49936589	49936589	+	Silent	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:49936589T>C	ENST00000296474.3	-	2	1365	c.1338A>G	c.(1336-1338)gtA>gtG	p.V446V	CTD-2330K9.2_ENST00000435478.1_RNA|MST1R_ENST00000344206.4_Silent_p.V446V	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	446	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CAGTGACCTGTACTGGTCCCA	0.572																																					p.V446V		Atlas-SNP	.											.	MST1R	205	.	0			c.A1338G						.						208.0	182.0	191.0					3																	49936589		2203	4300	6503	SO:0001819	synonymous_variant	4486	exon2			GACCTGTACTGGT	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1338A>G	chr3.hg19:g.49936589T>C		63.0	0.0		109.0	12.0	NM_001244937	B5A944|B5A945|B5A946|B5A947	Silent	SNP	ENST00000296474.3	hg19	CCDS2807.1																																																																																			.	.		0.572	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
ATXN7	6314	hgsc.bcm.edu	37	3	63975996	63975996	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:63975996G>T	ENST00000295900.6	+	10	2056	c.1506G>T	c.(1504-1506)gaG>gaT	p.E502D	ATXN7_ENST00000538065.1_Missense_Mutation_p.E502D|ATXN7_ENST00000398590.3_Missense_Mutation_p.E502D|ATXN7_ENST00000484332.1_Missense_Mutation_p.E357D|ATXN7_ENST00000487717.1_Missense_Mutation_p.E502D	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	502					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		ACAAAGAAGAGTCTGTTGAAA	0.552																																					p.E502D		Atlas-SNP	.											.	ATXN7	126	.	0			c.G1506T						.						106.0	113.0	111.0					3																	63975996		2055	4199	6254	SO:0001583	missense	6314	exon10			AGAAGAGTCTGTT	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.1506G>T	chr3.hg19:g.63975996G>T	ENSP00000295900:p.Glu502Asp	57.0	0.0		110.0	19.0	NM_000333	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	hg19	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759417	0.69763	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.91	4.86	0.63082	.	0.165282	0.56097	D	0.000035	T	0.56247	0.1972	L	0.45422	1.42	0.58432	D	0.999997	P;P;D	0.69078	0.603;0.724;0.997	B;B;D	0.79108	0.089;0.183;0.992	T	0.52366	-0.8585	10	0.45353	T	0.12	-16.3957	15.9733	0.80036	0.0746:0.0:0.9254:0.0	.	357;502;502	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	D	502;502;502;502;357	ENSP00000381590:E502D;ENSP00000295900:E502D;ENSP00000420234:E502D;ENSP00000439585:E502D;ENSP00000428277:E357D	ENSP00000295900:E502D	E	+	3	2	ATXN7	63951036	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.495000	0.35627	2.808000	0.96608	0.655000	0.94253	GAG	.	.		0.552	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64084858	64084858	+	Silent	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:64084858G>T	ENST00000295902.6	-	8	2989	c.2404C>A	c.(2404-2406)Cga>Aga	p.R802R	PRICKLE2-AS1_ENST00000460946.1_RNA|PRICKLE2_ENST00000564377.1_Silent_p.R858R|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	802					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R802*(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GTGACGTATCGCAGGCGCGCT	0.552																																					p.R802R		Atlas-SNP	.											PRICKLE2,NS,carcinoma,0,1	PRICKLE2	88	.	1	Substitution - Nonsense(1)	prostate(1)	c.C2404A						.						88.0	86.0	87.0					3																	64084858		2203	4300	6503	SO:0001819	synonymous_variant	166336	exon8			CGTATCGCAGGCG	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2404C>A	chr3.hg19:g.64084858G>T		80.0	0.0		119.0	19.0	NM_198859	Q0VF44	Silent	SNP	ENST00000295902.6	hg19	CCDS2902.1																																																																																			.	.		0.552	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
GSK3B	2932	hgsc.bcm.edu	37	3	119635000	119635000	+	Nonsense_Mutation	SNP	G	G	A	rs201787969		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:119635000G>A	ENST00000264235.8	-	5	1481	c.499C>T	c.(499-501)Cga>Tga	p.R167*	GSK3B_ENST00000316626.5_Nonsense_Mutation_p.R167*	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	167	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	GCTAAACTTCGGAACAGCTGA	0.348																																					p.R167X		Atlas-SNP	.											GSK3B_ENST00000316626,NS,carcinoma,0,2	GSK3B	119	.	0			c.C499T						.						81.0	84.0	83.0					3																	119635000		2203	4300	6503	SO:0001587	stop_gained	2932	exon5			AACTTCGGAACAG	BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.499C>T	chr3.hg19:g.119635000G>A	ENSP00000264235:p.Arg167*	47.0	0.0		77.0	8.0	NM_002093	D3DN89|Q9BWH3|Q9UL47	Nonsense_Mutation	SNP	ENST00000264235.8	hg19	CCDS54628.1	.	.	.	.	.	.	.	.	.	.	G	37	6.481761	0.97603	.	.	ENSG00000082701	ENST00000264235;ENST00000316626	.	.	.	4.89	2.99	0.34606	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0915	13.4517	0.61174	0.0:0.0:0.6701:0.3299	.	.	.	.	X	167	.	ENSP00000264235:R167X	R	-	1	2	GSK3B	121117690	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.621000	0.54210	0.684000	0.31448	0.563000	0.77884	CGA	.	.		0.348	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2		
DNAJB8	165721	hgsc.bcm.edu	37	3	128181899	128181899	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:128181899G>A	ENST00000469083.1	-	2	2747	c.190C>T	c.(190-192)Ctg>Ttg	p.L64L	DNAJB8-AS1_ENST00000471626.1_RNA|DNAJB8_ENST00000319153.3_Silent_p.L64L			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	64	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		CGGTCATACAGGGAGCGTTTC	0.602																																					p.L64L		Atlas-SNP	.											.	DNAJB8	34	.	0			c.C190T						.						126.0	127.0	126.0					3																	128181899		2203	4300	6503	SO:0001819	synonymous_variant	165721	exon3			CATACAGGGAGCG		CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.190C>T	chr3.hg19:g.128181899G>A		56.0	0.0		120.0	14.0	NM_153330	B3KWV7	Silent	SNP	ENST00000469083.1	hg19	CCDS3048.1																																																																																			.	.		0.602	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330	
PLXND1	23129	hgsc.bcm.edu	37	3	129303388	129303388	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:129303388G>A	ENST00000324093.4	-	6	2047	c.1869C>T	c.(1867-1869)atC>atT	p.I623I	PLXND1_ENST00000393239.1_Silent_p.I623I	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	623					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GGCTGCCCGAGATCTGCAGGA	0.647																																					p.I623I	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.C1869T						.						59.0	57.0	57.0					3																	129303388		2203	4300	6503	SO:0001819	synonymous_variant	23129	exon6			GCCCGAGATCTGC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1869C>T	chr3.hg19:g.129303388G>A		35.0	0.0		92.0	41.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	ENST00000324093.4	hg19	CCDS33854.1																																																																																			.	.		0.647	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
SLCO2A1	6578	hgsc.bcm.edu	37	3	133673915	133673915	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:133673915C>T	ENST00000310926.4	-	4	793	c.520G>A	c.(520-522)Gtg>Atg	p.V174M	SLCO2A1_ENST00000493729.1_Intron|SLCO2A1_ENST00000478651.1_5'Flank	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	174					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	TGGGCAACCACCATCAGGCCC	0.597																																					p.V174M		Atlas-SNP	.											.	SLCO2A1	72	.	0			c.G520A						.						71.0	71.0	71.0					3																	133673915		2203	4300	6503	SO:0001583	missense	6578	exon4			CAACCACCATCAG		CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.520G>A	chr3.hg19:g.133673915C>T	ENSP00000311291:p.Val174Met	59.0	0.0		131.0	56.0	NM_005630	Q86V98|Q8IUN2	Missense_Mutation	SNP	ENST00000310926.4	hg19	CCDS3084.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.542741	0.45280	.	.	ENSG00000174640	ENST00000310926	T	0.59906	0.23	5.89	4.1	0.47936	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.146813	0.64402	N	0.000009	T	0.67411	0.2890	L	0.45470	1.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	T	0.67086	-0.5759	10	0.56958	D	0.05	.	11.0765	0.48034	0.1296:0.8042:0.0:0.0662	.	174;174	F8W9W8;Q92959	.;SO2A1_HUMAN	M	174	ENSP00000311291:V174M	ENSP00000311291:V174M	V	-	1	0	SLCO2A1	135156605	1.000000	0.71417	0.995000	0.50966	0.053000	0.15095	7.518000	0.81795	0.826000	0.34661	-0.314000	0.08810	GTG	.	.		0.597	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357131.1	NM_005630	
PHC3	80012	hgsc.bcm.edu	37	3	169846627	169846627	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:169846627G>C	ENST00000494943.1	-	8	1665	c.1597C>G	c.(1597-1599)Cag>Gag	p.Q533E	PHC3_ENST00000467570.1_Missense_Mutation_p.Q492E|PHC3_ENST00000495893.2_Missense_Mutation_p.Q545E			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	533	Gln-rich.|Pro-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			ACCTGGCCCTGGGACAGAATT	0.512																																					p.Q545E		Atlas-SNP	.											.	PHC3	113	.	0			c.C1633G						.						129.0	131.0	131.0					3																	169846627		1947	4141	6088	SO:0001583	missense	80012	exon8			GGCCCTGGGACAG		CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.1597C>G	chr3.hg19:g.169846627G>C	ENSP00000420271:p.Gln533Glu	64.0	0.0		86.0	31.0	NM_024947	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	ENST00000494943.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.99	2.995155	0.54147	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000467570	T;T	0.31769	1.48;1.48	5.69	5.69	0.88448	.	0.189604	0.37136	N	0.002223	T	0.38268	0.1034	L	0.36672	1.1	0.80722	D	1	P;B;P;B	0.43578	0.811;0.187;0.713;0.091	P;B;P;B	0.54924	0.764;0.152;0.68;0.068	T	0.02639	-1.1130	10	0.02654	T	1	-1.2302	19.8034	0.96518	0.0:0.0:1.0:0.0	.	492;492;533;545	B4E2T1;E7EX82;Q8NDX5;Q8NDX5-7	.;.;PHC3_HUMAN;.	E	533;545;492	ENSP00000420271:Q533E;ENSP00000420294:Q545E	ENSP00000419089:Q492E	Q	-	1	0	PHC3	171329321	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.081000	0.64444	2.670000	0.90874	0.563000	0.77884	CAG	.	.		0.512	PHC3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000352182.3	NM_024947	
CC2D2A	57545	hgsc.bcm.edu	37	4	15601277	15601277	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:15601277A>G	ENST00000503292.1	+	37	4802	c.4622A>G	c.(4621-4623)gAt>gGt	p.D1541G	CC2D2A_ENST00000389652.5_Missense_Mutation_p.D1433G|CC2D2A_ENST00000413206.1_Missense_Mutation_p.D1541G|CC2D2A_ENST00000424120.1_Missense_Mutation_p.D1541G	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	1541					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						CAAGGAGAAGATGTAGAAGAT	0.448																																					p.D1541G		Atlas-SNP	.											.	CC2D2A	158	.	0			c.A4622G						.						75.0	70.0	72.0					4																	15601277		1920	4141	6061	SO:0001583	missense	57545	exon37			GAGAAGATGTAGA	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.4622A>G	chr4.hg19:g.15601277A>G	ENSP00000421809:p.Asp1541Gly	109.0	0.0		273.0	20.0	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	hg19	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	A	9.556	1.117098	0.20795	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.75	3.26	0.37387	.	0.126124	0.51477	D	0.000086	T	0.61451	0.2348	L	0.56396	1.775	0.80722	D	1	B;B	0.13594	0.008;0.001	B;B	0.15870	0.014;0.006	T	0.50642	-0.8804	10	0.17832	T	0.49	.	8.5037	0.33175	0.8009:0.1314:0.0677:0.0	.	1541;1433	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	G	1541;1541;1433;1433;1541;1433	ENSP00000403465:D1541G;ENSP00000398391:D1541G;ENSP00000421809:D1541G;ENSP00000374303:D1433G	ENSP00000374303:D1433G	D	+	2	0	CC2D2A	15210375	0.999000	0.42202	0.276000	0.24689	0.376000	0.30014	4.146000	0.58072	0.427000	0.26145	0.528000	0.53228	GAT	.	.		0.448	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
PPARGC1A	10891	hgsc.bcm.edu	37	4	23815325	23815325	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:23815325C>A	ENST00000264867.2	-	8	1900	c.1781G>T	c.(1780-1782)aGa>aTa	p.R594I	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	594	Arg/Ser-rich.|Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TGAAGAGGATCTACTGCCTGG	0.403																																					p.R594I	Esophageal Squamous(29;694 744 13796 34866 44181)	Atlas-SNP	.											.	PPARGC1A	129	.	0			c.G1781T						.						60.0	61.0	61.0					4																	23815325		2203	4300	6503	SO:0001583	missense	10891	exon8			GAGGATCTACTGC	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1781G>T	chr4.hg19:g.23815325C>A	ENSP00000264867:p.Arg594Ile	52.0	0.0		52.0	9.0	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	hg19	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313073	0.60414	.	.	ENSG00000109819	ENST00000264867	T	0.40225	1.04	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	M	0.78049	2.395	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.65849	-0.6068	10	0.51188	T	0.08	-5.1764	20.8598	0.99761	0.0:1.0:0.0:0.0	.	594	Q9UBK2	PRGC1_HUMAN	I	594	ENSP00000264867:R594I	ENSP00000264867:R594I	R	-	2	0	PPARGC1A	23424423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.684000	0.74538	2.937000	0.99478	0.650000	0.86243	AGA	.	.		0.403	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
BEND4	389206	hgsc.bcm.edu	37	4	42145706	42145706	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:42145706G>T	ENST00000502486.1	-	3	1372	c.793C>A	c.(793-795)Cca>Aca	p.P265T	BEND4_ENST00000504360.1_Missense_Mutation_p.P261T	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	265										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						GAGGGGTTTGGAGTTGGAAAG	0.488																																					p.P265T		Atlas-SNP	.											.	BEND4	67	.	0			c.C793A						.						87.0	88.0	88.0					4																	42145706		1909	4114	6023	SO:0001583	missense	389206	exon3			GGTTTGGAGTTGG	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.793C>A	chr4.hg19:g.42145706G>T	ENSP00000421169:p.Pro265Thr	78.0	0.0		158.0	11.0	NM_001159547	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	hg19	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	G	6.044	0.376490	0.11466	.	.	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.52	2.77	0.32553	.	0.317042	0.35067	N	0.003470	T	0.35307	0.0927	N	0.08118	0	0.35096	D	0.764746	B;B;B	0.26547	0.152;0.094;0.152	B;B;B	0.27500	0.08;0.023;0.08	T	0.37244	-0.9714	9	0.54805	T	0.06	-15.8412	16.5549	0.84482	0.0:0.3682:0.6318:0.0	.	187;265;265	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	T	136;265;261	.	ENSP00000412495:P136T	P	-	1	0	BEND4	41840463	1.000000	0.71417	0.062000	0.19696	0.001000	0.01503	3.989000	0.56958	0.259000	0.21709	-0.175000	0.13238	CCA	.	.		0.488	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
HERC3	8916	hgsc.bcm.edu	37	4	89591339	89591339	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:89591339A>T	ENST00000402738.1	+	16	2086	c.1847A>T	c.(1846-1848)gAg>gTg	p.E616V	HERC3_ENST00000543130.1_Missense_Mutation_p.E60V|HERC3_ENST00000264345.3_Missense_Mutation_p.E616V	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	616					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TACATTCCTGAGATTTCCAAT	0.363																																					p.E616V		Atlas-SNP	.											.	HERC3	82	.	0			c.A1847T						.						134.0	129.0	131.0					4																	89591339		2203	4300	6503	SO:0001583	missense	8916	exon16			TTCCTGAGATTTC	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1847A>T	chr4.hg19:g.89591339A>T	ENSP00000385684:p.Glu616Val	82.0	0.0		89.0	31.0	NM_014606	A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	hg19	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.602872	0.87157	.	.	ENSG00000138641	ENST00000402738;ENST00000264345;ENST00000543130;ENST00000512194	T;T;T;T	0.75260	0.82;0.82;1.13;-0.92	4.68	4.68	0.58851	.	0.051936	0.85682	D	0.000000	D	0.82435	0.5036	L	0.61036	1.89	0.80722	D	1	D	0.67145	0.996	P	0.62649	0.905	D	0.84386	0.0552	10	0.62326	D	0.03	.	14.5861	0.68326	1.0:0.0:0.0:0.0	.	616	Q15034	HERC3_HUMAN	V	616;616;60;17	ENSP00000385684:E616V;ENSP00000264345:E616V;ENSP00000441703:E60V;ENSP00000421021:E17V	ENSP00000264345:E616V	E	+	2	0	HERC3	89810362	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.709000	0.91379	2.092000	0.63282	0.482000	0.46254	GAG	.	.		0.363	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
FAT4	79633	hgsc.bcm.edu	37	4	126369855	126369855	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:126369855G>A	ENST00000394329.3	+	9	7697	c.7684G>A	c.(7684-7686)Gcc>Acc	p.A2562T	FAT4_ENST00000335110.5_Missense_Mutation_p.A860T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2562	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CGTGAATAAGGCCGATTTCCC	0.423																																					p.A2562T		Atlas-SNP	.											.	FAT4	1752	.	0			c.G7684A						.						79.0	78.0	78.0					4																	126369855		2203	4298	6501	SO:0001583	missense	79633	exon9			AATAAGGCCGATT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7684G>A	chr4.hg19:g.126369855G>A	ENSP00000377862:p.Ala2562Thr	42.0	0.0		25.0	12.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368545	0.61624	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.60797	0.16;0.16	5.92	5.92	0.95590	Cadherin (2);	0.000000	0.34088	U	0.004277	T	0.68531	0.3011	M	0.62266	1.93	0.58432	D	0.999997	P;P;P	0.50272	0.933;0.709;0.808	P;B;B	0.51582	0.674;0.133;0.26	T	0.68017	-0.5520	10	0.52906	T	0.07	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	860;2562;2562	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	T	2562;860	ENSP00000377862:A2562T;ENSP00000335169:A860T	ENSP00000335169:A860T	A	+	1	0	FAT4	126589305	1.000000	0.71417	0.997000	0.53966	0.841000	0.47740	9.666000	0.98612	2.822000	0.97130	0.650000	0.86243	GCC	.	.		0.423	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	hgsc.bcm.edu	37	4	126371628	126371628	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:126371628G>C	ENST00000394329.3	+	9	9470	c.9457G>C	c.(9457-9459)Gat>Cat	p.D3153H	FAT4_ENST00000335110.5_Missense_Mutation_p.D1451H	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3153	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAAAGCTCTTGATTATGAGCT	0.388																																					p.D3153H		Atlas-SNP	.											.	FAT4	1752	.	0			c.G9457C						.						80.0	81.0	81.0					4																	126371628		2203	4300	6503	SO:0001583	missense	79633	exon9			GCTCTTGATTATG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9457G>C	chr4.hg19:g.126371628G>C	ENSP00000377862:p.Asp3153His	75.0	0.0		67.0	11.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814864	0.50527	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.04234	3.67;3.67	5.63	5.63	0.86233	Cadherin (4);Cadherin-like (1);	0.000000	0.35378	U	0.003259	T	0.41696	0.1170	H	0.99058	4.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.66081	-0.6012	10	0.87932	D	0	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	1451;3153;3153	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	H	3153;1451	ENSP00000377862:D3153H;ENSP00000335169:D1451H	ENSP00000335169:D1451H	D	+	1	0	FAT4	126591078	1.000000	0.71417	0.997000	0.53966	0.197000	0.23852	9.666000	0.98612	2.652000	0.90054	0.655000	0.94253	GAT	.	.		0.388	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
MAP9	79884	hgsc.bcm.edu	37	4	156289738	156289738	+	Splice_Site	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:156289738C>A	ENST00000311277.4	-	5	971	c.708G>T	c.(706-708)gaG>gaT	p.E236D	AC097467.2_ENST00000597831.1_RNA|AC097467.2_ENST00000598890.1_RNA|AC097467.2_ENST00000596165.1_RNA|MAP9_ENST00000379248.2_Missense_Mutation_p.E163D|AC097467.2_ENST00000600928.1_RNA|MAP9_ENST00000515654.1_Splice_Site_p.E236D	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	236					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TAGTGCTAACCTCAGGATCAA	0.373																																					p.E236D		Atlas-SNP	.											.	MAP9	79	.	0			c.G708T						.						99.0	90.0	93.0					4																	156289738		2203	4300	6503	SO:0001630	splice_region_variant	79884	exon5			GCTAACCTCAGGA	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.708+1G>T	chr4.hg19:g.156289738C>A		110.0	0.0		88.0	29.0	NM_001039580	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	hg19	CCDS35493.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444329	0.43429	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024;ENST00000393836;ENST00000379248	T;T;T;T	0.59224	1.21;1.86;0.5;0.28	5.09	4.23	0.50019	.	0.371784	0.23268	N	0.050055	T	0.66674	0.2813	M	0.66939	2.045	0.32156	N	0.58356	P;D;P;P	0.65815	0.877;0.995;0.787;0.787	P;P;B;B	0.57371	0.464;0.819;0.218;0.218	T	0.73751	-0.3884	10	0.66056	D	0.02	-1.4673	10.0248	0.42066	0.0:0.9011:0.0:0.0989	.	235;163;236;236	B4DVG9;A8MSM7;B9EJB6;Q49MG5	.;.;.;MAP9_HUMAN	D	236;236;235;236;163	ENSP00000310593:E236D;ENSP00000427402:E236D;ENSP00000394048:E235D;ENSP00000368550:E163D	ENSP00000310593:E236D	E	-	3	2	MAP9	156509188	1.000000	0.71417	0.986000	0.45419	0.134000	0.20937	2.641000	0.46587	2.520000	0.84964	0.467000	0.42956	GAG	.	.		0.373	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	Missense_Mutation
CBR4	84869	hgsc.bcm.edu	37	4	169923357	169923357	+	Splice_Site	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr4:169923357C>G	ENST00000306193.3	-	4	569		c.e4-1		CBR4_ENST00000504480.1_Splice_Site|CBR4_ENST00000509108.1_Splice_Site	NM_032783.4	NP_116172.2	Q8N4T8	CBR4_HUMAN	carbonyl reductase 4						daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|fatty acid biosynthetic process (GO:0006633)|protein homotetramerization (GO:0051289)	mitochondrial matrix (GO:0005759)	NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|NADPH binding (GO:0070402)|NADPH dehydrogenase (quinone) activity (GO:0008753)|quinone binding (GO:0048038)			kidney(1)|large_intestine(2)|lung(2)	5		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		ACAATGCTTCCTAGGACaaaa	0.328																																					.		Atlas-SNP	.											.	CBR4	15	.	0			c.401-1G>C						.						29.0	29.0	29.0					4																	169923357		2201	4299	6500	SO:0001630	splice_region_variant	84869	exon5			TGCTTCCTAGGAC	BC021973	CCDS3812.1	4q32.3	2013-10-11			ENSG00000145439	ENSG00000145439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	25891	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 45C, member 1"""					19027726	Standard	NM_032783		Approved	FLJ14431, SDR45C1	uc003iry.3	Q8N4T8	OTTHUMG00000161025	ENST00000306193.3:c.401-1G>C	chr4.hg19:g.169923357C>G		31.0	0.0		49.0	24.0	NM_032783	Q8WTW8|Q96K93	Splice_Site	SNP	ENST00000306193.3	hg19	CCDS3812.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941649	0.53079	.	.	ENSG00000145439	ENST00000306193;ENST00000504480;ENST00000504561	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4136	0.94685	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CBR4	170159932	1.000000	0.71417	0.999000	0.59377	0.806000	0.45545	6.134000	0.71689	2.596000	0.87737	0.305000	0.20034	.	.	.		0.328	CBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363441.2	NM_032783	Intron
EMB	133418	hgsc.bcm.edu	37	5	49724007	49724007	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr5:49724007G>A	ENST00000303221.5	-	2	382	c.167C>T	c.(166-168)tCc>tTc	p.S56F	EMB_ENST00000506190.1_5'UTR|EMB_ENST00000514111.1_Missense_Mutation_p.S6F|EMB_ENST00000508934.1_Missense_Mutation_p.S56F	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	56					cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)			breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				ACTCTCCAAGGAAAAGTTATT	0.318																																					p.S56F		Atlas-SNP	.											.	EMB	42	.	0			c.C167T						.						112.0	113.0	113.0					5																	49724007		2203	4300	6503	SO:0001583	missense	133418	exon2			TCCAAGGAAAAGT	BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.167C>T	chr5.hg19:g.49724007G>A	ENSP00000302289:p.Ser56Phe	55.0	0.0		78.0	16.0	NM_198449	B7Z6S3|B7Z902	Missense_Mutation	SNP	ENST00000303221.5	hg19	CCDS3953.1	.	.	.	.	.	.	.	.	.	.	G	9.241	1.038241	0.19669	.	.	ENSG00000170571	ENST00000303221;ENST00000508934;ENST00000514111	T;T;T	0.60424	0.73;0.19;0.68	4.2	4.2	0.49525	.	0.896581	0.09633	N	0.775980	T	0.59487	0.2197	L	0.27053	0.805	0.29338	N	0.866241	D;D	0.58970	0.984;0.984	P;P	0.57371	0.819;0.819	T	0.51601	-0.8685	9	.	.	.	-0.531	12.3678	0.55238	0.0:0.0:1.0:0.0	.	56;56	D6RDX7;Q6PCB8	.;EMB_HUMAN	F	56;56;6	ENSP00000302289:S56F;ENSP00000425215:S56F;ENSP00000426404:S6F	.	S	-	2	0	EMB	49759764	1.000000	0.71417	0.978000	0.43139	0.031000	0.12232	3.755000	0.55197	2.642000	0.89623	0.655000	0.94253	TCC	.	.		0.318	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253853.1	NM_198449	
MOCS2	4338	hgsc.bcm.edu	37	5	52405551	52405551	+	Silent	SNP	C	C	T	rs397518417		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr5:52405551C>T	ENST00000361377.4	-	1	50	c.9G>A	c.(7-9)ccG>ccA	p.P3P	MOCS2_ENST00000584946.1_Silent_p.P3P|MOCS2_ENST00000396954.3_5'UTR|CTD-2366F13.1_ENST00000512301.1_RNA|CTD-2366F13.1_ENST00000502171.2_RNA|CTD-2366F13.1_ENST00000499459.2_RNA|MOCS2_ENST00000450852.3_Silent_p.P3P|MOCS2_ENST00000510818.2_Silent_p.P3P|MOCS2_ENST00000508922.1_Silent_p.P3P|MOCS2_ENST00000582677.1_Silent_p.P3P|MOCS2_ENST00000527216.1_Intron					molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				CCTGGCACAGCGGCACCATCC	0.711																																					p.P3P		Atlas-SNP	.											.	MOCS2	28	.	0			c.G9A						.						13.0	23.0	20.0					5																	52405551		1968	3956	5924	SO:0001819	synonymous_variant	4338	exon1			GCACAGCGGCACC	AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000361377.4:c.9G>A	chr5.hg19:g.52405551C>T		31.0	0.0		49.0	19.0	NM_176806		Silent	SNP	ENST00000361377.4	hg19	CCDS47205.1																																																																																			.	.		0.711	MOCS2-004	KNOWN	alternative_3_UTR|NMD_exception|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000367796.3	NM_183418	
ANKRD32	84250	hgsc.bcm.edu	37	5	94025298	94025298	+	Missense_Mutation	SNP	G	G	T	rs367590507		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr5:94025298G>T	ENST00000265140.5	+	18	2825	c.2406G>T	c.(2404-2406)aaG>aaT	p.K802N		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	802						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		ATTTTCACAAGACTAATCTAA	0.323																																					p.K802N		Atlas-SNP	.											.	ANKRD32	117	.	0			c.G2406T						.						43.0	46.0	45.0					5																	94025298		2202	4298	6500	SO:0001583	missense	84250	exon18			TCACAAGACTAAT	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2406G>T	chr5.hg19:g.94025298G>T	ENSP00000265140:p.Lys802Asn	66.0	0.0		82.0	25.0	NM_032290	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	hg19	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062451	0.55432	.	.	ENSG00000133302	ENST00000265140	T	0.63913	-0.07	5.67	2.91	0.33838	Ankyrin repeat-containing domain (3);	0.066807	0.56097	D	0.000027	T	0.59569	0.2203	N	0.16567	0.415	0.30410	N	0.779197	D	0.76494	0.999	D	0.69824	0.966	T	0.58825	-0.7568	10	0.66056	D	0.02	.	6.5315	0.22330	0.2064:0.1303:0.6632:0.0	.	802	Q9BQI6	ANR32_HUMAN	N	802	ENSP00000265140:K802N	ENSP00000265140:K802N	K	+	3	2	ANKRD32	94051054	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.039000	0.30266	0.414000	0.25790	0.655000	0.94253	AAG	.	.		0.323	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
GRAMD3	65983	hgsc.bcm.edu	37	5	125759319	125759319	+	Silent	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr5:125759319T>C	ENST00000285689.3	+	1	482	c.21T>C	c.(19-21)gaT>gaC	p.D7D	GRAMD3_ENST00000513040.1_Intron|GRAMD3_ENST00000514932.1_3'UTR|GRAMD3_ENST00000544396.1_5'UTR|GRAMD3_ENST00000543198.1_Silent_p.D7D|GRAMD3_ENST00000542322.1_Start_Codon_SNP_p.M1T|GRAMD3_ENST00000515200.1_Silent_p.D7D	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	7						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		TACAGCAAGATGTGGAAGACA	0.612																																					p.M1T		Atlas-SNP	.											.	GRAMD3	30	.	0			c.T2C						.						67.0	63.0	64.0					5																	125759319		2203	4300	6503	SO:0001819	synonymous_variant	65983	exon1			GCAAGATGTGGAA	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.21T>C	chr5.hg19:g.125759319T>C		56.0	0.0		114.0	63.0	NM_001146321	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	hg19	CCDS4136.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.651935	0.29336	.	.	ENSG00000155324	ENST00000542322	T	0.33438	1.41	5.62	1.96	0.26148	.	.	.	.	.	T	0.22666	0.0547	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06734	-1.0810	8	0.87932	D	0	.	6.4038	0.21652	0.0:0.0849:0.3312:0.5839	.	1	B7Z3R1	.	T	1	ENSP00000441876:M1T	ENSP00000441876:M1T	M	+	2	0	GRAMD3	125787218	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	0.233000	0.17911	0.406000	0.25560	0.533000	0.62120	ATG	.	.		0.612	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	
DDX46	9879	hgsc.bcm.edu	37	5	134143603	134143603	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr5:134143603C>T	ENST00000354283.4	+	16	2255	c.2120C>T	c.(2119-2121)gCa>gTa	p.A707V	DDX46_ENST00000452510.2_Missense_Mutation_p.A707V			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	707	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTACACAGAGCAGGGCGGACT	0.383																																					p.A707V	Colon(13;391 453 4901 21675 24897)	Atlas-SNP	.											.	DDX46	77	.	0			c.C2120T						.						60.0	62.0	62.0					5																	134143603		2203	4300	6503	SO:0001583	missense	9879	exon16			ACAGAGCAGGGCG		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2120C>T	chr5.hg19:g.134143603C>T	ENSP00000346236:p.Ala707Val	77.0	0.0		90.0	24.0	NM_014829	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	ENST00000354283.4	hg19	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	C	9.778	1.174651	0.21704	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.75260	-0.92;-0.92	5.49	5.49	0.81192	Helicase, C-terminal (3);	0.045148	0.85682	D	0.000000	T	0.45296	0.1335	N	0.00572	-1.36	0.80722	D	1	B	0.15930	0.015	B	0.28139	0.086	T	0.56414	-0.7983	10	0.02654	T	1	-18.615	19.744	0.96245	0.0:1.0:0.0:0.0	.	707	Q7L014	DDX46_HUMAN	V	707	ENSP00000416534:A707V;ENSP00000346236:A707V	ENSP00000346236:A707V	A	+	2	0	DDX46	134171502	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.983000	0.70540	2.746000	0.94184	0.561000	0.74099	GCA	.	.		0.383	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
ARSI	340075	hgsc.bcm.edu	37	5	149677216	149677216	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr5:149677216C>T	ENST00000328668.7	-	2	1850	c.1271G>A	c.(1270-1272)tGg>tAg	p.W424*		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	424					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGCAGCTTCCACTCACCCAC	0.622																																					p.W424X		Atlas-SNP	.											.	ARSI	65	.	0			c.G1271A						.						34.0	38.0	36.0					5																	149677216		2203	4300	6503	SO:0001587	stop_gained	340075	exon2			AGCTTCCACTCAC	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1271G>A	chr5.hg19:g.149677216C>T	ENSP00000333395:p.Trp424*	35.0	0.0		66.0	24.0	NM_001012301	A1L3B0|B3KV22|B7XD03	Nonsense_Mutation	SNP	ENST00000328668.7	hg19	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	C	35	5.459116	0.96240	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	.	.	.	4.45	4.45	0.53987	.	0.121961	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.3903	0.55355	0.1682:0.8318:0.0:0.0	.	.	.	.	X	424;281	.	ENSP00000333395:W424X	W	-	2	0	ARSI	149657409	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.772000	0.68889	2.296000	0.77279	0.561000	0.74099	TGG	.	.		0.622	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
HDGFL1	154150	hgsc.bcm.edu	37	6	22570186	22570186	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:22570186G>A	ENST00000230012.3	+	1	509	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	HDGFL1_ENST00000510882.2_Missense_Mutation_p.E128K	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	128										kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					CGGCGGCGACGAATTGGGGAA	0.701																																					p.E128K		Atlas-SNP	.											.	HDGFL1	33	.	0			c.G382A						.						6.0	6.0	6.0					6																	22570186		2018	4000	6018	SO:0001583	missense	154150	exon1			GGCGACGAATTGG	AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.382G>A	chr6.hg19:g.22570186G>A	ENSP00000230012:p.Glu128Lys	28.0	0.0		94.0	38.0	NM_138574	Q96MJ6	Missense_Mutation	SNP	ENST00000230012.3	hg19	CCDS34347.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723361	0.30503	.	.	ENSG00000112273	ENST00000230012;ENST00000510882	T;T	0.33865	1.39;1.39	2.8	-3.49	0.04724	.	0.579894	0.16944	N	0.193177	T	0.08626	0.0214	L	0.45137	1.4	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.25152	-1.0140	10	0.40728	T	0.16	-12.1753	4.1988	0.10455	0.4156:0.3428:0.2416:0.0	.	128	Q5TGJ6	HDGL1_HUMAN	K	128	ENSP00000230012:E128K;ENSP00000442129:E128K	ENSP00000230012:E128K	E	+	1	0	HDGFL1	22678165	0.004000	0.15560	0.000000	0.03702	0.070000	0.16714	0.700000	0.25601	-0.950000	0.03659	0.491000	0.48974	GAA	.	.		0.701	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574	
HIST1H2BD	3017	hgsc.bcm.edu	37	6	26158595	26158595	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:26158595C>T	ENST00000289316.2	+	1	222	c.198C>T	c.(196-198)ttC>ttT	p.F66F	HIST1H2BD_ENST00000377777.4_Silent_p.F66F	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	66					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						TGAATTCCTTCGTCAACGACA	0.577																																					p.F66F		Atlas-SNP	.											.	HIST1H2BD	45	.	0			c.C198T						.						180.0	169.0	173.0					6																	26158595		2203	4300	6503	SO:0001819	synonymous_variant	3017	exon1			TTCCTTCGTCAAC	M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.198C>T	chr6.hg19:g.26158595C>T		106.0	0.0		202.0	26.0	NM_021063		Silent	SNP	ENST00000289316.2	hg19	CCDS4587.1																																																																																			.	.		0.577	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040088.1	NM_021063	
GABBR1	2550	hgsc.bcm.edu	37	6	29574930	29574930	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:29574930C>A	ENST00000377034.4	-	17	2393	c.2058G>T	c.(2056-2058)tgG>tgT	p.W686C	GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000355973.3_Missense_Mutation_p.W569C|GABBR1_ENST00000377012.4_Missense_Mutation_p.W569C|GABBR1_ENST00000377016.4_Missense_Mutation_p.W624C	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	686					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TGTGGACCCACCAAATCTTGG	0.577																																					p.W686C		Atlas-SNP	.											.	GABBR1	95	.	0			c.G2058T						.						114.0	110.0	111.0					6																	29574930		2203	4300	6503	SO:0001583	missense	2550	exon17			GACCCACCAAATC	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2058G>T	chr6.hg19:g.29574930C>A	ENSP00000366233:p.Trp686Cys	65.0	0.0		183.0	18.0	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.3|21.3	4.129378|4.129378	0.77549|0.77549	.|.	.|.	ENSG00000204681|ENSG00000204681	ENST00000485026|ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	.|D;D;D;D	.|0.88201	.|-2.35;-2.35;-2.35;-2.35	4.57|4.57	4.57|4.57	0.56435|0.56435	.|GPCR, family 3, C-terminal (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94598|0.94598	0.8259|0.8259	M|M	0.90483|0.90483	3.12|3.12	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.999;0.999	D|D	0.95655|0.95655	0.8710|0.8710	5|10	.|0.87932	.|D	.|0	-5.0204|-5.0204	14.8623|14.8623	0.70389|0.70389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|624;686;569	.|Q9UBS5-3;Q9UBS5;Q5SUJ9	.|.;GABR1_HUMAN;.	L|C	67|569;624;569;686	.|ENSP00000348248:W569C;ENSP00000366215:W624C;ENSP00000366211:W569C;ENSP00000366233:W686C	.|ENSP00000348248:W569C	V|W	-|-	1|3	0|0	GABBR1|GABBR1	29682909|29682909	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.908000|0.908000	0.53690|0.53690	7.357000|7.357000	0.79456|0.79456	2.075000|2.075000	0.62263|0.62263	0.563000|0.563000	0.77884|0.77884	GTG|TGG	.	.		0.577	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
MUC21	394263	hgsc.bcm.edu	37	6	30954774	30954774	+	Missense_Mutation	SNP	G	G	C	rs41288649		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:30954774G>C	ENST00000376296.3	+	2	1063	c.822G>C	c.(820-822)gaG>gaC	p.E274D	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	274	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAACTCTGAGTCCAGCACAG	0.612																																					p.E274D		Atlas-SNP	.											.	MUC21	98	.	0			c.G822C						.						185.0	181.0	182.0					6																	30954774		2203	4300	6503	SO:0001583	missense	394263	exon2			CTCTGAGTCCAGC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.822G>C	chr6.hg19:g.30954774G>C	ENSP00000365473:p.Glu274Asp	72.0	0.0		234.0	25.0	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	hg19	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	7.723	0.697571	0.15106	.	.	ENSG00000204544	ENST00000376296	T	0.01963	4.53	3.7	-3.24	0.05094	.	.	.	.	.	T	0.00552	0.0018	L	0.29908	0.895	0.09310	N	1	P	0.40834	0.73	B	0.37451	0.25	T	0.48080	-0.9066	8	.	.	.	0.085	4.9779	0.14149	0.291:0.3326:0.3764:0.0	.	274	Q5SSG8	MUC21_HUMAN	D	274	ENSP00000365473:E274D	.	E	+	3	2	MUC21	31062753	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-2.404000	0.01045	-0.243000	0.09653	0.472000	0.43445	GAG	.	G|0.500;C|0.500		0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
HSPA1L	3305	hgsc.bcm.edu	37	6	31778842	31778842	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:31778842C>T	ENST00000375654.4	-	2	1097	c.908G>A	c.(907-909)cGa>cAa	p.R303Q	HSPA1L_ENST00000417199.3_Missense_Mutation_p.R303Q	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	303					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CTCTTCAAATCGAGCTCTGGT	0.483																																					p.R303Q		Atlas-SNP	.											.	HSPA1L	185	.	0			c.G908A						.						70.0	74.0	73.0					6																	31778842		2203	4300	6503	SO:0001583	missense	3305	exon2			TCAAATCGAGCTC	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.908G>A	chr6.hg19:g.31778842C>T	ENSP00000364805:p.Arg303Gln	58.0	0.0		113.0	60.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	hg19	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263130	0.59431	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.01005	5.45;5.45	5.4	5.4	0.78164	.	0.000000	0.31772	N	0.007091	T	0.00906	0.0030	M	0.64080	1.96	0.80722	D	1	B	0.21606	0.058	B	0.17722	0.019	T	0.55528	-0.8127	10	0.87932	D	0	-7.9667	16.7132	0.85391	0.0:1.0:0.0:0.0	.	303	P34931	HS71L_HUMAN	Q	303;303;248;193	ENSP00000364805:R303Q;ENSP00000387691:R303Q	ENSP00000364804:R248Q	R	-	2	0	HSPA1L	31886821	1.000000	0.71417	0.980000	0.43619	0.695000	0.40330	5.899000	0.69846	2.810000	0.96702	0.585000	0.79938	CGA	.	.		0.483	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
HLA-DPB1	3115	hgsc.bcm.edu	37	6	33053656	33053656	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:33053656G>T	ENST00000418931.2	+	4	863	c.747G>T	c.(745-747)agG>agT	p.R249S		NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	249					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						TGCACAGGAGGAGCAAGAAAG	0.532																																					p.R249S		Atlas-SNP	.											.	HLA-DPB1	28	.	0			c.G747T						.						87.0	82.0	84.0					6																	33053656		2203	4300	6503	SO:0001583	missense	3115	exon4			CAGGAGGAGCAAG		CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.747G>T	chr6.hg19:g.33053656G>T	ENSP00000408146:p.Arg249Ser	51.0	0.0		116.0	8.0	NM_002121	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Missense_Mutation	SNP	ENST00000418931.2	hg19	CCDS4765.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.43|16.43|16.43	3.121594|3.121594|3.121594	0.56613|0.56613|0.56613	.|.|.	.|.|.	ENSG00000223865|ENSG00000223865|ENSG00000223865	ENST00000422592|ENST00000416804|ENST00000418931;ENST00000411942;ENST00000428835	.|.|T;T	.|.|0.00808	.|.|5.78;5.67	4.03|4.03|4.03	1.24|1.24|1.24	0.21308|0.21308|0.21308	.|.|.	.|.|0.184300	.|.|0.42964	.|.|D	.|.|0.000624	.|T|T	.|0.01765|0.01765	.|0.0056|0.0056	M|M|M	0.87456|0.87456|0.87456	2.885|2.885|2.885	0.09310|0.09310|0.09310	N|N|N	0.999998|0.999998|0.999998	.|.|D;D;D	.|.|0.76494	.|.|0.997;0.999;0.999	.|.|D;D;D	.|.|0.64506	.|.|0.926;0.926;0.926	.|T|T	.|0.35773|0.35773	.|-0.9775|-0.9775	.|5|10	0.52906|.|0.87932	T|.|D	0.07|.|0	.|.|.	6.5722|6.5722|6.5722	0.22545|0.22545|0.22545	0.2937:0.0:0.7063:0.0|0.2937:0.0:0.7063:0.0|0.2937:0.0:0.7063:0.0	.|.|.	.|.|215;259;249	.|.|A2ALJ6;Q59GY1;P04440	.|.|.;.;DPB1_HUMAN	X|V|S	60|216|249;219;226	.|.|ENSP00000408146:R249S;ENSP00000412654:R226S	ENSP00000413559:E60X|.|ENSP00000389210:R219S	E|G|R	+|+|+	1|2|3	0|0|2	HLA-DPB1|HLA-DPB1|HLA-DPB1	33161634|33161634|33161634	0.003000|0.003000|0.003000	0.15002|0.15002|0.15002	0.003000|0.003000|0.003000	0.11579|0.11579|0.11579	0.341000|0.341000|0.341000	0.28922|0.28922|0.28922	0.325000|0.325000|0.325000	0.19628|0.19628|0.19628	0.130000|0.130000|0.130000	0.18549|0.18549|0.18549	0.643000|0.643000|0.643000	0.83706|0.83706|0.83706	GAG|GGA|AGG	.	.		0.532	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121	
PPIL1	51645	hgsc.bcm.edu	37	6	36823793	36823793	+	Silent	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:36823793T>C	ENST00000373699.5	-	4	548	c.297A>G	c.(295-297)gcA>gcG	p.A99A	PPIL1_ENST00000483552.1_5'UTR	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1	99	Cyclosporin A binding.|PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			lung(1)|ovary(1)	2						CATTGGCCATTGCGAGAATTC	0.537																																					p.A99A		Atlas-SNP	.											.	PPIL1	6	.	0			c.A297G						.						40.0	40.0	40.0					6																	36823793		2203	4300	6503	SO:0001819	synonymous_variant	51645	exon4			GGCCATTGCGAGA	AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.297A>G	chr6.hg19:g.36823793T>C		28.0	0.0		63.0	35.0	NM_016059	O15001|Q5TDC9	Silent	SNP	ENST00000373699.5	hg19	CCDS4826.1																																																																																			.	.		0.537	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040382.1		
MOCS1	4337	hgsc.bcm.edu	37	6	39895091	39895091	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:39895091A>G	ENST00000340692.5	-	2	230	c.227T>C	c.(226-228)cTc>cCc	p.L76P	MOCS1_ENST00000308559.7_Missense_Mutation_p.L76P|MOCS1_ENST00000373186.4_Missense_Mutation_p.L76P|MOCS1_ENST00000373195.3_Intron|MOCS1_ENST00000432280.2_Missense_Mutation_p.L47P|MOCS1_ENST00000373175.4_Missense_Mutation_p.L47P|MOCS1_ENST00000425303.2_Missense_Mutation_p.L76P|MOCS1_ENST00000373188.2_Missense_Mutation_p.L76P			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	76	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTTCTCTGTGAGGGAGATCCG	0.617																																					p.L76P	NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)	Atlas-SNP	.											.	MOCS1	87	.	0			c.T227C						.						38.0	38.0	38.0					6																	39895091		2202	4297	6499	SO:0001583	missense	4337	exon1			TCTGTGAGGGAGA	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.227T>C	chr6.hg19:g.39895091A>G	ENSP00000344794:p.Leu76Pro	33.0	0.0		101.0	17.0	NM_005943	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	hg19		.	.	.	.	.	.	.	.	.	.	A	25.5	4.649040	0.87958	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000340692;ENST00000425303;ENST00000432280	D;D;D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03	5.44	5.44	0.79542	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);Radical SAM (1);MoaA/nifB/pqqE, iron-sulphur binding, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97520	0.9188	H	0.97962	4.115	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.998;0.994	D	0.99078	1.0836	9	.	.	.	-27.7589	15.438	0.75162	1.0:0.0:0.0:0.0	.	76;76;76;76	Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;MOCS1_HUMAN;.;.	P	76;76;47;76;76;76;47	ENSP00000362282:L76P;ENSP00000309843:L76P;ENSP00000362270:L47P;ENSP00000362284:L76P;ENSP00000344794:L76P;ENSP00000416478:L76P;ENSP00000410809:L47P	.	L	-	2	0	MOCS1	40003069	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.130000	0.89598	2.182000	0.69389	0.482000	0.46254	CTC	.	.		0.617	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000040476.2	NM_005943	
MAP3K5	4217	hgsc.bcm.edu	37	6	136913604	136913604	+	Silent	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:136913604A>G	ENST00000359015.4	-	22	3387	c.3027T>C	c.(3025-3027)gaT>gaC	p.D1009D	MAP3K5_ENST00000355845.4_Silent_p.D256D	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1009					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTCCCTTGACATCTCTTTCTC	0.473																																					p.D1009D		Atlas-SNP	.											.	MAP3K5	136	.	0			c.T3027C						.						149.0	149.0	149.0					6																	136913604		2203	4300	6503	SO:0001819	synonymous_variant	4217	exon22			CTTGACATCTCTT	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.3027T>C	chr6.hg19:g.136913604A>G		66.0	0.0		99.0	16.0	NM_005923	A6NIA0|B4DGB2|Q5THN3|Q99461	Silent	SNP	ENST00000359015.4	hg19	CCDS5179.1																																																																																			.	.		0.473	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
RP3-470B24.5	0	hgsc.bcm.edu	37	6	168376895	168376895	+	lincRNA	SNP	G	G	A	rs372347044		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:168376895G>A	ENST00000538528.1	-	0	724																											GGAGGAGAAGGCAGTGGGGGT	0.617																																					p.C146C		Atlas-SNP	.											.	.	.	.	0			c.C438T						.						25.0	22.0	23.0					6																	168376895		692	1589	2281			0	exon1			GAGAAGGCAGTGG																													chr6.hg19:g.168376895G>A		93.0	0.0		210.0	20.0	NM_001129895		Silent	SNP	ENST00000538528.1	hg19																																																																																				.	.		0.617	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
AQP1	358	hgsc.bcm.edu	37	7	30951862	30951862	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:30951862C>T	ENST00000311813.4	+	1	393	c.338C>T	c.(337-339)tCa>tTa	p.S113L	AQP1_ENST00000434909.2_Missense_Mutation_p.S173L|AQP1_ENST00000509504.1_Missense_Mutation_p.S290L	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	113					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	GCCATCCTCTCAGGCATCACC	0.617																																					p.S113L		Atlas-SNP	.											.	AQP1	38	.	0			c.C338T						.						87.0	91.0	90.0					7																	30951862		2203	4300	6503	SO:0001583	missense	358	exon1			TCCTCTCAGGCAT	M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.338C>T	chr7.hg19:g.30951862C>T	ENSP00000311165:p.Ser113Leu	15.0	0.0		82.0	10.0	NM_198098	B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Missense_Mutation	SNP	ENST00000311813.4	hg19	CCDS5431.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.844051	0.51164	.	.	ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000240583;ENSG00000250424	ENST00000434909;ENST00000265298;ENST00000311813;ENST00000413400;ENST00000509504	D;D;D	0.92545	-3.06;-3.06;-3.06	4.46	4.46	0.54185	Aquaporin-like (2);	0.206480	0.43919	D	0.000510	D	0.90424	0.7002	N	0.11560	0.145	0.80722	D	1	D;D	0.69078	0.997;0.995	D;P	0.64410	0.925;0.827	D	0.91315	0.5077	10	0.46703	T	0.11	-1.4045	15.0132	0.71565	0.0:1.0:0.0:0.0	.	173;113	B4E220;P29972	.;AQP1_HUMAN	L	173;18;113;98;290	ENSP00000395059:S173L;ENSP00000311165:S113L;ENSP00000421315:S290L	ENSP00000265298:S18L	S	+	2	0	RP5-877J2.1;AQP1	30918387	0.725000	0.28048	0.971000	0.41717	0.526000	0.34562	1.301000	0.33447	2.490000	0.84030	0.561000	0.74099	TCA	.	.		0.617	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215002.3	NM_000385	
NPSR1	387129	hgsc.bcm.edu	37	7	34698055	34698055	+	Missense_Mutation	SNP	G	G	A	rs267601495		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:34698055G>A	ENST00000360581.1	+	1	159	c.31G>A	c.(31-33)Gat>Aat	p.D11N	NPSR1-AS1_ENST00000419766.1_RNA|NPSR1_ENST00000381553.3_Missense_Mutation_p.D11N|NPSR1_ENST00000381539.3_Missense_Mutation_p.D11N|NPSR1_ENST00000381542.1_Missense_Mutation_p.D11N|AC005493.1_ENST00000399077.1_Intron|NPSR1_ENST00000531252.1_Missense_Mutation_p.D11N|NPSR1_ENST00000359791.1_Missense_Mutation_p.D11N|NPSR1_ENST00000465305.1_Missense_Mutation_p.D11N	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	11						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)	p.D11H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	GGGCAGCTTCGATTCCAGTGG	0.572																																					p.D11N		Atlas-SNP	.											NPSR1_ENST00000359791,colon,carcinoma,0,3	NPSR1	134	.	1	Substitution - Missense(1)	skin(1)	c.G31A						.						102.0	91.0	95.0					7																	34698055		2203	4300	6503	SO:0001583	missense	387129	exon1			AGCTTCGATTCCA	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.31G>A	chr7.hg19:g.34698055G>A	ENSP00000353788:p.Asp11Asn	60.0	0.0		106.0	38.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	hg19	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	G	5.696	0.312915	0.10789	.	.	ENSG00000187258	ENST00000381553;ENST00000465305;ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	3.84	-6.33	0.01988	.	1.739720	0.03061	N	0.155829	T	0.11410	0.0278	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.09022	0.0;0.002;0.0;0.001;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0;0.0	T	0.12682	-1.0538	10	0.17369	T	0.5	0.3602	1.1791	0.01841	0.2309:0.2662:0.3298:0.1731	.	11;11;11;11;11;11	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	N	11	ENSP00000370965:D11N;ENSP00000434955:D11N;ENSP00000353788:D11N;ENSP00000370953:D11N;ENSP00000352839:D11N;ENSP00000433258:D11N;ENSP00000370950:D11N	ENSP00000352839:D11N	D	+	1	0	NPSR1	34664580	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-1.229000	0.02945	-1.277000	0.02411	-0.367000	0.07326	GAT	.	.		0.572	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
AEBP1	165	hgsc.bcm.edu	37	7	44149823	44149823	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:44149823C>A	ENST00000223357.3	+	11	1583	c.1278C>A	c.(1276-1278)gaC>gaA	p.D426E	AEBP1_ENST00000450684.2_5'Flank|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	426	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for DNA-binding and interaction with NFKBIA. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCACTGAGGACGACTACTATG	0.632																																					p.D426E		Atlas-SNP	.											.	AEBP1	102	.	0			c.C1278A						.						96.0	79.0	85.0					7																	44149823		2203	4300	6503	SO:0001583	missense	165	exon11			TGAGGACGACTAC	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1278C>A	chr7.hg19:g.44149823C>A	ENSP00000223357:p.Asp426Glu	57.0	0.0		138.0	14.0	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	hg19	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406636	0.42715	.	.	ENSG00000106624	ENST00000223357	D	0.99270	-5.66	5.24	-2.29	0.06805	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.97685	0.9241	L	0.37561	1.115	0.80722	D	1	P	0.43477	0.808	P	0.47705	0.555	D	0.94444	0.7661	10	0.54805	T	0.06	-44.4846	12.4051	0.55434	0.0:0.3852:0.0:0.6148	.	426	Q8IUX7	AEBP1_HUMAN	E	426	ENSP00000223357:D426E	ENSP00000223357:D426E	D	+	3	2	AEBP1	44116348	0.000000	0.05858	0.994000	0.49952	0.552000	0.35366	-2.477000	0.00985	-0.316000	0.08690	0.561000	0.74099	GAC	.	.		0.632	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
BAZ1B	9031	hgsc.bcm.edu	37	7	72903721	72903721	+	Splice_Site	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:72903721T>C	ENST00000339594.4	-	6	1032	c.694A>G	c.(694-696)Atc>Gtc	p.I232V	BAZ1B_ENST00000404251.1_Splice_Site_p.I232V	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	232	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTACTGATGATCTAGGTTAAA	0.393																																					p.I232V	Esophageal Squamous(112;1167 1561 21085 43672 48228)	Atlas-SNP	.											.	BAZ1B	147	.	0			c.A694G						.						108.0	94.0	99.0					7																	72903721		2203	4300	6503	SO:0001630	splice_region_variant	9031	exon6			TGATGATCTAGGT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.694-1A>G	chr7.hg19:g.72903721T>C		92.0	0.0		229.0	120.0	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	hg19	CCDS5549.1	.	.	.	.	.	.	.	.	.	.	T	4.518	0.096070	0.08681	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.57436	0.4;0.4	5.88	4.72	0.59763	.	0.113674	0.64402	N	0.000009	T	0.25865	0.0630	N	0.08118	0	0.38723	D	0.953488	B	0.02656	0.0	B	0.04013	0.001	T	0.14727	-1.0462	10	0.05721	T	0.95	-9.0796	8.3585	0.32344	0.0:0.1502:0.0:0.8498	.	232	Q9UIG0	BAZ1B_HUMAN	V	232	ENSP00000342434:I232V;ENSP00000385442:I232V	ENSP00000342434:I232V	I	-	1	0	BAZ1B	72541657	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.480000	0.53172	1.050000	0.40346	0.533000	0.62120	ATC	.	.		0.393	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	Missense_Mutation
PCLO	27445	hgsc.bcm.edu	37	7	82583266	82583266	+	Silent	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:82583266A>G	ENST00000333891.9	-	5	7340	c.7003T>C	c.(7003-7005)Tta>Cta	p.L2335L	PCLO_ENST00000423517.2_Silent_p.L2335L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTTTCGGATAAGCTACTTTTT	0.423																																					p.L2335L		Atlas-SNP	.											.	PCLO	1506	.	0			c.T7003C						.						108.0	109.0	109.0					7																	82583266		1859	4102	5961	SO:0001819	synonymous_variant	27445	exon5			CGGATAAGCTACT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7003T>C	chr7.hg19:g.82583266A>G		120.0	0.0		360.0	82.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.423	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
RINT1	60561	hgsc.bcm.edu	37	7	105195558	105195558	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:105195558C>T	ENST00000257700.2	+	11	1786	c.1555C>T	c.(1555-1557)Cga>Tga	p.R519*		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	519	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TTTTAGGATACGATTAACACA	0.393																																					p.R519X		Atlas-SNP	.											.	RINT1	65	.	0			c.C1555T						.						156.0	154.0	155.0					7																	105195558		2203	4300	6503	SO:0001587	stop_gained	60561	exon11			AGGATACGATTAA	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.1555C>T	chr7.hg19:g.105195558C>T	ENSP00000257700:p.Arg519*	68.0	0.0		123.0	8.0	NM_021930	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Nonsense_Mutation	SNP	ENST00000257700.2	hg19	CCDS34726.1	.	.	.	.	.	.	.	.	.	.	C	40	8.473654	0.98827	.	.	ENSG00000135249	ENST00000257700	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8305	20.2245	0.98337	0.0:1.0:0.0:0.0	.	.	.	.	X	519	.	ENSP00000257700:R519X	R	+	1	2	RINT1	104982794	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.129000	0.57957	2.770000	0.95276	0.650000	0.86243	CGA	.	.		0.393	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
SPAM1	6677	hgsc.bcm.edu	37	7	123594436	123594436	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:123594436C>T	ENST00000439500.1	+	4	1425	c.812C>T	c.(811-813)cCt>cTt	p.P271L	SPAM1_ENST00000223028.7_Missense_Mutation_p.P271L|SPAM1_ENST00000340011.5_Missense_Mutation_p.P271L|SPAM1_ENST00000460182.1_Missense_Mutation_p.P271L|SPAM1_ENST00000402183.2_Missense_Mutation_p.P271L	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	271					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAGCAGTCTCCTGTAGCTGCT	0.418																																					p.P271L		Atlas-SNP	.											.	SPAM1	195	.	0			c.C812T						.						113.0	105.0	108.0					7																	123594436		2203	4300	6503	SO:0001583	missense	6677	exon3			AGTCTCCTGTAGC	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.812C>T	chr7.hg19:g.123594436C>T	ENSP00000402123:p.Pro271Leu	71.0	0.0		107.0	12.0	NM_153189	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	hg19	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354418	0.41700	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	6.13	4.34	0.51931	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.900897	0.09753	N	0.760366	T	0.18002	0.0432	N	0.20685	0.6	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.28106	-1.0054	9	.	.	.	-4.201	11.6139	0.51078	0.1232:0.8123:0.0:0.0645	.	271;271	Q8TC30;P38567	.;HYALP_HUMAN	L	271	ENSP00000386028:P271L;ENSP00000417934:P271L;ENSP00000345849:P271L;ENSP00000402123:P271L;ENSP00000223028:P271L	.	P	+	2	0	SPAM1	123381672	0.208000	0.23494	0.001000	0.08648	0.000000	0.00434	3.688000	0.54699	0.906000	0.36621	-0.201000	0.12746	CCT	.	.		0.418	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
SLC13A4	26266	hgsc.bcm.edu	37	7	135390908	135390908	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:135390908C>T	ENST00000354042.4	-	4	1195	c.506G>A	c.(505-507)gGc>gAc	p.G169D	RP11-644N4.1_ENST00000609370.1_RNA	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	169					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						GTTGGAGTTGCCCGCCACGAG	0.617																																					p.G169D		Atlas-SNP	.											.	SLC13A4	56	.	0			c.G506A						.						103.0	89.0	94.0					7																	135390908		2203	4300	6503	SO:0001583	missense	26266	exon4			GAGTTGCCCGCCA	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.506G>A	chr7.hg19:g.135390908C>T	ENSP00000297282:p.Gly169Asp	41.0	0.0		108.0	13.0	NM_012450	A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	hg19	CCDS5840.1	.	.	.	.	.	.	.	.	.	.	C	9.560	1.118121	0.20877	.	.	ENSG00000164707	ENST00000354042	T	0.02787	4.16	5.0	-0.336	0.12658	.	0.781774	0.11805	N	0.527708	T	0.03178	0.0093	L	0.38838	1.175	0.09310	N	1	P	0.42161	0.772	B	0.43575	0.424	T	0.46275	-0.9203	10	0.17369	T	0.5	.	9.3835	0.38329	0.0:0.4104:0.4426:0.147	.	169	Q9UKG4	S13A4_HUMAN	D	169	ENSP00000297282:G169D	ENSP00000297282:G169D	G	-	2	0	SLC13A4	135041448	0.032000	0.19561	0.000000	0.03702	0.469000	0.32828	0.211000	0.17474	-0.383000	0.07858	-1.943000	0.00494	GGC	.	.		0.617	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
OR9A2	135924	hgsc.bcm.edu	37	7	142724155	142724155	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:142724155A>C	ENST00000350513.2	-	1	127	c.65T>G	c.(64-66)cTa>cGa	p.L22R		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					AATGTGGTGTAGTCCTTGGGA	0.423																																					p.L22R		Atlas-SNP	.											.	OR9A2	52	.	0			c.T65G						.						81.0	81.0	81.0					7																	142724155		2203	4300	6503	SO:0001583	missense	135924	exon1			TGGTGTAGTCCTT		CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.65T>G	chr7.hg19:g.142724155A>C	ENSP00000316518:p.Leu22Arg	82.0	0.0		146.0	51.0	NM_001001658	B9EH51|Q6IF71|Q8NGD9	Missense_Mutation	SNP	ENST00000350513.2	hg19	CCDS34767.1	.	.	.	.	.	.	.	.	.	.	A	9.476	1.096856	0.20552	.	.	ENSG00000179468	ENST00000350513	T	0.05580	3.42	4.31	1.86	0.25419	.	0.319950	0.17220	U	0.182349	T	0.10165	0.0249	M	0.87038	2.855	0.09310	N	1	B	0.12630	0.006	B	0.16289	0.015	T	0.31806	-0.9930	10	0.87932	D	0	-0.95	2.8423	0.05533	0.6109:0.0:0.2026:0.1865	.	22	Q8NGT5	OR9A2_HUMAN	R	22	ENSP00000316518:L22R	ENSP00000316518:L22R	L	-	2	0	OR9A2	142434277	0.006000	0.16342	0.000000	0.03702	0.010000	0.07245	2.360000	0.44151	0.279000	0.22186	-0.509000	0.04479	CTA	.	.		0.423	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350862.1		
GALNTL5	168391	hgsc.bcm.edu	37	7	151664464	151664464	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:151664464G>A	ENST00000392800.2	+	2	387	c.133G>A	c.(133-135)Gct>Act	p.A45T	GALNTL5_ENST00000431418.2_Missense_Mutation_p.A45T	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	45					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GCCTCTGTCAGCTTGGTCCCC	0.428																																					p.A45T		Atlas-SNP	.											.	GALNTL5	87	.	0			c.G133A						.						62.0	63.0	63.0					7																	151664464		2203	4300	6503	SO:0001583	missense	168391	exon2			CTGTCAGCTTGGT	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.133G>A	chr7.hg19:g.151664464G>A	ENSP00000376548:p.Ala45Thr	97.0	0.0		170.0	116.0	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	hg19	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	G	9.617	1.132789	0.21041	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.59224	0.28;0.28	4.33	-8.67	0.00863	.	1.962090	0.02605	N	0.101470	T	0.33323	0.0859	N	0.22421	0.69	0.09310	N	1	B	0.22604	0.072	B	0.18871	0.023	T	0.11567	-1.0582	10	0.21014	T	0.42	.	2.7292	0.05222	0.5072:0.2096:0.1778:0.1054	.	45	Q7Z4T8	GLTL5_HUMAN	T	45	ENSP00000392582:A45T;ENSP00000376548:A45T	ENSP00000376548:A45T	A	+	1	0	GALNTL5	151295397	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.359000	0.02602	-1.821000	0.01213	0.650000	0.86243	GCT	.	.		0.428	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
PAXIP1	22976	hgsc.bcm.edu	37	7	154760558	154760558	+	Silent	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:154760558T>C	ENST00000404141.1	-	7	1507	c.1353A>G	c.(1351-1353)caA>caG	p.Q451Q	PAXIP1_ENST00000397192.1_Silent_p.Q451Q|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	451	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		gctgctgctgttgctgTGAAA	0.567																																					p.Q451Q		Atlas-SNP	.											.	PAXIP1	150	.	0			c.A1353G						.						24.0	26.0	25.0					7																	154760558		1840	3458	5298	SO:0001819	synonymous_variant	22976	exon7			CTGCTGTTGCTGT	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1353A>G	chr7.hg19:g.154760558T>C		46.0	0.0		130.0	16.0	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	ENST00000404141.1	hg19	CCDS47753.1																																																																																			.	.		0.567	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
PAXIP1	22976	hgsc.bcm.edu	37	7	154760561	154760561	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:154760561C>T	ENST00000404141.1	-	7	1504	c.1350G>A	c.(1348-1350)caG>caA	p.Q450Q	PAXIP1_ENST00000397192.1_Silent_p.Q450Q|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	450	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		gctgctgttgctgTGAAAATG	0.562																																					p.Q450Q		Atlas-SNP	.											.	PAXIP1	150	.	0			c.G1350A						.						23.0	26.0	25.0					7																	154760561		1829	3462	5291	SO:0001819	synonymous_variant	22976	exon7			CTGTTGCTGTGAA	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1350G>A	chr7.hg19:g.154760561C>T		46.0	0.0		130.0	12.0	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	ENST00000404141.1	hg19	CCDS47753.1																																																																																			.	.		0.562	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
SLC7A2	6542	hgsc.bcm.edu	37	8	17421125	17421125	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:17421125C>A	ENST00000494857.1	+	12	1903	c.1685C>A	c.(1684-1686)cCa>cAa	p.P562Q	SLC7A2_ENST00000004531.10_Missense_Mutation_p.P602Q|SLC7A2_ENST00000398090.3_Missense_Mutation_p.P601Q|SLC7A2_ENST00000522656.1_Missense_Mutation_p.P562Q|SLC7A2_ENST00000470360.1_Missense_Mutation_p.P601Q	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	562					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CCATTCTTACCATTTTTGCCA	0.413																																					p.P602Q		Atlas-SNP	.											.	SLC7A2	157	.	0			c.C1805A						.						251.0	238.0	243.0					8																	17421125		2203	4300	6503	SO:0001583	missense	6542	exon11			TCTTACCATTTTT	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1685C>A	chr8.hg19:g.17421125C>A	ENSP00000419140:p.Pro562Gln	126.0	0.0		343.0	73.0	NM_001164771	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	ENST00000494857.1	hg19	CCDS34852.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.483271	0.84854	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.95588	-3.46;-3.46;-3.75;-3.6;-3.75	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.98814	0.9600	H	0.98027	4.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.99107	1.0845	10	0.87932	D	0	.	20.2344	0.98354	0.0:1.0:0.0:0.0	.	602;601;562	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	Q	562;562;601;602;601	ENSP00000419140:P562Q;ENSP00000430464:P562Q;ENSP00000419873:P601Q;ENSP00000004531:P602Q;ENSP00000381164:P601Q	ENSP00000004531:P602Q	P	+	2	0	SLC7A2	17465399	1.000000	0.71417	0.357000	0.25798	0.838000	0.47535	7.818000	0.86416	2.854000	0.98071	0.655000	0.94253	CCA	.	.		0.413	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	
SLC18A1	6570	hgsc.bcm.edu	37	8	20004896	20004896	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:20004896G>T	ENST00000276373.5	-	15	1603	c.1337C>A	c.(1336-1338)tCc>tAc	p.S446Y	SLC18A1_ENST00000381608.4_Intron|SLC18A1_ENST00000265808.7_Missense_Mutation_p.S414Y|SLC18A1_ENST00000440926.1_Missense_Mutation_p.S446Y|SLC18A1_ENST00000519026.1_Missense_Mutation_p.S414Y|SLC18A1_ENST00000437980.1_Intron	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	446					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	ACCACCGGTGGATGGACCTGG	0.542																																					p.S446Y		Atlas-SNP	.											.	SLC18A1	68	.	0			c.C1337A						.						77.0	67.0	70.0					8																	20004896		2203	4300	6503	SO:0001583	missense	6570	exon15			CCGGTGGATGGAC		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.1337C>A	chr8.hg19:g.20004896G>T	ENSP00000276373:p.Ser446Tyr	54.0	0.0		79.0	13.0	NM_003053	E9PDJ5|Q9BRE4	Missense_Mutation	SNP	ENST00000276373.5	hg19	CCDS6013.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229561	0.58777	.	.	ENSG00000036565	ENST00000265808;ENST00000276373;ENST00000440926;ENST00000519026	T;T;T;T	0.80738	0.37;-1.41;-1.41;0.37	4.88	4.88	0.63580	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.110707	0.64402	D	0.000005	D	0.89501	0.6733	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.90054	0.4151	10	0.54805	T	0.06	-19.284	16.7583	0.85506	0.0:0.0:1.0:0.0	.	414;446	E9PDJ5;P54219	.;VMAT1_HUMAN	Y	414;446;446;414	ENSP00000265808:S414Y;ENSP00000276373:S446Y;ENSP00000387549:S446Y;ENSP00000429664:S414Y	ENSP00000265808:S414Y	S	-	2	0	SLC18A1	20049176	1.000000	0.71417	0.989000	0.46669	0.254000	0.26022	9.417000	0.97391	2.543000	0.85770	0.462000	0.41574	TCC	.	.		0.542	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1		
NCOA2	10499	hgsc.bcm.edu	37	8	71039123	71039123	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:71039123C>T	ENST00000452400.2	-	19	4022	c.3841G>A	c.(3841-3843)Ggt>Agt	p.G1281S	NCOA2_ENST00000267974.4_Missense_Mutation_p.G369S	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1281					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GCTGGCATACCACTAGGAGCC	0.493			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.G1281S		Atlas-SNP	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.G3841A						.						155.0	147.0	149.0					8																	71039123		1982	4157	6139	SO:0001583	missense	10499	exon19			GCATACCACTAGG	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3841G>A	chr8.hg19:g.71039123C>T	ENSP00000399968:p.Gly1281Ser	71.0	0.0		149.0	23.0	NM_006540	Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	hg19	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611027	0.66558	.	.	ENSG00000140396	ENST00000452400;ENST00000267974	T;T	0.26373	1.74;1.74	5.97	5.97	0.96955	Domain of unknown function DUF1518 (1);	0.000000	0.85682	D	0.000000	T	0.40145	0.1105	L	0.31065	0.9	0.58432	D	0.999993	D;D	0.76494	0.999;0.998	D;D	0.70935	0.971;0.966	T	0.02533	-1.1145	10	0.21014	T	0.42	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	369;1281	F8WAJ2;Q15596	.;NCOA2_HUMAN	S	1281;369	ENSP00000399968:G1281S;ENSP00000267974:G369S	ENSP00000267974:G369S	G	-	1	0	NCOA2	71201677	1.000000	0.71417	0.997000	0.53966	0.787000	0.44495	4.552000	0.60747	2.836000	0.97738	0.655000	0.94253	GGT	.	.		0.493	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
EYA1	2138	hgsc.bcm.edu	37	8	72233982	72233982	+	Silent	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:72233982G>T	ENST00000340726.3	-	6	1044	c.405C>A	c.(403-405)ggC>ggA	p.G135G	EYA1_ENST00000388740.3_Silent_p.G102G|EYA1_ENST00000388741.2_Silent_p.G101G|EYA1_ENST00000388742.4_Silent_p.G135G|EYA1_ENST00000388743.2_Silent_p.G134G|EYA1_ENST00000419131.1_Silent_p.G135G|EYA1_ENST00000303824.7_Silent_p.G134G	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	135					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			ATGAGGAAATGCCGTACGGCT	0.483																																					p.G135G		Atlas-SNP	.											.	EYA1	108	.	0			c.C405A	GRCh37	CD972191	EYA1	D		.						143.0	100.0	115.0					8																	72233982		2203	4300	6503	SO:0001819	synonymous_variant	2138	exon5			GGAAATGCCGTAC	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.405C>A	chr8.hg19:g.72233982G>T		112.0	0.0		313.0	41.0	NM_172059	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Silent	SNP	ENST00000340726.3	hg19	CCDS34906.1																																																																																			.	.		0.483	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
PTDSS1	9791	hgsc.bcm.edu	37	8	97345763	97345763	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:97345763C>T	ENST00000517309.1	+	13	1717	c.1391C>T	c.(1390-1392)tCa>tTa	p.S464L	PTDSS1_ENST00000522072.1_Intron|PTDSS1_ENST00000455950.2_Missense_Mutation_p.S318L	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	464					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CATTCCAAGTCAAAAGTCACC	0.468											OREG0018880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S464L		Atlas-SNP	.											.	PTDSS1	70	.	0			c.C1391T						.						160.0	149.0	153.0					8																	97345763		2203	4300	6503	SO:0001583	missense	9791	exon13			CCAAGTCAAAAGT	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1391C>T	chr8.hg19:g.97345763C>T	ENSP00000430548:p.Ser464Leu	64.0	0.0	1327	113.0	17.0	NM_014754	E5RFC5|Q9BUQ5	Missense_Mutation	SNP	ENST00000517309.1	hg19	CCDS6271.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.175674	0.57692	.	.	ENSG00000156471	ENST00000517309;ENST00000455950	T;T	0.46819	0.86;0.86	5.55	4.64	0.57946	.	0.140810	0.49305	D	0.000141	T	0.37293	0.0998	L	0.29908	0.895	0.42822	D	0.993992	B	0.17038	0.02	B	0.12156	0.007	T	0.27839	-1.0062	10	0.62326	D	0.03	-16.6697	13.7698	0.63018	0.0:0.8471:0.1529:0.0	.	464	P48651	PTSS1_HUMAN	L	464;318	ENSP00000430548:S464L;ENSP00000401248:S318L	ENSP00000401248:S318L	S	+	2	0	PTDSS1	97414939	0.998000	0.40836	0.972000	0.41901	0.996000	0.88848	2.930000	0.48924	2.602000	0.87976	0.655000	0.94253	TCA	.	.		0.468	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2		
ZC3H3	23144	hgsc.bcm.edu	37	8	144550407	144550407	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:144550407G>T	ENST00000262577.5	-	8	2178	c.2147C>A	c.(2146-2148)cCc>cAc	p.P716H		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	716					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GTGGGAGAAGGGGCAGGTCCC	0.667																																					p.P716H		Atlas-SNP	.											ZC3H3,NS,malignant_melanoma,0,1	ZC3H3	75	.	0			c.C2147A						.						69.0	64.0	66.0					8																	144550407		2203	4300	6503	SO:0001583	missense	23144	exon8			GAGAAGGGGCAGG	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2147C>A	chr8.hg19:g.144550407G>T	ENSP00000262577:p.Pro716His	24.0	0.0		58.0	20.0	NM_015117	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	hg19	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447515	0.84101	.	.	ENSG00000014164	ENST00000262577	D	0.85088	-1.94	5.4	4.52	0.55395	Zinc finger, CCCH-type (2);	0.058787	0.64402	N	0.000002	D	0.92221	0.7533	M	0.80746	2.51	0.58432	D	0.99999	D	0.76494	0.999	D	0.77557	0.99	D	0.93150	0.6549	10	0.72032	D	0.01	-21.9847	15.4404	0.75178	0.0:0.0:0.8599:0.1401	.	716	Q8IXZ2	ZC3H3_HUMAN	H	716	ENSP00000262577:P716H	ENSP00000262577:P716H	P	-	2	0	ZC3H3	144621550	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.011000	0.93618	1.259000	0.44117	0.655000	0.94253	CCC	.	.		0.667	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117	
CPSF1	29894	hgsc.bcm.edu	37	8	145623090	145623090	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr8:145623090G>C	ENST00000349769.3	-	21	2172	c.2078C>G	c.(2077-2079)tCc>tGc	p.S693C	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	693					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AATCACCTTGGACTGCTGTGG	0.697																																					p.S693C	NSCLC(133;1088 1848 27708 34777 35269)	Atlas-SNP	.											.	CPSF1	92	.	0			c.C2078G						.						27.0	30.0	29.0					8																	145623090		2203	4298	6501	SO:0001583	missense	29894	exon21			ACCTTGGACTGCT	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2078C>G	chr8.hg19:g.145623090G>C	ENSP00000339353:p.Ser693Cys	15.0	0.0		41.0	10.0	NM_013291	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	hg19	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198604	0.58126	.	.	ENSG00000071894	ENST00000349769	T	0.34275	1.37	5.61	4.73	0.59995	.	0.123358	0.56097	D	0.000025	T	0.51483	0.1677	L	0.55481	1.735	0.53688	D	0.999976	D	0.76494	0.999	D	0.65987	0.94	T	0.51076	-0.8751	10	0.51188	T	0.08	-13.0961	12.0782	0.53655	0.0:0.0:0.8283:0.1717	.	693	Q10570	CPSF1_HUMAN	C	693	ENSP00000339353:S693C	ENSP00000339353:S693C	S	-	2	0	CPSF1	145593898	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	6.586000	0.74067	1.362000	0.46000	0.491000	0.48974	TCC	.	.		0.697	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
SH3GL2	6456	hgsc.bcm.edu	37	9	17795714	17795714	+	Silent	SNP	G	G	A	rs371297260		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr9:17795714G>A	ENST00000380607.4	+	9	1152	c.1032G>A	c.(1030-1032)gtG>gtA	p.V344V	SH3GL2_ENST00000537391.1_Silent_p.V297V	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	344	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		TCAATTATGTGGAAATTCTGG	0.483																																					p.V344V		Atlas-SNP	.											.	SH3GL2	60	.	0			c.G1032A						.	G		1,4405	2.1+/-5.4	0,1,2202	98.0	84.0	89.0		1032	4.7	1.0	9		89	0,8600		0,0,4300	no	coding-synonymous	SH3GL2	NM_003026.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		344/353	17795714	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6456	exon9			TTATGTGGAAATT	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.1032G>A	chr9.hg19:g.17795714G>A		109.0	0.0		277.0	59.0	NM_003026	B2R618|Q9NQK5	Silent	SNP	ENST00000380607.4	hg19	CCDS6483.1																																																																																			.	.		0.483	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026	
KLHL9	55958	hgsc.bcm.edu	37	9	21334288	21334288	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr9:21334288G>A	ENST00000359039.4	-	1	1091	c.571C>T	c.(571-573)Cta>Tta	p.L191L	KLHL9_ENST00000537938.1_Silent_p.L123L			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	191	BACK.				cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)				endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		GGGAGTTTTAGAAACTCCCCA	0.388																																					p.L191L		Atlas-SNP	.											.	KLHL9	61	.	0			c.C571T						.						49.0	53.0	52.0					9																	21334288		2203	4300	6503	SO:0001819	synonymous_variant	55958	exon1			GTTTTAGAAACTC	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.571C>T	chr9.hg19:g.21334288G>A		42.0	0.0		40.0	9.0	NM_018847	Q8TCQ2	Silent	SNP	ENST00000359039.4	hg19	CCDS6503.1																																																																																			.	.		0.388	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847	
IKBKAP	8518	hgsc.bcm.edu	37	9	111658811	111658811	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr9:111658811C>G	ENST00000374647.5	-	25	3008	c.2701G>C	c.(2701-2703)Gat>Cat	p.D901H	IKBKAP_ENST00000537196.1_Missense_Mutation_p.D552H	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	901					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGGACCAAATCAAAGTCATAG	0.388																																					p.D901H		Atlas-SNP	.											.	IKBKAP	122	.	0			c.G2701C						.						111.0	101.0	104.0					9																	111658811		2203	4300	6503	SO:0001583	missense	8518	exon25			CCAAATCAAAGTC	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.2701G>C	chr9.hg19:g.111658811C>G	ENSP00000363779:p.Asp901His	82.0	0.0		93.0	31.0	NM_003640	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	hg19	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714445	0.68730	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.27890	1.64;1.64	5.13	4.22	0.49857	.	0.051676	0.85682	D	0.000000	T	0.51873	0.1700	M	0.70787	2.145	0.32810	D	0.501346	D	0.76494	0.999	D	0.70016	0.967	T	0.66101	-0.6007	10	0.62326	D	0.03	-15.7408	12.1646	0.54123	0.0:0.9146:0.0:0.0854	.	901	O95163	ELP1_HUMAN	H	901;552	ENSP00000363779:D901H;ENSP00000439367:D552H	ENSP00000363779:D901H	D	-	1	0	IKBKAP	110698632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.472000	0.60189	1.264000	0.44198	0.563000	0.77884	GAT	.	.		0.388	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
PRKCQ	5588	hgsc.bcm.edu	37	10	6553138	6553138	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr10:6553138A>T	ENST00000263125.5	-	3	236	c.137T>A	c.(136-138)aTc>aAc	p.I46N	PRKCQ_ENST00000539722.1_5'UTR|PRKCQ_ENST00000397176.2_Missense_Mutation_p.I46N	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	46	C2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CTTTTTCTGGATATACATCTG	0.453																																					p.I46N	Ovarian(50;572 1126 10530 25349 30594)	Atlas-SNP	.											.	PRKCQ	113	.	0			c.T137A						.						146.0	129.0	135.0					10																	6553138		2203	4300	6503	SO:0001583	missense	5588	exon3			TTCTGGATATACA	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.137T>A	chr10.hg19:g.6553138A>T	ENSP00000263125:p.Ile46Asn	98.0	0.0		98.0	46.0	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	hg19	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	A	14.57	2.575291	0.45902	.	.	ENSG00000065675	ENST00000263125;ENST00000397176	T;T	0.69806	-0.43;-0.36	5.33	5.33	0.75918	C2 calcium/lipid-binding domain, CaLB (1);	0.302177	0.36665	N	0.002477	T	0.61135	0.2323	L	0.29908	0.895	0.80722	D	1	B;B	0.28128	0.089;0.201	B;B	0.35655	0.207;0.092	T	0.63571	-0.6607	10	0.72032	D	0.01	.	15.6241	0.76840	1.0:0.0:0.0:0.0	.	46;46	Q04759-2;Q04759	.;KPCT_HUMAN	N	46	ENSP00000263125:I46N;ENSP00000380361:I46N	ENSP00000263125:I46N	I	-	2	0	PRKCQ	6593144	1.000000	0.71417	0.965000	0.40720	0.802000	0.45316	5.182000	0.65059	2.145000	0.66743	0.533000	0.62120	ATC	.	.		0.453	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
C10orf12	26148	hgsc.bcm.edu	37	10	98743690	98743690	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr10:98743690G>A	ENST00000286067.2	+	1	2650	c.2543G>A	c.(2542-2544)tGt>tAt	p.C848Y		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	848										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TCACGGAAATGTAGGAGTTCA	0.378																																					p.C848Y		Atlas-SNP	.											.	C10orf12	94	.	0			c.G2543A						.						81.0	76.0	78.0					10																	98743690		2203	4300	6503	SO:0001583	missense	26148	exon1			GGAAATGTAGGAG	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2543G>A	chr10.hg19:g.98743690G>A	ENSP00000286067:p.Cys848Tyr	82.0	0.0		113.0	29.0	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	hg19	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	G	5.055	0.195766	0.09599	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.08370	3.1	5.95	5.05	0.67936	.	0.739585	0.12696	N	0.446733	T	0.09818	0.0241	L	0.53249	1.67	0.09310	N	0.999999	B	0.22080	0.064	B	0.16289	0.015	T	0.20472	-1.0274	10	0.59425	D	0.04	-0.4738	6.8695	0.24113	0.1422:0.0:0.7146:0.1432	.	848	Q8N655	CJ012_HUMAN	Y	848;682	ENSP00000286067:C848Y	ENSP00000286067:C848Y	C	+	2	0	C10orf12	98733680	0.999000	0.42202	0.715000	0.30552	0.001000	0.01503	3.339000	0.52135	1.527000	0.49086	0.655000	0.94253	TGT	.	.		0.378	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
MUC6	4588	hgsc.bcm.edu	37	11	1017945	1017945	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:1017945A>G	ENST00000421673.2	-	31	4906	c.4856T>C	c.(4855-4857)tTc>tCc	p.F1619S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1619	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGAGGTGGAGAAAGGTGGAAC	0.542																																					p.F1619S		Atlas-SNP	.											.	MUC6	408	.	0			c.T4856C						.																																			SO:0001583	missense	4588	exon31			GTGGAGAAAGGTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4856T>C	chr11.hg19:g.1017945A>G	ENSP00000406861:p.Phe1619Ser	174.0	0.0		771.0	31.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	0.026	-1.375208	0.01214	.	.	ENSG00000184956	ENST00000421673	T	0.19669	2.13	2.39	-1.65	0.08291	.	.	.	.	.	T	0.14227	0.0344	L	0.41710	1.295	0.09310	N	1	B	0.29341	0.242	B	0.35931	0.214	T	0.39860	-0.9593	9	0.06625	T	0.88	.	6.4604	0.21954	0.6729:0.0:0.3271:0.0	.	1619	Q6W4X9	MUC6_HUMAN	S	1619	ENSP00000406861:F1619S	ENSP00000406861:F1619S	F	-	2	0	MUC6	1007945	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.579000	0.05834	-0.502000	0.06596	-0.917000	0.02746	TTC	.	.		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
TPH1	7166	hgsc.bcm.edu	37	11	18050909	18050909	+	Splice_Site	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:18050909C>G	ENST00000250018.2	-	5	1033		c.e5-1		TPH1_ENST00000341556.2_Splice_Site	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1						aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	GGGGTCTCCACTAATGAGATA	0.383																																					.		Atlas-SNP	.											.	TPH1	44	.	0			c.471-1G>C						.						149.0	155.0	153.0					11																	18050909		2200	4293	6493	SO:0001630	splice_region_variant	7166	exon6			TCTCCACTAATGA	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.471-1G>C	chr11.hg19:g.18050909C>G		60.0	0.0		63.0	17.0	NM_004179	D3DQX6|O95188|O95189|Q16736|Q3KPG8	Splice_Site	SNP	ENST00000250018.2	hg19	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573105	0.65765	.	.	ENSG00000129167	ENST00000250018;ENST00000341556	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0942	0.97832	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TPH1	18007485	1.000000	0.71417	0.999000	0.59377	0.585000	0.36419	7.738000	0.84966	2.756000	0.94617	0.650000	0.86243	.	.	.		0.383	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389696.1	NM_004179	Intron
HPS5	11234	hgsc.bcm.edu	37	11	18339305	18339305	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:18339305C>T	ENST00000349215.3	-	2	378	c.101G>A	c.(100-102)cGt>cAt	p.R34H	HPS5_ENST00000531848.1_Intron|HPS5_ENST00000396253.3_Intron|HPS5_ENST00000438420.2_Intron	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	34					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CACCTTTAGACGACTGGAGTC	0.463									Hermansky-Pudlak syndrome																												p.R34H		Atlas-SNP	.											.	HPS5	70	.	0			c.G101A						.						59.0	53.0	55.0					11																	18339305		2199	4293	6492	SO:0001583	missense	11234	exon2	Familial Cancer Database	HPS, HPS1-8	TTTAGACGACTGG	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.101G>A	chr11.hg19:g.18339305C>T	ENSP00000265967:p.Arg34His	59.0	0.0		96.0	22.0	NM_181507	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	ENST00000349215.3	hg19	CCDS7836.1	.	.	.	.	.	.	.	.	.	.	C	34	5.345874	0.95807	.	.	ENSG00000110756	ENST00000349215	T	0.63255	-0.03	5.05	5.05	0.67936	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71281	0.3321	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.917;1.0	T	0.75505	-0.3294	10	0.87932	D	0	.	18.4032	0.90525	0.0:1.0:0.0:0.0	.	50;34	Q8IZE8;Q9UPZ3	.;HPS5_HUMAN	H	34	ENSP00000265967:R34H	ENSP00000265967:R34H	R	-	2	0	HPS5	18295881	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.334000	0.79466	0.591000	0.81541	CGT	.	.		0.463	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	
PHF21A	51317	hgsc.bcm.edu	37	11	45975168	45975168	+	Silent	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:45975168T>C	ENST00000418153.2	-	10	1201	c.1002A>G	c.(1000-1002)aaA>aaG	p.K334K	PHF21A_ENST00000323180.6_Silent_p.K335K|PHF21A_ENST00000257821.4_Silent_p.K335K|PHF21A_ENST00000527753.1_5'UTR			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	334					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						CTGTGTGAGATTTAACTGTCT	0.388																																					p.K335K		Atlas-SNP	.											.	PHF21A	107	.	0			c.A1005G						.						107.0	97.0	100.0					11																	45975168		2202	4299	6501	SO:0001819	synonymous_variant	51317	exon10			GTGAGATTTAACT	AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.1002A>G	chr11.hg19:g.45975168T>C		126.0	0.0		396.0	190.0	NM_016621	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Silent	SNP	ENST00000418153.2	hg19	CCDS44578.1																																																																																			.	.		0.388	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
OR4A16	81327	hgsc.bcm.edu	37	11	55111334	55111334	+	Missense_Mutation	SNP	C	C	A	rs548070218		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:55111334C>A	ENST00000314721.2	+	1	708	c.658C>A	c.(658-660)Cta>Ata	p.L220I		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TGGAGTCATCCTAAACTTCCT	0.443																																					p.L220I		Atlas-SNP	.											.	OR4A16	120	.	0			c.C658A						.						171.0	158.0	162.0					11																	55111334		2201	4296	6497	SO:0001583	missense	81327	exon1			GTCATCCTAAACT	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.658C>A	chr11.hg19:g.55111334C>A	ENSP00000325128:p.Leu220Ile	138.0	0.0		342.0	76.0	NM_001005274	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	hg19	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	c	10.11	1.259097	0.23051	.	.	ENSG00000181961	ENST00000314721	T	0.00152	8.66	2.54	1.58	0.23477	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	L	0.48642	1.525	0.24991	N	0.991537	P	0.45011	0.848	P	0.50934	0.654	T	0.41928	-0.9481	9	0.87932	D	0	.	4.2522	0.10700	0.0:0.6327:0.0:0.3673	.	220	Q8NH70	O4A16_HUMAN	I	220	ENSP00000325128:L220I	ENSP00000325128:L220I	L	+	1	2	OR4A16	54867910	0.000000	0.05858	0.378000	0.26068	0.067000	0.16453	-2.213000	0.01224	0.370000	0.24538	0.423000	0.28283	CTA	.	.		0.443	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
OR8H2	390151	hgsc.bcm.edu	37	11	55872714	55872714	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:55872714C>A	ENST00000313503.1	+	1	196	c.196C>A	c.(196-198)Cac>Aac	p.H66N		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H66Y(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TTTCCTTACTCACCTGTCATT	0.428										HNSCC(53;0.14)																											p.H66N		Atlas-SNP	.											OR8H2,NS,carcinoma,0,1	OR8H2	117	.	1	Substitution - Missense(1)	lung(1)	c.C196A						.						232.0	218.0	223.0					11																	55872714		2201	4292	6493	SO:0001583	missense	390151	exon1			CTTACTCACCTGT	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.196C>A	chr11.hg19:g.55872714C>A	ENSP00000323982:p.His66Asn	99.0	0.0		184.0	18.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	hg19	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	c	0.011	-1.709980	0.00712	.	.	ENSG00000181767	ENST00000313503	T	0.00892	5.57	3.58	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	0.228496	0.31519	N	0.007516	T	0.00412	0.0013	N	0.02142	-0.665	0.09310	N	1	B	0.34290	0.447	B	0.34242	0.178	T	0.48410	-0.9038	10	0.02654	T	1	.	6.119	0.20142	0.2702:0.6231:0.0:0.1067	.	66	Q8N162	OR8H2_HUMAN	N	66	ENSP00000323982:H66N	ENSP00000323982:H66N	H	+	1	0	OR8H2	55629290	0.000000	0.05858	0.894000	0.35097	0.612000	0.37316	-0.085000	0.11250	1.952000	0.56665	0.440000	0.28878	CAC	.	.		0.428	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
PIWIL4	143689	hgsc.bcm.edu	37	11	94353216	94353216	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:94353216C>A	ENST00000299001.6	+	19	2559	c.2348C>A	c.(2347-2349)aCc>aAc	p.T783N	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA|PIWIL4_ENST00000537419.1_Missense_Mutation_p.T134N	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	783	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GTTAGTCCTACCTACTATAAT	0.458																																					p.T783N		Atlas-SNP	.											.	PIWIL4	70	.	0			c.C2348A						.						86.0	81.0	83.0					11																	94353216		2201	4298	6499	SO:0001583	missense	143689	exon19			GTCCTACCTACTA	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.2348C>A	chr11.hg19:g.94353216C>A	ENSP00000299001:p.Thr783Asn	88.0	0.0		89.0	13.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	hg19	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.519264	0.64634	.	.	ENSG00000134627	ENST00000299001;ENST00000537419	T;T	0.34275	1.37;1.37	5.39	5.39	0.77823	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.64402	D	0.000004	T	0.74779	0.3761	H	0.97315	3.98	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.84533	0.0634	10	0.87932	D	0	-18.4737	17.9256	0.88982	0.0:1.0:0.0:0.0	.	783	Q7Z3Z4	PIWL4_HUMAN	N	783;134	ENSP00000299001:T783N;ENSP00000439710:T134N	ENSP00000299001:T783N	T	+	2	0	PIWIL4	93992864	1.000000	0.71417	0.974000	0.42286	0.181000	0.23173	7.306000	0.78905	2.542000	0.85734	0.561000	0.74099	ACC	.	.		0.458	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
APOC3	345	hgsc.bcm.edu	37	11	116701502	116701502	+	Silent	SNP	C	C	T	rs372158089		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:116701502C>T	ENST00000227667.3	+	3	131	c.69C>T	c.(67-69)gcC>gcT	p.A23A	APOC3_ENST00000375345.1_Silent_p.A41A|APOC3_ENST00000470144.1_3'UTR	NM_000040.1	NP_000031.1	P02656	APOC3_HUMAN	apolipoprotein C-III	23					cellular response to glucose stimulus (GO:0071333)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle remodeling (GO:0034375)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of cholesterol import (GO:0060621)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of high-density lipoprotein particle clearance (GO:0010987)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of triglyceride catabolic process (GO:0010897)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	cholesterol binding (GO:0015485)|enzyme regulator activity (GO:0030234)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|phospholipid binding (GO:0005543)			endometrium(1)|lung(6)	7	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CTTCAGAGGCCGAGGATGCCT	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		16260	0.0		0.0	False		,,,				2504	0.001				p.A23A	GBM(81;259 1650 7161 35190)	Atlas-SNP	.											.	APOC3	8	.	0			c.C69T						.	C		1,4401	2.1+/-5.4	0,1,2200	45.0	40.0	42.0		69	-9.9	0.0	11		42	0,8592		0,0,4296	no	coding-synonymous	APOC3	NM_000040.1		0,1,6496	TT,TC,CC		0.0,0.0227,0.0077		23/100	116701502	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	345	exon3			AGAGGCCGAGGAT	X01388	CCDS8377.1	11q23.3	2013-01-24			ENSG00000110245	ENSG00000110245		"""Apolipoproteins"""	610	protein-coding gene	gene with protein product		107720					Standard	NM_000040		Approved		uc001ppt.1	P02656	OTTHUMG00000046115	ENST00000227667.3:c.69C>T	chr11.hg19:g.116701502C>T		47.0	0.0		38.0	6.0	NM_000040	Q08E83|Q6Q786	Silent	SNP	ENST00000227667.3	hg19	CCDS8377.1																																																																																			.	.		0.627	APOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106284.2	NM_000040	
ERC1	23085	hgsc.bcm.edu	37	12	1192560	1192560	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:1192560G>C	ENST00000397203.2	+	3	1306	c.900G>C	c.(898-900)caG>caC	p.Q300H	ERC1_ENST00000360905.4_Missense_Mutation_p.Q300H|ERC1_ENST00000543086.3_Missense_Mutation_p.Q300H|ERC1_ENST00000589028.1_Missense_Mutation_p.Q300H|ERC1_ENST00000355446.5_Missense_Mutation_p.Q300H|ERC1_ENST00000546231.2_Missense_Mutation_p.Q300H			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	300					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CTCAAAAGCAGACCCTAAATG	0.473																																					p.Q300H		Atlas-SNP	.											.	ERC1	95	.	0			c.G900C						.						65.0	66.0	66.0					12																	1192560		2203	4300	6503	SO:0001583	missense	23085	exon3			AAAGCAGACCCTA	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.900G>C	chr12.hg19:g.1192560G>C	ENSP00000380386:p.Gln300His	49.0	0.0		38.0	9.0	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	hg19	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.937699	0.34189	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000543086;ENST00000542302;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.56	-1.25	0.09405	.	0.000000	0.85682	D	0.000000	T	0.45716	0.1356	L	0.56769	1.78	0.47698	D	0.999498	B;B;B;B	0.22541	0.033;0.001;0.002;0.071	B;B;B;B	0.33690	0.036;0.004;0.003;0.168	T	0.50294	-0.8845	10	0.72032	D	0.01	-18.95	12.7244	0.57162	0.2798:0.0:0.7202:0.0	.	76;300;300;300	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	H	300;300;300;300;300;300;300;300;300;300;76	ENSP00000340054:Q300H;ENSP00000380386:Q300H;ENSP00000438546:Q300H;ENSP00000445336:Q300H;ENSP00000442739:Q300H;ENSP00000347621:Q300H;ENSP00000354158:Q300H;ENSP00000410064:Q300H	ENSP00000340054:Q300H	Q	+	3	2	ERC1	1062821	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	0.640000	0.24705	-0.144000	0.11314	0.655000	0.94253	CAG	.	.		0.473	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
ESPL1	9700	hgsc.bcm.edu	37	12	53670586	53670586	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:53670586A>T	ENST00000257934.4	+	8	1974	c.1883A>T	c.(1882-1884)cAc>cTc	p.H628L	ESPL1_ENST00000552462.1_Missense_Mutation_p.H628L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	628					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CGAGCCACCCACCTGGTAGAA	0.612																																					p.H628L	Colon(53;1069 1201 2587 5382)	Atlas-SNP	.											.	ESPL1	158	.	0			c.A1883T						.						59.0	65.0	63.0					12																	53670586		2203	4299	6502	SO:0001583	missense	9700	exon8			CCACCCACCTGGT	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.1883A>T	chr12.hg19:g.53670586A>T	ENSP00000257934:p.His628Leu	15.0	0.0		42.0	14.0	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	hg19	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.019977	0.35606	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12465	2.68;2.68	5.38	5.38	0.77491	.	0.323012	0.34245	N	0.004124	T	0.14356	0.0347	M	0.63428	1.95	0.27089	N	0.962896	B	0.23442	0.085	B	0.16722	0.016	T	0.10314	-1.0635	10	0.33141	T	0.24	.	8.4595	0.32919	0.7308:0.0:0.0:0.2692	.	628	Q14674	ESPL1_HUMAN	L	628;303;628	ENSP00000257934:H628L;ENSP00000449831:H628L	ENSP00000257934:H628L	H	+	2	0	ESPL1	51956853	0.940000	0.31905	0.998000	0.56505	0.997000	0.91878	1.960000	0.40422	2.262000	0.75019	0.528000	0.53228	CAC	.	.		0.612	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
SRGAP1	57522	hgsc.bcm.edu	37	12	64505683	64505683	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:64505683C>T	ENST00000355086.3	+	17	2585	c.2061C>T	c.(2059-2061)atC>atT	p.I687I	RP11-196H14.4_ENST00000535806.1_RNA|SRGAP1_ENST00000357825.3_Silent_p.I664I|SRGAP1_ENST00000543397.1_Silent_p.I624I	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	687	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		AAACCATCATCATCCACCATG	0.423																																					p.I687I		Atlas-SNP	.											.	SRGAP1	146	.	0			c.C2061T						.						171.0	151.0	158.0					12																	64505683		2203	4300	6503	SO:0001819	synonymous_variant	57522	exon17			CATCATCATCCAC	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2061C>T	chr12.hg19:g.64505683C>T		96.0	0.0		150.0	18.0	NM_020762	Q9H8A3|Q9P2P2	Silent	SNP	ENST00000355086.3	hg19	CCDS8967.1																																																																																			.	.		0.423	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
PTPRB	5787	hgsc.bcm.edu	37	12	70954625	70954625	+	Missense_Mutation	SNP	C	C	G	rs112738980		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:70954625C>G	ENST00000261266.5	-	15	3633	c.3604G>C	c.(3604-3606)Gac>Cac	p.D1202H	PTPRB_ENST00000550358.1_Missense_Mutation_p.D1332H|PTPRB_ENST00000550857.1_Missense_Mutation_p.D1112H|PTPRB_ENST00000538708.1_Missense_Mutation_p.D1112H|PTPRB_ENST00000451516.2_Missense_Mutation_p.D1112H|PTPRB_ENST00000334414.6_Missense_Mutation_p.D1420H|PTPRB_ENST00000551525.1_Missense_Mutation_p.D1419H	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1202	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TCATAAAAGTCAAAGTCCCCA	0.498																																					p.D1420H		Atlas-SNP	.											.	PTPRB	676	.	0			c.G4258C						.						91.0	85.0	87.0					12																	70954625		1896	4123	6019	SO:0001583	missense	5787	exon17			AAAAGTCAAAGTC	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3604G>C	chr12.hg19:g.70954625C>G	ENSP00000261266:p.Asp1202His	90.0	0.0		138.0	15.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232757	0.79688	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26;0.26;0.26;0.26	5.43	5.43	0.79202	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.095331	0.64402	D	0.000001	T	0.78220	0.4249	M	0.84082	2.675	0.53688	D	0.999978	P;P;D;P;D;D;D	0.71674	0.906;0.822;0.996;0.835;0.998;0.978;0.984	P;P;D;B;D;D;P	0.65987	0.794;0.794;0.93;0.356;0.94;0.918;0.834	T	0.81324	-0.0984	10	0.72032	D	0.01	.	19.2383	0.93871	0.0:1.0:0.0:0.0	.	1112;1112;1299;1419;1420;1202;1332	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	H	1420;1112;1332;1112;1112;1202;1419;1299	ENSP00000334928:D1420H;ENSP00000393028:D1112H;ENSP00000448058:D1332H;ENSP00000438927:D1112H;ENSP00000447302:D1112H;ENSP00000261266:D1202H;ENSP00000448349:D1419H;ENSP00000446982:D1299H	ENSP00000261266:D1202H	D	-	1	0	PTPRB	69240892	0.968000	0.33430	0.994000	0.49952	0.948000	0.59901	2.243000	0.43115	2.528000	0.85240	0.558000	0.71614	GAC	.	.		0.498	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PTPRB	5787	hgsc.bcm.edu	37	12	70984008	70984008	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:70984008C>G	ENST00000261266.5	-	6	1161	c.1132G>C	c.(1132-1134)Gac>Cac	p.D378H	PTPRB_ENST00000550358.1_Missense_Mutation_p.D596H|PTPRB_ENST00000550857.1_Intron|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000538708.1_Missense_Mutation_p.D378H|PTPRB_ENST00000451516.2_Intron|PTPRB_ENST00000334414.6_Missense_Mutation_p.D596H|PTPRB_ENST00000551525.1_Missense_Mutation_p.D595H	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	378	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GCAACTTTGTCTGGAACTAAA	0.453											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D596H		Atlas-SNP	.											.	PTPRB	676	.	0			c.G1786C						.						115.0	111.0	112.0					12																	70984008		1917	4129	6046	SO:0001583	missense	5787	exon8			CTTTGTCTGGAAC	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1132G>C	chr12.hg19:g.70984008C>G	ENSP00000261266:p.Asp378His	99.0	0.0	1126	227.0	25.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920749	0.52653	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T	0.05081	3.5;3.5;3.5;3.5;3.5;3.5	5.85	3.91	0.45181	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.671921	0.15965	N	0.236042	T	0.11410	0.0278	N	0.22421	0.69	0.80722	D	1	P;P;P;B;P;P	0.46912	0.702;0.84;0.702;0.313;0.544;0.886	P;P;P;B;P;P	0.54590	0.525;0.756;0.642;0.402;0.653;0.693	T	0.25745	-1.0123	10	0.45353	T	0.12	.	16.154	0.81644	0.0:0.6324:0.3676:0.0	.	378;475;595;596;378;596	F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;PTPRB_HUMAN;.	H	596;596;596;378;378;595;475	ENSP00000334928:D596H;ENSP00000448058:D596H;ENSP00000438927:D378H;ENSP00000261266:D378H;ENSP00000448349:D595H;ENSP00000446982:D475H	ENSP00000261266:D378H	D	-	1	0	PTPRB	69270275	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	2.269000	0.43346	1.451000	0.47736	0.655000	0.94253	GAC	.	.		0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
GLIPR1	11010	hgsc.bcm.edu	37	12	75875766	75875766	+	Silent	SNP	T	T	A	rs373244879		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:75875766T>A	ENST00000266659.3	+	2	528	c.327T>A	c.(325-327)tcT>tcA	p.S109S	RP11-585P4.5_ENST00000547326.1_RNA	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	109	SCP.				cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						CCATTTTTTCTGTGTCTTCCG	0.473																																					p.S109S		Atlas-SNP	.											.	GLIPR1	33	.	0			c.T327A						.						118.0	102.0	107.0					12																	75875766		2203	4300	6503	SO:0001819	synonymous_variant	11010	exon2			TTTTTCTGTGTCT	U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.327T>A	chr12.hg19:g.75875766T>A		77.0	0.0		143.0	32.0	NM_006851	A7YET6|F8VUC2|Q15409|Q969K2	Silent	SNP	ENST00000266659.3	hg19	CCDS9011.1																																																																																			.	.		0.473	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405722.1	NM_006851	
TMEM132C	92293	hgsc.bcm.edu	37	12	129028648	129028648	+	Splice_Site	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:129028648G>A	ENST00000435159.2	+	3	1121	c.1121G>A	c.(1120-1122)aGg>aAg	p.R374K	TMEM132C_ENST00000315208.8_5'UTR	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	374						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCACGCAACAGGTAAGCGGTG	0.706																																					p.R374K		Atlas-SNP	.											.	TMEM132C	142	.	0			c.G1121A						.						14.0	24.0	21.0					12																	129028648		691	1591	2282	SO:0001630	splice_region_variant	92293	exon3			GCAACAGGTAAGC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1121+1G>A	chr12.hg19:g.129028648G>A		16.0	0.0		25.0	15.0	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	hg19		.	.	.	.	.	.	.	.	.	.	G	19.52	3.842642	0.71488	.	.	ENSG00000181234	ENST00000435159	T	0.13901	2.55	4.71	4.71	0.59529	.	.	.	.	.	T	0.19604	0.0471	M	0.68952	2.095	0.49798	D	0.999822	P	0.48694	0.914	B	0.43536	0.423	T	0.08310	-1.0728	9	0.18710	T	0.47	.	17.6508	0.88163	0.0:0.0:1.0:0.0	.	374	Q8N3T6	T132C_HUMAN	K	374	ENSP00000410852:R374K	ENSP00000410852:R374K	R	+	2	0	TMEM132C	127594601	1.000000	0.71417	0.996000	0.52242	0.478000	0.33099	5.782000	0.68973	2.316000	0.78162	0.655000	0.94253	AGG	.	.		0.706	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	Missense_Mutation
RNF17	56163	hgsc.bcm.edu	37	13	25435486	25435486	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr13:25435486C>T	ENST00000255324.5	+	27	3907	c.3855C>T	c.(3853-3855)ccC>ccT	p.P1285P	RNF17_ENST00000381921.1_Silent_p.P1285P|RNF17_ENST00000339524.3_Silent_p.P337P	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1285	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CTGATATACCCCAGTTTTGTA	0.313																																					p.P1285P		Atlas-SNP	.											.	RNF17	259	.	0			c.C3855T						.						221.0	223.0	222.0					13																	25435486		2203	4300	6503	SO:0001819	synonymous_variant	56163	exon27			TATACCCCAGTTT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3855C>T	chr13.hg19:g.25435486C>T		114.0	0.0		216.0	28.0	NM_031277	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	hg19	CCDS9308.2																																																																																			.	.		0.313	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
SUPT20H	55578	hgsc.bcm.edu	37	13	37619483	37619483	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr13:37619483C>T	ENST00000350612.6	-	6	413	c.193G>A	c.(193-195)Gag>Aag	p.E65K	SUPT20H_ENST00000360252.4_Missense_Mutation_p.E66K|SUPT20H_ENST00000464744.1_Missense_Mutation_p.E66K|SUPT20H_ENST00000475892.1_Missense_Mutation_p.E65K|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000356185.3_Missense_Mutation_p.E66K|SUPT20H_ENST00000542180.1_Missense_Mutation_p.E53K	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	65					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										ACAAGCTTCTCTAACAAGTTC	0.353																																					p.E66K		Atlas-SNP	.											.	.	.	.	0			c.G196A						.						105.0	94.0	97.0					13																	37619483		2203	4300	6503	SO:0001583	missense	55578	exon6			GCTTCTCTAACAA	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.193G>A	chr13.hg19:g.37619483C>T	ENSP00000218894:p.Glu65Lys	67.0	0.0		60.0	19.0	NM_017569	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	ENST00000350612.6	hg19	CCDS31959.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265120	0.95399	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.69151	0.3079	M	0.82056	2.57	0.80722	D	1	D;D;D;D;D;D	0.76494	0.995;0.997;0.997;0.995;0.993;0.999	D;D;D;D;D;D	0.74674	0.973;0.973;0.968;0.973;0.941;0.984	T	0.70956	-0.4731	10	0.87932	D	0	-16.4567	20.4777	0.99188	0.0:1.0:0.0:0.0	.	53;65;65;66;66;65	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	K	66;65;65;66;65;66;53;66	ENSP00000353388:E66K;ENSP00000417510:E65K;ENSP00000218894:E65K;ENSP00000348512:E66K;ENSP00000419754:E66K;ENSP00000439000:E53K;ENSP00000420170:E66K	ENSP00000218894:E65K	E	-	1	0	FAM48A	36517483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.875000	0.69660	2.840000	0.97914	0.655000	0.94253	GAG	.	.		0.353	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1	NM_017569	
FREM2	341640	hgsc.bcm.edu	37	13	39265592	39265592	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr13:39265592A>G	ENST00000280481.7	+	1	4327	c.4111A>G	c.(4111-4113)Acc>Gcc	p.T1371A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1371					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CATGAATTTTACCCAGGATGA	0.393																																					p.T1371A		Atlas-SNP	.											.	FREM2	385	.	0			c.A4111G						.						68.0	66.0	67.0					13																	39265592		2203	4300	6503	SO:0001583	missense	341640	exon1			AATTTTACCCAGG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4111A>G	chr13.hg19:g.39265592A>G	ENSP00000280481:p.Thr1371Ala	76.0	0.0		91.0	10.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	18.93	3.728121	0.69074	.	.	ENSG00000150893	ENST00000280481	T	0.61510	0.1	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.82559	0.5063	H	0.94771	3.58	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.87648	0.2526	10	0.87932	D	0	.	16.1699	0.81801	1.0:0.0:0.0:0.0	.	1371	Q5SZK8	FREM2_HUMAN	A	1371	ENSP00000280481:T1371A	ENSP00000280481:T1371A	T	+	1	0	FREM2	38163592	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.335000	0.96500	2.217000	0.71921	0.533000	0.62120	ACC	.	.		0.393	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
DIAPH3	81624	hgsc.bcm.edu	37	13	60498943	60498943	+	Silent	SNP	A	A	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr13:60498943A>C	ENST00000400324.4	-	18	2356	c.2136T>G	c.(2134-2136)ctT>ctG	p.L712L	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400330.1_Silent_p.L712L|DIAPH3_ENST00000267215.4_Silent_p.L712L|DIAPH3_ENST00000400320.1_Silent_p.L666L|DIAPH3_ENST00000400319.1_Silent_p.L642L|DIAPH3_ENST00000377908.2_Silent_p.L701L	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	712	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CTAAAAACTTAAGTTCTTTAA	0.299																																					p.L712L		Atlas-SNP	.											.	DIAPH3	139	.	0			c.T2136G						.						44.0	45.0	45.0					13																	60498943		1778	4035	5813	SO:0001819	synonymous_variant	81624	exon18			AAACTTAAGTTCT	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2136T>G	chr13.hg19:g.60498943A>C		148.0	0.0		239.0	50.0	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Silent	SNP	ENST00000400324.4	hg19	CCDS41898.1																																																																																			.	.		0.299	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
ITGBL1	9358	hgsc.bcm.edu	37	13	102366888	102366888	+	Silent	SNP	T	T	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr13:102366888T>G	ENST00000376180.3	+	10	1599	c.1380T>G	c.(1378-1380)ggT>ggG	p.G460G	ITGBL1_ENST00000545560.2_Silent_p.G319G|RP11-397O8.7_ENST00000606869.1_lincRNA|ITGBL1_ENST00000376162.3_Silent_p.G367G	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	460	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AACATGATGGTCTCATTTGTA	0.433																																					p.G460G		Atlas-SNP	.											.	ITGBL1	83	.	0			c.T1380G						.						344.0	320.0	328.0					13																	102366888		2203	4300	6503	SO:0001819	synonymous_variant	9358	exon10			TGATGGTCTCATT	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.1380T>G	chr13.hg19:g.102366888T>G		105.0	0.0		208.0	50.0	NM_004791	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Silent	SNP	ENST00000376180.3	hg19	CCDS9499.1																																																																																			.	.		0.433	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
ATP10A	57194	hgsc.bcm.edu	37	15	25959333	25959333	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr15:25959333C>T	ENST00000356865.6	-	10	1943	c.1832G>A	c.(1831-1833)cGg>cAg	p.R611Q		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	611					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGTGAACCTCCGCAGGAAGTC	0.592																																					p.R611Q		Atlas-SNP	.											.	ATP10A	270	.	0			c.G1832A						.						46.0	51.0	49.0					15																	25959333		2203	4300	6503	SO:0001583	missense	57194	exon10			AACCTCCGCAGGA	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1832G>A	chr15.hg19:g.25959333C>T	ENSP00000349325:p.Arg611Gln	16.0	0.0		31.0	12.0	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	hg19	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	9.027	0.986406	0.18889	.	.	ENSG00000206190	ENST00000356865	T	0.10005	2.92	4.41	2.49	0.30216	HAD-like domain (1);	0.269079	0.37437	N	0.002095	T	0.05868	0.0153	N	0.21194	0.64	0.39530	D	0.968651	B	0.25521	0.128	B	0.20955	0.032	T	0.32903	-0.9889	10	0.09084	T	0.74	-30.2031	8.8515	0.35203	0.149:0.7722:0.0:0.0788	.	611	O60312	AT10A_HUMAN	Q	611	ENSP00000349325:R611Q	ENSP00000349325:R611Q	R	-	2	0	ATP10A	23510426	0.994000	0.37717	0.026000	0.17262	0.057000	0.15508	4.174000	0.58256	0.484000	0.27630	-0.140000	0.14226	CGG	.	.		0.592	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
HERC2	8924	hgsc.bcm.edu	37	15	28457606	28457606	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr15:28457606T>A	ENST00000261609.7	-	43	7018	c.6910A>T	c.(6910-6912)Aaa>Taa	p.K2304*		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAGGCCTGTTTAGTCGATTTC	0.453																																					p.K2304X		Atlas-SNP	.											.	HERC2	501	.	0			c.A6910T						.						107.0	96.0	100.0					15																	28457606		2203	4297	6500	SO:0001587	stop_gained	8924	exon43			CCTGTTTAGTCGA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6910A>T	chr15.hg19:g.28457606T>A	ENSP00000261609:p.Lys2304*	185.0	0.0		921.0	162.0	NM_004667		Nonsense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	46	12.694378	0.99689	.	.	ENSG00000128731	ENST00000261609	.	.	.	4.53	4.53	0.55603	.	0.329464	0.31438	N	0.007648	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	14.0351	0.64640	0.0:0.0:0.0:1.0	.	.	.	.	X	2304	.	ENSP00000261609:K2304X	K	-	1	0	HERC2	26131201	0.996000	0.38824	0.957000	0.39632	0.060000	0.15804	4.343000	0.59348	1.899000	0.54978	0.254000	0.18369	AAA	.	.		0.453	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TYRO3	7301	hgsc.bcm.edu	37	15	41854881	41854881	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr15:41854881G>A	ENST00000263798.3	+	4	769	c.545G>A	c.(544-546)gGa>gAa	p.G182E	TYRO3_ENST00000559066.1_Missense_Mutation_p.G137E	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	182	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AAGATCGGGGGACCCGCTCCC	0.577																																					p.G182E		Atlas-SNP	.											.	TYRO3	169	.	0			c.G545A						.						46.0	44.0	45.0					15																	41854881		2203	4300	6503	SO:0001583	missense	7301	exon4			TCGGGGGACCCGC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.545G>A	chr15.hg19:g.41854881G>A	ENSP00000263798:p.Gly182Glu	42.0	0.0		47.0	31.0	NM_006293	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	hg19	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	g	9.032	0.987648	0.18966	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.74002	-0.8	4.8	-0.989	0.10242	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.625022	0.13249	N	0.402233	T	0.33527	0.0866	N	0.01352	-0.895	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.38156	-0.9674	10	0.02654	T	1	-0.0368	2.956	0.05876	0.5108:0.1131:0.2483:0.1278	.	182	Q06418	TYRO3_HUMAN	E	114;182	ENSP00000263798:G182E	ENSP00000263798:G182E	G	+	2	0	TYRO3	39642173	0.774000	0.28592	0.361000	0.25849	0.892000	0.51952	0.271000	0.18626	-0.094000	0.12374	0.472000	0.43445	GGA	.	.		0.577	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		
CTDSPL2	51496	hgsc.bcm.edu	37	15	44811383	44811383	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr15:44811383G>A	ENST00000260327.4	+	11	1692	c.1129G>A	c.(1129-1131)Gaa>Aaa	p.E377K	CTDSPL2_ENST00000558966.1_Missense_Mutation_p.E377K|CTDSPL2_ENST00000396780.1_Missense_Mutation_p.E305K|CTDSPL2_ENST00000558373.1_Missense_Mutation_p.E305K|CTD-2329K10.1_ENST00000561324.1_RNA	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	377	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		GCTTTTCCGTGAACATTGTGT	0.284																																					p.E377K		Atlas-SNP	.											.	CTDSPL2	31	.	0			c.G1129A						.						26.0	28.0	27.0					15																	44811383		2188	4293	6481	SO:0001583	missense	51496	exon11			TTCCGTGAACATT	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.1129G>A	chr15.hg19:g.44811383G>A	ENSP00000260327:p.Glu377Lys	75.0	0.0		109.0	27.0	NM_016396	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Missense_Mutation	SNP	ENST00000260327.4	hg19	CCDS10110.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164126	0.94727	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	T;T	0.19105	2.17;2.17	5.66	5.66	0.87406	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.55081	0.1898	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.946;0.995	T	0.61496	-0.7051	10	0.87932	D	0	-14.6475	19.7309	0.96181	0.0:0.0:1.0:0.0	.	305;377	Q05D32-2;Q05D32	.;CTSL2_HUMAN	K	377;305	ENSP00000260327:E377K;ENSP00000380000:E305K	ENSP00000260327:E377K	E	+	1	0	CTDSPL2	42598675	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.837000	0.99465	2.669000	0.90835	0.557000	0.71058	GAA	.	.		0.284	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396	
MYO1E	4643	hgsc.bcm.edu	37	15	59464100	59464100	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr15:59464100G>A	ENST00000288235.4	-	22	2875	c.2476C>T	c.(2476-2478)Ctc>Ttc	p.L826F	MIR2116_ENST00000517221.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	826	Myosin tail. {ECO:0000255}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		ACTCACCTGAGGGACACAGAC	0.562																																					p.L826F		Atlas-SNP	.											.	MYO1E	99	.	0			c.C2476T						.						132.0	116.0	121.0					15																	59464100		2191	4291	6482	SO:0001583	missense	4643	exon22			ACCTGAGGGACAC	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2476C>T	chr15.hg19:g.59464100G>A	ENSP00000288235:p.Leu826Phe	49.0	0.0		87.0	19.0	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	hg19	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769950	0.49680	.	.	ENSG00000157483	ENST00000288235	T	0.50001	0.76	5.05	5.05	0.67936	Myosin tail 2 (1);	0.000000	0.85682	D	0.000000	T	0.71117	0.3302	M	0.90145	3.09	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	T	0.76189	-0.3050	10	0.87932	D	0	.	10.2432	0.43326	0.1516:0.0:0.8484:0.0	.	826	Q12965	MYO1E_HUMAN	F	826	ENSP00000288235:L826F	ENSP00000288235:L826F	L	-	1	0	MYO1E	57251392	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	5.563000	0.67352	2.640000	0.89533	0.561000	0.74099	CTC	.	.		0.562	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
ATP2A1	487	hgsc.bcm.edu	37	16	28913552	28913552	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr16:28913552T>C	ENST00000357084.3	+	17	2636	c.2369T>C	c.(2368-2370)gTg>gCg	p.V790A	ATP2A1_ENST00000395503.4_Missense_Mutation_p.V790A|ATP2A1_ENST00000536376.1_Missense_Mutation_p.V665A	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	790	Interacts with phospholamban 2. {ECO:0000250}.				apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CTGATCCCGGTGCAGCTGCTA	0.662																																					p.V790A		Atlas-SNP	.											.	ATP2A1	116	.	0			c.T2369C						.						73.0	78.0	76.0					16																	28913552		2197	4300	6497	SO:0001583	missense	487	exon17			TCCCGGTGCAGCT		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2369T>C	chr16.hg19:g.28913552T>C	ENSP00000349595:p.Val790Ala	58.0	0.0		135.0	44.0	NM_004320	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	hg19	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.107243	0.77096	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.97831	-4.56;-4.56;-4.56	4.95	3.85	0.44370	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98248	0.9420	M	0.82433	2.59	0.58432	D	0.999995	D;P;P	0.56746	0.977;0.618;0.564	P;P;P	0.62649	0.905;0.697;0.625	D	0.98231	1.0483	10	0.87932	D	0	.	9.8633	0.41127	0.0:0.0829:0.0:0.9171	.	665;790;790	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	A	790;790;827;665	ENSP00000349595:V790A;ENSP00000378879:V790A;ENSP00000443101:V665A	ENSP00000349595:V790A	V	+	2	0	ATP2A1	28821053	1.000000	0.71417	0.998000	0.56505	0.805000	0.45488	7.844000	0.86867	0.899000	0.36444	0.459000	0.35465	GTG	.	.		0.662	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
ZNF843	283933	hgsc.bcm.edu	37	16	31448157	31448157	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr16:31448157G>A	ENST00000315678.5	-	2	738	c.14C>T	c.(13-15)cCc>cTc	p.P5L	ZNF843_ENST00000564218.1_Missense_Mutation_p.P5L	NM_001136509.1	NP_001129981.1	Q8N446	ZN843_HUMAN	zinc finger protein 843	5							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|large_intestine(1)|prostate(1)	4						CAGGGCAAAGGGGAGGCTTCT	0.632																																					p.P5L		Atlas-SNP	.											.	ZNF843	14	.	0			c.C14T						.						41.0	40.0	40.0					16																	31448157		692	1591	2283	SO:0001583	missense	283933	exon2			GCAAAGGGGAGGC	BC036762	CCDS45471.1	16p11.2	2013-01-11			ENSG00000176723	ENSG00000176723		"""Zinc fingers, C2H2-type"""	28710	protein-coding gene	gene with protein product						12477932	Standard	NM_001136509		Approved	MGC46336	uc010vfm.1	Q8N446		ENST00000315678.5:c.14C>T	chr16.hg19:g.31448157G>A	ENSP00000322899:p.Pro5Leu	15.0	0.0		41.0	10.0	NM_001136509	A8K4U8	Missense_Mutation	SNP	ENST00000315678.5	hg19	CCDS45471.1	.	.	.	.	.	.	.	.	.	.	G	4.258	0.046949	0.08243	.	.	ENSG00000176723	ENST00000315678	T	0.01725	4.67	1.72	-2.16	0.07080	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.47355	-0.9124	9	0.87932	D	0	.	2.4102	0.04422	0.5072:0.0:0.2543:0.2385	.	5	Q8N446	ZN843_HUMAN	L	5	ENSP00000322899:P5L	ENSP00000322899:P5L	P	-	2	0	ZNF843	31355658	0.005000	0.15991	0.000000	0.03702	0.002000	0.02628	1.208000	0.32345	-0.422000	0.07405	0.411000	0.27672	CCC	.	.		0.632	ZNF843-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432843.1	NM_001136509	
SPIRE2	84501	hgsc.bcm.edu	37	16	89924764	89924764	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr16:89924764G>T	ENST00000378247.3	+	8	1164	c.1121G>T	c.(1120-1122)tGc>tTc	p.C374F	SPIRE2_ENST00000393062.2_Missense_Mutation_p.C374F	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	374					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TCTCTGCCCTGCATCCTCAAC	0.672																																					p.C374F		Atlas-SNP	.											.	SPIRE2	63	.	0			c.G1121T						.						101.0	108.0	106.0					16																	89924764		2198	4299	6497	SO:0001583	missense	84501	exon8			TGCCCTGCATCCT	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.1121G>T	chr16.hg19:g.89924764G>T	ENSP00000367494:p.Cys374Phe	41.0	0.0		60.0	24.0	NM_032451	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Missense_Mutation	SNP	ENST00000378247.3	hg19	CCDS32516.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689927	0.68271	.	.	ENSG00000204991	ENST00000378247;ENST00000393062	T;T	0.46063	0.89;0.88	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	0.993;1.0;0.998;1.0	P;D;D;D	0.91635	0.884;0.999;0.93;0.999	T	0.67677	-0.5609	10	0.48119	T	0.1	-37.2302	17.6972	0.88285	0.0:0.0:1.0:0.0	.	241;374;326;374	Q8WWL2-4;Q8WWL2-2;Q8WWL2-3;Q8WWL2	.;.;.;SPIR2_HUMAN	F	374	ENSP00000367494:C374F;ENSP00000376782:C374F	ENSP00000367494:C374F	C	+	2	0	SPIRE2	88452265	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.927000	0.92846	2.537000	0.85549	0.655000	0.94253	TGC	.	.		0.672	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
PRDM7	11105	hgsc.bcm.edu	37	16	90126813	90126813	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr16:90126813C>G	ENST00000449207.2	-	9	1188	c.1169G>C	c.(1168-1170)aGt>aCt	p.S390T	PRDM7_ENST00000325921.6_Intron|PRDM7_ENST00000407825.1_Intron	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	390					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CCTGGCCATACTCATCCCCAT	0.512																																					p.S390T		Atlas-SNP	.											.	PRDM7	53	.	0			c.G1169C						.						125.0	124.0	125.0					16																	90126813		1943	4133	6076	SO:0001583	missense	11105	exon9			GCCATACTCATCC	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.1169G>C	chr16.hg19:g.90126813C>G	ENSP00000396732:p.Ser390Thr	122.0	0.0		181.0	63.0	NM_001098173	A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	hg19	CCDS45557.1	.	.	.	.	.	.	.	.	.	.	.	0.785	-0.760829	0.02996	.	.	ENSG00000126856	ENST00000449207	T	0.11495	2.77	2.23	-0.309	0.12769	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.51233	D	0.999911	B	0.17038	0.02	B	0.15870	0.014	T	0.42649	-0.9439	8	.	.	.	-8.8469	2.8348	0.05510	0.0:0.4952:0.3051:0.1997	.	390	Q9NQW5	PRDM7_HUMAN	T	390	ENSP00000396732:S390T	.	S	-	2	0	PRDM7	88654314	0.920000	0.31207	0.875000	0.34327	0.328000	0.28507	0.290000	0.18975	0.246000	0.21394	0.485000	0.47835	AGT	.	.		0.512	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1		
SGSM2	9905	hgsc.bcm.edu	37	17	2282393	2282393	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:2282393C>T	ENST00000426855.2	+	22	3003	c.2828C>T	c.(2827-2829)tCg>tTg	p.S943L	SGSM2_ENST00000574563.1_Missense_Mutation_p.S943L|SGSM2_ENST00000268989.3_Missense_Mutation_p.S988L|RP1-59D14.5_ENST00000574290.1_RNA|RP1-59D14.5_ENST00000573007.1_RNA	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	943					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CACATCTCATCGGAGCACTTT	0.547																																					p.S988L		Atlas-SNP	.											.	SGSM2	60	.	0			c.C2963T						.						197.0	139.0	158.0					17																	2282393		2203	4300	6503	SO:0001583	missense	9905	exon23			TCTCATCGGAGCA	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.2828C>T	chr17.hg19:g.2282393C>T	ENSP00000415107:p.Ser943Leu	114.0	0.0		155.0	60.0	NM_014853	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	ENST00000426855.2	hg19	CCDS45570.1	.	.	.	.	.	.	.	.	.	.	C	34	5.352908	0.95830	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.21361	2.01;2.01	5.43	5.43	0.79202	Rab-GAP/TBC domain (3);	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.89840	3.065	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.993;0.993;0.995	T	0.65573	-0.6135	10	0.87932	D	0	-0.0013	18.2136	0.89878	0.0:1.0:0.0:0.0	.	943;943;943;988	O43147-5;B9A6J3;O43147;O43147-2	.;.;SGSM2_HUMAN;.	L	988;943	ENSP00000268989:S988L;ENSP00000415107:S943L	ENSP00000268989:S988L	S	+	2	0	SGSM2	2229143	1.000000	0.71417	0.453000	0.27007	0.952000	0.60782	7.798000	0.85924	2.572000	0.86782	0.561000	0.74099	TCG	.	.		0.547	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
SPAG7	9552	hgsc.bcm.edu	37	17	4864100	4864100	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:4864100T>C	ENST00000206020.3	-	2	201	c.134A>G	c.(133-135)aAa>aGa	p.K45R	SPAG7_ENST00000575142.1_Missense_Mutation_p.K34R|SPAG7_ENST00000573366.1_5'UTR	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	45						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						AAACTCCACTTTCTGTTGTTT	0.478																																					p.K45R		Atlas-SNP	.											.	SPAG7	22	.	0			c.A134G						.						173.0	164.0	167.0					17																	4864100		1880	4117	5997	SO:0001583	missense	9552	exon2			TCCACTTTCTGTT	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.134A>G	chr17.hg19:g.4864100T>C	ENSP00000206020:p.Lys45Arg	136.0	0.0		198.0	151.0	NM_004890	Q96EU5	Missense_Mutation	SNP	ENST00000206020.3	hg19	CCDS42240.1	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151909	0.38021	.	.	ENSG00000091640	ENST00000206020	.	.	.	5.24	5.24	0.73138	Single-stranded nucleic acid binding R3H (1);	0.000000	0.85682	D	0.000000	T	0.53610	0.1807	M	0.65975	2.015	0.80722	D	1	B	0.34290	0.447	B	0.28638	0.092	T	0.58470	-0.7631	9	0.51188	T	0.08	-5.2553	13.1387	0.59423	0.0:0.0:0.0:1.0	.	45	O75391	SPAG7_HUMAN	R	45	.	ENSP00000206020:K45R	K	-	2	0	SPAG7	4804823	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.302000	0.65733	2.202000	0.70862	0.533000	0.62120	AAA	.	.		0.478	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890	
TVP23C	201158	hgsc.bcm.edu	37	17	15449210	15449210	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:15449210T>G	ENST00000225576.3	-	5	446	c.351A>C	c.(349-351)aaA>aaC	p.K117N	TVP23C_ENST00000584811.1_Missense_Mutation_p.K53N|TVP23C_ENST00000438826.3_Missense_Mutation_p.K117N|TVP23C_ENST00000518321.1_Missense_Mutation_p.K117N|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.K117N|TVP23C_ENST00000428082.2_Missense_Mutation_p.K117N|TVP23C_ENST00000519970.1_Missense_Mutation_p.K31N	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	117						integral component of membrane (GO:0016021)											CTGACACAGTTTTATTCTCTT	0.323																																					p.K117N		Atlas-SNP	.											.	.	.	.	0			c.A351C						.						103.0	103.0	103.0					17																	15449210		2203	4297	6500	SO:0001583	missense	201158	exon5			CACAGTTTTATTC	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.351A>C	chr17.hg19:g.15449210T>G	ENSP00000225576:p.Lys117Asn	114.0	0.0		267.0	99.0	NM_145301	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	hg19	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	4.724	0.134640	0.09032	.	.	ENSG00000259024;ENSG00000259024;ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000557349;ENST00000481756;ENST00000519970;ENST00000225576;ENST00000428082;ENST00000438826;ENST00000419890	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	5.17	2.93	0.34026	.	0.215756	0.41097	D	0.000953	T	0.38081	0.1027	L	0.59436	1.845	0.23598	N	0.997326	B;B;B;B	0.34103	0.003;0.437;0.001;0.437	B;B;B;B	0.37091	0.012;0.241;0.007;0.241	T	0.23119	-1.0197	10	0.39692	T	0.17	.	8.451	0.32871	0.0:0.1653:0.0:0.8347	.	117;31;117;117	Q96ET8-2;B4E0Q0;Q96ET8-3;Q96ET8	.;.;.;F18B2_HUMAN	N	117;31;31;31;117;117;117;53	ENSP00000429865:K117N;ENSP00000428961:K31N;ENSP00000225576:K117N;ENSP00000406387:K117N;ENSP00000413355:K117N;ENSP00000409988:K53N	ENSP00000225576:K117N	K	-	3	2	RP11-726O12.1;FAM18B2	15389935	0.034000	0.19679	0.076000	0.20297	0.165000	0.22458	0.090000	0.15025	0.907000	0.36646	0.528000	0.53228	AAA	.	.		0.323	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
MYO15A	51168	hgsc.bcm.edu	37	17	18058480	18058480	+	Missense_Mutation	SNP	G	G	A	rs367717396		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:18058480G>A	ENST00000205890.5	+	46	8619	c.8281G>A	c.(8281-8283)Gtg>Atg	p.V2761M	MYO15A_ENST00000585180.1_Missense_Mutation_p.V25M|MYO15A_ENST00000418233.3_Missense_Mutation_p.V25M	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2761	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V2761M(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GAAGCGGGCCGTGGTCAGCAC	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18625	0.0		0.0	False		,,,				2504	0.0				p.V2761M		Atlas-SNP	.											MYO15A,NS,carcinoma,0,1	MYO15A	268	.	1	Substitution - Missense(1)	lung(1)	c.G8281A						.	G	MET/VAL	0,4220		0,0,2110	45.0	55.0	52.0		8281	4.1	0.5	17		52	1,8447		0,1,4223	no	missense	MYO15A	NM_016239.3	21	0,1,6333	AA,AG,GG		0.0118,0.0,0.0079	possibly-damaging	2761/3531	18058480	1,12667	2110	4224	6334	SO:0001583	missense	51168	exon45			CGGGCCGTGGTCA	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8281G>A	chr17.hg19:g.18058480G>A	ENSP00000205890:p.Val2761Met	19.0	0.0		48.0	25.0	NM_016239	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	hg19	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	G	8.308	0.821400	0.16678	0.0	1.18E-4	ENSG00000091536	ENST00000205890	D	0.89939	-2.59	5.1	4.12	0.48240	.	.	.	.	.	D	0.90631	0.7062	M	0.78049	2.395	0.80722	D	1	P;D	0.64830	0.951;0.994	P;P	0.54965	0.726;0.765	D	0.90331	0.4352	9	0.72032	D	0.01	.	4.8201	0.13387	0.3075:0.0:0.6925:0.0	.	25;2761	B4DFC7;Q9UKN7	.;MYO15_HUMAN	M	2761	ENSP00000205890:V2761M	ENSP00000205890:V2761M	V	+	1	0	MYO15A	17999205	1.000000	0.71417	0.484000	0.27391	0.113000	0.19764	4.470000	0.60175	2.363000	0.80096	0.561000	0.74099	GTG	.	.		0.632	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
TOP3A	7156	hgsc.bcm.edu	37	17	18188782	18188782	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:18188782G>A	ENST00000321105.5	-	14	1864	c.1650C>T	c.(1648-1650)taC>taT	p.Y550Y	TOP3A_ENST00000540524.1_Silent_p.Y80Y|TOP3A_ENST00000542570.1_Silent_p.Y455Y	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	550					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						TGAGGCCCACGTACATCCGGG	0.582																																					p.Y550Y		Atlas-SNP	.											.	TOP3A	85	.	0			c.C1650T						.						120.0	83.0	96.0					17																	18188782		2203	4300	6503	SO:0001819	synonymous_variant	7156	exon14			GCCCACGTACATC	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.1650C>T	chr17.hg19:g.18188782G>A		63.0	0.0		169.0	82.0	NM_004618	A8KA61|B4DK80|D3DXC7|Q13473	Silent	SNP	ENST00000321105.5	hg19	CCDS11194.1																																																																																			.	.		0.582	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
SMCR8	140775	hgsc.bcm.edu	37	17	18221376	18221376	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:18221376G>T	ENST00000406438.3	+	1	2753	c.2273G>T	c.(2272-2274)gGc>gTc	p.G758V		NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	758						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						CCCAGCTATGGCTGCTACGCT	0.522																																					p.G758V		Atlas-SNP	.											.	SMCR8	62	.	0			c.G2273T						.						132.0	113.0	119.0					17																	18221376		2203	4300	6503	SO:0001583	missense	140775	exon1			GCTATGGCTGCTA	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.2273G>T	chr17.hg19:g.18221376G>T	ENSP00000385025:p.Gly758Val	53.0	0.0		101.0	26.0	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	hg19	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096642	0.76870	.	.	ENSG00000176994	ENST00000406438	T	0.25579	1.79	5.55	5.55	0.83447	.	0.166916	0.52532	D	0.000072	T	0.39118	0.1066	L	0.56769	1.78	0.80722	D	1	D	0.56521	0.976	P	0.49421	0.61	T	0.17167	-1.0378	10	0.66056	D	0.02	-13.0526	19.861	0.96785	0.0:0.0:1.0:0.0	.	758	Q8TEV9	SMCR8_HUMAN	V	758	ENSP00000385025:G758V	ENSP00000385025:G758V	G	+	2	0	SMCR8	18162101	1.000000	0.71417	0.727000	0.30756	0.991000	0.79684	9.358000	0.97109	2.767000	0.95098	0.655000	0.94253	GGC	.	.		0.522	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
KRT35	3886	hgsc.bcm.edu	37	17	39635729	39635729	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:39635729T>A	ENST00000393989.1	-	3	623	c.581A>T	c.(580-582)cAg>cTg	p.Q194L	KRT35_ENST00000246639.2_Missense_Mutation_p.Q164L	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	194	Coil 1B.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				CTCCACCAGCTGCCGCAGGGA	0.587																																					p.Q194L		Atlas-SNP	.											.	KRT35	58	.	0			c.A581T						.						86.0	82.0	83.0					17																	39635729		2203	4300	6503	SO:0001583	missense	3886	exon3			ACCAGCTGCCGCA	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.581A>T	chr17.hg19:g.39635729T>A	ENSP00000377558:p.Gln194Leu	75.0	0.0		184.0	16.0	NM_002280	O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	hg19	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	T	17.48	3.399813	0.62177	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.89415	-2.51;-2.51	4.47	4.47	0.54385	Filament (1);	0.000000	0.48767	D	0.000178	D	0.89336	0.6686	M	0.74467	2.265	0.38662	D	0.9521	B	0.31625	0.332	B	0.41036	0.346	D	0.88947	0.3384	10	0.45353	T	0.12	.	8.8939	0.35451	0.1664:0.0:0.0:0.8336	.	194	Q92764	KRT35_HUMAN	L	164;194	ENSP00000246639:Q164L;ENSP00000377558:Q194L	ENSP00000246639:Q164L	Q	-	2	0	KRT35	36889255	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.579000	0.46059	1.988000	0.58038	0.533000	0.62120	CAG	.	.		0.587	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	
MRC2	9902	hgsc.bcm.edu	37	17	60757607	60757607	+	Missense_Mutation	SNP	C	C	T	rs370911684		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:60757607C>T	ENST00000303375.5	+	15	2777	c.2375C>T	c.(2374-2376)tCc>tTc	p.S792F	MRC2_ENST00000446119.2_5'Flank	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	792	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GACCTGGCCTCCCTGCAGTGG	0.657																																					p.S792F		Atlas-SNP	.											.	MRC2	126	.	0			c.C2375T						.						60.0	57.0	58.0					17																	60757607		2203	4300	6503	SO:0001583	missense	9902	exon15			TGGCCTCCCTGCA	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2375C>T	chr17.hg19:g.60757607C>T	ENSP00000307513:p.Ser792Phe	46.0	0.0		131.0	30.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	hg19	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692791	0.68271	.	.	ENSG00000011028	ENST00000303375	T	0.20332	2.08	5.41	4.38	0.52667	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.178752	0.49916	D	0.000121	T	0.38134	0.1029	L	0.42632	1.34	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.13899	-1.0492	10	0.66056	D	0.02	-38.795	15.5958	0.76578	0.0:0.8622:0.1378:0.0	.	792	Q9UBG0	MRC2_HUMAN	F	792	ENSP00000307513:S792F	ENSP00000307513:S792F	S	+	2	0	MRC2	58111339	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	2.425000	0.44723	2.539000	0.85634	0.305000	0.20034	TCC	.	.		0.657	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
ABCA8	10351	hgsc.bcm.edu	37	17	66873752	66873752	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:66873752C>T	ENST00000269080.2	-	31	4124	c.3987G>A	c.(3985-3987)gcG>gcA	p.A1329A	ABCA8_ENST00000586539.1_Silent_p.A1369A|ABCA8_ENST00000430352.2_Silent_p.A1369A	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1329	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TGGGCCACAGCGCGTTCTCCT	0.602																																					p.A1329A		Atlas-SNP	.											.	ABCA8	213	.	0			c.G3987A						.						141.0	120.0	127.0					17																	66873752		2203	4300	6503	SO:0001819	synonymous_variant	10351	exon31			CCACAGCGCGTTC	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3987G>A	chr17.hg19:g.66873752C>T		42.0	0.0		120.0	23.0	NM_007168	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	hg19	CCDS11680.1																																																																																			.	.		0.602	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
CCDC57	284001	hgsc.bcm.edu	37	17	80136965	80136965	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:80136965C>T	ENST00000389641.4	-	9	1348	c.1312G>A	c.(1312-1314)Gaa>Aaa	p.E438K	CCDC57_ENST00000392347.1_Missense_Mutation_p.E438K|CCDC57_ENST00000327026.3_Intron|CCDC57_ENST00000392343.3_Missense_Mutation_p.E438K			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	438										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TGGTCCCTTTCAATGTCATCA	0.607																																					p.E438K		Atlas-SNP	.											.	CCDC57	102	.	0			c.G1312A						.						58.0	63.0	61.0					17																	80136965		2082	4207	6289	SO:0001583	missense	284001	exon9			CCCTTTCAATGTC	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.1312G>A	chr17.hg19:g.80136965C>T	ENSP00000374292:p.Glu438Lys	49.0	0.0		123.0	24.0	NM_198082	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	hg19		.	.	.	.	.	.	.	.	.	.	C	18.40	3.616639	0.66672	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	T;T;T	0.31769	2.72;2.72;1.48	5.52	5.52	0.82312	.	0.149714	0.45606	D	0.000358	T	0.54631	0.1870	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.53315	-0.8456	10	0.48119	T	0.1	-30.6164	14.9303	0.70908	0.0:1.0:0.0:0.0	.	438;438	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	K	438	ENSP00000374292:E438K;ENSP00000376158:E438K;ENSP00000376154:E438K	ENSP00000374292:E438K	E	-	1	0	CCDC57	77730254	0.993000	0.37304	0.472000	0.27241	0.306000	0.27790	3.418000	0.52721	2.581000	0.87130	0.557000	0.71058	GAA	.	.		0.607	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
ARHGAP28	79822	hgsc.bcm.edu	37	18	6887166	6887166	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr18:6887166C>T	ENST00000383472.4	+	12	1568	c.1464C>T	c.(1462-1464)caC>caT	p.H488H	ARHGAP28_ENST00000419673.2_Silent_p.H329H|ARHGAP28_ENST00000262227.3_Silent_p.H436H|ARHGAP28_ENST00000418986.1_Silent_p.H329H|ARHGAP28_ENST00000532996.1_Silent_p.H311H|ARHGAP28_ENST00000531294.1_Silent_p.H324H|ARHGAP28_ENST00000314319.3_Silent_p.H329H|ARHGAP28_ENST00000400091.2_Silent_p.H488H			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	488	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				GAGGGCCTCACGTCAAAGTAC	0.493																																					p.H329H		Atlas-SNP	.											.	ARHGAP28	181	.	0			c.C987T						.						148.0	125.0	133.0					18																	6887166		2203	4300	6503	SO:0001819	synonymous_variant	79822	exon11			GCCTCACGTCAAA	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1464C>T	chr18.hg19:g.6887166C>T		91.0	0.0		106.0	27.0	NM_001010000	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	ENST00000383472.4	hg19																																																																																				.	.		0.493	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
AQP4	361	hgsc.bcm.edu	37	18	24442273	24442273	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr18:24442273G>T	ENST00000383168.4	-	2	448	c.320C>A	c.(319-321)aCc>aAc	p.T107N	AQP4-AS1_ENST00000578701.1_RNA|AQP4_ENST00000583022.1_5'Flank|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|AQP4_ENST00000581374.1_Missense_Mutation_p.T85N|AQP4_ENST00000440832.3_Missense_Mutation_p.T85N	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	107					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					GATCTTCCTGGTGCACACCAT	0.557																																					p.T107N		Atlas-SNP	.											.	AQP4	27	.	0			c.C320A						.						106.0	89.0	95.0					18																	24442273		2203	4300	6503	SO:0001583	missense	361	exon2			TTCCTGGTGCACA	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.320C>A	chr18.hg19:g.24442273G>T	ENSP00000372654:p.Thr107Asn	37.0	0.0		51.0	13.0	NM_001650	P78564	Missense_Mutation	SNP	ENST00000383168.4	hg19	CCDS11889.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.500913	0.64298	.	.	ENSG00000171885	ENST00000383168;ENST00000440832;ENST00000383170	D	0.93019	-3.15	5.57	5.57	0.84162	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.91606	0.7348	L	0.53729	1.69	0.80722	D	1	P	0.40681	0.727	B	0.41174	0.349	D	0.92024	0.5628	10	0.72032	D	0.01	.	12.843	0.57813	0.0748:0.0:0.9252:0.0	.	107	P55087	AQP4_HUMAN	N	107;87;114	ENSP00000372654:T107N	ENSP00000372654:T107N	T	-	2	0	AQP4	22696271	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.462000	0.73526	2.614000	0.88457	0.462000	0.41574	ACC	.	.		0.557	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254914.2	NM_001650, NM_004028	
SLC25A23	79085	hgsc.bcm.edu	37	19	6458301	6458301	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:6458301C>T	ENST00000301454.4	-	2	297	c.191G>A	c.(190-192)gGc>gAc	p.G64D	SLC25A23_ENST00000334510.5_Missense_Mutation_p.G64D	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	64					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						GTCGAGCCCGCCATCTGGGTC	0.577																																					p.G64D		Atlas-SNP	.											.	SLC25A23	43	.	0			c.G191A						.						36.0	30.0	32.0					19																	6458301		2203	4300	6503	SO:0001583	missense	79085	exon2			AGCCCGCCATCTG	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.191G>A	chr19.hg19:g.6458301C>T	ENSP00000301454:p.Gly64Asp	13.0	0.0		13.0	12.0	NM_024103	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	hg19	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079290	0.76528	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000334510	T;T;D	0.83837	0.1;0.1;-1.77	4.72	2.39	0.29439	EF-hand-like domain (1);	0.235256	0.42420	N	0.000713	D	0.86810	0.6022	M	0.90814	3.15	0.52501	D	0.999955	B	0.28291	0.206	B	0.37387	0.248	D	0.84430	0.0576	10	0.56958	D	0.05	-2.5106	11.7402	0.51788	0.3212:0.6788:0.0:0.0	.	64	Q9BV35	SCMC3_HUMAN	D	64	ENSP00000264088:G64D;ENSP00000301454:G64D;ENSP00000334537:G64D	ENSP00000264088:G64D	G	-	2	0	SLC25A23	6409301	0.941000	0.31946	0.002000	0.10522	0.858000	0.48976	2.119000	0.41958	0.325000	0.23359	0.462000	0.41574	GGC	.	.		0.577	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
MAP1S	55201	hgsc.bcm.edu	37	19	17831786	17831786	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:17831786G>C	ENST00000324096.4	+	2	311	c.160G>C	c.(160-162)Gat>Cat	p.D54H	MAP1S_ENST00000544059.2_Missense_Mutation_p.D28H|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	54	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CTGCAACCTTGATGAACAGCT	0.587																																					p.D54H		Atlas-SNP	.											.	MAP1S	74	.	0			c.G160C						.						148.0	130.0	136.0					19																	17831786		2203	4300	6503	SO:0001583	missense	55201	exon2			AACCTTGATGAAC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.160G>C	chr19.hg19:g.17831786G>C	ENSP00000325313:p.Asp54His	65.0	0.0		104.0	23.0	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	hg19	CCDS32954.1	.	.	.	.	.	.	.	.	.	.	g	16.81	3.224656	0.58668	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.21932	1.98;1.98	3.87	3.87	0.44632	.	0.000000	0.49305	D	0.000153	T	0.43700	0.1259	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	0.996;0.998;1.0	D;D;D	0.91635	0.918;0.919;0.999	T	0.46020	-0.9221	10	0.87932	D	0	-16.1082	13.6604	0.62363	0.0:0.0:1.0:0.0	.	28;54;54	B4DH53;A8K940;Q66K74	.;.;MAP1S_HUMAN	H	54;28	ENSP00000325313:D54H;ENSP00000439243:D28H	ENSP00000325313:D54H	D	+	1	0	MAP1S	17692786	1.000000	0.71417	0.487000	0.27428	0.082000	0.17680	6.993000	0.76245	1.863000	0.54032	0.486000	0.48141	GAT	.	.		0.587	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
PDCD2L	84306	hgsc.bcm.edu	37	19	34916969	34916969	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:34916969C>G	ENST00000246535.3	+	7	1068	c.1021C>G	c.(1021-1023)Ccc>Gcc	p.P341A	PDCD2L_ENST00000587065.2_Missense_Mutation_p.P39A|UBA2_ENST00000246548.4_5'Flank|CTD-2588C8.8_ENST00000592220.1_RNA|UBA2_ENST00000439527.2_5'Flank	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	341					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TCATCAGACTCCCATGGAAGA	0.328																																					p.P341A		Atlas-SNP	.											.	PDCD2L	27	.	0			c.C1021G						.						80.0	83.0	82.0					19																	34916969		2203	4300	6503	SO:0001583	missense	84306	exon7			CAGACTCCCATGG	BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.1021C>G	chr19.hg19:g.34916969C>G	ENSP00000246535:p.Pro341Ala	67.0	0.0		67.0	23.0	NM_032346		Missense_Mutation	SNP	ENST00000246535.3	hg19	CCDS12438.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693910	0.30052	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.56	4.53	0.55603	Programmed cell death protein 2, C-terminal (1);	0.103148	0.64402	D	0.000003	T	0.56558	0.1993	L	0.51422	1.61	0.48511	D	0.999668	P	0.48407	0.91	P	0.46237	0.508	T	0.56523	-0.7965	9	0.37606	T	0.19	-15.6775	13.6521	0.62316	0.0:0.9245:0.0:0.0755	.	341	Q9BRP1	PDD2L_HUMAN	A	341	.	ENSP00000246535:P341A	P	+	1	0	PDCD2L	39608809	0.992000	0.36948	0.837000	0.33122	0.117000	0.20001	4.175000	0.58263	1.372000	0.46190	-0.128000	0.14901	CCC	.	.		0.328	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
ZNF227	7770	hgsc.bcm.edu	37	19	44739856	44739856	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:44739856A>T	ENST00000313040.7	+	6	1478	c.1273A>T	c.(1273-1275)Atc>Ttc	p.I425F	ZNF227_ENST00000391961.2_Missense_Mutation_p.I374F|ZNF227_ENST00000589005.1_Missense_Mutation_p.I374F	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				ACATTTTCACATCCATCAGAG	0.488																																					p.I425F		Atlas-SNP	.											.	ZNF227	62	.	0			c.A1273T						.						84.0	87.0	86.0					19																	44739856		2203	4300	6503	SO:0001583	missense	7770	exon6			TTTCACATCCATC	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1273A>T	chr19.hg19:g.44739856A>T	ENSP00000321049:p.Ile425Phe	40.0	0.0		46.0	11.0	NM_182490	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	hg19	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.030064	0.54790	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.01005	5.45;5.45	4.12	4.12	0.48240	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02230	0.0069	L	0.33710	1.025	0.23994	N	0.996235	D;D;P;D	0.65815	0.995;0.993;0.955;0.995	D;P;P;D	0.63597	0.916;0.867;0.679;0.916	T	0.57808	-0.7747	9	0.19147	T	0.46	.	11.7334	0.51750	1.0:0.0:0.0:0.0	.	346;404;377;425	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	F	425;382;374;404;126	ENSP00000321049:I425F;ENSP00000375823:I374F	ENSP00000321049:I425F	I	+	1	0	ZNF227	49431696	0.000000	0.05858	0.997000	0.53966	0.951000	0.60555	-0.378000	0.07446	1.802000	0.52723	0.460000	0.39030	ATC	.	.		0.488	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
ZNF578	147660	hgsc.bcm.edu	37	19	53014087	53014087	+	Silent	SNP	T	T	A	rs556778715		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:53014087T>A	ENST00000421239.2	+	6	697	c.453T>A	c.(451-453)ccT>ccA	p.P151P	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GAAACAAGCCTATTAAAGATC	0.403																																					p.P151P		Atlas-SNP	.											.	.	.	.	0			c.T453A						.						154.0	154.0	154.0					19																	53014087		2203	4300	6503	SO:0001819	synonymous_variant	147660	exon6			CAAGCCTATTAAA	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.453T>A	chr19.hg19:g.53014087T>A		121.0	0.0		168.0	50.0	NM_001099694	B4DR51|I3L1Y6	Silent	SNP	ENST00000421239.2	hg19	CCDS54310.1																																																																																			.	.		0.403	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
ZNF845	91664	hgsc.bcm.edu	37	19	53854648	53854648	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:53854648G>A	ENST00000595091.1	+	5	939	c.720G>A	c.(718-720)gcG>gcA	p.A240A	ZNF845_ENST00000458035.1_Silent_p.A240A			Q96IR2	ZN845_HUMAN	zinc finger protein 845	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						ATTTAGGAGCGAAACAATATA	0.363																																					p.A240A		Atlas-SNP	.											.	ZNF845	101	.	0			c.G720A						.						99.0	83.0	88.0					19																	53854648		692	1591	2283	SO:0001819	synonymous_variant	91664	exon4			AGGAGCGAAACAA	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.720G>A	chr19.hg19:g.53854648G>A		110.0	0.0		149.0	8.0	NM_138374		Silent	SNP	ENST00000595091.1	hg19	CCDS46170.1																																																																																			.	.		0.363	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
TSEN34	79042	hgsc.bcm.edu	37	19	54695669	54695669	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr19:54695669A>G	ENST00000396383.1	+	3	652	c.341A>G	c.(340-342)gAg>gGg	p.E114G	MBOAT7_ENST00000391754.1_5'Flank|MBOAT7_ENST00000474910.1_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|TSEN34_ENST00000396388.2_Missense_Mutation_p.E114G|MBOAT7_ENST00000245615.1_5'Flank|TSEN34_ENST00000302937.4_Missense_Mutation_p.E114G|MBOAT7_ENST00000431666.2_5'Flank|TSEN34_ENST00000429671.2_Missense_Mutation_p.E114G|MBOAT7_ENST00000338624.6_5'Flank			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	114					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAGCTCCTGGAGAAGATTACG	0.627																																					p.E114G	Esophageal Squamous(37;841 964 4869 42824)	Atlas-SNP	.											.	TSEN34	17	.	0			c.A341G						.						44.0	47.0	46.0					19																	54695669		1894	4106	6000	SO:0001583	missense	79042	exon3			TCCTGGAGAAGAT	AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.341A>G	chr19.hg19:g.54695669A>G	ENSP00000379667:p.Glu114Gly	30.0	0.0		46.0	10.0	NM_024075	A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Missense_Mutation	SNP	ENST00000396383.1	hg19	CCDS42609.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.087343	0.55968	.	.	ENSG00000170892	ENST00000455798;ENST00000456872;ENST00000302937;ENST00000429671;ENST00000396383;ENST00000396388	T;T;T;T;T;T	0.67523	-0.26;-0.27;-0.24;-0.25;-0.24;-0.24	4.36	4.36	0.52297	.	0.593383	0.18153	N	0.150014	T	0.57695	0.2071	L	0.47716	1.5	0.33031	D	0.530226	B;B	0.26672	0.156;0.094	B;B	0.21917	0.037;0.023	T	0.65080	-0.6255	10	0.36615	T	0.2	.	11.3906	0.49811	1.0:0.0:0.0:0.0	.	114;114	E7EQB3;Q9BSV6	.;SEN34_HUMAN	G	114;117;114;114;114;114	ENSP00000400743:E114G;ENSP00000408689:E117G;ENSP00000305524:E114G;ENSP00000397402:E114G;ENSP00000379667:E114G;ENSP00000379671:E114G	ENSP00000305524:E114G	E	+	2	0	TSEN34	59387481	0.778000	0.28640	0.928000	0.36995	0.991000	0.79684	1.916000	0.39986	1.761000	0.52028	0.459000	0.35465	GAG	.	.		0.627	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	NM_024075	
DSN1	79980	hgsc.bcm.edu	37	20	35383170	35383170	+	Silent	SNP	C	C	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr20:35383170C>T	ENST00000426836.1	-	10	1329	c.957G>A	c.(955-957)caG>caA	p.Q319Q	DSN1_ENST00000373745.3_Silent_p.Q319Q|DSN1_ENST00000373734.4_Silent_p.Q212Q|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000448110.2_Silent_p.Q303Q|DSN1_ENST00000373740.3_Silent_p.Q247Q|DSN1_ENST00000373750.4_Silent_p.Q319Q	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	319					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				GCTTACCGAGCTGTACTGACA	0.478																																					p.Q319Q		Atlas-SNP	.											.	DSN1	32	.	0			c.G957A						.						97.0	76.0	83.0					20																	35383170		2203	4300	6503	SO:0001819	synonymous_variant	79980	exon10			ACCGAGCTGTACT	AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.957G>A	chr20.hg19:g.35383170C>T		33.0	0.0		74.0	17.0	NM_001145315	B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Silent	SNP	ENST00000426836.1	hg19	CCDS13286.1																																																																																			.	.		0.478	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079043.2	NM_024918	
BACH1	571	hgsc.bcm.edu	37	21	30699058	30699058	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr21:30699058G>A	ENST00000399921.1	+	3	1156	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K	BACH1_ENST00000286800.3_Missense_Mutation_p.E305K	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						TGAAAAATCAGAAGTGACTCC	0.388																																					p.E305K		Atlas-SNP	.											.	BACH1	66	.	0			c.G913A						.						110.0	114.0	113.0					21																	30699058		2203	4300	6503	SO:0001583	missense	571	exon3			AAATCAGAAGTGA	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.913G>A	chr21.hg19:g.30699058G>A	ENSP00000382805:p.Glu305Lys	36.0	0.0		23.0	9.0	NM_206866	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000399921.1	hg19	CCDS13585.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633614	0.47049	.	.	ENSG00000156273	ENST00000286800;ENST00000399921	T;T	0.71817	-0.6;-0.6	5.65	3.8	0.43715	.	0.423319	0.26029	N	0.026773	T	0.53110	0.1776	N	0.19112	0.55	0.09310	N	1	B	0.31680	0.335	B	0.25140	0.058	T	0.26052	-1.0114	10	0.14656	T	0.56	-12.5395	16.7676	0.85528	0.0:0.2164:0.7836:0.0	.	305	O14867	BACH1_HUMAN	K	305	ENSP00000286800:E305K;ENSP00000382805:E305K	ENSP00000286800:E305K	E	+	1	0	BACH1	29620929	0.984000	0.35163	0.004000	0.12327	0.969000	0.65631	4.010000	0.57117	0.891000	0.36235	0.655000	0.94253	GAA	.	.		0.388	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
AIRE	326	hgsc.bcm.edu	37	21	45712255	45712255	+	Missense_Mutation	SNP	C	C	T	rs376901046		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr21:45712255C>T	ENST00000291582.5	+	9	1193	c.1066C>T	c.(1066-1068)Cgg>Tgg	p.R356W	AIRE_ENST00000355347.4_Missense_Mutation_p.R149W|AIRE_ENST00000329347.4_Missense_Mutation_p.R149W	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	356					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		AGAGGAGCCCCGGCCCCAGGA	0.706									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy				C|||	1	0.000199681	0.0	0.0	5008	,	,		14318	0.0		0.0	False		,,,				2504	0.001				p.R356W		Atlas-SNP	.											.	AIRE	61	.	0			c.C1066T						.	C	TRP/ARG,TRP/ARG	0,4268		0,0,2134	12.0	17.0	15.0		1066,475	0.7	0.0	21		15	3,8467		0,3,4232	no	missense,missense	AIRE	NM_000383.2,NM_000658.2	101,101	0,3,6366	TT,TC,CC		0.0354,0.0,0.0236	probably-damaging,probably-damaging	356/546,159/349	45712255	3,12735	2134	4235	6369	SO:0001583	missense	326	exon9	Familial Cancer Database	APECED	GAGCCCCGGCCCC	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.1066C>T	chr21.hg19:g.45712255C>T	ENSP00000291582:p.Arg356Trp	28.0	0.0		32.0	11.0	NM_000383	B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	ENST00000291582.5	hg19	CCDS13706.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053313	0.36181	0.0	3.54E-4	ENSG00000160224	ENST00000291582;ENST00000337909;ENST00000397994;ENST00000355347;ENST00000329347	D;D;D	0.96885	-3.72;-4.16;-4.04	4.27	0.706	0.18133	.	2.392740	0.02114	N	0.055069	D	0.96981	0.9014	L	0.57536	1.79	0.09310	N	1	D;D	0.76494	0.999;0.993	P;P	0.62014	0.897;0.548	D	0.87388	0.2361	10	0.62326	D	0.03	-33.7671	6.2932	0.21071	0.413:0.4236:0.1634:0.0	.	159;356	B2RP50;O43918	.;AIRE_HUMAN	W	356;159;159;149;149	ENSP00000291582:R356W;ENSP00000347505:R149W;ENSP00000331055:R149W	ENSP00000291582:R356W	R	+	1	2	AIRE	44536683	0.000000	0.05858	0.039000	0.18376	0.126000	0.20510	-0.058000	0.11750	0.243000	0.21327	0.462000	0.41574	CGG	.	.		0.706	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195842.2		
PI4KA	5297	hgsc.bcm.edu	37	22	21161719	21161719	+	Missense_Mutation	SNP	T	T	C	rs542084506		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr22:21161719T>C	ENST00000572273.1	-	10	1155	c.925A>G	c.(925-927)Act>Gct	p.T309A	PI4KA_ENST00000255882.6_Missense_Mutation_p.T367A			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	309					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CTGAAGGAAGTGTAGTAGAGA	0.507													T|||	1	0.000199681	0.0008	0.0	5008	,	,		21855	0.0		0.0	False		,,,				2504	0.0				p.T367A	GBM(136;1332 1831 3115 23601 50806)	Atlas-SNP	.											.	PI4KA	313	.	0			c.A1099G						.						175.0	121.0	140.0					22																	21161719		2203	4300	6503	SO:0001583	missense	5297	exon10			AGGAAGTGTAGTA	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.925A>G	chr22.hg19:g.21161719T>C	ENSP00000458238:p.Thr309Ala	45.0	0.0		54.0	28.0	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.34	2.805680	0.50315	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.24	0.382	0.16234	.	0.399434	0.28354	N	0.015648	T	0.27419	0.0673	N	0.08118	0	0.80722	D	1	B;B	0.13145	0.007;0.0	B;B	0.12156	0.007;0.0	T	0.03325	-1.1048	9	0.49607	T	0.09	-17.1863	7.0933	0.25295	0.3425:0.0693:0.0:0.5881	.	367;309	D3DX33;P42356	.;PI4KA_HUMAN	A	309	.	ENSP00000255882:T309A	T	-	1	0	PI4KA	19491719	1.000000	0.71417	0.603000	0.28903	0.986000	0.74619	2.730000	0.47335	0.086000	0.17137	-0.336000	0.08194	ACT	.	.		0.507	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
TCF20	6942	hgsc.bcm.edu	37	22	42607990	42607990	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr22:42607990C>G	ENST00000359486.3	-	1	3458	c.3322G>C	c.(3322-3324)Gta>Cta	p.V1108L	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.V1108L	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GCAGCAATTACTCCCTGAGCA	0.507																																					p.V1108L		Atlas-SNP	.											.	TCF20	164	.	0			c.G3322C						.						78.0	77.0	77.0					22																	42607990		2203	4300	6503	SO:0001583	missense	6942	exon1			CAATTACTCCCTG	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3322G>C	chr22.hg19:g.42607990C>G	ENSP00000352463:p.Val1108Leu	38.0	0.0		52.0	7.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	hg19	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307250	0.81247	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.63580	-0.05;-0.05	5.91	5.91	0.95273	.	0.100298	0.44483	D	0.000454	T	0.52435	0.1734	N	0.19112	0.55	0.80722	D	1	P;P	0.42518	0.782;0.675	B;B	0.43478	0.421;0.241	T	0.45175	-0.9279	10	0.17832	T	0.49	-12.8393	18.4788	0.90804	0.0:1.0:0.0:0.0	.	1108;1108	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	L	1108	ENSP00000352463:V1108L;ENSP00000335561:V1108L	ENSP00000335561:V1108L	V	-	1	0	TCF20	40937934	1.000000	0.71417	0.973000	0.42090	0.940000	0.58332	4.989000	0.63870	2.802000	0.96397	0.655000	0.94253	GTA	.	.		0.507	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
CDKL5	6792	hgsc.bcm.edu	37	X	18622799	18622799	+	Silent	SNP	G	G	A			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chrX:18622799G>A	ENST00000379989.3	+	13	2040	c.1755G>A	c.(1753-1755)ctG>ctA	p.L585L	CDKL5_ENST00000379996.3_Silent_p.L585L|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	585					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					CCCATTCACTGTCTGCACCTC	0.507																																					p.L585L		Atlas-SNP	.											.	CDKL5	124	.	0			c.G1755A						.						146.0	141.0	143.0					X																	18622799		2203	4300	6503	SO:0001819	synonymous_variant	6792	exon12			TTCACTGTCTGCA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.1755G>A	chrX.hg19:g.18622799G>A		36.0	0.0		49.0	32.0	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	hg19	CCDS14186.1																																																																																			.	.		0.507	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
FMR1NB	158521	hgsc.bcm.edu	37	X	147084806	147084806	+	Silent	SNP	A	A	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chrX:147084806A>C	ENST00000370467.3	+	2	437	c.363A>C	c.(361-363)gcA>gcC	p.A121A		NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	121						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)				breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					AAGATTCCGCATTGGAAGCTT	0.358																																					p.A121A		Atlas-SNP	.											.	FMR1NB	51	.	0			c.A363C						.						113.0	105.0	108.0					X																	147084806		2203	4300	6503	SO:0001819	synonymous_variant	158521	exon2			TTCCGCATTGGAA		CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.363A>C	chrX.hg19:g.147084806A>C		113.0	0.0		204.0	13.0	NM_152578	D3DWT3	Silent	SNP	ENST00000370467.3	hg19	CCDS14683.1																																																																																			.	.		0.358	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1	NM_152578	
MT-CO1	4512	hgsc.bcm.edu	37	M	7330	7330	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chrM:7330T>C	ENST00000361624.2	+	1	1427	c.1427T>C	c.(1426-1428)tTc>tCc	p.F476S	MT-ATP6_ENST00000361899.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	476					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTGAGAAGCCTTCGCTTCGAA	0.428																																					p.F476S		Atlas-SNP	.											.	.	.	.	0			c.T1427C						.																																			SO:0001583	missense	5742	exon1			AAGCCTTCGCTTC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1427T>C	chrM.hg19:g.7330T>C	ENSP00000354499:p.Phe476Ser	27.0	0.0		137.0	21.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.428	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
FZD9	8326	hgsc.bcm.edu	37	7	72849249	72849250	+	In_Frame_Ins	INS	-	-	CAG			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr7:72849249_72849250insCAG	ENST00000344575.3	+	1	1141_1142	c.912_913insCAG	c.(913-915)cag>CAGcag	p.305_305Q>QQ		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	305					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCTACGTGATCCAGGAGGGCCT	0.649																																					p.I304delinsIQ	Pancreas(144;909 1878 36867 38226 39554)	Atlas-Indel,Pindel	.											.	FZD9	51	.	0			c.912_913insCAG						.																																			SO:0001652	inframe_insertion	8326	exon1			.	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.913_915dupCAG	chr7.hg19:g.72849250_72849252dupCAG	ENSP00000345785:p.Gln305dup	36.0	0.0		110.0	20.0	NM_003508		In_Frame_Ins	INS	ENST00000344575.3	hg19	CCDS5548.1																																																																																			.	.		0.649	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252120.1		
MAATS1	89876	hgsc.bcm.edu	37	3	119421979	119421980	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:119421979_119421980insC	ENST00000273390.5	+	1	111_112	c.34_35insC	c.(34-36)gccfs	p.A12fs	MAATS1_ENST00000463700.1_Frame_Shift_Ins_p.A12fs	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	12						mitochondrion (GO:0005739)											GGAGCCCCAGGCCCAGCCGCAG	0.639																																					p.A12fs		Atlas-INDEL	.											.	.	.	.	0			c.34_35insC						.																																			SO:0001589	frameshift_variant	89876	exon1			.	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.37dupC	chr3.hg19:g.119421982_119421982dupC	ENSP00000273390:p.Ala12fs	34.0	0.0		95.0	11.0	NM_033364	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Frame_Shift_Ins	INS	ENST00000273390.5	hg19	CCDS2994.1																																																																																			.	.		0.639	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	
ASXL2	55252	hgsc.bcm.edu	37	2	26101043	26101044	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr2:26101043_26101044insG	ENST00000435504.4	-	1	341_342	c.48_49insC	c.(46-51)gccgccfs	p.A17fs	ASXL2_ENST00000272341.4_5'UTR|ASXL2_ENST00000336112.4_5'UTR			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	17					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.A17S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCGTCTTGGCGGCCTCCGCCC	0.663																																					p.A17fs		Atlas-INDEL	.											ASXL2_ENST00000435504,NS,carcinoma,0,1	ASXL2	217	.	1	Substitution - Missense(1)	prostate(1)	c.49_50insC						.																																			SO:0001589	frameshift_variant	55252	exon1			.			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.49dupC	chr2.hg19:g.26101045_26101045dupG	ENSP00000391447:p.Ala17fs	36.0	0.0		127.0	10.0	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Frame_Shift_Ins	INS	ENST00000435504.4	hg19																																																																																				.	.		0.663	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
OPRL1	4987	hgsc.bcm.edu	37	20	62729669	62729676	+	Frame_Shift_Del	DEL	CTGGGGCC	CTGGGGCC	-			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	CTGGGGCC	CTGGGGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr20:62729669_62729676delCTGGGGCC	ENST00000349451.3	+	6	1042_1049	c.630_637delCTGGGGCC	c.(628-639)tactggggcccgfs	p.WGP211fs	OPRL1_ENST00000355631.4_Frame_Shift_Del_p.WGP211fs|OPRL1_ENST00000336866.2_Frame_Shift_Del_p.WGP211fs	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	211					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					CTCAGGATTACTGGGGCCCGGTGTTTGC	0.62																																					p.210_212del		Atlas-Indel,Pindel	.											.	OPRL1	47	.	0			c.629_636del						.																																			SO:0001589	frameshift_variant	4987	exon4			.		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.630_637delCTGGGGCC	chr20.hg19:g.62729669_62729676delCTGGGGCC	ENSP00000336764:p.Trp211fs	116.0	0.0		257.0	19.0	NM_000913	Q8TD34|Q8WYH9|Q9H4K4	Frame_Shift_Del	DEL	ENST00000349451.3	hg19	CCDS13556.1																																																																																			.	.		0.620	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647	
RETNLB	84666	hgsc.bcm.edu	37	3	108474715	108474716	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr3:108474715_108474716insC	ENST00000295755.6	-	3	443_444	c.245_246insG	c.(244-246)tgtfs	p.C82fs	RETNLB_ENST00000482939.1_Intron	NM_032579.2	NP_115968.1	Q9BQ08	RETNB_HUMAN	resistin like beta	82					cell proliferation (GO:0008283)	extracellular region (GO:0005576)				endometrium(1)|kidney(3)|lung(10)|prostate(1)|skin(1)	16						CCCACGAACCACAGCCATAGCC	0.579																																					p.C82fs		Atlas-INDEL	.											.	RETNLB	38	.	0			c.246_247insG						.																																			SO:0001589	frameshift_variant	84666	exon3			.	AF290873	CCDS2953.1	3q13.1	2008-02-05			ENSG00000163515	ENSG00000163515			20388	protein-coding gene	gene with protein product		605645				10921885, 12574343	Standard	NM_032579		Approved	HXCP2, FIZZ2, RELMb	uc003dxh.2	Q9BQ08	OTTHUMG00000159393	ENST00000295755.6:c.246dupG	chr3.hg19:g.108474716_108474716dupC	ENSP00000295755:p.Cys82fs	62.0	0.0		311.0	27.0	NM_032579	Q14D27	Frame_Shift_Ins	INS	ENST00000295755.6	hg19	CCDS2953.1																																																																																			.	.		0.579	RETNLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355093.1		
TP53	7157	hgsc.bcm.edu	37	17	7578454	7578455	+	In_Frame_Ins	INS	-	-	CGCGGA			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:7578454_7578455insCGCGGA	ENST00000269305.4	-	5	664_665	c.475_476insTCCGCG	c.(475-477)gcc>gTCCGCGcc	p.158_159insVR	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_In_Frame_Ins_p.158_159insVR|TP53_ENST00000420246.2_In_Frame_Ins_p.158_159insVR|TP53_ENST00000413465.2_In_Frame_Ins_p.158_159insVR|TP53_ENST00000455263.2_In_Frame_Ins_p.158_159insVR|TP53_ENST00000445888.2_In_Frame_Ins_p.158_159insVR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	158	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A159V(33)|p.A159P(19)|p.0?(8)|p.A159T(7)|p.A159D(7)|p.R158fs(6)|p.R158fs*11(6)|p.A159fs*11(4)|p.A159S(4)|p.R65fs(2)|p.A27P(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R26fs(2)|p.A66P(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.A66V(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.R65fs*11(1)|p.A27V(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGCCATGGCGCGGACGCGG	0.629		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A159delinsVRA	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,bladder,carcinoma,0,1	TP53	33396	.	127	Substitution - Missense(76)|Deletion - Frameshift(18)|Deletion - In frame(12)|Complex(10)|Whole gene deletion(8)|Complex - frameshift(2)|Insertion - In frame(1)	lung(27)|central_nervous_system(20)|large_intestine(15)|oesophagus(10)|stomach(9)|breast(9)|liver(8)|ovary(6)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|urinary_tract(4)|bone(4)|pancreas(2)|thyroid(1)|soft_tissue(1)|endometrium(1)|skin(1)|prostate(1)	c.476_477insTCCGCG						.																																			SO:0001652	inframe_insertion	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.470_475dupTCCGCG	chr17.hg19:g.7578455_7578460dupCGCGGA	ENSP00000269305:p.Val157_Arg158dup	32.0	0.0		33.0	12.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Ins	INS	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.629	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DEPDC1	55635	hgsc.bcm.edu	37	1	68955231	68955232	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:68955231_68955232insT	ENST00000456315.2	-	3	488_489	c.374_375insA	c.(373-375)aacfs	p.N125fs	DEPDC1_ENST00000370966.5_Frame_Shift_Ins_p.N125fs	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	125					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		TCTCTATGTTGTTTTTTCTCAA	0.317																																					p.N125fs		Atlas-Indel,Pindel	.											.	DEPDC1	102	.	0			c.375_376insA						.																																			SO:0001589	frameshift_variant	55635	exon3			.	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.375dupA	chr1.hg19:g.68955237_68955237dupT	ENSP00000412292:p.Asn125fs	157.0	0.0		333.0	29.0	NM_017779	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Frame_Shift_Ins	INS	ENST00000456315.2	hg19	CCDS44159.1																																																																																			.	.		0.317	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779	
USH2A	7399	hgsc.bcm.edu	37	1	216369968	216369974	+	Frame_Shift_Del	DEL	TTTCCTC	TTTCCTC	-			TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	TTTCCTC	TTTCCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr1:216369968_216369974delTTTCCTC	ENST00000307340.3	-	19	4558_4564	c.4172_4178delGAGGAAA	c.(4171-4179)agaggaaaafs	p.RGK1391fs	USH2A_ENST00000366943.2_Frame_Shift_Del_p.RGK1391fs|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366942.3_Frame_Shift_Del_p.RGK1391fs	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1391	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCCCACAACTTTTCCTCTTGTAACATT	0.406										HNSCC(13;0.011)																											p.1391_1393del		Pindel	.											USH2A,NS,carcinoma,0,1	USH2A	1168	.	0			c.4173_4179del	GRCh37	CM071123	USH2A	M		.																																			SO:0001589	frameshift_variant	7399	exon19			.	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4172_4178delGAGGAAA	chr1.hg19:g.216369968_216369974delTTTCCTC	ENSP00000305941:p.Arg1391fs	0.0	0.0		10.0	10.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Frame_Shift_Del	DEL	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	.		0.406	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
BCLAF1	9774	hgsc.bcm.edu	37	6	136582246	136582439	+	Stop_Codon_Del	DEL	TGGTGGGTGCAAGTTCTGCTCTGTTGTAATCTTACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATT	TGGTGGGTGCAAGTTCTGCTCTGTTGTAATCTTACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATT	-	rs376948280|rs537502804|rs562481221|rs527483217|rs62431283|rs112744301|rs62431282|rs370252607|rs570210520|rs111800140|rs193167212|rs375440569	byFrequency	TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	TGGTGGGTGCAAGTTCTGCTCTGTTGTAATCTTACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATT	TGGTGGGTGCAAGTTCTGCTCTGTTGTAATCTTACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:136582246_136582439delTGGTGGGTGCAAGTTCTGCTCTGTTGTAATCTTACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATT	ENST00000531224.1	-	0	2973_3017				BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000530767.1_Stop_Codon_Del|BCLAF1_ENST00000031135.9_Stop_Codon_Del|BCLAF1_ENST00000527536.1_Stop_Codon_Del|BCLAF1_ENST00000353331.4_Stop_Codon_Del|BCLAF1_ENST00000527759.1_Stop_Codon_Del|BCLAF1_ENST00000392348.2_Stop_Codon_Del	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1						apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATTTTATACCTTTTCTTCCTTGCGTCTGTCCTTCTTTTCTTCATTATTTTCCATGG	0.315																																					p.920_921del	Colon(142;1534 1789 5427 7063 28491)	Pindel	.											.	BCLAF1	203	.	0			c.2758_3016del						.																																			SO:0001567	stop_retained_variant	9774	exon13			.	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	Exception_encountered	chr6.hg19:g.136582246_136582439delTGGTGGGTGCAAGTTCTGCTCTGTTGTAATCTTACTTCATATTTATTATTCCTAAAAGAGAGAGAAAAAATTAAAGATTAACAAAAGATGCGGAGAGTGAAAAGGAACCATATTAATAATTGTTCCTAAAAATGAAATAATTCACCCACCAAACCTATATCAAAAAAAATCTGTCAGAATCACAAGTTGAAATT	Exception_encountered	0.0	0.0		14.0	14.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Frame_Shift_Del	DEL	ENST00000531224.1	hg19	CCDS5177.1																																																																																			.	.		0.315	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
QRICH2	84074	hgsc.bcm.edu	37	17	74288539	74288571	+	In_Frame_Del	DEL	CTGCACCAGGTGGGACCAAACCACGCTGATGAT	CTGCACCAGGTGGGACCAAACCACGCTGATGAT	-	rs557984318|rs77671598|rs35035566|rs370061384|rs79093440|rs34007000	byFrequency	TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	CTGCACCAGGTGGGACCAAACCACGCTGATGAT	CTGCACCAGGTGGGACCAAACCACGCTGATGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:74288539_74288571delCTGCACCAGGTGGGACCAAACCACGCTGATGAT	ENST00000262765.5	-	4	1918_1950	c.1739_1771delATCATCAGCGTGGTTTGGTCCCACCTGGTGCAG	c.(1738-1773)gatcatcagcgtggtttggtcccacctggtgcagat>gat	p.580_591DHQRGLVPPGAD>D		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	580	Gln-rich.							p.H581Q(5)|p.Q582R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CCACGCTGATCTGCACCAGGTGGGACCAAACCACGCTGATGATCTGCACGAGG	0.536																																					p.580_591del		Pindel	.											.	QRICH2	143	.	6	Substitution - Missense(6)	kidney(4)|lung(2)	c.1740_1772del						.																																			SO:0001651	inframe_deletion	84074	exon4			.	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1739_1771delATCATCAGCGTGGTTTGGTCCCACCTGGTGCAG	chr17.hg19:g.74288539_74288571delCTGCACCAGGTGGGACCAAACCACGCTGATGAT	ENSP00000262765:p.Asp580_Ala590del	0.0	0.0		12.0	12.0	NM_032134	A2RRE1|Q96LM3	In_Frame_Del	DEL	ENST00000262765.5	hg19	CCDS32741.1																																																																																			.	.		0.536	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
NCAM1	4684	hgsc.bcm.edu	37	11	112832332	112832363	+	5'UTR	DEL	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	-	rs6589347|rs11284059|rs559828324|rs201772924|rs563686839|rs7105734|rs112306738		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr11:112832332_112832363delCATCCCTCCCAGCCAGCAGATTACAATGCTGC	ENST00000533760.1	+	0	243_274				NCAM1_ENST00000397957.4_3'UTR|RP11-629G13.1_ENST00000500537.2_RNA|RP11-629G13.1_ENST00000532002.1_RNA	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CAGCAGATTACAATGCTGCCAAACTAAGGATTTCATTTGGACTTTGTTTTTC	0.491																																					.		Pindel	.											.	NCAM1	372	.	0			.						.																																			SO:0001623	5_prime_UTR_variant	4684	wholegene			.		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.-326CATCCCTCCCAGCCAGCAGATTACAATGCTGC>-	chr11.hg19:g.112832332_112832363delCATCCCTCCCAGCCAGCAGATTACAATGCTGC		0.0	0.0		22.0	22.0	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Frame_Shift_Del	DEL	ENST00000533760.1	hg19																																																																																				.	.		0.491	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
CDC27	996	hgsc.bcm.edu	37	17	45234594	45234729	+	Splice_Site	DEL	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	-	rs149474782|rs113608268|rs370849730|rs78395997|rs76624491|rs370261409|rs75353677|rs368304141|rs376818791|rs372212798|rs375653477|rs374472811|rs76359747|rs147617501|rs374614181|rs78108688|rs142987740|rs143453365|rs75990396|rs144985864|rs367644695|rs202182614|rs139751753|rs11570485|rs372926889|rs140171160|rs368750026|rs201098929|rs199899451|rs75175938|rs200340309|rs537990668	byFrequency	TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr17:45234594_45234729delCTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	ENST00000066544.3	-	6	590_724	c.497_631delAGTTCTTACGGAAACACCCCAGGACACAATTGTAAGTGTCTTATATTCTAGTGTTCAAAATATTATGAAAACTACAAAGAATGATCTGAACTAAATAATATATTGTGAATGACTTGGTAGAAATTTTCTGTTTCAG	c.(496-633)cagttcttacggaaacaccccaggacacaattgtaagtgtcttatattctagtgttcaaaatattatgaaaactacaaagaatgatctgaactaaataatatattgtgaatgacttggtagaaattttctgtttcaga>cga	p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF166fs	CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000531206.1_Splice_Site_p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF166fs|CDC27_ENST00000446365.2_Splice_Site_p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF105fs|CDC27_ENST00000527547.1_Splice_Site_p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF166fs	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	166					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.T167T(7)|p.T171T(3)|p.V201I(2)|p.E199E(2)|p.T200T(2)|p.L173S(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACTGTCTCAGGCTGTCTGTGAGATAAACTATGATTAGGTACTTGTGTTGTGCAAGAGTTGGGCAGACAGTTGCTAAAGTTCTGTAAAGATGTGAATTTAAATGTTTGGTCAGGATC	0.342																																					p.201_211del		Pindel	.											.	CDC27	337	.	17	Substitution - coding silent(14)|Substitution - Missense(3)	large_intestine(6)|prostate(6)|kidney(4)|NS(1)	c.601_631del						.																																			SO:0001630	splice_region_variant	996	exon6			.	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.631-104AGTTCTTACGGAAACACCCCAGGACACAATTGTAAGTGTCTTATATTCTAGTGTTCAAAATATTATGAAAACTACAAAGAATGATCTGAACTAAATAATATATTGTGAATGACTTGGTAGAAATTTTCTGTTTCAG>-	chr17.hg19:g.45234594_45234729delCTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT		0.0	0.0		10.0	10.0	NM_001114091	G3V1C4|Q16349|Q96F35	Frame_Shift_Del	DEL	ENST00000066544.3	hg19	CCDS11509.1																																																																																			.	.		0.342	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		Frame_Shift_Del
CBWD6	644019	hgsc.bcm.edu	37	9	69256787	69256893	+	Splice_Site	DEL	CACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACT	CACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACT	-	rs199904980|rs368164842|rs62557779|rs370995342|rs111966921|rs113407575	byFrequency	TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	CACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACT	CACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr9:69256787_69256893delCACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACT	ENST00000377457.5	-	3	347_444	c.242_339delAGTGCGCTGGAGAAATCCTTAGCTGTCAGCCAAGGTGGAGAGCTCTATGAAGAGTGGCTGGAACTTAGAAACGGTTGCCTCTGCTGTTCAGTGAAGTGAGGAATGTG	c.(241-339)gagtgcgctggagaaatccttagctgtcagccaaggtggagagctctatgaagagtggctggaacttagaaacggttgcctctgctgttcagtgaagtg>g	p.ECAGEILSCQPRWRAL*RVAGT*KRLPLLFSEV81fs	CBWD6_ENST00000377449.1_Splice_Site_p.ECAGEILSCQPRWRAL*RVAGT*KRLPLLFSEV45fs|CBWD6_ENST00000382399.4_Splice_Site_p.ECAGEILSCQPRWRAL*RVAGT*KRLPLLFSEV81fs|CBWD6_ENST00000377441.1_Stop_Codon_Del	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6	81							ATP binding (GO:0005524)			lung(4)	4						TAAACACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACTTCCTAGAATAAATAAC	0.352																																					p.82_113del		Pindel	.											.	CBWD6	19	.	0			c.245_338del						.																																			SO:0001630	splice_region_variant	644019	exon3			.		CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.338+1AGTGCGCTGGAGAAATCCTTAGCTGTCAGCCAAGGTGGAGAGCTCTATGAAGAGTGGCTGGAACTTAGAAACGGTTGCCTCTGCTGTTCAGTGAAGTGAGGAATGTG>-	chr9.hg19:g.69256787_69256893delCACATTCCTCACTTCACTGAACAGCAGAGGCAACCGTTTCTAAGTTCCAGCCACTCTTCATAGAGCTCTCCACCTTGGCTGACAGCTAAGGATTTCTCCAGCGCACT		0.0	0.0		18.0	18.0	NM_001085457		Frame_Shift_Del	DEL	ENST00000377457.5	hg19	CCDS43827.1																																																																																			.	.		0.352	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143172.2	XM_928822	Frame_Shift_Del
CELA1	1990	hgsc.bcm.edu	37	12	51740405	51740433	+	Start_Codon_Del	DEL	CTGGACCATATCCACTTACCATAAAGGAC	CTGGACCATATCCACTTACCATAAAGGAC	-	rs150350903|rs573952082|rs201074609|rs141305161|rs117443541|rs377599213|rs143199509|rs61761206|rs148235680|rs370927847|rs148270827|rs116944010|rs386762976|rs149358345|rs55827519	byFrequency	TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	CTGGACCATATCCACTTACCATAAAGGAC	CTGGACCATATCCACTTACCATAAAGGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr12:51740405_51740433delCTGGACCATATCCACTTACCATAAAGGAC	ENST00000293636.1	-	0	30_57					NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1						exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V3fs*21(1)|p.L4P(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ATATCCACTTACCATAAAGGACCAGCATGTTGCCGATGGAGTAGACCAC	0.524																																					p.3_6del		Pindel	.											.	CELA1	39	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(1)|lung(1)	c.8_16del						.																																			SO:0001582	initiator_codon_variant	1990	exon1			.		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523		chr12.hg19:g.51740405_51740433delCTGGACCATATCCACTTACCATAAAGGAC		0.0	0.0		20.0	20.0	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	In_Frame_Del	DEL	ENST00000293636.1	hg19	CCDS8812.1																																																																																			.	-|0.574;CACCAGGAAGCG|0.426		0.524	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
HLA-A	3105	hgsc.bcm.edu	37	6	29911899	29911900	+	Splice_Site	INS	-	-	C	rs199474608|rs199474609|rs386698554|rs377011235|rs41544717		TCGA-DD-A11A-01A-11D-A12Z-10	TCGA-DD-A11A-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3387dbca-ef9a-4ffe-94f2-e002df056e64	926ba7c3-0c83-4e06-8ba2-ed15ba1f87a5	g.chr6:29911899_29911900insC	ENST00000396634.1	+	6	961_962	c.620_621insC	c.(619-624)gacccc>gaCcccc	p.DP207fs	HLA-A_ENST00000376806.5_Splice_Site_p.DP207fs|HLA-A_ENST00000376809.5_Splice_Site_p.DP207fs|HLA-A_ENST00000376802.2_Splice_Site_p.DP207fs			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	207	Alpha-3.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TTCCCGTCAGACCCCCCCAAGA	0.574									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.D207fs		Pindel	.											.	HLA-A	89	.	0			c.620_621insC						.																																			SO:0001630	splice_region_variant	3105	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	.	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.620-1->C	chr6.hg19:g.29911906_29911906dupC		0.0	0.0		17.0	17.0	NM_002116	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Frame_Shift_Ins	INS	ENST00000396634.1	hg19	CCDS34373.1																																																																																			.	.		0.574	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	Frame_Shift_Ins
