#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KAZN	23254	hgsc.bcm.edu	37	1	14925544	14925544	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr1:14925544G>C	ENST00000376030.2	+	1	345	c.51G>C	c.(49-51)caG>caC	p.Q17H	KAZN_ENST00000422387.2_Missense_Mutation_p.Q17H|KAZN_ENST00000503743.1_Missense_Mutation_p.Q17H	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	17					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GGGCGGTCCAGTCGGCCAGCC	0.667																																					p.Q17H		Atlas-SNP	.											.	KAZN	57	.	0			c.G51C						.						31.0	37.0	35.0					1																	14925544		1967	4136	6103	SO:0001583	missense	23254	exon1			GGTCCAGTCGGCC	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.51G>C	chr1.hg19:g.14925544G>C	ENSP00000365198:p.Gln17His	142.0	1.0		67.0	50.0	NM_015209	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	ENST00000376030.2	hg19	CCDS152.2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280690	0.80692	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387	T;T;T	0.51325	0.71;0.71;0.71	3.98	3.98	0.46160	.	0.124322	0.31268	U	0.007953	T	0.54078	0.1836	L	0.50333	1.59	0.80722	D	1	D;D	0.61080	0.987;0.989	P;P	0.53912	0.693;0.737	T	0.60311	-0.7288	10	0.87932	D	0	-15.2006	13.4971	0.61432	0.0:0.0:1.0:0.0	.	17;17	Q674X7-2;Q674X7	.;KAZRN_HUMAN	H	17	ENSP00000365198:Q17H;ENSP00000426015:Q17H;ENSP00000391728:Q17H	ENSP00000365198:Q17H	Q	+	3	2	KAZN	14798131	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.168000	0.71908	1.739000	0.51704	0.313000	0.20887	CAG	.	.		0.667	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999	
TTC24	164118	hgsc.bcm.edu	37	1	156552954	156552954	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr1:156552954G>T	ENST00000368237.3	+	3	1031	c.1031G>T	c.(1030-1032)cGg>cTg	p.R344L	TTC24_ENST00000368236.3_Missense_Mutation_p.R344L|TTC24_ENST00000478081.1_Intron			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	344										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGCTGCCCGGGACTCTGGT	0.652																																					p.R344L		Atlas-SNP	.											.	TTC24	46	.	0			c.G1031T						.						38.0	41.0	40.0					1																	156552954		1981	4148	6129	SO:0001583	missense	164118	exon4			CTGCCCGGGACTC		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1031G>T	chr1.hg19:g.156552954G>T	ENSP00000357220:p.Arg344Leu	288.0	0.0		253.0	70.0	NM_001105669	Q5T3H7	Missense_Mutation	SNP	ENST00000368237.3	hg19	CCDS53379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.58|12.58	1.981317|1.981317	0.34942|0.34942	.|.	.|.	ENSG00000187862|ENSG00000187862	ENST00000340086;ENST00000413282|ENST00000368236;ENST00000368237	.|D;D	.|0.95035	.|-3.59;-3.59	4.87|4.87	-0.252|-0.252	0.12999|0.12999	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.531595	.|0.15832	.|N	.|0.242466	D|D	0.86900|0.86900	0.6044|0.6044	M|M	0.67700|0.67700	2.07|2.07	0.26495|0.26495	N|N	0.974872|0.974872	.|P	.|0.38992	.|0.653	.|B	.|0.36504	.|0.226	T|T	0.80527|0.80527	-0.1343|-0.1343	5|10	.|0.59425	.|D	.|0.04	-4.733|-4.733	8.948|8.948	0.35771|0.35771	0.5517:0.0:0.4483:0.0|0.5517:0.0:0.4483:0.0	.|.	.|344	.|A2A3L6	.|TTC24_HUMAN	W|L	117;109|344	.|ENSP00000357219:R344L;ENSP00000357220:R344L	.|ENSP00000357219:R344L	G|R	+|+	1|2	0|0	TTC24|TTC24	154819578|154819578	0.949000|0.949000	0.32298|0.32298	0.628000|0.628000	0.29241|0.29241	0.487000|0.487000	0.33371|0.33371	0.722000|0.722000	0.25925|0.25925	0.086000|0.086000	0.17137|0.17137	0.455000|0.455000	0.32223|0.32223	GGG|CGG	.	.		0.652	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
VANGL2	57216	hgsc.bcm.edu	37	1	160388964	160388964	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr1:160388964C>T	ENST00000368061.2	+	4	839	c.365C>T	c.(364-366)aCg>aTg	p.T122M		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	122					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCTTTCCTCACGCCTCTGGCC	0.662																																					p.T122M		Atlas-SNP	.											.	VANGL2	83	.	0			c.C365T						.						59.0	58.0	58.0					1																	160388964		2203	4300	6503	SO:0001583	missense	57216	exon4			TCCTCACGCCTCT	AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.365C>T	chr1.hg19:g.160388964C>T	ENSP00000357040:p.Thr122Met	49.0	0.0		66.0	17.0	NM_020335	D3DVE9|Q5T212	Missense_Mutation	SNP	ENST00000368061.2	hg19	CCDS30915.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057332	0.76074	.	.	ENSG00000162738	ENST00000368061	D	0.83075	-1.68	4.93	3.94	0.45596	.	0.000000	0.85682	D	0.000000	D	0.89608	0.6764	M	0.84219	2.685	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.90763	0.4666	10	0.87932	D	0	-20.8955	13.7554	0.62933	0.0:0.845:0.155:0.0	.	122	Q9ULK5	VANG2_HUMAN	M	122	ENSP00000357040:T122M	ENSP00000357040:T122M	T	+	2	0	VANGL2	158655588	1.000000	0.71417	0.990000	0.47175	0.878000	0.50629	5.635000	0.67841	2.433000	0.82419	0.563000	0.77884	ACG	.	.		0.662	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335	
C1orf226	400793	hgsc.bcm.edu	37	1	162353415	162353415	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr1:162353415C>T	ENST00000458626.2	+	2	933	c.761C>T	c.(760-762)gCa>gTa	p.A254V	C1orf226_ENST00000426197.2_Missense_Mutation_p.A297V	NM_001085375.1	NP_001078844.1	A1L170	CA226_HUMAN	chromosome 1 open reading frame 226	254										central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12						CCTCCTCAGGCACGGACCTCC	0.607																																					p.A297V		Atlas-SNP	.											.	C1orf226	49	.	0			c.C890T						.						21.0	24.0	23.0					1																	162353415		2015	4178	6193	SO:0001583	missense	400793	exon3			CTCAGGCACGGAC	AI480219, AK023199, AK125122, AL512785, BC127743	CCDS44268.1, CCDS53422.1	1q23.3	2013-10-11			ENSG00000239887	ENSG00000239887			34351	protein-coding gene	gene with protein product						14702039	Standard	NM_001085375		Approved	FLJ13137	uc010pkt.1	A1L170	OTTHUMG00000031376	ENST00000458626.2:c.761C>T	chr1.hg19:g.162353415C>T	ENSP00000437071:p.Ala254Val	44.0	0.0		42.0	14.0	NM_001135240	B4DF31	Missense_Mutation	SNP	ENST00000458626.2	hg19	CCDS53422.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459629	0.43736	.	.	ENSG00000239887	ENST00000426197;ENST00000458626	.	.	.	5.62	4.71	0.59529	.	.	.	.	.	T	0.32585	0.0834	N	0.24115	0.695	.	.	.	P;D	0.53619	0.585;0.961	B;P	0.47645	0.399;0.553	T	0.09729	-1.0661	6	.	.	.	-9.5985	18.2171	0.89889	0.0:0.8776:0.1224:0.0	.	297;254	A1L170-2;A1L170	.;CA226_HUMAN	V	297;254	.	.	A	+	2	0	C1orf226	160620039	0.021000	0.18746	0.967000	0.41034	0.070000	0.16714	0.777000	0.26718	0.734000	0.32515	-0.795000	0.03280	GCA	.	.		0.607	C1orf226-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076793.2	NM_001085375	
PIGC	5279	hgsc.bcm.edu	37	1	172413127	172413127	+	Splice_Site	SNP	C	C	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr1:172413127C>A	ENST00000258324.1	-	1	103		c.e1+1		PIGC_ENST00000367728.1_5'UTR|PIGC_ENST00000344529.4_Splice_Site|C1orf105_ENST00000367727.4_Intron|PIGC_ENST00000484368.1_Splice_Site	NM_002642.3|NM_153747.1	NP_002633.1|NP_714969.1	Q92535	PIGC_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class C						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			breast(1)|endometrium(1)|kidney(1)|lung(1)	4						AACCCACCTACCCGAGAGTTC	0.672											OREG0013986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		Atlas-SNP	.											.	PIGC	24	.	0			.						.																																			SO:0001630	splice_region_variant	5279	.			CACCTACCCGAGA	BC006539	CCDS1302.1	1q23-q25	2013-02-26	2006-06-28		ENSG00000135845	ENSG00000135845	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	8960	protein-coding gene	gene with protein product	"""phosphatidylinositol N-acetylglucosaminyltransferase"""	601730	"""phosphatidylinositol glycan, class C"""			8806613, 9325057	Standard	NM_153747		Approved		uc001gio.3	Q92535	OTTHUMG00000034751	ENST00000258324.1:c.230+1G>T	chr1.hg19:g.172413127C>A		100.0	0.0	1900	71.0	43.0	.	O14491	Splice_Site	SNP	ENST00000258324.1	hg19	CCDS1302.1																																																																																			.	.		0.672	PIGC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084065.1	NM_153747	Intron
APOBEC4	403314	hgsc.bcm.edu	37	1	183617170	183617170	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr1:183617170A>T	ENST00000308641.4	-	2	1018	c.747T>A	c.(745-747)aaT>aaA	p.N249K	RGL1_ENST00000304685.4_Intron|APOBEC4_ENST00000481562.1_Intron|RGL1_ENST00000536277.1_Intron	NM_203454.2	NP_982279.1	Q8WW27	ABEC4_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)	249					mRNA processing (GO:0006397)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(6)|skin(1)	21						TTGTGTTTGGATTCCTTTTTG	0.458																																					p.N249K		Atlas-SNP	.											.	APOBEC4	45	.	0			c.T747A						.						102.0	106.0	105.0					1																	183617170		2203	4300	6503	SO:0001583	missense	403314	exon2			GTTTGGATTCCTT	BC021711	CCDS1358.1	1q25.3	2008-02-05	2005-10-27	2005-10-27	ENSG00000173627	ENSG00000173627		"""Apolipoprotein B mRNA editing enzymes"""	32152	protein-coding gene	gene with protein product		609908	"""chromosome 1 open reading frame 169"""	C1orf169		16082223	Standard	NM_203454		Approved	MGC26594, FLJ25691, RP1-127C7.4	uc001gqn.3	Q8WW27	OTTHUMG00000035459	ENST00000308641.4:c.747T>A	chr1.hg19:g.183617170A>T	ENSP00000310622:p.Asn249Lys	841.0	0.0		687.0	181.0	NM_203454	Q8N7F6	Missense_Mutation	SNP	ENST00000308641.4	hg19	CCDS1358.1	.	.	.	.	.	.	.	.	.	.	A	6.837	0.523599	0.13066	.	.	ENSG00000173627	ENST00000308641	T	0.13778	2.56	5.15	3.8	0.43715	.	0.621363	0.14561	N	0.312068	T	0.13970	0.0338	L	0.59436	1.845	0.09310	N	0.999992	B	0.32245	0.361	B	0.33042	0.157	T	0.17992	-1.0351	10	0.56958	D	0.05	-18.7721	5.1447	0.14979	0.7218:0.0:0.2782:0.0	.	249	Q8WW27	ABEC4_HUMAN	K	249	ENSP00000310622:N249K	ENSP00000310622:N249K	N	-	3	2	APOBEC4	181883793	0.985000	0.35326	0.102000	0.21198	0.151000	0.21798	1.019000	0.30014	1.942000	0.56320	0.533000	0.62120	AAT	.	.		0.458	APOBEC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086126.1	NM_203454	
NCKAP5	344148	hgsc.bcm.edu	37	2	133538773	133538773	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr2:133538773T>G	ENST00000409261.1	-	15	5274	c.4901A>C	c.(4900-4902)gAa>gCa	p.E1634A	NCKAP5_ENST00000473859.1_5'UTR|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.E1634A	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1634										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGATCCACTTTCTGTCTGTGG	0.453																																					p.E1634A		Atlas-SNP	.											.	NCKAP5	322	.	0			c.A4901C						.						109.0	107.0	108.0					2																	133538773		1900	4122	6022	SO:0001583	missense	344148	exon15			CCACTTTCTGTCT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4901A>C	chr2.hg19:g.133538773T>G	ENSP00000387128:p.Glu1634Ala	568.0	0.0		275.0	124.0	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.682606	0.47991	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11277	2.79;2.79	5.35	4.21	0.49690	.	0.000000	0.32836	U	0.005599	T	0.11110	0.0271	L	0.29908	0.895	0.80722	D	1	D	0.55385	0.971	P	0.47075	0.536	T	0.03524	-1.1028	10	0.72032	D	0.01	.	9.668	0.39996	0.0:0.0779:0.0:0.9221	.	1634	O14513	NCKP5_HUMAN	A	1634	ENSP00000387128:E1634A;ENSP00000380603:E1634A	ENSP00000380603:E1634A	E	-	2	0	NCKAP5	133255243	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	4.150000	0.58098	1.059000	0.40554	0.533000	0.62120	GAA	.	.		0.453	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
SESTD1	91404	hgsc.bcm.edu	37	2	180036920	180036920	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr2:180036920T>C	ENST00000428443.3	-	5	612	c.296A>G	c.(295-297)aAg>aGg	p.K99R	SESTD1_ENST00000486468.1_5'UTR	NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	99	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTCATCTGGCTTTACCACACA	0.308																																					p.K99R		Atlas-SNP	.											.	SESTD1	66	.	0			c.A296G						.						98.0	101.0	100.0					2																	180036920		2203	4300	6503	SO:0001583	missense	91404	exon5			TCTGGCTTTACCA	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.296A>G	chr2.hg19:g.180036920T>C	ENSP00000415332:p.Lys99Arg	350.0	0.0		195.0	77.0	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	hg19	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.094321	0.36952	.	.	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	D;T;T	0.84442	-1.85;-0.01;-0.01	5.15	5.15	0.70609	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80053	0.4553	N	0.01751	-0.74	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.81656	-0.0834	9	.	.	.	-11.6898	14.9769	0.71281	0.0:0.0:0.0:1.0	.	99	Q86VW0	SESD1_HUMAN	R	99	ENSP00000415332:K99R;ENSP00000416164:K99R;ENSP00000410286:K99R	.	K	-	2	0	SESTD1	179745165	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.958000	0.87877	1.942000	0.56320	0.454000	0.30748	AAG	.	.		0.308	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
TRAK2	66008	hgsc.bcm.edu	37	2	202245372	202245372	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr2:202245372A>T	ENST00000332624.3	-	16	3067	c.2639T>A	c.(2638-2640)tTa>tAa	p.L880*		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	880					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						TCCACCTAATAAACTGCTACC	0.463																																					p.L880X		Atlas-SNP	.											.	TRAK2	62	.	0			c.T2639A						.						76.0	75.0	75.0					2																	202245372		2203	4300	6503	SO:0001587	stop_gained	66008	exon16			CCTAATAAACTGC	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.2639T>A	chr2.hg19:g.202245372A>T	ENSP00000328875:p.Leu880*	236.0	0.0		127.0	52.0	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Nonsense_Mutation	SNP	ENST00000332624.3	hg19	CCDS2347.1	.	.	.	.	.	.	.	.	.	.	A	41	8.904768	0.98998	.	.	ENSG00000115993	ENST00000332624	.	.	.	6.17	6.17	0.99709	.	0.087590	0.44483	D	0.000455	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	.	.	.	X	880	.	ENSP00000328875:L880X	L	-	2	0	TRAK2	201953617	1.000000	0.71417	0.035000	0.18076	0.459000	0.32528	8.627000	0.90974	2.371000	0.80710	0.533000	0.62120	TTA	.	.		0.463	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
OGG1	4968	hgsc.bcm.edu	37	3	9792677	9792677	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr3:9792677A>C	ENST00000344629.7	+	2	529	c.186A>C	c.(184-186)caA>caC	p.Q62H	OGG1_ENST00000302008.8_Missense_Mutation_p.Q62H|OGG1_ENST00000349503.5_Missense_Mutation_p.Q62H|OGG1_ENST00000302003.7_Missense_Mutation_p.Q62H|OGG1_ENST00000449570.2_Missense_Mutation_p.Q62H|OGG1_ENST00000383826.5_Missense_Mutation_p.Q62H|OGG1_ENST00000339511.5_Missense_Mutation_p.Q62H|OGG1_ENST00000302036.7_Missense_Mutation_p.Q62H|OGG1_ENST00000436092.1_3'UTR			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	62					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					TAGCGGATCAAGTATGGACAC	0.577								Base excision repair (BER), DNA glycosylases																													p.Q62H		Atlas-SNP	.											.	OGG1	57	.	0			c.A186C						.						116.0	89.0	98.0					3																	9792677		2203	4300	6503	SO:0001583	missense	4968	exon2			GGATCAAGTATGG	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.186A>C	chr3.hg19:g.9792677A>C	ENSP00000342851:p.Gln62His	139.0	0.0		71.0	24.0	NM_016819	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	hg19	CCDS2581.1	.	.	.	.	.	.	.	.	.	.	A	8.800	0.932625	0.18131	.	.	ENSG00000114026	ENST00000302003;ENST00000344629;ENST00000302036;ENST00000349503;ENST00000339511;ENST00000449570;ENST00000302008;ENST00000383826	T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.54	0.888	0.19206	8-oxoguanine DNA glycosylase, N-terminal (1);Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);	0.248639	0.41605	D	0.000851	T	0.43233	0.1238	N	0.16037	0.36	0.33408	D	0.578254	B;D;D;P;B;P;B;P	0.62365	0.002;0.961;0.991;0.874;0.002;0.874;0.001;0.748	B;P;P;B;B;B;B;B	0.55667	0.03;0.781;0.469;0.335;0.005;0.335;0.0;0.165	T	0.54563	-0.8275	10	0.49607	T	0.09	-2.3299	8.0951	0.30824	0.1389:0.3387:0.5224:0.0	.	62;62;62;62;62;62;62;62	E5KPM8;E5KPM6;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2	.;.;.;.;.;.;OGG1_HUMAN;.	H	62	ENSP00000305584:Q62H;ENSP00000342851:Q62H;ENSP00000306561:Q62H;ENSP00000303132:Q62H;ENSP00000345520:Q62H;ENSP00000403598:Q62H;ENSP00000305527:Q62H;ENSP00000373337:Q62H	ENSP00000305584:Q62H	Q	+	3	2	OGG1	9767677	0.957000	0.32711	0.266000	0.24541	0.156000	0.22039	0.040000	0.13905	0.129000	0.18514	0.533000	0.62120	CAA	.	.		0.577	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
ENTPD3	956	hgsc.bcm.edu	37	3	40442397	40442397	+	Silent	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr3:40442397C>T	ENST00000301825.3	+	4	299	c.181C>T	c.(181-183)Ctg>Ttg	p.L61L	ENTPD3_ENST00000456402.1_Silent_p.L61L|ENTPD3-AS1_ENST00000425156.1_RNA|ENTPD3-AS1_ENST00000452768.1_RNA|ENTPD3-AS1_ENST00000439293.1_RNA|ENTPD3_ENST00000445129.1_Silent_p.L61L	NM_001248.2	NP_001239.2	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase 3	61					nucleoside diphosphate catabolic process (GO:0009134)|nucleoside triphosphate catabolic process (GO:0009143)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		TGGTATTGTGCTGGATGCCGG	0.483																																					p.L61L		Atlas-SNP	.											.	ENTPD3	48	.	0			c.C181T						.						194.0	198.0	197.0					3																	40442397		2203	4300	6503	SO:0001819	synonymous_variant	956	exon4			ATTGTGCTGGATG	AF039917	CCDS2691.1, CCDS74919.1	3p21.3	2004-02-26			ENSG00000168032	ENSG00000168032			3365	protein-coding gene	gene with protein product		603161		CD39L3		9676430	Standard	XM_005265605		Approved	NTPDase-3, HB6	uc003ckd.4	O75355	OTTHUMG00000131390	ENST00000301825.3:c.181C>T	chr3.hg19:g.40442397C>T		439.0	0.0		157.0	68.0	NM_001248	B2R8D0|G5E9N0|O60495|Q8N6K2	Silent	SNP	ENST00000301825.3	hg19	CCDS2691.1																																																																																			.	.		0.483	ENTPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254179.2	NM_001248	
TRPC1	7220	hgsc.bcm.edu	37	3	142525018	142525018	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr3:142525018A>G	ENST00000476941.1	+	13	2809	c.2323A>G	c.(2323-2325)Ata>Gta	p.I775V	TRPC1_ENST00000273482.6_Missense_Mutation_p.I741V	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	775					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						CCGAAATGAAATAAGGGATTT	0.348																																					p.I775V		Atlas-SNP	.											.	TRPC1	82	.	0			c.A2323G						.						78.0	78.0	78.0					3																	142525018		2203	4300	6503	SO:0001583	missense	7220	exon13			AATGAAATAAGGG	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.2323A>G	chr3.hg19:g.142525018A>G	ENSP00000419313:p.Ile775Val	303.0	0.0		219.0	95.0	NM_001251845	Q14CE4	Missense_Mutation	SNP	ENST00000476941.1	hg19	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	A	9.280	1.047830	0.19827	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;T	0.80123	-1.34;-1.34	5.59	5.59	0.84812	.	0.037965	0.85682	D	0.000000	T	0.50599	0.1625	N	0.00313	-1.665	0.46203	D	0.998923	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.55049	-0.8201	10	0.19590	T	0.45	-27.4427	15.7661	0.78128	1.0:0.0:0.0:0.0	.	775;741	P48995;P48995-2	TRPC1_HUMAN;.	V	775;741	ENSP00000419313:I775V;ENSP00000273482:I741V	ENSP00000273482:I741V	I	+	1	0	TRPC1	144007708	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.942000	0.92970	2.134000	0.65973	0.460000	0.39030	ATA	.	.		0.348	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
SLITRK3	22865	hgsc.bcm.edu	37	3	164907129	164907129	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr3:164907129G>A	ENST00000475390.1	-	2	1933	c.1490C>T	c.(1489-1491)cCt>cTt	p.P497L	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P497L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	497					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GAAGGCTGCAGGCTGGATTTC	0.498										HNSCC(40;0.11)																											p.P497L		Atlas-SNP	.											.	SLITRK3	263	.	0			c.C1490T						.						69.0	73.0	71.0					3																	164907129		2203	4300	6503	SO:0001583	missense	22865	exon2			GCTGCAGGCTGGA	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1490C>T	chr3.hg19:g.164907129G>A	ENSP00000420091:p.Pro497Leu	88.0	0.0		43.0	23.0	NM_014926	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	hg19	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738472	0.69304	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.52526	0.66;0.66	5.13	5.13	0.70059	.	0.000000	0.37483	N	0.002077	T	0.67692	0.2920	M	0.61387	1.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68743	-0.5328	10	0.66056	D	0.02	-12.8839	18.7378	0.91763	0.0:0.0:1.0:0.0	.	497	O94933	SLIK3_HUMAN	L	497	ENSP00000420091:P497L;ENSP00000241274:P497L	ENSP00000241274:P497L	P	-	2	0	SLITRK3	166389823	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.830000	0.97506	0.655000	0.94253	CCT	.	.		0.498	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
C6	729	hgsc.bcm.edu	37	5	41201723	41201723	+	Silent	SNP	G	G	A	rs398122811		TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr5:41201723G>A	ENST00000263413.3	-	3	501	c.237C>T	c.(235-237)ccC>ccT	p.P79P	C6_ENST00000337836.5_Silent_p.P79P	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	79	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GGCAGTTGATGGGGCATCTTT	0.428																																					p.P79P		Atlas-SNP	.											C6,NS,carcinoma,0,1	C6	197	.	0			c.C237T	GRCh37	CD961874	C6	D		.						109.0	105.0	106.0					5																	41201723		2203	4300	6503	SO:0001819	synonymous_variant	729	exon3			GTTGATGGGGCAT	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.237C>T	chr5.hg19:g.41201723G>A		456.0	0.0		183.0	79.0	NM_001115131		Silent	SNP	ENST00000263413.3	hg19	CCDS3936.1																																																																																			.	.		0.428	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
PLAC8L1	153770	hgsc.bcm.edu	37	5	145483862	145483862	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr5:145483862C>T	ENST00000311450.4	-	1	70	c.13G>A	c.(13-15)Gga>Aga	p.G5R	RP11-118M9.3_ENST00000514002.1_RNA	NM_001029869.1	NP_001025040.1	A1L4L8	PL8L1_HUMAN	PLAC8-like 1	5										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|stomach(2)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGTTACTTCCAAACCAATTC	0.383																																					p.G5R		Atlas-SNP	.											.	PLAC8L1	17	.	0			c.G13A						.						111.0	109.0	109.0					5																	145483862		2203	4300	6503	SO:0001583	missense	153770	exon1			TACTTCCAAACCA		CCDS34264.1	5q32	2008-02-05			ENSG00000173261	ENSG00000173261			31746	protein-coding gene	gene with protein product							Standard	XM_005268381		Approved		uc003lnv.3	A1L4L8	OTTHUMG00000163418	ENST00000311450.4:c.13G>A	chr5.hg19:g.145483862C>T	ENSP00000309087:p.Gly5Arg	300.0	0.0		135.0	52.0	NM_001029869		Missense_Mutation	SNP	ENST00000311450.4	hg19	CCDS34264.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.262040	0.39995	.	.	ENSG00000173261	ENST00000311450	T	0.47869	0.83	4.65	2.87	0.33458	.	0.426594	0.20221	N	0.096684	T	0.32041	0.0816	L	0.27053	0.805	0.30565	N	0.764089	B	0.22080	0.064	B	0.20767	0.031	T	0.30592	-0.9973	10	0.87932	D	0	-3.1067	6.963	0.24608	0.0:0.7926:0.0:0.2074	.	5	A1L4L8	PL8L1_HUMAN	R	5	ENSP00000309087:G5R	ENSP00000309087:G5R	G	-	1	0	PLAC8L1	145464055	0.996000	0.38824	0.996000	0.52242	0.132000	0.20833	0.281000	0.18810	0.697000	0.31718	0.563000	0.77884	GGA	.	.		0.383	PLAC8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373290.1	XM_087761	
EEF1A1	1915	hgsc.bcm.edu	37	6	74227627	74227628	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr6:74227627_74227628GT>AA	ENST00000316292.9	-	7	2285_2286	c.1294_1295AC>TT	c.(1294-1296)ACa>TTa	p.T432L	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000309268.6_Missense_Mutation_p.T432L|EEF1A1_ENST00000331523.2_Missense_Mutation_p.T432L	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	432					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CACCGCAACTGTCTGTCTCATA	0.401											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T432I|p.T432S		Atlas-SNP	.											.	EEF1A1	56	.	0			c.C1295T|c.A1294T						.																																			SO:0001583	missense	1915	exon8			GCAACTGTCTGTC|CAACTGTCTGTCT	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1294_1295delinsAA	chr6.hg19:g.74227627_74227628delinsAA	ENSP00000339063:p.Thr432Leu	239.0|240.0	0.0	1151	114.0|112.0	40.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1																																																																																			.	.		0.401	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
RNF216	54476	hgsc.bcm.edu	37	7	5681008	5681008	+	Splice_Site	SNP	C	C	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr7:5681008C>A	ENST00000425013.2	-	15	2213		c.e15-1		RNF216_ENST00000389902.3_Splice_Site|RNF216_ENST00000469375.1_Splice_Site	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216						apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TTTTTCTTCACTGAAATAAGA	0.403																																					.		Atlas-SNP	.											.	RNF216	71	.	0			c.1989-1G>T						.						45.0	46.0	45.0					7																	5681008		2203	4300	6503	SO:0001630	splice_region_variant	54476	exon16			TCTTCACTGAAAT	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1989-1G>T	chr7.hg19:g.5681008C>A		127.0	0.0		90.0	42.0	NM_207116	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Splice_Site	SNP	ENST00000425013.2	hg19	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300859	0.81136	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.871	0.88811	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RNF216	5647534	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.194000	0.77789	2.444000	0.82710	0.563000	0.77884	.	.	.		0.403	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	Intron
RAB2A	5862	hgsc.bcm.edu	37	8	61496802	61496802	+	Silent	SNP	G	G	T	rs535641144		TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr8:61496802G>T	ENST00000262646.7	+	4	573	c.222G>T	c.(220-222)tcG>tcT	p.S74S	RAB2A_ENST00000531289.1_Silent_p.S50S|RAB2A_ENST00000530071.1_3'UTR|RAB2A_ENST00000529579.1_Silent_p.S74S	NM_002865.2	NP_002856.1	P61019	RAB2A_HUMAN	RAB2A, member RAS oncogene family	74					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(4)	6			BRCA - Breast invasive adenocarcinoma(89;0.0805)			TCACAAGGTCGTATTACAGAG	0.363																																					p.S74S		Atlas-SNP	.											.	RAB2A	21	.	0			c.G222T						.						157.0	155.0	156.0					8																	61496802		2203	4300	6503	SO:0001819	synonymous_variant	5862	exon4			AAGGTCGTATTAC		CCDS6175.1, CCDS56537.1	8q12.1	2007-01-15	2007-01-15	2007-01-15	ENSG00000104388	ENSG00000104388		"""RAB, member RAS oncogene"""	9763	protein-coding gene	gene with protein product		179509	"""RAB2, member RAS oncogene family"""	RAB2			Standard	NM_002865		Approved		uc003xud.2	P61019	OTTHUMG00000134298	ENST00000262646.7:c.222G>T	chr8.hg19:g.61496802G>T		167.0	0.0		115.0	39.0	NM_002865	B2R5W8|B4DMQ5|P08886	Silent	SNP	ENST00000262646.7	hg19	CCDS6175.1																																																																																			.	.		0.363	RAB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259145.2		
MFSD3	113655	hgsc.bcm.edu	37	8	145735131	145735131	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr8:145735131C>T	ENST00000301327.4	+	1	675	c.415C>T	c.(415-417)Cag>Tag	p.Q139*	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'Flank	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	139	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CAATACCGTGCAGGTGGTCGC	0.692											OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q139X		Atlas-SNP	.											.	MFSD3	17	.	0			c.C415T						.						8.0	8.0	8.0					8																	145735131		2125	4213	6338	SO:0001587	stop_gained	113655	exon1			ACCGTGCAGGTGG		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.415C>T	chr8.hg19:g.145735131C>T	ENSP00000301327:p.Gln139*	50.0	0.0	1696	60.0	27.0	NM_138431		Nonsense_Mutation	SNP	ENST00000301327.4	hg19	CCDS6431.1	.	.	.	.	.	.	.	.	.	.	C	35	5.506859	0.96386	.	.	ENSG00000167700	ENST00000301327	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-18.3085	16.1659	0.81754	0.0:1.0:0.0:0.0	.	.	.	.	X	139	.	ENSP00000301327:Q139X	Q	+	1	0	MFSD3	145705939	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	5.256000	0.65468	2.484000	0.83849	0.561000	0.74099	CAG	.	.		0.692	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
S1PR3	1903	hgsc.bcm.edu	37	9	91616620	91616620	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr9:91616620G>T	ENST00000375846.3	+	1	5200	c.505G>T	c.(505-507)Ggc>Tgc	p.G169C	S1PR3_ENST00000358157.2_Missense_Mutation_p.G169C			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	169					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						CTTCACGCTGGGCGCCCTGCC	0.567											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G169C		Atlas-SNP	.											.	S1PR3	49	.	0			c.G505T						.						164.0	117.0	133.0					9																	91616620		2203	4300	6503	SO:0001583	missense	1903	exon2			ACGCTGGGCGCCC	AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.505G>T	chr9.hg19:g.91616620G>T	ENSP00000365006:p.Gly169Cys	131.0	0.0	1283	50.0	39.0	NM_005226	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	hg19	CCDS6680.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997500	0.74818	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.37584	1.19;1.19	5.41	5.41	0.78517	GPCR, rhodopsin-like superfamily (1);	0.121539	0.56097	D	0.000033	T	0.67297	0.2878	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.72374	-0.4313	10	0.87932	D	0	.	19.3785	0.94521	0.0:0.0:1.0:0.0	.	169	Q99500	S1PR3_HUMAN	C	169	ENSP00000350878:G169C;ENSP00000365006:G169C	ENSP00000350878:G169C	G	+	1	0	S1PR3	90806440	1.000000	0.71417	0.999000	0.59377	0.526000	0.34562	9.478000	0.97927	2.815000	0.96918	0.561000	0.74099	GGC	.	.		0.567	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226	
ALAD	210	hgsc.bcm.edu	37	9	116152930	116152930	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr9:116152930G>A	ENST00000409155.3	-	6	620	c.424C>T	c.(424-426)Cgg>Tgg	p.R142W	ALAD_ENST00000277315.5_Missense_Mutation_p.R125W|ALAD_ENST00000482001.1_5'Flank	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	142					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	TCCTCAGCCCGGAATGCTCCG	0.627																																					p.R142W		Atlas-SNP	.											.	ALAD	36	.	0			c.C424T						.						35.0	37.0	36.0					9																	116152930		2203	4300	6503	SO:0001583	missense	210	exon6			CAGCCCGGAATGC	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.424C>T	chr9.hg19:g.116152930G>A	ENSP00000386284:p.Arg142Trp	54.0	0.0		15.0	9.0	NM_000031	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Missense_Mutation	SNP	ENST00000409155.3	hg19	CCDS6794.2	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652626	0.67472	.	.	ENSG00000148218	ENST00000409155;ENST00000277315	D;D	0.87334	-2.24;-2.24	5.8	4.9	0.64082	Aldolase-type TIM barrel (1);	1.098010	0.06621	N	0.757457	D	0.90017	0.6883	L	0.46157	1.445	0.23459	N	0.997634	D;P;D	0.57899	0.96;0.875;0.981	P;P;P	0.53722	0.594;0.678;0.733	T	0.79769	-0.1664	10	0.62326	D	0.03	1.7263	14.9393	0.70980	0.0:0.0:0.8558:0.1442	.	142;125;171	P13716;B7Z3I9;P13716-2	HEM2_HUMAN;.;.	W	142;125	ENSP00000386284:R142W;ENSP00000277315:R125W	ENSP00000277315:R125W	R	-	1	2	ALAD	115192751	0.995000	0.38212	0.125000	0.21846	0.765000	0.43378	2.472000	0.45136	1.425000	0.47237	0.655000	0.94253	CGG	.	.		0.627	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945	
SLC2A6	11182	hgsc.bcm.edu	37	9	136339125	136339125	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr9:136339125C>A	ENST00000371899.4	-	7	1090	c.1013G>T	c.(1012-1014)cGc>cTc	p.R338L	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Missense_Mutation_p.R338L	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	338					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CAGCACCTTGCGGCCTGCGAG	0.692																																					p.R338L		Atlas-SNP	.											.	SLC2A6	31	.	0			c.G1013T						.						35.0	30.0	32.0					9																	136339125		2201	4299	6500	SO:0001583	missense	11182	exon7			ACCTTGCGGCCTG	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.1013G>T	chr9.hg19:g.136339125C>A	ENSP00000360966:p.Arg338Leu	71.0	0.0		24.0	15.0	NM_017585	A6NNU6|Q5SXD7|Q8NCC2	Missense_Mutation	SNP	ENST00000371899.4	hg19	CCDS6975.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341124	0.81911	.	.	ENSG00000160326	ENST00000371897;ENST00000371899	D;D	0.83914	-1.78;-1.78	5.37	5.37	0.77165	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93552	0.7942	H	0.95679	3.705	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95054	0.8189	10	0.87932	D	0	.	14.6331	0.68671	0.1459:0.8541:0.0:0.0	.	338;338	Q9UGQ3-2;Q9UGQ3	.;GTR6_HUMAN	L	338	ENSP00000360964:R338L;ENSP00000360966:R338L	ENSP00000360964:R338L	R	-	2	0	SLC2A6	135328946	1.000000	0.71417	0.999000	0.59377	0.812000	0.45895	5.449000	0.66619	2.532000	0.85374	0.561000	0.74099	CGC	.	.		0.692	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
SOX6	55553	hgsc.bcm.edu	37	11	15994640	15994640	+	Silent	SNP	T	T	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr11:15994640T>A	ENST00000352083.6	-	16	2279	c.2202A>T	c.(2200-2202)ccA>ccT	p.P734P	SOX6_ENST00000316399.6_Silent_p.P714P|SOX6_ENST00000396356.3_Silent_p.P714P|SOX6_ENST00000527619.1_Silent_p.P710P|SOX6_ENST00000528252.1_Silent_p.P707P|SOX6_ENST00000528429.1_Silent_p.P734P			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	734					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						CTGTGGTGATTGGAATCTGAG	0.443																																					p.P747P		Atlas-SNP	.											.	SOX6	149	.	0			c.A2241T						.						77.0	78.0	78.0					11																	15994640		2200	4294	6494	SO:0001819	synonymous_variant	55553	exon16			GGTGATTGGAATC	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.2202A>T	chr11.hg19:g.15994640T>A		196.0	0.0		125.0	60.0	NM_001145819	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Silent	SNP	ENST00000352083.6	hg19																																																																																				.	.		0.443	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	
SSRP1	6749	hgsc.bcm.edu	37	11	57100232	57100232	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr11:57100232C>T	ENST00000278412.2	-	6	901	c.635G>A	c.(634-636)gGt>gAt	p.G212D		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	212					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						GTCATAACGACCACGAGGAGT	0.522																																					p.G212D	Colon(89;1000 1340 6884 23013 41819)	Atlas-SNP	.											.	SSRP1	75	.	0			c.G635A						.						91.0	86.0	88.0					11																	57100232		2201	4296	6497	SO:0001583	missense	6749	exon6			TAACGACCACGAG	M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.635G>A	chr11.hg19:g.57100232C>T	ENSP00000278412:p.Gly212Asp	129.0	0.0		83.0	41.0	NM_003146	Q5BJG8	Missense_Mutation	SNP	ENST00000278412.2	hg19	CCDS7952.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.031245	0.54790	.	.	ENSG00000149136	ENST00000278412;ENST00000526696;ENST00000529002	T;T;T	0.64260	-0.09;-0.09;-0.09	5.97	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.84406	0.5465	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89005	0.3424	10	0.87932	D	0	-20.1083	16.2813	0.82687	0.1337:0.8663:0.0:0.0	.	212	Q08945	SSRP1_HUMAN	D	212;115;115	ENSP00000278412:G212D;ENSP00000431154:G115D;ENSP00000434546:G115D	ENSP00000278412:G212D	G	-	2	0	SSRP1	56856808	1.000000	0.71417	0.990000	0.47175	0.098000	0.18820	6.738000	0.74822	1.521000	0.48983	0.561000	0.74099	GGT	.	.		0.522	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1	NM_003146	
OVCH1	341350	hgsc.bcm.edu	37	12	29597095	29597095	+	Silent	SNP	A	A	G			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr12:29597095A>G	ENST00000318184.5	-	24	2999	c.3000T>C	c.(2998-3000)tcT>tcC	p.S1000S	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	1000						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TAGTTCTGTGAGAATTTCTTG	0.408																																					p.S1000S		Atlas-SNP	.											.	OVCH1	195	.	0			c.T3000C						.						200.0	199.0	199.0					12																	29597095		1828	4086	5914	SO:0001819	synonymous_variant	341350	exon24			TCTGTGAGAATTT	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.3000T>C	chr12.hg19:g.29597095A>G		123.0	0.0		73.0	25.0	NM_183378		Silent	SNP	ENST00000318184.5	hg19																																																																																				.	.		0.408	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
KIF21A	55605	hgsc.bcm.edu	37	12	39688230	39688230	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr12:39688230T>C	ENST00000361418.5	-	38	5036	c.5021A>G	c.(5020-5022)aAt>aGt	p.N1674S	KIF21A_ENST00000544797.2_Missense_Mutation_p.N1637S|KIF21A_ENST00000395670.3_Missense_Mutation_p.N1675S|KIF21A_ENST00000361961.3_Missense_Mutation_p.N1661S|KIF21A_ENST00000541463.2_Missense_Mutation_p.N1621S			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1674					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TCATGTTTAATTACTGGCAAT	0.373																																					p.N1674S		Atlas-SNP	.											.	KIF21A	238	.	0			c.A5021G						.						127.0	115.0	119.0					12																	39688230		2203	4300	6503	SO:0001583	missense	55605	exon38			GTTTAATTACTGG	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.5021A>G	chr12.hg19:g.39688230T>C	ENSP00000354878:p.Asn1674Ser	319.0	1.0		104.0	36.0	NM_001173464	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	hg19	CCDS53776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.69|11.69	1.713169|1.713169	0.30413|0.30413	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000552961|ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463	.|T;T;T;T;T;T	.|0.70516	.|-0.47;-0.41;0.4;-0.49;-0.36;-0.48	5.13|5.13	1.5|1.5	0.22942|0.22942	.|.	.|0.122003	.|0.36134	.|N	.|0.002765	T|T	0.72479|0.72479	0.3465|0.3465	L|L	0.34521|0.34521	1.04|1.04	0.30499|0.30499	N|N	0.770573|0.770573	.|D;B;D;D;D;D	.|0.76494	.|0.974;0.005;0.997;0.974;0.99;0.999	.|D;B;D;D;D;D	.|0.77557	.|0.953;0.007;0.97;0.969;0.979;0.99	T|T	0.69847|0.69847	-0.5034|-0.5034	5|10	.|0.54805	.|T	.|0.06	.|.	9.0609|9.0609	0.36433|0.36433	0.0:0.211:0.0:0.789|0.0:0.211:0.0:0.789	.|.	.|1637;1621;1674;1661;1627;661	.|F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8	.|.;.;KI21A_HUMAN;.;.;.	V|S	975|1661;1675;1627;661;655;1637;1674;1621	.|ENSP00000354851:N1661S;ENSP00000379029:N1675S;ENSP00000448792:N655S;ENSP00000445606:N1637S;ENSP00000354878:N1674S;ENSP00000438075:N1621S	.|ENSP00000344501:N1627S	I|N	-|-	1|2	0|0	KIF21A|KIF21A	37974497|37974497	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.305000|0.305000	0.27757|0.27757	0.602000|0.602000	0.24134|0.24134	0.014000|0.014000	0.14944|0.14944	-0.280000|-0.280000	0.10049|0.10049	ATT|AAT	.	.		0.373	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
MORN3	283385	hgsc.bcm.edu	37	12	122097220	122097220	+	Silent	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr12:122097220G>A	ENST00000355329.3	-	2	350	c.180C>T	c.(178-180)gcC>gcT	p.A60A		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	60						nucleus (GO:0005634)				breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		CCTCATAGATGGCTCCTTTCT	0.592																																					p.A60A		Atlas-SNP	.											.	MORN3	20	.	0			c.C180T						.						137.0	108.0	118.0					12																	122097220		2203	4300	6503	SO:0001819	synonymous_variant	283385	exon2			ATAGATGGCTCCT	BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.180C>T	chr12.hg19:g.122097220G>A		210.0	0.0		94.0	33.0	NM_173855	Q86YQ9	Silent	SNP	ENST00000355329.3	hg19	CCDS31917.1																																																																																			.	.		0.592	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402154.1	NM_173855	
TSC22D1	8848	hgsc.bcm.edu	37	13	45147977	45147977	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr13:45147977G>A	ENST00000458659.2	-	1	2724	c.2234C>T	c.(2233-2235)cCc>cTc	p.P745L	TSC22D1_ENST00000501704.2_Intron|TSC22D1_ENST00000460842.1_5'Flank	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	745	Gln-rich.				negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CTGGGTAGAGGGCTGCTGCAC	0.522																																					p.P745L		Atlas-SNP	.											.	TSC22D1	88	.	0			c.C2234T						.						58.0	60.0	59.0					13																	45147977		2203	4300	6503	SO:0001583	missense	8848	exon1			GTAGAGGGCTGCT	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.2234C>T	chr13.hg19:g.45147977G>A	ENSP00000397435:p.Pro745Leu	120.0	0.0		88.0	34.0	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	ENST00000458659.2	hg19	CCDS31966.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811732	0.32053	.	.	ENSG00000102804	ENST00000458659	T	0.36520	1.25	4.77	3.92	0.45320	.	0.515734	0.17667	N	0.166110	T	0.26011	0.0634	L	0.27053	0.805	0.80722	D	1	B	0.27823	0.19	B	0.24006	0.05	T	0.05699	-1.0869	10	0.44086	T	0.13	.	12.1484	0.54036	0.0828:0.0:0.9172:0.0	.	745	Q15714	T22D1_HUMAN	L	745	ENSP00000397435:P745L	ENSP00000397435:P745L	P	-	2	0	TSC22D1	44045977	0.984000	0.35163	0.868000	0.34077	0.849000	0.48306	1.812000	0.38952	1.226000	0.43582	0.462000	0.41574	CCC	.	.		0.522	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
CEP128	145508	hgsc.bcm.edu	37	14	80971304	80971304	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr14:80971304C>A	ENST00000555265.1	-	24	3507	c.3132G>T	c.(3130-3132)tgG>tgT	p.W1044C	CEP128_ENST00000281129.3_Missense_Mutation_p.W1044C|CEP128_ENST00000553717.1_5'UTR			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	1044						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TGTGATCCTGCCAAGAGGATG	0.403																																					p.W1044C		Atlas-SNP	.											.	CEP128	146	.	0			c.G3132T						.						69.0	67.0	67.0					14																	80971304		2203	4300	6503	SO:0001583	missense	145508	exon23			ATCCTGCCAAGAG	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.3132G>T	chr14.hg19:g.80971304C>A	ENSP00000451162:p.Trp1044Cys	78.0	0.0		23.0	7.0	NM_152446	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	hg19	CCDS32130.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.352|4.352	0.064812|0.064812	0.08388|0.08388	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000556061|ENST00000281129;ENST00000555265	.|T;T	.|0.33216	.|1.42;1.42	5.32|5.32	4.42|4.42	0.53409|0.53409	.|.	.|0.500009	.|0.18843	.|N	.|0.129630	T|T	0.18383|0.18383	0.0441|0.0441	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	.|B	.|0.16802	.|0.019	.|B	.|0.16289	.|0.015	T|T	0.04216|0.04216	-1.0968|-1.0968	5|10	.|0.35671	.|T	.|0.21	.|.	12.1086|12.1086	0.53825|0.53825	0.0:0.8287:0.1713:0.0|0.0:0.8287:0.1713:0.0	.|.	.|1044	.|Q6ZU80	.|CE128_HUMAN	S|C	110|1044	.|ENSP00000281129:W1044C;ENSP00000451162:W1044C	.|ENSP00000281129:W1044C	A|W	-|-	1|3	0|0	CEP128|CEP128	80041057|80041057	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.066000|0.066000	0.16364|0.16364	1.978000|1.978000	0.40598|0.40598	1.440000|1.440000	0.47531|0.47531	0.650000|0.650000	0.86243|0.86243	GCA|TGG	.	.		0.403	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
SALL1	6299	hgsc.bcm.edu	37	16	51171120	51171120	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr16:51171120G>A	ENST00000251020.4	-	3	3911	c.3878C>T	c.(3877-3879)cCc>cTc	p.P1293L	SALL1_ENST00000566102.1_3'UTR|SALL1_ENST00000440970.1_Missense_Mutation_p.P1196L|SALL1_ENST00000541611.1_Missense_Mutation_p.P116L	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1293					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GCCGGCCAGGGGAGCATTGGG	0.577																																					p.P1293L	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.C3878T						.						73.0	69.0	70.0					16																	51171120		2198	4300	6498	SO:0001583	missense	6299	exon3			GCCAGGGGAGCAT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3878C>T	chr16.hg19:g.51171120G>A	ENSP00000251020:p.Pro1293Leu	180.0	0.0		44.0	29.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	hg19	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617114	0.46736	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559;ENST00000541611	T;T;T	0.50813	0.73;0.73;0.73	5.8	5.8	0.92144	.	0.050430	0.85682	D	0.000000	T	0.51075	0.1653	L	0.43923	1.385	0.80722	D	1	B;P	0.40180	0.006;0.705	B;B	0.44044	0.006;0.439	T	0.49293	-0.8955	10	0.54805	T	0.06	.	20.0486	0.97617	0.0:0.0:1.0:0.0	.	1293;116	Q9NSC2;F5H733	SALL1_HUMAN;.	L	1293;1196;1257;116	ENSP00000251020:P1293L;ENSP00000407914:P1196L;ENSP00000442827:P116L	ENSP00000251020:P1293L	P	-	2	0	SALL1	49728621	1.000000	0.71417	0.918000	0.36340	0.896000	0.52359	8.040000	0.89188	2.752000	0.94435	0.643000	0.83706	CCC	.	.		0.577	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
MIS12	79003	hgsc.bcm.edu	37	17	5392627	5392627	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr17:5392627C>T	ENST00000381165.3	+	3	998	c.445C>T	c.(445-447)Cag>Tag	p.Q149*	DERL2_ENST00000571968.1_5'Flank|MIS12_ENST00000573759.1_Nonsense_Mutation_p.Q149*	NM_001258217.1|NM_001258219.1|NM_001258220.1|NM_024039.2	NP_001245146.1|NP_001245148.1|NP_001245149.1|NP_076944.1			MIS12 kinetochore complex component											central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(2)	12						AAAAATTGTTCAGGCCAAACT	0.398																																					p.Q149X		Atlas-SNP	.											.	MIS12	19	.	0			c.C445T						.						164.0	160.0	161.0					17																	5392627		2203	4300	6503	SO:0001587	stop_gained	79003	exon2			ATTGTTCAGGCCA	AL136906	CCDS11074.1	17p13.3	2013-07-03	2013-07-03		ENSG00000167842	ENSG00000167842			24967	protein-coding gene	gene with protein product		609178	"""MIS12, MIND kinetochore complex component, homolog (yeast)"", ""MIS12, MIND kinetochore complex component, homolog (S. pombe)"""			11230166, 12515822	Standard	NM_001258217		Approved	MGC2488, hMIS12, KNTC2AP, MTW1	uc031qyj.1	Q9H081	OTTHUMG00000102042	ENST00000381165.3:c.445C>T	chr17.hg19:g.5392627C>T	ENSP00000370557:p.Gln149*	202.0	0.0		102.0	9.0	NM_001258220		Nonsense_Mutation	SNP	ENST00000381165.3	hg19	CCDS11074.1	.	.	.	.	.	.	.	.	.	.	C	36	5.656557	0.96724	.	.	ENSG00000167842	ENST00000381165	.	.	.	5.81	1.25	0.21368	.	0.275260	0.42172	D	0.000743	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-13.354	10.14	0.42730	0.3616:0.4154:0.223:0.0	.	.	.	.	X	149	.	ENSP00000370557:Q149X	Q	+	1	0	MIS12	5333351	0.930000	0.31532	0.990000	0.47175	0.998000	0.95712	1.487000	0.35540	0.022000	0.15160	0.591000	0.81541	CAG	.	.		0.398	MIS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219827.1	NM_024039	
SREBF1	6720	hgsc.bcm.edu	37	17	17719328	17719328	+	Silent	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr17:17719328G>A	ENST00000261646.5	-	12	2413	c.2229C>T	c.(2227-2229)agC>agT	p.S743S	SREBF1_ENST00000355815.4_Silent_p.S773S|SREBF1_ENST00000395757.1_Silent_p.S489S|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000338854.5_Silent_p.S743S	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	743					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						GGCGGGCACTGCTCAGGAAGA	0.677																																					p.S773S		Atlas-SNP	.											.	SREBF1	47	.	0			c.C2319T						.						40.0	43.0	42.0					17																	17719328		2203	4299	6502	SO:0001819	synonymous_variant	6720	exon13			GGCACTGCTCAGG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2229C>T	chr17.hg19:g.17719328G>A		130.0	0.0		57.0	21.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Silent	SNP	ENST00000261646.5	hg19	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134561	0.21123	.	.	ENSG00000072310	ENST00000395751	.	.	.	5.2	-3.49	0.04724	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.0331	12.1669	0.54135	0.4434:0.0:0.5566:0.0	.	.	.	.	X	751	.	.	Q	-	1	0	SREBF1	17660053	1.000000	0.71417	0.575000	0.28536	0.858000	0.48976	0.886000	0.28241	-0.495000	0.06659	-0.291000	0.09656	CAG	.	.		0.677	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
VEZF1	7716	hgsc.bcm.edu	37	17	56052168	56052168	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr17:56052168G>C	ENST00000581208.1	-	6	1272	c.1232C>G	c.(1231-1233)aCt>aGt	p.T411S	VEZF1_ENST00000584396.1_Missense_Mutation_p.T402S	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	411	4 X 7 AA repeats of P-[LV]-T-[IL]-T-[ST]- P.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						GTTTGACATAGTCCCAGACGA	0.468																																					p.T411S		Atlas-SNP	.											.	VEZF1	50	.	0			c.C1232G						.						161.0	157.0	158.0					17																	56052168		2203	4300	6503	SO:0001583	missense	7716	exon6			GACATAGTCCCAG	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1232C>G	chr17.hg19:g.56052168G>C	ENSP00000462337:p.Thr411Ser	333.0	0.0		177.0	74.0	NM_007146		Missense_Mutation	SNP	ENST00000581208.1	hg19	CCDS32687.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883171	0.51908	.	.	ENSG00000136451	ENST00000258963	.	.	.	6.06	6.06	0.98353	.	0.433958	0.28688	N	0.014477	T	0.39279	0.1072	N	0.14661	0.345	0.58432	D	0.999995	P	0.38827	0.649	B	0.33042	0.157	T	0.38265	-0.9669	9	0.54805	T	0.06	-9.2383	20.6208	0.99490	0.0:0.0:1.0:0.0	.	411	Q14119	VEZF1_HUMAN	S	411	.	ENSP00000258963:T411S	T	-	2	0	VEZF1	53407167	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.946000	0.75953	2.882000	0.98803	0.655000	0.94253	ACT	.	.		0.468	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
CLTC	1213	hgsc.bcm.edu	37	17	57738828	57738828	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr17:57738828A>G	ENST00000269122.3	+	8	1466	c.1192A>G	c.(1192-1194)Atc>Gtc	p.I398V	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.I398V	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	398	Globular terminal domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCCAGACACTATCCGTCGGTT	0.448			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.I398V		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.A1192G						.						133.0	121.0	125.0					17																	57738828		2203	4300	6503	SO:0001583	missense	1213	exon8			GACACTATCCGTC	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1192A>G	chr17.hg19:g.57738828A>G	ENSP00000269122:p.Ile398Val	150.0	0.0		83.0	32.0	NM_004859	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	hg19	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.907204	0.52333	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.51817	0.69;0.69	5.78	5.78	0.91487	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58366	0.2117	M	0.73598	2.24	0.80722	D	1	B;B	0.17038	0.0;0.02	B;B	0.37550	0.004;0.253	T	0.56798	-0.7919	10	0.40728	T	0.16	-20.971	16.1215	0.81361	1.0:0.0:0.0:0.0	.	398;398	Q00610;Q00610-2	CLH1_HUMAN;.	V	398	ENSP00000269122:I398V;ENSP00000376763:I398V	ENSP00000269122:I398V	I	+	1	0	CLTC	55093610	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	9.339000	0.96797	2.208000	0.71279	0.528000	0.53228	ATC	.	.		0.448	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
CCDC40	55036	hgsc.bcm.edu	37	17	78011929	78011929	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr17:78011929C>T	ENST00000397545.4	+	2	64	c.37C>T	c.(37-39)Ccg>Tcg	p.P13S	CCDC40_ENST00000374876.4_Missense_Mutation_p.P13S|CCDC40_ENST00000374877.3_Missense_Mutation_p.P13S|CCDC40_ENST00000269318.5_Missense_Mutation_p.P13S|TBC1D16_ENST00000310924.2_5'Flank	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	13					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CAGGTCCCATCCGGAAGATGG	0.418																																					p.P13S		Atlas-SNP	.											.	CCDC40	198	.	0			c.C37T						.						60.0	60.0	60.0					17																	78011929		1831	4080	5911	SO:0001583	missense	55036	exon2			TCCCATCCGGAAG	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.37C>T	chr17.hg19:g.78011929C>T	ENSP00000380679:p.Pro13Ser	110.0	0.0		73.0	35.0	NM_017950	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	hg19	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	C	7.950	0.744705	0.15710	.	.	ENSG00000141519	ENST00000374877;ENST00000269318;ENST00000374876;ENST00000397545	T;T;T;T	0.48201	0.84;0.82;0.84;0.89	3.11	2.14	0.27477	.	.	.	.	.	T	0.33118	0.0852	N	0.14661	0.345	0.09310	N	0.999999	D;B	0.54964	0.969;0.421	P;B	0.50314	0.637;0.055	T	0.09465	-1.0673	9	0.16420	T	0.52	-2.15	6.248	0.20830	0.0:0.8614:0.0:0.1386	.	13;13	Q4G0X9-5;Q4G0X9	.;CCD40_HUMAN	S	13	ENSP00000364011:P13S;ENSP00000269318:P13S;ENSP00000364010:P13S;ENSP00000380679:P13S	ENSP00000269318:P13S	P	+	1	0	CCDC40	75626524	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.401000	0.20948	0.878000	0.35920	0.563000	0.77884	CCG	.	.		0.418	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
STK11	6794	hgsc.bcm.edu	37	19	1221320	1221320	+	Silent	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:1221320G>A	ENST00000326873.7	+	6	2016	c.843G>A	c.(841-843)ccG>ccA	p.P281P		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	281	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in ovarian carcinoma; somatic mutation). {ECO:0000269|PubMed:10429654}.		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.L282fs*3(3)|p.?(2)|p.Y246fs*3(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGCCCCCCGCTCTCTGACC	0.617		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.P281P		Atlas-SNP	.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	.	STK11	410	.	26	Whole gene deletion(20)|Insertion - Frameshift(3)|Unknown(2)|Deletion - Frameshift(1)	cervix(14)|lung(8)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.G843A	GRCh37	CD982962	STK11	D		.						32.0	35.0	34.0					19																	1221320		1919	4103	6022	SO:0001819	synonymous_variant	6794	exon6	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	CCCCCCGCTCTCT	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.843G>A	chr19.hg19:g.1221320G>A		41.0	0.0		43.0	16.0	NM_000455	B2RBX7|E7EW76	Silent	SNP	ENST00000326873.7	hg19	CCDS45896.1																																																																																			.	.		0.617	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
C3	718	hgsc.bcm.edu	37	19	6682236	6682236	+	Missense_Mutation	SNP	G	G	C	rs148227405		TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:6682236G>C	ENST00000245907.6	-	34	4269	c.4177C>G	c.(4177-4179)Cgg>Ggg	p.R1393G	C3_ENST00000599668.1_5'Flank	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1393					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGGTCTCCCCGGTACCTGGAT	0.532																																					p.R1393G		Atlas-SNP	.											.	C3	192	.	0			c.C4177G						.						70.0	64.0	66.0					19																	6682236		2203	4300	6503	SO:0001583	missense	718	exon34			CTCCCCGGTACCT	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4177C>G	chr19.hg19:g.6682236G>C	ENSP00000245907:p.Arg1393Gly	133.0	0.0		55.0	20.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	hg19	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745870	0.30955	.	.	ENSG00000125730	ENST00000245907	T	0.30182	1.54	5.78	4.74	0.60224	Alpha-macroglobulin, receptor-binding (2);	0.654672	0.16237	N	0.223340	T	0.26159	0.0638	L	0.40543	1.245	0.23238	N	0.998061	B	0.30563	0.285	B	0.30716	0.119	T	0.13124	-1.0521	10	0.22109	T	0.4	.	12.8817	0.58020	0.0807:0.0:0.9193:0.0	.	1393	P01024	CO3_HUMAN	G	1393	ENSP00000245907:R1393G	ENSP00000245907:R1393G	R	-	1	2	C3	6633236	0.998000	0.40836	1.000000	0.80357	0.540000	0.34992	2.010000	0.40913	1.407000	0.46875	0.586000	0.80456	CGG	.	G|1.000;A|0.000		0.532	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
RGL3	57139	hgsc.bcm.edu	37	19	11517408	11517408	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:11517408A>T	ENST00000380456.3	-	6	833	c.770T>A	c.(769-771)cTc>cAc	p.L257H	RGL3_ENST00000393423.3_Missense_Mutation_p.L257H|Y_RNA_ENST00000365487.1_RNA	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	257	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						CAAGTCTATGAGGGTCAGCTG	0.632																																					p.L257H	GBM(174;751 2067 17998 27979 33959)	Atlas-SNP	.											.	RGL3	100	.	0			c.T770A						.						43.0	36.0	38.0					19																	11517408		2203	4300	6503	SO:0001583	missense	57139	exon6			TCTATGAGGGTCA	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.770T>A	chr19.hg19:g.11517408A>T	ENSP00000369823:p.Leu257His	61.0	0.0		30.0	18.0	NM_001035223	B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	ENST00000380456.3	hg19	CCDS32910.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.493475	0.44352	.	.	ENSG00000205517	ENST00000342684;ENST00000393423;ENST00000380456	T;T	0.38240	1.15;1.15	4.25	4.25	0.50352	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.200500	0.32769	N	0.005679	T	0.66587	0.2804	M	0.92691	3.335	0.31238	N	0.695552	P;D;P;D	0.89917	0.948;1.0;0.948;1.0	P;D;P;D	0.80764	0.805;0.994;0.805;0.987	T	0.75671	-0.3237	10	0.87932	D	0	.	12.4652	0.55753	1.0:0.0:0.0:0.0	.	257;257;257;54	Q3MIN7;B5ME84;B7ZL22;Q8TEP0	RGL3_HUMAN;.;.;.	H	54;257;257	ENSP00000377075:L257H;ENSP00000369823:L257H	ENSP00000344665:L54H	L	-	2	0	RGL3	11378408	0.001000	0.12720	0.355000	0.25773	0.407000	0.30961	1.302000	0.33459	1.775000	0.52247	0.482000	0.46254	CTC	.	.		0.632	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	
MAST1	22983	hgsc.bcm.edu	37	19	12975699	12975699	+	Silent	SNP	G	G	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:12975699G>T	ENST00000251472.4	+	13	1482	c.1443G>T	c.(1441-1443)acG>acT	p.T481T		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						TTGCTGAGACGGTGCTAGCCC	0.582																																					p.T481T		Atlas-SNP	.											.	MAST1	214	.	0			c.G1443T						.						145.0	129.0	135.0					19																	12975699		2203	4300	6503	SO:0001819	synonymous_variant	22983	exon13			TGAGACGGTGCTA	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1443G>T	chr19.hg19:g.12975699G>T		182.0	0.0		54.0	26.0	NM_014975		Silent	SNP	ENST00000251472.4	hg19	CCDS32921.1																																																																																			.	.		0.582	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
BRD4	23476	hgsc.bcm.edu	37	19	15350762	15350762	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:15350762G>A	ENST00000263377.2	-	15	3462	c.3241C>T	c.(3241-3243)Cac>Tac	p.H1081Y		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1081	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGAGACTGGTGGGTCAGGCTC	0.602			T	C15orf55	lethal midline carcinoma of young people																																p.H1081Y		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.C3241T						.						75.0	72.0	73.0					19																	15350762		2203	4300	6503	SO:0001583	missense	23476	exon15			ACTGGTGGGTCAG	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3241C>T	chr19.hg19:g.15350762G>A	ENSP00000263377:p.His1081Tyr	129.0	0.0		96.0	43.0	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	hg19	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.131823	0.37630	.	.	ENSG00000141867	ENST00000263377	T	0.34859	1.34	4.62	3.58	0.41010	.	0.254840	0.27917	N	0.017340	T	0.31888	0.0811	L	0.46157	1.445	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14117	-1.0484	10	0.72032	D	0.01	-9.0751	11.4752	0.50293	0.0904:0.0:0.9096:0.0	.	1081	O60885	BRD4_HUMAN	Y	1081	ENSP00000263377:H1081Y	ENSP00000263377:H1081Y	H	-	1	0	BRD4	15211762	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	9.066000	0.93949	0.915000	0.36847	0.561000	0.74099	CAC	.	.		0.602	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
KIAA0355	9710	hgsc.bcm.edu	37	19	34791642	34791642	+	Silent	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:34791642C>T	ENST00000299505.6	+	2	1137	c.264C>T	c.(262-264)aaC>aaT	p.N88N		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	88										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					ATGCCCTGAACGTCTTCTGCC	0.557																																					p.N88N		Atlas-SNP	.											.	KIAA0355	105	.	0			c.C264T						.						77.0	66.0	70.0					19																	34791642		2203	4300	6503	SO:0001819	synonymous_variant	9710	exon2			CCTGAACGTCTTC		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.264C>T	chr19.hg19:g.34791642C>T		148.0	0.0		72.0	5.0	NM_014686	Q2M3W4	Silent	SNP	ENST00000299505.6	hg19	CCDS12436.1																																																																																			.	.		0.557	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
ZNF302	55900	hgsc.bcm.edu	37	19	35174079	35174079	+	Silent	SNP	A	A	G			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:35174079A>G	ENST00000446502.2	+	5	490	c.282A>G	c.(280-282)ccA>ccG	p.P94P	ZNF302_ENST00000457781.2_Silent_p.P50P|ZNF302_ENST00000423823.2_Silent_p.P50P|ZNF302_ENST00000505242.1_Silent_p.P50P|ZNF302_ENST00000505365.2_Silent_p.P50P|ZNF302_ENST00000509528.1_Intron|ZNF302_ENST00000507959.1_Silent_p.P51P			Q9NR11	ZN302_HUMAN	zinc finger protein 302	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	all_lung(56;6.16e-07)|Lung NSC(56;9.71e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TAACTAAGCCATATGTGATCA	0.413																																					p.P50P		Atlas-SNP	.											.	ZNF302	27	.	0			c.A150G						.						120.0	118.0	119.0					19																	35174079		2203	4300	6503	SO:0001819	synonymous_variant	55900	exon4			TAAGCCATATGTG	AF155656	CCDS46042.1, CCDS74330.1, CCDS74331.1, CCDS74332.1, CCDS74333.1	19q13.2	2013-01-08			ENSG00000089335	ENSG00000089335		"""Zinc fingers, C2H2-type"", ""-"""	13848	protein-coding gene	gene with protein product							Standard	NM_018675		Approved	ZNF327, ZNF135L, ZNF140L	uc002nvq.1	Q9NR11	OTTHUMG00000163329	ENST00000446502.2:c.282A>G	chr19.hg19:g.35174079A>G		175.0	0.0		108.0	44.0	NM_018443	Q658J3|Q9BZD8|Q9P0J4	Silent	SNP	ENST00000446502.2	hg19																																																																																				.	.		0.413	ZNF302-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000372731.1		
KMT2B	9757	hgsc.bcm.edu	37	19	36211168	36211168	+	Missense_Mutation	SNP	T	T	C	rs540162147		TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:36211168T>C	ENST00000222270.7	+	3	919	c.919T>C	c.(919-921)Ttt>Ctt	p.F307L	KMT2B_ENST00000420124.1_Missense_Mutation_p.F307L|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_Missense_Mutation_p.F307L	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	307					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGTGATCAAGTTTGTTTCAAG	0.577													T|||	1	0.000199681	0.0	0.0	5008	,	,		14313	0.0		0.0	False		,,,				2504	0.001				p.F307L		Atlas-SNP	.											.	MLL4	229	.	0			c.T919C						.						18.0	22.0	21.0					19																	36211168		1951	4133	6084	SO:0001583	missense	8085	exon3			ATCAAGTTTGTTT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.919T>C	chr19.hg19:g.36211168T>C	ENSP00000222270:p.Phe307Leu	72.0	0.0		66.0	27.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	T	11.06	1.527193	0.27299	.	.	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.87887	-2.31;-2.31;0.14	4.17	3.14	0.36123	.	0.205285	0.24098	U	0.041575	T	0.74801	0.3764	N	0.14661	0.345	0.30078	N	0.809429	B	0.13594	0.008	B	0.11329	0.006	T	0.69176	-0.5214	10	0.87932	D	0	.	7.5273	0.27662	0.0:0.0:0.2195:0.7805	.	307	Q9UMN6	MLL4_HUMAN	L	307	ENSP00000222270:F307L;ENSP00000398837:F307L;ENSP00000345761:F307L	ENSP00000222270:F307L	F	+	1	0	AD000671.1	40903008	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	2.446000	0.44908	0.611000	0.30052	-0.648000	0.03929	TTT	.	.		0.577	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
KLHDC7B	113730	hgsc.bcm.edu	37	22	50987578	50987578	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr22:50987578G>A	ENST00000395676.2	+	1	1117	c.983G>A	c.(982-984)cGg>cAg	p.R328Q	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	328										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TTCAACCCCCGGGAGAACACC	0.716																																					p.R328Q		Atlas-SNP	.											.	KLHDC7B	39	.	0			c.G983A						.						36.0	46.0	43.0					22																	50987578		2057	4105	6162	SO:0001583	missense	113730	exon1			ACCCCCGGGAGAA	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.983G>A	chr22.hg19:g.50987578G>A	ENSP00000379034:p.Arg328Gln	8.0	0.0		24.0	7.0	NM_138433		Missense_Mutation	SNP	ENST00000395676.2	hg19	CCDS14097.2	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203681	0.38905	.	.	ENSG00000130487	ENST00000395676	T	0.66280	-0.2	4.99	-4.36	0.03645	Kelch-type beta propeller (1);	2.202390	0.02891	N	0.134118	T	0.30103	0.0754	N	0.01576	-0.805	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.33523	-0.9865	10	0.09843	T	0.71	.	9.116	0.36758	0.3541:0.1209:0.5249:0.0	.	328	Q96G42	KLD7B_HUMAN	Q	328	ENSP00000379034:R328Q	ENSP00000379034:R328Q	R	+	2	0	KLHDC7B	49334444	0.000000	0.05858	0.006000	0.13384	0.646000	0.38490	-1.269000	0.02834	-0.685000	0.05177	-0.683000	0.03753	CGG	.	.		0.716	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317089.2	NM_138433	
MTM1	4534	hgsc.bcm.edu	37	X	149814213	149814213	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chrX:149814213C>T	ENST00000370396.2	+	9	790	c.736C>T	c.(736-738)Ctt>Ttt	p.L246F	MTM1_ENST00000413012.2_Missense_Mutation_p.L209F|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.L131F|MTM1_ENST00000542741.1_Missense_Mutation_p.L151F	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	246	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTCAGCCTCTTGTCGGTAT	0.378																																					p.L246F		Atlas-SNP	.											.	MTM1	89	.	0			c.C736T						.						180.0	153.0	162.0					X																	149814213		2203	4300	6503	SO:0001583	missense	4534	exon9			CAGCCTCTTGTCG	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.736C>T	chrX.hg19:g.149814213C>T	ENSP00000359423:p.Leu246Phe	220.0	0.0		119.0	104.0	NM_000252	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	hg19	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677584	0.88445	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43	5.93	5.93	0.95920	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.98137	0.9385	H	0.94183	3.505	0.48087	D	0.999587	D;D	0.59357	0.969;0.985	D;D	0.69142	0.924;0.962	D	0.98900	1.0776	10	0.87932	D	0	.	19.2929	0.94110	0.0:1.0:0.0:0.0	.	209;246	B7Z491;Q13496	.;MTM1_HUMAN	F	246;151;131;209	ENSP00000359423:L246F;ENSP00000444015:L151F;ENSP00000439784:L131F;ENSP00000389157:L209F	ENSP00000359423:L246F	L	+	1	0	MTM1	149564871	0.977000	0.34250	1.000000	0.80357	0.994000	0.84299	2.467000	0.45093	2.508000	0.84585	0.594000	0.82650	CTT	.	.		0.378	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252	
LAMB4	22798	hgsc.bcm.edu	37	7	107704297	107704298	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr7:107704297_107704298delCT	ENST00000388781.3	-	22	3052_3053	c.2969_2970delAG	c.(2968-2970)gagfs	p.E990fs	LAMB4_ENST00000205386.4_Frame_Shift_Del_p.E990fs|LAMB4_ENST00000388780.3_Frame_Shift_Del_p.E990fs	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	990	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ATCGAAGGCACTCCCCTGTTAC	0.51																																					p.990_991del		Atlas-Indel,Pindel	.											.	LAMB4	253	.	0			c.2970_2971del						.																																			SO:0001589	frameshift_variant	22798	exon22			.	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2969_2970delAG	chr7.hg19:g.107704297_107704298delCT	ENSP00000373433:p.Glu990fs	508.0	0.0		180.0	65.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Frame_Shift_Del	DEL	ENST00000388781.3	hg19	CCDS34732.1																																																																																			.	.		0.510	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
AXIN1	8312	hgsc.bcm.edu	37	16	348180	348180	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr16:348180delG	ENST00000262320.3	-	6	1697	c.1326delC	c.(1324-1326)cccfs	p.P442fs	AXIN1_ENST00000481769.1_5'UTR|AXIN1_ENST00000354866.3_Frame_Shift_Del_p.P442fs	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	442	Interaction with CTNNB1. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GGTGCCAAGCGGGGGCGGGAG	0.667											OREG0003699	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A443fs		Atlas-INDEL	.											.,1	AXIN1	290	.	0			c.1327delG						.																																			SO:0001589	frameshift_variant	8312	exon6			.	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1326delC	chr16.hg19:g.348180delG	ENSP00000262320:p.Pro442fs	54.0	0.0	587	11.0	10.0	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Del	DEL	ENST00000262320.3	hg19	CCDS10405.1																																																																																			.	.		0.667	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
ZNF676	163223	hgsc.bcm.edu	37	19	22364225	22364225	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr19:22364225delA	ENST00000397121.2	-	3	611	c.294delT	c.(292-294)tatfs	p.Y98fs		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TAAGTTTATTATAACCTTCTT	0.308																																					p.N99fs		Atlas-Indel,Pindel	.											.	ZNF676	146	.	0			c.295delA						.						134.0	123.0	127.0					19																	22364225		1976	4181	6157	SO:0001589	frameshift_variant	163223	exon3			.	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.294delT	chr19.hg19:g.22364225delA	ENSP00000380310:p.Tyr98fs	565.0	0.0		167.0	78.0	NM_001001411	A8MVX5	Frame_Shift_Del	DEL	ENST00000397121.2	hg19	CCDS42539.1																																																																																			.	.		0.308	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
MUC2	4583	hgsc.bcm.edu	37	11	1096485	1096485	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11B-01A-11D-A12Z-10	TCGA-DD-A11B-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0642c1b7-0644-41ae-b17a-db7e1cffcb72	353422f9-5ae7-40a6-99ef-18d0b2562c39	g.chr11:1096485delG	ENST00000441003.2	+	34	6537	c.6510delG	c.(6508-6510)aagfs	p.K2170fs	MUC2_ENST00000361558.6_Frame_Shift_Del_p.K308fs	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4532					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCAACGACAAGGTGTCCTGTC	0.592																																					p.K2166fs		Atlas-Indel,Pindel	.											.	MUC2	614	.	0			c.6497delA						.						109.0	120.0	116.0					11																	1096485		2183	4268	6451	SO:0001589	frameshift_variant	4583	exon35			.	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6510delG	chr11.hg19:g.1096485delG	ENSP00000415183:p.Lys2170fs	89.0	0.0		49.0	23.0	NM_002457	Q14878	Frame_Shift_Del	DEL	ENST00000441003.2	hg19																																																																																				.	.		0.592	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
