#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF2	65122	hgsc.bcm.edu	37	1	12920107	12920107	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:12920107C>T	ENST00000240189.2	+	3	934	c.847C>T	c.(847-849)Cac>Tac	p.H283Y		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	283					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTTCAGTGGGCACCTGGAACA	0.463																																					p.H283Y		Atlas-SNP	.											.	PRAMEF2	85	.	0			c.C847T						.						80.0	81.0	81.0					1																	12920107		2202	4294	6496	SO:0001583	missense	65122	exon3			AGTGGGCACCTGG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.847C>T	chr1.hg19:g.12920107C>T	ENSP00000240189:p.His283Tyr	91.0	0.0		58.0	20.0	NM_023014		Missense_Mutation	SNP	ENST00000240189.2	hg19	CCDS149.1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214119	0.01555	.	.	ENSG00000120952	ENST00000240189	T	0.00949	5.51	0.833	0.833	0.18875	.	1.018660	0.07819	N	0.959497	T	0.01124	0.0037	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.45659	-0.9246	10	0.39692	T	0.17	.	5.0256	0.14383	0.0:1.0:0.0:0.0	.	283	O60811	PRAM2_HUMAN	Y	283	ENSP00000240189:H283Y	ENSP00000240189:H283Y	H	+	1	0	PRAMEF2	12842694	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.334000	0.07883	0.753000	0.32945	0.184000	0.17185	CAC	.	.		0.463	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
SPEN	23013	hgsc.bcm.edu	37	1	16257658	16257658	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:16257658T>G	ENST00000375759.3	+	11	5127	c.4923T>G	c.(4921-4923)agT>agG	p.S1641R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1641					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGCCTCCAAGTGTCACAGTCG	0.478																																					p.S1641R		Atlas-SNP	.											.	SPEN	374	.	0			c.T4923G						.						154.0	165.0	161.0					1																	16257658		2203	4300	6503	SO:0001583	missense	23013	exon11			TCCAAGTGTCACA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.4923T>G	chr1.hg19:g.16257658T>G	ENSP00000364912:p.Ser1641Arg	68.0	0.0		64.0	20.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	T	10.67	1.415399	0.25552	.	.	ENSG00000065526	ENST00000375759	T	0.09538	2.97	5.28	-4.5	0.03493	.	.	.	.	.	T	0.04679	0.0127	N	0.19112	0.55	0.09310	N	1	P	0.34780	0.468	B	0.32864	0.154	T	0.38693	-0.9649	9	0.30854	T	0.27	0.6893	2.3616	0.04308	0.1527:0.3313:0.0862:0.4298	.	1641	Q96T58	MINT_HUMAN	R	1641	ENSP00000364912:S1641R	ENSP00000364912:S1641R	S	+	3	2	SPEN	16130245	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.769000	0.04710	-0.291000	0.09012	0.383000	0.25322	AGT	.	.		0.478	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
PHC2	1912	hgsc.bcm.edu	37	1	33799862	33799862	+	Silent	SNP	G	G	A	rs370099521		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:33799862G>A	ENST00000257118.5	-	9	1640	c.1587C>T	c.(1585-1587)acC>acT	p.T529T	RN7SKP16_ENST00000410180.1_RNA|MIR3605_ENST00000583214.1_RNA|PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000373422.3_Silent_p.T135T|PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000419414.2_Silent_p.T530T|PHC2_ENST00000431992.1_Silent_p.T500T|PHC2_ENST00000373418.3_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	529					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCTGAGGTCGGTCAGTGCAT	0.592																																					p.T529T		Atlas-SNP	.											.	PHC2	78	.	0			c.C1587T						.						107.0	103.0	105.0					1																	33799862		2203	4300	6503	SO:0001819	synonymous_variant	1912	exon9			GAGGTCGGTCAGT	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1587C>T	chr1.hg19:g.33799862G>A		98.0	0.0		108.0	48.0	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	ENST00000257118.5	hg19	CCDS378.1																																																																																			.	.		0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
CFAP57	149465	hgsc.bcm.edu	37	1	43649280	43649280	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:43649280G>C	ENST00000372492.4	+	4	817	c.493G>C	c.(493-495)Gat>Cat	p.D165H	WDR65_ENST00000528956.1_Missense_Mutation_p.D165H	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		165										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGTCCACAGGATAACACTCA	0.388																																					p.D165H		Atlas-SNP	.											.	WDR65	76	.	0			c.G493C						.						74.0	76.0	75.0					1																	43649280		2203	4300	6503	SO:0001583	missense	149465	exon4			CCACAGGATAACA																												ENST00000372492.4:c.493G>C	chr1.hg19:g.43649280G>C	ENSP00000361570:p.Asp165His	140.0	0.0		80.0	40.0	NM_152498	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	hg19		.	.	.	.	.	.	.	.	.	.	G	21.3	4.121368	0.77436	.	.	ENSG00000243710	ENST00000372492;ENST00000528956;ENST00000529956	T;T;T	0.32515	4.96;1.45;4.96	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.051667	0.85682	D	0.000000	T	0.64494	0.2603	M	0.88704	2.975	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.81914	0.994;0.995	T	0.69206	-0.5206	10	0.56958	D	0.05	.	19.7559	0.96291	0.0:0.0:1.0:0.0	.	165;165	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	H	165	ENSP00000361570:D165H;ENSP00000435310:D165H;ENSP00000434133:D165H	ENSP00000361570:D165H	D	+	1	0	WDR65	43421867	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.232000	0.78116	2.656000	0.90262	0.655000	0.94253	GAT	.	.		0.388	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
TAL1	6886	hgsc.bcm.edu	37	1	47685719	47685719	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:47685719G>A	ENST00000294339.3	-	4	1245	c.669C>T	c.(667-669)ctC>ctT	p.L223L	TAL1_ENST00000371884.2_Silent_p.L223L|TAL1_ENST00000371883.3_Silent_p.L225L|TAL1_ENST00000459729.1_5'UTR	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	223	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						CATTCTTGCTGAGCTTCTTGT	0.592			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																p.L223L		Atlas-SNP	.		Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	.	TAL1	31	.	0			c.C669T						.						64.0	62.0	63.0					1																	47685719		2203	4300	6503	SO:0001819	synonymous_variant	6886	exon4			CTTGCTGAGCTTC	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.669C>T	chr1.hg19:g.47685719G>A		224.0	0.0		178.0	71.0	NM_003189	D3DQ24	Silent	SNP	ENST00000294339.3	hg19	CCDS547.1																																																																																			.	.		0.592	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	NM_003189	
GBP2	2634	hgsc.bcm.edu	37	1	89573964	89573964	+	Missense_Mutation	SNP	C	C	T	rs200077424		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:89573964C>T	ENST00000370466.3	-	11	1938	c.1670G>A	c.(1669-1671)cGc>cAc	p.R557H	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	557					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R557H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		CTTGAGAAGGCGTTCCTGTTC	0.408																																					p.R557H		Atlas-SNP	.											GBP2,NS,carcinoma,0,1	GBP2	58	.	1	Substitution - Missense(1)	endometrium(1)	c.G1670A						.						122.0	113.0	116.0					1																	89573964		2203	4300	6503	SO:0001583	missense	2634	exon11			AGAAGGCGTTCCT	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.1670G>A	chr1.hg19:g.89573964C>T	ENSP00000359497:p.Arg557His	74.0	0.0		52.0	20.0	NM_004120	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	hg19	CCDS719.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680795	0.47886	.	.	ENSG00000162645	ENST00000370466	T	0.55760	0.5	4.29	-6.79	0.01715	Guanylate-binding protein, C-terminal (3);	2.631740	0.03031	U	0.152049	T	0.42988	0.1227	M	0.81802	2.56	0.09310	N	1	D	0.55605	0.972	P	0.51355	0.667	T	0.55211	-0.8176	10	0.59425	D	0.04	-10.6503	7.0098	0.24855	0.2258:0.1683:0.0:0.6059	.	557	P32456	GBP2_HUMAN	H	557	ENSP00000359497:R557H	ENSP00000359497:R557H	R	-	2	0	GBP2	89346552	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-6.050000	0.00083	-1.516000	0.01782	-0.152000	0.13540	CGC	.	C|0.999;T|0.001		0.408	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
COL11A1	1301	hgsc.bcm.edu	37	1	103461593	103461593	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:103461593G>A	ENST00000370096.3	-	27	2559	c.2247C>T	c.(2245-2247)ccC>ccT	p.P749P	COL11A1_ENST00000512756.1_Silent_p.P633P|COL11A1_ENST00000353414.4_Silent_p.P710P|COL11A1_ENST00000358392.2_Silent_p.P761P	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	749	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GTGGACCAGGGGGACCCTGAA	0.363																																					p.P761P		Atlas-SNP	.											.	COL11A1	972	.	0			c.C2283T						.						40.0	44.0	43.0					1																	103461593		2201	4300	6501	SO:0001819	synonymous_variant	1301	exon27			ACCAGGGGGACCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2247C>T	chr1.hg19:g.103461593G>A		88.0	0.0		20.0	16.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	hg19	CCDS778.1																																																																																			.	.		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
ANKRD34A	284615	hgsc.bcm.edu	37	1	145474731	145474731	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:145474731T>A	ENST00000323397.4	+	4	2696	c.1403T>A	c.(1402-1404)tTg>tAg	p.L468*	RP11-315I20.1_ENST00000600340.1_RNA|LIX1L_ENST00000369308.3_5'Flank	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	468						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAGCGCAAATTGGTGAGACGC	0.662																																					p.L468X		Atlas-SNP	.											.	ANKRD34A	52	.	0			c.T1403A						.						21.0	24.0	23.0					1																	145474731		2203	4300	6503	SO:0001587	stop_gained	284615	exon4			GCAAATTGGTGAG	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1403T>A	chr1.hg19:g.145474731T>A	ENSP00000314103:p.Leu468*	27.0	0.0		43.0	16.0	NM_001039888	B3KSU3	Nonsense_Mutation	SNP	ENST00000323397.4	hg19	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	T	48	14.271858	0.99787	.	.	ENSG00000181039	ENST00000323397	.	.	.	5.22	5.22	0.72569	.	0.099140	0.31031	N	0.008393	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1908	13.1433	0.59446	0.0:0.0:0.0:1.0	.	.	.	.	X	468	.	ENSP00000314103:L468X	L	+	2	0	ANKRD34A	144186088	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.633000	0.61318	2.190000	0.69967	0.529000	0.55759	TTG	.	.		0.662	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
FLG	2312	hgsc.bcm.edu	37	1	152280175	152280175	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:152280175T>C	ENST00000368799.1	-	3	7222	c.7187A>G	c.(7186-7188)cAc>cGc	p.H2396R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2396	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGACTCTTGGTGGCTCTGCTG	0.582									Ichthyosis																												p.H2396R		Atlas-SNP	.											.	FLG	900	.	0			c.A7187G						.						67.0	71.0	70.0					1																	152280175		2202	4279	6481	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCTTGGTGGCTCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7187A>G	chr1.hg19:g.152280175T>C	ENSP00000357789:p.His2396Arg	393.0	1.0		404.0	106.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.254229	0.22965	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01629	4.72	3.84	-1.46	0.08800	.	.	.	.	.	T	0.00815	0.0027	M	0.78223	2.4	0.09310	N	1	B	0.18741	0.03	B	0.15052	0.012	T	0.41124	-0.9526	9	0.30078	T	0.28	.	3.9105	0.09201	0.0:0.3241:0.1923:0.4836	.	2396	P20930	FILA_HUMAN	R	2396;306	ENSP00000357789:H2396R	ENSP00000271820:H306R	H	-	2	0	FLG	150546799	0.000000	0.05858	0.007000	0.13788	0.038000	0.13279	-0.412000	0.07132	-0.127000	0.11661	0.397000	0.26171	CAC	.	.		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
VANGL2	57216	hgsc.bcm.edu	37	1	160388869	160388869	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:160388869C>T	ENST00000368061.2	+	4	744	c.270C>T	c.(268-270)cgC>cgT	p.R90R		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	90					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACCTCACACGCATCGCCAAGG	0.622																																					p.R90R		Atlas-SNP	.											.	VANGL2	83	.	0			c.C270T						.						117.0	113.0	114.0					1																	160388869		2203	4300	6503	SO:0001819	synonymous_variant	57216	exon4			CACACGCATCGCC	AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.270C>T	chr1.hg19:g.160388869C>T		67.0	0.0		115.0	21.0	NM_020335	D3DVE9|Q5T212	Silent	SNP	ENST00000368061.2	hg19	CCDS30915.1																																																																																			.	.		0.622	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335	
FAM20B	9917	hgsc.bcm.edu	37	1	179013021	179013021	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:179013021C>T	ENST00000263733.4	+	2	375	c.39C>T	c.(37-39)ctC>ctT	p.L13L		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	13						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						TAGCAATTCTCCTTGTCATTT	0.468																																					p.L13L		Atlas-SNP	.											.	FAM20B	38	.	0			c.C39T						.						99.0	85.0	90.0					1																	179013021		2203	4300	6503	SO:0001819	synonymous_variant	9917	exon2			AATTCTCCTTGTC	AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.39C>T	chr1.hg19:g.179013021C>T		127.0	0.0		209.0	75.0	NM_014864	Q5W0C3|Q5W0C4	Silent	SNP	ENST00000263733.4	hg19	CCDS1328.1																																																																																			.	.		0.468	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864	
KIF21B	23046	hgsc.bcm.edu	37	1	200960199	200960199	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:200960199C>A	ENST00000422435.2	-	18	2849	c.2533G>T	c.(2533-2535)Gac>Tac	p.D845Y	KIF21B_ENST00000461742.2_Missense_Mutation_p.D845Y|KIF21B_ENST00000360529.5_Missense_Mutation_p.D845Y|KIF21B_ENST00000332129.2_Missense_Mutation_p.D845Y	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	845					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GCCCCAGAGTCCAGCATGGGT	0.617																																					p.D845Y		Atlas-SNP	.											.	KIF21B	208	.	0			c.G2533T						.						69.0	72.0	71.0					1																	200960199		2203	4300	6503	SO:0001583	missense	23046	exon18			CAGAGTCCAGCAT	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2533G>T	chr1.hg19:g.200960199C>A	ENSP00000411831:p.Asp845Tyr	121.0	0.0		171.0	47.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	hg19	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364284	0.82463	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.72167	-0.28;-0.59;-0.63;-0.32	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.81049	0.4742	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	P;P;P;D	0.65874	0.87;0.87;0.87;0.939	T	0.81152	-0.1063	9	.	.	.	.	16.9766	0.86315	0.0:1.0:0.0:0.0	.	845;845;845;845	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	Y	845	ENSP00000328494:D845Y;ENSP00000353724:D845Y;ENSP00000433808:D845Y;ENSP00000411831:D845Y	.	D	-	1	0	KIF21B	199226822	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.381000	0.79718	2.305000	0.77605	0.591000	0.81541	GAC	.	.		0.617	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
RBBP5	5929	hgsc.bcm.edu	37	1	205084043	205084043	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:205084043G>A	ENST00000264515.6	-	3	233	c.92C>T	c.(91-93)aCc>aTc	p.T31I	RBBP5_ENST00000367164.1_Missense_Mutation_p.T31I|RBBP5_ENST00000484379.1_5'UTR	NM_001193273.1|NM_005057.3	NP_001180202.1|NP_005048.2	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	31					cellular response to DNA damage stimulus (GO:0006974)|histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	methylated histone binding (GO:0035064)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	27	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCTGTTAAAGGTGCAAGTCAA	0.408																																					p.T31I		Atlas-SNP	.											.	RBBP5	45	.	0			c.C92T						.						53.0	48.0	49.0					1																	205084043		2203	4298	6501	SO:0001583	missense	5929	exon3			TTAAAGGTGCAAG	BC053856	CCDS30983.1, CCDS53463.1	1q32	2013-01-10	2001-11-28		ENSG00000117222	ENSG00000117222		"""WD repeat domain containing"""	9888	protein-coding gene	gene with protein product	"""SWD1, Set1c WD40 repeat protein, homolog (S. cerevisiae)"""	600697	"""retinoblastoma-binding protein 5"""			7558034	Standard	NM_005057		Approved	RBQ3, SWD1	uc001hbu.2	Q15291	OTTHUMG00000037104	ENST00000264515.6:c.92C>T	chr1.hg19:g.205084043G>A	ENSP00000264515:p.Thr31Ile	192.0	0.0		369.0	120.0	NM_005057	A8K272|Q7Z6D8|Q8NDZ7	Missense_Mutation	SNP	ENST00000264515.6	hg19	CCDS30983.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226673	0.79576	.	.	ENSG00000117222	ENST00000264515;ENST00000367164	T;T	0.59502	0.26;0.26	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64560	0.2609	M	0.64170	1.965	0.80722	D	1	P;B;P	0.43169	0.687;0.397;0.8	P;B;B	0.45232	0.474;0.098;0.248	T	0.67078	-0.5761	10	0.66056	D	0.02	.	19.6939	0.96016	0.0:0.0:1.0:0.0	.	66;31;31	B4DMM7;Q15291-2;Q15291	.;.;RBBP5_HUMAN	I	31	ENSP00000264515:T31I;ENSP00000356132:T31I	ENSP00000264515:T31I	T	-	2	0	RBBP5	203350666	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.735000	0.98825	2.764000	0.94973	0.650000	0.86243	ACC	.	.		0.408	RBBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090077.1	NM_005057	
PTPN14	5784	hgsc.bcm.edu	37	1	214557484	214557484	+	Missense_Mutation	SNP	G	G	A	rs200947677		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:214557484G>A	ENST00000366956.5	-	13	1908	c.1714C>T	c.(1714-1716)Cgg>Tgg	p.R572W	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	572	Poly-Pro.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GGTCGTGGCCGTGGGTAGGGG	0.652																																					p.R572W	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											PTPN14,caecum,carcinoma,0,2	PTPN14	168	.	0			c.C1714T						.	G	TRP/ARG	0,4406		0,0,2203	42.0	46.0	45.0		1714	4.7	0.9	1		45	1,8599	1.2+/-3.3	0,1,4299	no	missense	PTPN14	NM_005401.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	572/1188	214557484	1,13005	2203	4300	6503	SO:0001583	missense	5784	exon13			GTGGCCGTGGGTA	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1714C>T	chr1.hg19:g.214557484G>A	ENSP00000355923:p.Arg572Trp	55.0	0.0		54.0	18.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850976	0.71719	0.0	1.16E-4	ENSG00000152104	ENST00000366956	T	0.68765	-0.35	5.61	4.68	0.58851	.	0.194784	0.45606	D	0.000350	T	0.72162	0.3426	L	0.47716	1.5	0.80722	D	1	D	0.69078	0.997	P	0.56434	0.798	T	0.72200	-0.4362	10	0.38643	T	0.18	.	16.3998	0.83635	0.0:0.0:0.8676:0.1324	.	572	Q15678	PTN14_HUMAN	W	572	ENSP00000355923:R572W	ENSP00000355923:R572W	R	-	1	2	PTPN14	212624107	0.883000	0.30277	0.857000	0.33713	0.992000	0.81027	3.487000	0.53222	1.482000	0.48325	0.650000	0.86243	CGG	.	G|0.999;A|0.001		0.652	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
ZNF695	57116	hgsc.bcm.edu	37	1	247162655	247162655	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:247162655T>C	ENST00000339986.7	-	3	401	c.254A>G	c.(253-255)cAc>cGc	p.H85R	ZNF695_ENST00000487338.2_Missense_Mutation_p.H85R|ZNF695_ENST00000498046.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	85	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCTACCTGAGTGTCTGGCTGT	0.483																																					p.H85R		Atlas-SNP	.											.	ZNF695	55	.	0			c.A254G						.						112.0	115.0	114.0					1																	247162655		2037	4235	6272	SO:0001583	missense	57116	exon3			CCTGAGTGTCTGG		CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.254A>G	chr1.hg19:g.247162655T>C	ENSP00000341236:p.His85Arg	310.0	0.0		196.0	85.0	NM_001204221	Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	ENST00000339986.7	hg19	CCDS44344.1	.	.	.	.	.	.	.	.	.	.	T	0.898	-0.723208	0.03158	.	.	ENSG00000197472	ENST00000487338;ENST00000391780;ENST00000339986	T;T	0.05996	5.9;3.36	0.149	0.149	0.14863	Krueppel-associated box (1);	.	.	.	.	T	0.01905	0.0060	N	0.00972	-1.085	0.09310	N	1	P;P;P	0.42735	0.462;0.788;0.667	B;B;B	0.37989	0.227;0.124;0.262	T	0.41662	-0.9496	8	0.45353	T	0.12	.	.	.	.	.	85;73;85	Q8IW36;F2Z2N8;Q8IW36-1	ZN695_HUMAN;.;.	R	85	ENSP00000429736:H85R;ENSP00000341236:H85R	ENSP00000428213:H73R	H	-	2	0	ZNF695	245229278	0.287000	0.24315	0.114000	0.21550	0.115000	0.19883	0.939000	0.28978	0.166000	0.19597	0.164000	0.16699	CAC	.	.		0.483	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097823.5	NM_020394	
SUCLG1	8802	hgsc.bcm.edu	37	2	84660559	84660559	+	Splice_Site	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:84660559C>T	ENST00000393868.2	-	6	800	c.590G>A	c.(589-591)gGc>gAc	p.G197D	SUCLG1_ENST00000491123.1_5'Flank	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	197					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	GGACACAATGCCTTAACGAAA	0.393																																					p.G197D	Ovarian(48;203 1101 37206 40305 50790)	Atlas-SNP	.											.	SUCLG1	30	.	0			c.G590A						.						70.0	64.0	66.0					2																	84660559		2203	4300	6503	SO:0001630	splice_region_variant	8802	exon6			ACAATGCCTTAAC	Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.590-1G>A	chr2.hg19:g.84660559C>T		172.0	0.0		81.0	34.0	NM_003849	Q9BWB0|Q9UNP6	Missense_Mutation	SNP	ENST00000393868.2	hg19	CCDS1967.2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985575	0.93044	.	.	ENSG00000163541	ENST00000393868	D	0.86030	-2.06	5.83	5.83	0.93111	Succinyl-CoA synthetase-like (2);	0.046728	0.85682	D	0.000000	D	0.96084	0.8724	H	0.99877	4.88	0.80722	D	1	D;D	0.67145	0.991;0.996	P;P	0.62014	0.658;0.897	D	0.97912	1.0309	10	0.87932	D	0	.	17.6146	0.88064	0.0:1.0:0.0:0.0	.	197;197	B7Z438;P53597	.;SUCA_HUMAN	D	197	ENSP00000377446:G197D	ENSP00000377446:G197D	G	-	2	0	SUCLG1	84514070	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.818000	0.86416	2.758000	0.94735	0.655000	0.94253	GGC	.	.		0.393	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2	NM_003849	Missense_Mutation
TANC1	85461	hgsc.bcm.edu	37	2	160053178	160053178	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:160053178C>T	ENST00000263635.6	+	18	3276	c.3039C>T	c.(3037-3039)caC>caT	p.H1013H	TANC1_ENST00000454300.1_Silent_p.H907H	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1013					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TACGGGGCCACGGTGACATTC	0.627																																					p.H1013H		Atlas-SNP	.											.	TANC1	157	.	0			c.C3039T						.						59.0	64.0	62.0					2																	160053178		2103	4204	6307	SO:0001819	synonymous_variant	85461	exon18			GGGCCACGGTGAC	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.3039C>T	chr2.hg19:g.160053178C>T		106.0	0.0		100.0	35.0	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	hg19	CCDS42766.1																																																																																			.	.		0.627	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
PLEKHM3	389072	hgsc.bcm.edu	37	2	208865840	208865840	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:208865840T>C	ENST00000427836.2	-	2	1013	c.524A>G	c.(523-525)cAg>cGg	p.Q175R	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.Q175R|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.Q175R	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	175	Poly-Gln.				intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AAGCAATGgctgctgctgttg	0.478																																					p.Q175R		Atlas-SNP	.											.	PLEKHM3	101	.	0			c.A524G						.						26.0	34.0	32.0					2																	208865840		2134	4268	6402	SO:0001583	missense	389072	exon2			AATGGCTGCTGCT	AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.524A>G	chr2.hg19:g.208865840T>C	ENSP00000417003:p.Gln175Arg	168.0	0.0		156.0	84.0	NM_001080475	B9EKV2|Q8WW68	Missense_Mutation	SNP	ENST00000427836.2	hg19	CCDS42808.1	.	.	.	.	.	.	.	.	.	.	T	6.520	0.464167	0.12402	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	D;D;D	0.82984	-1.65;-1.65;-1.67	4.42	3.29	0.37713	.	0.335412	0.27563	N	0.018819	T	0.60130	0.2245	N	0.08118	0	0.09310	N	0.999994	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.39860	-0.9593	10	0.15952	T	0.53	.	4.9311	0.13917	0.0:0.2102:0.0:0.7898	.	175;175	C9J119;Q6ZWE6	.;PKHM3_HUMAN	R	175	ENSP00000417003:Q175R;ENSP00000373899:Q175R;ENSP00000400150:Q175R	ENSP00000373899:Q175R	Q	-	2	0	PLEKHM3	208574085	0.017000	0.18338	0.986000	0.45419	0.250000	0.25880	0.190000	0.17057	1.960000	0.56953	0.449000	0.29647	CAG	.	.		0.478	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475	
USP40	55230	hgsc.bcm.edu	37	2	234394614	234394614	+	Silent	SNP	G	G	A	rs369926451		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:234394614G>A	ENST00000427112.2	-	28	3239	c.3204C>T	c.(3202-3204)gaC>gaT	p.D1068D	USP40_ENST00000496298.1_5'UTR|USP40_ENST00000450966.1_Silent_p.D1080D|USP40_ENST00000251722.6_Silent_p.D1068D			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	1068					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TCAGCAGCACGTCCTGGGGGC	0.597																																					p.D1080D		Atlas-SNP	.											.	USP40	174	.	0			c.C3240T						.	G		1,3995		0,1,1997	10.0	11.0	11.0		3240	0.6	0.7	2		11	0,8296		0,0,4148	no	coding-synonymous	USP40	NM_018218.2		0,1,6145	AA,AG,GG		0.0,0.025,0.0081		1080/1248	234394614	1,12291	1998	4148	6146	SO:0001819	synonymous_variant	55230	exon28			CAGCACGTCCTGG	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.3204C>T	chr2.hg19:g.234394614G>A		22.0	0.0		9.0	9.0	NM_018218	Q6NX38|Q70EL0	Silent	SNP	ENST00000427112.2	hg19	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	8.169	0.791253	0.16258	2.5E-4	0.0	ENSG00000085982	ENST00000454354	.	.	.	5.75	0.614	0.17603	.	.	.	.	.	T	0.41442	0.1159	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22034	-1.0228	4	.	.	.	.	0.8175	0.01105	0.2516:0.3156:0.218:0.2148	.	.	.	.	M	36	.	.	T	-	2	0	USP40	234059353	0.002000	0.14202	0.666000	0.29783	0.995000	0.86356	-0.184000	0.09698	-0.176000	0.10707	0.650000	0.86243	ACG	.	.		0.597	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
SATB1	6304	hgsc.bcm.edu	37	3	18436227	18436227	+	Silent	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:18436227A>T	ENST00000338745.6	-	7	2667	c.933T>A	c.(931-933)ccT>ccA	p.P311P	SATB1_ENST00000417717.2_Silent_p.P311P|SATB1_ENST00000475083.1_5'Flank|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Silent_p.P311P	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	311					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GAGGACTGATAGGTGTTGATA	0.567																																					p.P311P		Atlas-SNP	.											.	SATB1	96	.	0			c.T933A						.						149.0	138.0	142.0					3																	18436227		2203	4300	6503	SO:0001819	synonymous_variant	6304	exon7			ACTGATAGGTGTT		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.933T>A	chr3.hg19:g.18436227A>T		156.0	0.0		103.0	60.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Silent	SNP	ENST00000338745.6	hg19	CCDS2631.1																																																																																			.	.		0.567	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
RBM6	10180	hgsc.bcm.edu	37	3	50095360	50095360	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:50095360G>A	ENST00000266022.4	+	9	2152	c.1893G>A	c.(1891-1893)agG>agA	p.R631R	RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000422955.1_Silent_p.R109R|RBM6_ENST00000443081.1_Silent_p.R499R|RBM6_ENST00000442092.1_Silent_p.R109R	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	631					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CTTCTCGAAGGGAAGGGCCAA	0.507																																					p.R631R		Atlas-SNP	.											.	RBM6	85	.	0			c.G1893A						.						81.0	78.0	79.0					3																	50095360		2203	4300	6503	SO:0001819	synonymous_variant	10180	exon9			TCGAAGGGAAGGG	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1893G>A	chr3.hg19:g.50095360G>A		49.0	0.0		52.0	35.0	NM_005777	O60549|O75524|Q86SS3	Silent	SNP	ENST00000266022.4	hg19	CCDS2809.1																																																																																			.	.		0.507	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
ARHGAP31	57514	hgsc.bcm.edu	37	3	119087231	119087231	+	Silent	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:119087231C>G	ENST00000264245.4	+	3	748	c.216C>G	c.(214-216)ggC>ggG	p.G72G		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	72	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AAGAGTTTGGCTCAGATCAAT	0.522																																					p.G72G	Pancreas(7;176 297 5394 51128 51241)	Atlas-SNP	.											.	ARHGAP31	175	.	0			c.C216G						.						129.0	122.0	124.0					3																	119087231		1967	4160	6127	SO:0001819	synonymous_variant	57514	exon3			GTTTGGCTCAGAT		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.216C>G	chr3.hg19:g.119087231C>G		86.0	0.0		86.0	57.0	NM_020754	Q9ULL6	Silent	SNP	ENST00000264245.4	hg19	CCDS43135.1																																																																																			.	.		0.522	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
PAK2	5062	hgsc.bcm.edu	37	3	196547330	196547330	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:196547330G>A	ENST00000327134.3	+	13	1564	c.1242G>A	c.(1240-1242)gtG>gtA	p.V414V		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	414	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.V415F(1)|p.V414V(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		CACCAGAGGTGGTTACACGGA	0.488																																					p.V414V		Atlas-SNP	.											PAK2_ENST00000327134,NS,carcinoma,0,2	PAK2	113	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	c.G1242A						.						155.0	130.0	138.0					3																	196547330		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon13			AGAGGTGGTTACA	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.1242G>A	chr3.hg19:g.196547330G>A		135.0	0.0		146.0	40.0	NM_002577	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	hg19	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	G	9.873	1.199547	0.22121	.	.	ENSG00000180370	ENST00000426668	.	.	.	4.69	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7285	0.46083	0.0739:0.1311:0.795:0.0	.	.	.	.	X	157	.	.	W	+	2	0	PAK2	198031727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.432000	0.34936	1.303000	0.44873	0.655000	0.94253	TGG	.	.		0.488	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
FAM184B	27146	hgsc.bcm.edu	37	4	17710586	17710586	+	Missense_Mutation	SNP	C	C	A	rs61746992	byFrequency	TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:17710586C>A	ENST00000265018.3	-	2	1035	c.823G>T	c.(823-825)Gac>Tac	p.D275Y		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	275										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						TGCTCCAGGTCTCCTTCCAGC	0.577																																					p.D275Y		Atlas-SNP	.											.	FAM184B	38	.	0			c.G823T						.						63.0	55.0	58.0					4																	17710586		692	1591	2283	SO:0001583	missense	27146	exon2			CCAGGTCTCCTTC		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.823G>T	chr4.hg19:g.17710586C>A	ENSP00000265018:p.Asp275Tyr	147.0	0.0		110.0	45.0	NM_015688		Missense_Mutation	SNP	ENST00000265018.3	hg19	CCDS47033.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705797	0.68615	.	.	ENSG00000047662	ENST00000265018	T	0.78126	-1.15	5.14	5.14	0.70334	.	0.185429	0.46442	D	0.000283	D	0.86527	0.5954	L	0.60455	1.87	0.51767	D	0.999939	D	0.69078	0.997	D	0.79784	0.993	D	0.87480	0.2420	10	0.87932	D	0	-31.9922	18.7908	0.91973	0.0:1.0:0.0:0.0	.	275	Q9ULE4	F184B_HUMAN	Y	275	ENSP00000265018:D275Y	ENSP00000265018:D275Y	D	-	1	0	FAM184B	17319684	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.542000	0.53625	2.665000	0.90641	0.655000	0.94253	GAC	.	C|0.972;G|0.028		0.577	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
GUF1	60558	hgsc.bcm.edu	37	4	44697656	44697656	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:44697656A>T	ENST00000281543.5	+	15	1934	c.1740A>T	c.(1738-1740)aaA>aaT	p.K580N	GUF1_ENST00000506793.1_3'UTR|RP11-700J17.1_ENST00000610260.1_RNA	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						CAATTGGCAAAGCCATATGTG	0.358																																					p.K580N		Atlas-SNP	.											.	GUF1	72	.	0			c.A1740T						.						65.0	67.0	66.0					4																	44697656		2203	4300	6503	SO:0001583	missense	60558	exon15			TGGCAAAGCCATA		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1740A>T	chr4.hg19:g.44697656A>T	ENSP00000281543:p.Lys580Asn	69.0	0.0		63.0	35.0	NM_021927		Missense_Mutation	SNP	ENST00000281543.5	hg19	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.028402	0.54790	.	.	ENSG00000151806	ENST00000281543	T	0.71103	-0.54	5.74	4.58	0.56647	GTP-binding protein LepA, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77498	0.4139	M	0.74389	2.26	0.58432	D	0.999999	D	0.56287	0.975	P	0.56514	0.8	T	0.79801	-0.1650	10	0.87932	D	0	-23.4571	7.8275	0.29324	0.8466:0.0:0.1534:0.0	.	580	Q8N442	GUF1_HUMAN	N	580	ENSP00000281543:K580N	ENSP00000281543:K580N	K	+	3	2	GUF1	44392413	0.998000	0.40836	0.992000	0.48379	0.057000	0.15508	3.069000	0.50026	2.183000	0.69458	0.533000	0.62120	AAA	.	.		0.358	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
CNGA1	1259	hgsc.bcm.edu	37	4	47939598	47939598	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:47939598T>C	ENST00000514170.1	-	11	1232	c.913A>G	c.(913-915)Atg>Gtg	p.M305V	CNGA1_ENST00000358519.4_Missense_Mutation_p.M305V|CNGA1_ENST00000544810.1_Missense_Mutation_p.M305V|CNGA1_ENST00000420489.2_Missense_Mutation_p.M305V|CNGA1_ENST00000402813.3_Missense_Mutation_p.M374V			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	305					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						ACGATATACATAACAAGGTTG	0.363																																					p.M374V		Atlas-SNP	.											.	CNGA1	74	.	0			c.A1120G						.						164.0	158.0	160.0					4																	47939598		1872	4104	5976	SO:0001583	missense	1259	exon10			TATACATAACAAG	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.913A>G	chr4.hg19:g.47939598T>C	ENSP00000426862:p.Met305Val	140.0	0.0		92.0	43.0	NM_001142564	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	ENST00000514170.1	hg19	CCDS43226.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738312	0.49045	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57	5.09	5.09	0.68999	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95037	0.8393	L	0.39566	1.225	0.49582	D	0.999806	B;B	0.18968	0.032;0.032	B;B	0.20577	0.03;0.03	D	0.93042	0.6458	10	0.18276	T	0.48	.	14.9022	0.70687	0.0:0.0:0.0:1.0	.	305;305	Q4W5E3;P29973	.;CNGA1_HUMAN	V	374;305;305;305;305	ENSP00000384264:M374V;ENSP00000426862:M305V;ENSP00000443401:M305V;ENSP00000351320:M305V;ENSP00000389881:M305V	ENSP00000351320:M305V	M	-	1	0	CNGA1	47634355	1.000000	0.71417	0.948000	0.38648	0.862000	0.49288	4.770000	0.62309	1.923000	0.55706	0.533000	0.62120	ATG	.	.		0.363	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
AFP	174	hgsc.bcm.edu	37	4	74319616	74319616	+	Splice_Site	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:74319616T>C	ENST00000395792.2	+	13	1885		c.e13+2		AFP_ENST00000506820.1_Splice_Site|AFP_ENST00000226359.2_Splice_Site	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein						ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTGAAGAGGTACATGCAGCT	0.388									Alpha-Fetoprotein, Hereditary Persistence of																												.		Atlas-SNP	.											.	AFP	60	.	0			c.1785+2T>C						.						78.0	73.0	75.0					4																	74319616		2203	4300	6503	SO:0001630	splice_region_variant	174	exon13	Familial Cancer Database	HPAFP	AAGAGGTACATGC	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1785+2T>C	chr4.hg19:g.74319616T>C		184.0	0.0		122.0	9.0	NM_001134	B2RBU3	Splice_Site	SNP	ENST00000395792.2	hg19	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	T	8.418	0.845661	0.16963	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6488	0.45636	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	AFP	74538480	0.997000	0.39634	0.907000	0.35723	0.077000	0.17291	2.789000	0.47813	2.011000	0.59026	0.459000	0.35465	.	.	.		0.388	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3		Intron
WDR17	116966	hgsc.bcm.edu	37	4	177017675	177017675	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:177017675C>T	ENST00000280190.4	+	2	161	c.5C>T	c.(4-6)gCt>gTt	p.A2V	SNORA51_ENST00000364646.1_RNA|WDR17_ENST00000393643.2_Intron|WDR17_ENST00000508596.1_Intron|WDR17_ENST00000507824.2_Missense_Mutation_p.A2V|WDR17_ENST00000509792.1_Intron			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	2										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CATTCTATGGCTTGGATGACT	0.343																																					p.A2V		Atlas-SNP	.											.	WDR17	198	.	0			c.C5T						.						146.0	147.0	147.0					4																	177017675		2203	4300	6503	SO:0001583	missense	116966	exon2			CTATGGCTTGGAT	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.5C>T	chr4.hg19:g.177017675C>T	ENSP00000280190:p.Ala2Val	121.0	0.0		48.0	17.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	hg19	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.121595	0.77436	.	.	ENSG00000150627	ENST00000280190;ENST00000507824	T	0.58358	0.34	5.1	4.25	0.50352	.	0.483821	0.18772	N	0.131581	T	0.34221	0.0890	N	0.08118	0	0.80722	D	1	B	0.21452	0.056	B	0.25405	0.06	T	0.28839	-1.0031	10	0.87932	D	0	-21.5603	12.3889	0.55348	0.0:0.9169:0.0:0.0831	.	2	Q8IZU2	WDR17_HUMAN	V	2	ENSP00000280190:A2V	ENSP00000280190:A2V	A	+	2	0	WDR17	177254669	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.879000	0.48522	2.814000	0.96858	0.655000	0.94253	GCT	.	.		0.343	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
TENM3	55714	hgsc.bcm.edu	37	4	183675952	183675952	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:183675952G>C	ENST00000511685.1	+	22	4555	c.4432G>C	c.(4432-4434)Gct>Cct	p.A1478P	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.A1478P			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1478					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATCCTCCCTGGCTGCTTCTCC	0.473																																					p.A1478P		Atlas-SNP	.											.	.	.	.	0			c.G4432C						.						82.0	83.0	83.0					4																	183675952		1987	4161	6148	SO:0001583	missense	55714	exon21			TCCCTGGCTGCTT	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4432G>C	chr4.hg19:g.183675952G>C	ENSP00000424226:p.Ala1478Pro	91.0	0.0		43.0	21.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435939	0.83885	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.92647	-3.08;-3.08	5.16	5.16	0.70880	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.94735	0.8301	H	0.95151	3.63	0.80722	D	1	P	0.51791	0.948	B	0.41135	0.348	D	0.96381	0.9281	9	0.87932	D	0	.	18.8456	0.92205	0.0:0.0:1.0:0.0	.	1478	Q9P273	TEN3_HUMAN	P	1478	ENSP00000424226:A1478P;ENSP00000385276:A1478P	ENSP00000385276:A1478P	A	+	1	0	ODZ3	183912946	1.000000	0.71417	0.385000	0.26158	0.926000	0.56050	9.657000	0.98554	2.698000	0.92095	0.563000	0.77884	GCT	.	.		0.473	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
CMBL	134147	hgsc.bcm.edu	37	5	10288612	10288612	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:10288612T>A	ENST00000296658.3	-	3	665	c.245A>T	c.(244-246)cAa>cTa	p.Q82L	CMBL_ENST00000510532.1_5'UTR	NM_138809.3	NP_620164.1	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase homolog (Pseudomonas)	82						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(9)|skin(1)|stomach(1)	13						CCAAGGCTCTTGCCCTACAAA	0.448																																					p.Q82L		Atlas-SNP	.											.	CMBL	24	.	0			c.A245T						.						95.0	90.0	91.0					5																	10288612		2203	4300	6503	SO:0001583	missense	134147	exon3			GGCTCTTGCCCTA		CCDS3878.1	5p15.2	2010-06-25	2006-09-12		ENSG00000164237	ENSG00000164237	3.1.-.-		25090	protein-coding gene	gene with protein product		613379	"""carboxymethylenebutenolidase-like (Pseudomonas)"""			3804974, 20177059	Standard	NM_138809		Approved	FLJ23617	uc003jes.3	Q96DG6	OTTHUMG00000131043	ENST00000296658.3:c.245A>T	chr5.hg19:g.10288612T>A	ENSP00000296658:p.Gln82Leu	57.0	0.0		60.0	16.0	NM_138809	D3DTC7|Q8TED6	Missense_Mutation	SNP	ENST00000296658.3	hg19	CCDS3878.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.924552	0.52653	.	.	ENSG00000164237	ENST00000296658	T	0.48201	0.82	5.48	4.31	0.51392	Dienelactone hydrolase (1);	0.246359	0.40469	N	0.001094	T	0.42449	0.1203	L	0.54323	1.7	0.43032	D	0.994604	B	0.30563	0.285	B	0.28916	0.096	T	0.37572	-0.9700	10	0.59425	D	0.04	-15.8316	10.4159	0.44322	0.0:0.0778:0.0:0.9222	.	82	Q96DG6	CMBL_HUMAN	L	82	ENSP00000296658:Q82L	ENSP00000296658:Q82L	Q	-	2	0	CMBL	10341612	0.999000	0.42202	0.171000	0.22900	0.899000	0.52679	4.149000	0.58091	0.898000	0.36418	0.459000	0.35465	CAA	.	.		0.448	CMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253689.1	NM_138809	
PSD2	84249	hgsc.bcm.edu	37	5	139189232	139189232	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:139189232T>C	ENST00000274710.3	+	2	412	c.207T>C	c.(205-207)caT>caC	p.H69H		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	69					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCCTTCCATGGCCTCAGCC	0.642																																					p.H69H		Atlas-SNP	.											.	PSD2	88	.	0			c.T207C						.						84.0	86.0	85.0					5																	139189232		2203	4300	6503	SO:0001819	synonymous_variant	84249	exon2			CTTCCATGGCCTC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.207T>C	chr5.hg19:g.139189232T>C		231.0	0.0		168.0	88.0	NM_032289	D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	hg19	CCDS4216.1																																																																																			.	.		0.642	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
MRPL22	29093	hgsc.bcm.edu	37	5	154346429	154346429	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:154346429G>A	ENST00000523037.1	+	7	634	c.593G>A	c.(592-594)cGc>cAc	p.R198H	MRPL22_ENST00000439747.3_Missense_Mutation_p.R224H|MRPL22_ENST00000265229.8_Missense_Mutation_p.R118H|MRPL22_ENST00000522038.1_Missense_Mutation_p.R204H|MRPL22_ENST00000518364.1_3'UTR	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	198					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGCAGCTTCGCAGCCGGACC	0.438																																					p.R198H		Atlas-SNP	.											MRPL22,colon,carcinoma,0,1	MRPL22	18	.	0			c.G593A						.						54.0	47.0	50.0					5																	154346429		2203	4300	6503	SO:0001583	missense	29093	exon7			AGCTTCGCAGCCG	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.593G>A	chr5.hg19:g.154346429G>A	ENSP00000431040:p.Arg198His	49.0	0.0		63.0	33.0	NM_014180	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	hg19	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506467	0.64410	.	.	ENSG00000082515	ENST00000523037;ENST00000265229;ENST00000439747;ENST00000522038	T;T;T;T	0.59772	0.28;0.4;0.24;0.27	5.8	5.8	0.92144	.	0.579484	0.18168	N	0.149546	T	0.74574	0.3734	M	0.79926	2.475	0.58432	D	0.999999	D	0.60575	0.988	P	0.55303	0.773	T	0.75958	-0.3134	10	0.54805	T	0.06	-1.2567	20.0415	0.97592	0.0:0.0:1.0:0.0	.	198	Q9NWU5	RM22_HUMAN	H	198;118;224;204	ENSP00000431040:R198H;ENSP00000265229:R118H;ENSP00000411177:R224H;ENSP00000429039:R204H	ENSP00000265229:R118H	R	+	2	0	MRPL22	154326622	0.996000	0.38824	0.800000	0.32199	0.138000	0.21146	4.728000	0.62000	2.745000	0.94114	0.563000	0.77884	CGC	.	.		0.438	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
NUP153	9972	hgsc.bcm.edu	37	6	17640200	17640200	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:17640200C>G	ENST00000262077.2	-	15	1815	c.1816G>C	c.(1816-1818)Gga>Cga	p.G606R	NUP153_ENST00000537253.1_Missense_Mutation_p.G637R	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	606					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			AGAACACTTCCTTCTTTCAGG	0.348																																					p.G606R		Atlas-SNP	.											.	NUP153	116	.	0			c.G1816C						.						107.0	110.0	109.0					6																	17640200		2203	4300	6503	SO:0001583	missense	9972	exon15			CACTTCCTTCTTT	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.1816G>C	chr6.hg19:g.17640200C>G	ENSP00000262077:p.Gly606Arg	92.0	0.0		78.0	24.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	hg19	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880581	0.91740	.	.	ENSG00000124789	ENST00000262077;ENST00000537253	T;T	0.40476	1.03;1.03	5.42	5.42	0.78866	Nucleoporin, Nup153-like (1);	0.000000	0.50627	D	0.000107	T	0.62877	0.2464	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.65998	-0.6032	10	0.72032	D	0.01	-3.6872	19.5755	0.95441	0.0:1.0:0.0:0.0	.	637;606	F6QR24;P49790	.;NU153_HUMAN	R	606;637	ENSP00000262077:G606R;ENSP00000444029:G637R	ENSP00000262077:G606R	G	-	1	0	NUP153	17748179	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.774000	0.75012	2.700000	0.92200	0.585000	0.79938	GGA	.	.		0.348	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
OR2J3	442186	hgsc.bcm.edu	37	6	29080221	29080221	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:29080221C>A	ENST00000377169.1	+	1	554	c.554C>A	c.(553-555)cCa>cAa	p.P185Q		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TGTGAAGTTCCAGCACTTCTG	0.458																																					p.P185Q		Atlas-SNP	.											.	OR2J3	53	.	0			c.C554A						.						103.0	113.0	110.0					6																	29080221		1304	2585	3889	SO:0001583	missense	442186	exon1			AAGTTCCAGCACT		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.554C>A	chr6.hg19:g.29080221C>A	ENSP00000366374:p.Pro185Gln	328.0	0.0		301.0	85.0	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	hg19	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962058	0.34659	.	.	ENSG00000204701	ENST00000377169	T	0.00211	8.54	2.78	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00300	0.0009	M	0.86864	2.845	0.33794	D	0.625804	D	0.63880	0.993	D	0.74023	0.982	T	0.50092	-0.8868	9	0.87932	D	0	.	7.8712	0.29567	0.0:0.8763:0.0:0.1237	.	185	O76001	OR2J3_HUMAN	Q	185	ENSP00000366374:P185Q	ENSP00000366374:P185Q	P	+	2	0	OR2J3	29188200	0.000000	0.05858	0.999000	0.59377	0.286000	0.27126	-0.162000	0.10012	1.549000	0.49425	0.436000	0.28706	CCA	.	.		0.458	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
PPP2R5D	5528	hgsc.bcm.edu	37	6	42975774	42975774	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:42975774C>T	ENST00000485511.1	+	7	1007	c.828C>T	c.(826-828)atC>atT	p.I276I	PPP2R5D_ENST00000461010.1_Silent_p.I170I|PPP2R5D_ENST00000472118.1_Silent_p.I268I|PPP2R5D_ENST00000394110.3_Silent_p.I244I	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	276					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGCTTATATCCGTAGGCAGA	0.542																																					p.I276I	Melanoma(63;587 1613 29742 31770)	Atlas-SNP	.											.	PPP2R5D	47	.	0			c.C828T						.						101.0	100.0	100.0					6																	42975774		2203	4300	6503	SO:0001819	synonymous_variant	5528	exon7			TTATATCCGTAGG	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.828C>T	chr6.hg19:g.42975774C>T		109.0	0.0		126.0	70.0	NM_006245	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Silent	SNP	ENST00000485511.1	hg19	CCDS4878.1	.	.	.	.	.	.	.	.	.	.	C	8.759	0.923119	0.18056	.	.	ENSG00000112640	ENST00000470467	.	.	.	5.84	-1.0	0.10196	.	.	.	.	.	T	0.22322	0.0538	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27434	-1.0074	4	.	.	.	-22.2167	0.9127	0.01298	0.3292:0.3139:0.0988:0.2582	.	.	.	.	S	196	.	.	P	+	1	0	PPP2R5D	43083752	0.967000	0.33354	0.994000	0.49952	0.995000	0.86356	0.071000	0.14594	-0.187000	0.10516	-0.302000	0.09304	CCG	.	.		0.542	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040573.3	NM_006245	
TRDN	10345	hgsc.bcm.edu	37	6	123825006	123825006	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:123825006C>A	ENST00000398178.3	-	8	672	c.651G>T	c.(649-651)aaG>aaT	p.K217N	TRDN_ENST00000546248.1_Missense_Mutation_p.K217N|TRDN_ENST00000334268.4_Missense_Mutation_p.K217N	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	217					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CCTTTTTAGTCTTTTCTTCAC	0.323																																					p.K217N		Atlas-SNP	.											.	TRDN	88	.	0			c.G651T						.						174.0	149.0	157.0					6																	123825006		1828	4081	5909	SO:0001583	missense	10345	exon8			TTTAGTCTTTTCT	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.651G>T	chr6.hg19:g.123825006C>A	ENSP00000381240:p.Lys217Asn	510.0	0.0		248.0	209.0	NM_001256020	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	hg19	CCDS55053.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.81|13.81	2.348001|2.348001	0.41599|0.41599	.|.	.|.	ENSG00000186439|ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613|ENST00000361029	T;T;D|.	0.97575|.	-0.09;-0.09;-4.44|.	5.3|5.3	4.43|4.43	0.53597|0.53597	Aspartyl beta-hydroxylase/Triadin domain (1);|.	0.222762|.	0.39834|.	N|.	0.001257|.	T|T	0.54143|0.54143	0.1840|0.1840	M|M	0.75447|0.75447	2.3|2.3	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D;D|.	0.89917|.	0.99;0.999;0.999;1.0|.	P;D;D;D|.	0.72982|.	0.814;0.969;0.969;0.979|.	T|T	0.58278|0.58278	-0.7664|-0.7664	10|5	0.72032|.	D|.	0.01|.	-8.974|-8.974	8.1933|8.1933	0.31381|0.31381	0.0:0.8163:0.0:0.1837|0.0:0.8163:0.0:0.1837	.|.	217;217;217;217|.	F5H2W7;Q5SWK9;Q8IVK2;Q13061|.	.;.;.;TRDN_HUMAN|.	N|I	217;217;217;217;217;217;122|56	ENSP00000381240:K217N;ENSP00000333984:K217N;ENSP00000439281:K217N|.	ENSP00000329278:K122N|.	K|R	-|-	3|2	2|0	TRDN|TRDN	123866705|123866705	0.917000|0.917000	0.31117|0.31117	0.950000|0.950000	0.38849|0.38849	0.930000|0.930000	0.56654|0.56654	1.573000|1.573000	0.36472|0.36472	1.215000|1.215000	0.43411|0.43411	0.467000|0.467000	0.42956|0.42956	AAG|AGA	.	.		0.323	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
RNF216	54476	hgsc.bcm.edu	37	7	5662625	5662625	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:5662625T>C	ENST00000425013.2	-	17	2691	c.2467A>G	c.(2467-2469)Atg>Gtg	p.M823V	RNF216_ENST00000469375.1_5'UTR|RNF216_ENST00000389902.3_Missense_Mutation_p.M880V	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	823	Pro-rich.				apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATAGGCCCCATGTTGAGTGGG	0.632																																					p.M880V		Atlas-SNP	.											.	RNF216	71	.	0			c.A2638G						.						90.0	94.0	93.0					7																	5662625		2203	4300	6503	SO:0001583	missense	54476	exon17			GCCCCATGTTGAG	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.2467A>G	chr7.hg19:g.5662625T>C	ENSP00000404602:p.Met823Val	115.0	0.0		63.0	17.0	NM_207111	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	hg19	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	T	7.905	0.735170	0.15574	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.41758	0.99;1.0	5.04	0.817	0.18773	.	0.264571	0.41938	D	0.000795	T	0.25975	0.0633	L	0.29908	0.895	0.27953	N	0.937071	B;B	0.12013	0.004;0.005	B;B	0.10450	0.003;0.005	T	0.12578	-1.0542	10	0.42905	T	0.14	-6.3676	6.4203	0.21740	0.3737:0.0:0.1296:0.4967	.	823;880	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	V	823;880;635	ENSP00000404602:M823V;ENSP00000374552:M880V	ENSP00000374552:M880V	M	-	1	0	RNF216	5629151	1.000000	0.71417	1.000000	0.80357	0.123000	0.20343	1.296000	0.33389	0.292000	0.22492	0.459000	0.35465	ATG	.	.		0.632	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
ABCA13	154664	hgsc.bcm.edu	37	7	48467402	48467402	+	Missense_Mutation	SNP	C	C	T	rs547117792		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:48467402C>T	ENST00000435803.1	+	42	12523	c.12499C>T	c.(12499-12501)Cac>Tac	p.H4167Y		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4167					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CAAGAAATCTCACATTGCCCT	0.423																																					p.H4167Y		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C12499T						.						59.0	56.0	57.0					7																	48467402		1866	4123	5989	SO:0001583	missense	154664	exon42			AAATCTCACATTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12499C>T	chr7.hg19:g.48467402C>T	ENSP00000411096:p.His4167Tyr	151.0	0.0		106.0	52.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	0.291	-0.979834	0.02197	.	.	ENSG00000179869	ENST00000435803	D	0.86297	-2.1	4.74	0.727	0.18254	.	0.603419	0.14587	N	0.310535	T	0.62441	0.2428	N	0.02011	-0.69	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.53180	-0.8475	10	0.05436	T	0.98	.	8.5673	0.33547	0.0:0.2977:0.5957:0.1066	.	1869;4167	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	Y	4167	ENSP00000411096:H4167Y	ENSP00000411096:H4167Y	H	+	1	0	ABCA13	48437948	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.394000	0.07296	0.017000	0.15025	-0.150000	0.13652	CAC	.	.		0.423	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ZNF804B	219578	hgsc.bcm.edu	37	7	88966173	88966173	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:88966173C>T	ENST00000333190.4	+	4	4486	c.3877C>T	c.(3877-3879)Cct>Tct	p.P1293S		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1293							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGCATTTATTCCTACATTGTT	0.453										HNSCC(36;0.09)																											p.P1293S		Atlas-SNP	.											.	ZNF804B	322	.	0			c.C3877T						.						207.0	191.0	197.0					7																	88966173		2203	4300	6503	SO:0001583	missense	219578	exon4			TTTATTCCTACAT	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3877C>T	chr7.hg19:g.88966173C>T	ENSP00000329638:p.Pro1293Ser	211.0	0.0		127.0	62.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	hg19	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.776524	0.70107	.	.	ENSG00000182348	ENST00000333190	T	0.14766	2.48	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000006	T	0.42063	0.1186	M	0.77103	2.36	0.52099	D	0.999945	D	0.89917	1.0	D	0.91635	0.999	T	0.25502	-1.0130	10	0.72032	D	0.01	-15.2313	19.3813	0.94536	0.0:1.0:0.0:0.0	.	1293	A4D1E1	Z804B_HUMAN	S	1293	ENSP00000329638:P1293S	ENSP00000329638:P1293S	P	+	1	0	ZNF804B	88804109	1.000000	0.71417	0.998000	0.56505	0.489000	0.33432	6.985000	0.76193	2.798000	0.96311	0.655000	0.94253	CCT	.	.		0.453	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ASNS	440	hgsc.bcm.edu	37	7	97481701	97481701	+	Missense_Mutation	SNP	C	C	T	rs568570377		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:97481701C>T	ENST00000394309.3	-	13	2027	c.1556G>A	c.(1555-1557)cGt>cAt	p.R519H	ASNS_ENST00000437628.1_Missense_Mutation_p.R436H|ASNS_ENST00000175506.4_Missense_Mutation_p.R519H|ASNS_ENST00000455086.1_Missense_Mutation_p.R436H|ASNS_ENST00000394308.3_Missense_Mutation_p.R519H|ASNS_ENST00000422745.1_Missense_Mutation_p.R498H|ASNS_ENST00000444334.1_Missense_Mutation_p.R498H	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	519	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	AAAGACTTGACGGTAGTAATA	0.478																																					p.R519H	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Atlas-SNP	.											.	ASNS	97	.	0			c.G1556A						.						154.0	148.0	150.0					7																	97481701		2203	4300	6503	SO:0001583	missense	440	exon13			ACTTGACGGTAGT	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1556G>A	chr7.hg19:g.97481701C>T	ENSP00000377846:p.Arg519His	135.0	0.0		125.0	50.0	NM_133436	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	hg19	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039046	0.93630	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.53640	0.62;0.62;0.61;0.62;0.63;0.61;0.63	5.23	5.23	0.72850	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.75803	0.3899	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.82186	-0.0582	10	0.87932	D	0	-6.9268	16.6738	0.85273	0.0:1.0:0.0:0.0	.	519	P08243	ASNS_HUMAN	H	519;519;436;519;498;436;498	ENSP00000175506:R519H;ENSP00000377846:R519H;ENSP00000414379:R436H;ENSP00000377845:R519H;ENSP00000414901:R498H;ENSP00000408472:R436H;ENSP00000406994:R498H	ENSP00000175506:R519H	R	-	2	0	ASNS	97319637	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	5.580000	0.67464	2.609000	0.88269	0.561000	0.74099	CGT	.	.		0.478	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
ALKBH4	54784	hgsc.bcm.edu	37	7	102100057	102100057	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:102100057C>A	ENST00000292566.3	-	2	354	c.315G>T	c.(313-315)agG>agT	p.R105S		NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	105					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			kidney(1)|lung(5)|skin(2)	8						CTACCTGCTTCCTCCGTCCAG	0.642																																					p.R105S		Atlas-SNP	.											.	ALKBH4	21	.	0			c.G315T						.						94.0	88.0	90.0					7																	102100057		2203	4300	6503	SO:0001583	missense	54784	exon2			CTGCTTCCTCCGT	BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.315G>T	chr7.hg19:g.102100057C>A	ENSP00000292566:p.Arg105Ser	56.0	0.0		29.0	12.0	NM_017621	Q53H92|Q9H6A4	Missense_Mutation	SNP	ENST00000292566.3	hg19	CCDS5723.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827971	0.50845	.	.	ENSG00000160993	ENST00000292566	T	0.40756	1.02	4.51	2.7	0.31948	.	0.098436	0.64402	D	0.000002	T	0.46889	0.1416	M	0.86740	2.835	0.53688	D	0.999979	P	0.51653	0.947	B	0.41723	0.365	T	0.54057	-0.8350	10	0.72032	D	0.01	-18.5777	9.7796	0.40640	0.0:0.8308:0.0:0.1692	.	105	Q9NXW9	ALKB4_HUMAN	S	105	ENSP00000292566:R105S	ENSP00000292566:R105S	R	-	3	2	ALKBH4	101887062	1.000000	0.71417	0.997000	0.53966	0.721000	0.41392	2.531000	0.45650	0.355000	0.24131	-0.258000	0.10820	AGG	.	.		0.642	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349503.1	NM_017621	
PREX2	80243	hgsc.bcm.edu	37	8	69021775	69021775	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:69021775A>T	ENST00000288368.4	+	25	3340	c.3063A>T	c.(3061-3063)gaA>gaT	p.E1021D		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1021					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAGACTTAGAAACCCAAGACA	0.463																																					p.E1021D		Atlas-SNP	.											.	PREX2	614	.	0			c.A3063T						.						128.0	125.0	126.0					8																	69021775		2203	4300	6503	SO:0001583	missense	80243	exon25			CTTAGAAACCCAA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3063A>T	chr8.hg19:g.69021775A>T	ENSP00000288368:p.Glu1021Asp	93.0	0.0		102.0	29.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302048	0.60195	.	.	ENSG00000046889	ENST00000288368	T	0.41400	1.0	5.72	4.57	0.56435	.	.	.	.	.	T	0.36468	0.0968	L	0.43923	1.385	0.40182	D	0.977305	B	0.14805	0.011	B	0.18871	0.023	T	0.18840	-1.0324	9	0.62326	D	0.03	.	11.4392	0.50086	0.9299:0.0:0.0701:0.0	.	1021	Q70Z35	PREX2_HUMAN	D	1021	ENSP00000288368:E1021D	ENSP00000288368:E1021D	E	+	3	2	PREX2	69184329	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.397000	0.44477	1.012000	0.39366	0.533000	0.62120	GAA	.	.		0.463	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
RGS22	26166	hgsc.bcm.edu	37	8	101118126	101118126	+	Splice_Site	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:101118126C>A	ENST00000360863.6	-	1	218	c.24G>T	c.(22-24)gcG>gcT	p.A8A	RGS22_ENST00000523287.1_5'Flank|RGS22_ENST00000523437.1_Splice_Site_p.A8A	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	8					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GCCACCTACCCGCGGTGAGCC	0.751																																					p.A8A		Atlas-SNP	.											.	RGS22	319	.	0			c.G24T						.						7.0	15.0	12.0					8																	101118126		1344	2930	4274	SO:0001630	splice_region_variant	26166	exon1			CCTACCCGCGGTG	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.25+1G>T	chr8.hg19:g.101118126C>A		40.0	0.0		60.0	34.0	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	hg19	CCDS43758.1																																																																																			.	.		0.751	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	Silent
KIAA2026	158358	hgsc.bcm.edu	37	9	5920263	5920263	+	Silent	SNP	G	G	T	rs535663249		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:5920263G>T	ENST00000399933.3	-	8	5732	c.5733C>A	c.(5731-5733)ctC>ctA	p.L1911L	KIAA2026_ENST00000381461.2_Silent_p.L1881L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1911								p.L1086L(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TAGATATAAGGAGAACATGGC	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		19171	0.0		0.0	False		,,,				2504	0.001				p.L1911L		Atlas-SNP	.											KIAA2026,NS,carcinoma,0,1	KIAA2026	231	.	1	Substitution - coding silent(1)	breast(1)	c.C5733A						.						135.0	135.0	135.0					9																	5920263		1888	4109	5997	SO:0001819	synonymous_variant	158358	exon8			TATAAGGAGAACA	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5733C>A	chr9.hg19:g.5920263G>T		72.0	0.0		53.0	31.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	hg19																																																																																				.	.		0.443	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
C5	727	hgsc.bcm.edu	37	9	123792742	123792742	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:123792742T>C	ENST00000223642.1	-	7	720	c.691A>G	c.(691-693)Atc>Gtc	p.I231V		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	231					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TCTGGCTCGATTGAGACAGAA	0.284																																					p.I231V		Atlas-SNP	.											.	C5	124	.	0			c.A691G						.						18.0	19.0	18.0					9																	123792742		2136	4159	6295	SO:0001583	missense	727	exon7			GCTCGATTGAGAC	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.691A>G	chr9.hg19:g.123792742T>C	ENSP00000223642:p.Ile231Val	389.0	0.0		186.0	88.0	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	hg19	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	T	4.450	0.083274	0.08533	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.30714	1.52	5.75	1.96	0.26148	.	0.162190	0.56097	N	0.000036	T	0.20170	0.0485	L	0.49699	1.58	0.24121	N	0.995801	P;B	0.40144	0.704;0.001	B;B	0.28638	0.092;0.004	T	0.11251	-1.0595	10	0.45353	T	0.12	.	7.5761	0.27937	0.1082:0.1314:0.0:0.7604	.	302;231	Q59GS8;P01031	.;CO5_HUMAN	V	231;302	ENSP00000223642:I231V	ENSP00000223642:I231V	I	-	1	0	C5	122832563	1.000000	0.71417	0.300000	0.25030	0.314000	0.28054	1.333000	0.33816	0.115000	0.18071	-1.139000	0.01908	ATC	.	.		0.284	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43650967	43650967	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:43650967C>T	ENST00000374466.3	+	2	705	c.370C>T	c.(370-372)Ctt>Ttt	p.L124F	CSGALNACT2_ENST00000374464.1_Missense_Mutation_p.L124F	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	124					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTTAGAGTTTCTTCATTCCCA	0.418																																					p.L124F		Atlas-SNP	.											.	CSGALNACT2	67	.	0			c.C370T						.						90.0	78.0	82.0					10																	43650967		2203	4300	6503	SO:0001583	missense	55454	exon2			GAGTTTCTTCATT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.370C>T	chr10.hg19:g.43650967C>T	ENSP00000363590:p.Leu124Phe	97.0	0.0		66.0	33.0	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	hg19	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917611	0.73098	.	.	ENSG00000169826	ENST00000374466;ENST00000374464	T;T	0.36520	1.36;1.25	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.61553	0.2356	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.63391	-0.6648	10	0.59425	D	0.04	-18.9168	13.4372	0.61090	0.0:0.9283:0.0:0.0717	.	124;124	Q8N6G5;Q8N6G5-2	CGAT2_HUMAN;.	F	124	ENSP00000363590:L124F;ENSP00000363588:L124F	ENSP00000363588:L124F	L	+	1	0	CSGALNACT2	42970973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.728000	0.54991	2.861000	0.98227	0.650000	0.86243	CTT	.	.		0.418	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
PALD1	27143	hgsc.bcm.edu	37	10	72324191	72324191	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:72324191T>C	ENST00000263563.6	+	19	2602	c.2334T>C	c.(2332-2334)taT>taC	p.Y778Y		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	778						cytosol (GO:0005829)											TGGAGCGCTATGTCTGCCTGA	0.622																																					p.Y778Y		Atlas-SNP	.											.	.	.	.	0			c.T2334C						.						123.0	118.0	120.0					10																	72324191		2203	4300	6503	SO:0001819	synonymous_variant	27143	exon19			GCGCTATGTCTGC	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2334T>C	chr10.hg19:g.72324191T>C		168.0	0.0		79.0	20.0	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Silent	SNP	ENST00000263563.6	hg19	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	T	1.598	-0.527231	0.04141	.	.	ENSG00000107719	ENST00000426268	.	.	.	5.21	1.26	0.21427	.	.	.	.	.	T	0.57227	0.2039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49899	-0.8890	4	.	.	.	-24.9332	8.8717	0.35320	0.0:0.6022:0.0:0.3978	.	.	.	.	R	159	.	.	C	+	1	0	KIAA1274	71994197	0.964000	0.33143	0.326000	0.25389	0.187000	0.23431	0.760000	0.26475	0.203000	0.20529	-0.375000	0.07067	TGT	.	.		0.622	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
TMEM254	80195	hgsc.bcm.edu	37	10	81850592	81850592	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:81850592G>C	ENST00000372281.3	+	4	321	c.291G>C	c.(289-291)tgG>tgC	p.W97C	TMEM254_ENST00000372275.1_3'UTR|TMEM254_ENST00000372274.1_3'UTR|TMEM254_ENST00000467529.1_3'UTR	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254	97						integral component of membrane (GO:0016021)											AGCTACTCTGGTTCCTACAGA	0.403																																					p.W121C		Atlas-SNP	.											.	TMEM254	1	.	0			c.G363C						.						161.0	146.0	151.0					10																	81850592		2203	4300	6503	SO:0001583	missense	80195	exon4			ACTCTGGTTCCTA	BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.291G>C	chr10.hg19:g.81850592G>C	ENSP00000361355:p.Trp97Cys	186.0	0.0		89.0	31.0	NM_001270367	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	Missense_Mutation	SNP	ENST00000372281.3	hg19	CCDS7363.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.74|16.74|16.74	3.207456|3.207456|3.207456	0.58343|0.58343|0.58343	.|.|.	.|.|.	ENSG00000133678|ENSG00000133678|ENSG00000133678	ENST00000372273|ENST00000450179|ENST00000372281	.|.|.	.|.|.	.|.|.	4.07|4.07|4.07	4.07|4.07|4.07	0.47477|0.47477|0.47477	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.80221|0.80221|0.80221	0.4583|0.4583|0.4583	M|M|M	0.86420|0.86420|0.86420	2.815|2.815|2.815	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D	.|.|0.89917	.|.|1.0;1.0	.|.|D;D	.|.|0.91635	.|.|0.999;0.999	D|D|D	0.83751|0.83751|0.83751	0.0209|0.0209|0.0209	5|5|9	.|.|0.87932	.|.|D	.|.|0	-15.4804|-15.4804|-15.4804	12.4851|12.4851|12.4851	0.55868|0.55868|0.55868	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|121;97	.|.|E7ERB9;Q8TBM7	.|.|.;CJ057_HUMAN	A|L|C	118|75|97	.|.|.	.|.|ENSP00000361355:W97C	G|V|W	+|+|+	2|1|3	0|0|0	C10orf57|C10orf57|C10orf57	81840572|81840572|81840572	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.953000|0.953000|0.953000	0.61014|0.61014|0.61014	3.985000|3.985000|3.985000	0.56930|0.56930|0.56930	2.224000|2.224000|2.224000	0.72417|0.72417|0.72417	0.557000|0.557000|0.557000	0.71058|0.71058|0.71058	GGT|GTT|TGG	.	.		0.403	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049030.1	NM_025125	
PDCD11	22984	hgsc.bcm.edu	37	10	105162878	105162878	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:105162878C>T	ENST00000369797.3	+	4	332	c.238C>T	c.(238-240)Ctg>Ttg	p.L80L		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	80					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CTTCTAGTCCCTGTGTGAGGG	0.443																																					p.L80L		Atlas-SNP	.											.	PDCD11	160	.	0			c.C238T						.						188.0	187.0	187.0					10																	105162878		2203	4300	6503	SO:0001819	synonymous_variant	22984	exon4			TAGTCCCTGTGTG	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.238C>T	chr10.hg19:g.105162878C>T		348.0	0.0		216.0	59.0	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	hg19	CCDS31276.1																																																																																			.	.		0.443	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
CASP7	840	hgsc.bcm.edu	37	10	115457351	115457351	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:115457351G>A	ENST00000345633.4	+	3	483	c.99G>A	c.(97-99)ccG>ccA	p.P33P	CASP7_ENST00000369315.1_Silent_p.P33P|CASP7_ENST00000369321.2_Silent_p.P66P|CASP7_ENST00000369318.3_Silent_p.P33P|CASP7_ENST00000369331.4_Silent_p.P33P	NM_033339.4	NP_203125.1	P55210	CASP7_HUMAN	caspase 7, apoptosis-related cysteine peptidase	33					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		CGTTTGTACCGTCCCTCTTCA	0.547																																					p.R108H		Atlas-SNP	.											.	CASP7	21	.	0			c.G323A						.						178.0	141.0	154.0					10																	115457351		2203	4300	6503	SO:0001819	synonymous_variant	840	exon2			TGTACCGTCCCTC	U37448	CCDS7580.1, CCDS7581.1, CCDS7582.1, CCDS58096.1, CCDS73200.1	10q25	2006-02-17	2005-08-17		ENSG00000165806	ENSG00000165806		"""Caspases"""	1508	protein-coding gene	gene with protein product		601761	"""caspase 7, apoptosis-related cysteine protease"""			8521391, 8576161	Standard	NM_033338		Approved	MCH3, CMH-1, ICE-LAP3	uc010qsa.3	P55210	OTTHUMG00000019076	ENST00000345633.4:c.99G>A	chr10.hg19:g.115457351G>A		127.0	0.0		75.0	17.0	NM_001267057	B4DQU7|B5BU45|D3DRB8|Q13364|Q53YD5|Q5SVL0|Q5SVL3|Q96BA0	Missense_Mutation	SNP	ENST00000345633.4	hg19	CCDS7581.1																																																																																			.	.		0.547	CASP7-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050439.1	NM_033338	
ZNF214	7761	hgsc.bcm.edu	37	11	7021165	7021165	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:7021165T>G	ENST00000278314.4	-	3	2064	c.1749A>C	c.(1747-1749)aaA>aaC	p.K583N	ZNF214_ENST00000536068.1_Missense_Mutation_p.K583N|ZNF214_ENST00000531083.1_5'Flank	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	583					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		ATTCACGGCATTTGTAAGGTT	0.343																																					p.K583N	Ovarian(22;251 657 736 21522 46864)	Atlas-SNP	.											.	ZNF214	65	.	0			c.A1749C						.						75.0	79.0	78.0					11																	7021165		2200	4295	6495	SO:0001583	missense	7761	exon3			ACGGCATTTGTAA	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1749A>C	chr11.hg19:g.7021165T>G	ENSP00000278314:p.Lys583Asn	111.0	0.0		66.0	22.0	NM_013249	B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	hg19	CCDS31418.1	.	.	.	.	.	.	.	.	.	.	T	6.273	0.418459	0.11870	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.61859	0.07;0.07	3.84	2.72	0.32119	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000208	T	0.54319	0.1851	M	0.61387	1.9	0.09310	N	1	P	0.48016	0.904	P	0.45167	0.472	T	0.51276	-0.8726	10	0.66056	D	0.02	.	7.5285	0.27668	0.0:0.1056:0.0:0.8944	.	583	Q9UL59	ZN214_HUMAN	N	583	ENSP00000278314:K583N;ENSP00000445373:K583N	ENSP00000278314:K583N	K	-	3	2	ZNF214	6977741	0.000000	0.05858	0.323000	0.25347	0.670000	0.39368	-0.570000	0.05895	0.845000	0.35118	0.454000	0.30748	AAA	.	.		0.343	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1		
CALCA	796	hgsc.bcm.edu	37	11	14990439	14990439	+	Intron	SNP	A	A	T	rs377551213		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:14990439A>T	ENST00000486207.1	-	3	236				CALCA_ENST00000359642.3_Missense_Mutation_p.I111N|CALCA_ENST00000396372.2_Missense_Mutation_p.I111N|CALCA_ENST00000361010.3_Intron|CALCB_ENST00000523376.1_Intron|CALCA_ENST00000331587.4_Missense_Mutation_p.I111N			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha						activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						TCCAACCCCAATTGCAGTTTG	0.517																																					p.I111N		Atlas-SNP	.											.	CALCA	30	.	0			c.T332A						.						221.0	181.0	195.0					11																	14990439		2200	4294	6494	SO:0001627	intron_variant	796	exon4			ACCCCAATTGCAG	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.228-1039T>A	chr11.hg19:g.14990439A>T		190.0	0.0		130.0	64.0	NM_001741	Q93048|Q9UCP0	Missense_Mutation	SNP	ENST00000486207.1	hg19	CCDS31432.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216046	0.39201	.	.	ENSG00000110680	ENST00000359642;ENST00000331587;ENST00000396372	T;T;T	0.31247	1.5;1.5;1.5	4.61	2.26	0.28386	Calcitonin peptide-like (1);	0.227204	0.44902	D	0.000413	T	0.29882	0.0747	L	0.44542	1.39	0.34839	D	0.740528	P	0.50369	0.934	P	0.47402	0.546	T	0.42120	-0.9470	10	0.87932	D	0	-16.9073	8.635	0.33941	0.8373:0.0:0.1627:0.0	.	111	P01258	CALC_HUMAN	N	111	ENSP00000352663:I111N;ENSP00000331746:I111N;ENSP00000379657:I111N	ENSP00000331746:I111N	I	-	2	0	CALCA	14947015	1.000000	0.71417	0.780000	0.31762	0.466000	0.32739	5.577000	0.67444	0.370000	0.24538	-0.290000	0.09829	ATT	.	.		0.517	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741	
LRRC4C	57689	hgsc.bcm.edu	37	11	40137651	40137651	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:40137651C>T	ENST00000278198.2	-	2	2155	c.192G>A	c.(190-192)cgG>cgA	p.R64R	LRRC4C_ENST00000528697.1_Silent_p.R64R|LRRC4C_ENST00000527150.1_Silent_p.R64R|LRRC4C_ENST00000530763.1_Silent_p.R64R			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	64	LRRNT.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GCAGGTTTTTCCGAACACAAA	0.532																																					p.R64R		Atlas-SNP	.											.	LRRC4C	190	.	0			c.G192A						.						88.0	75.0	79.0					11																	40137651		2203	4300	6503	SO:0001819	synonymous_variant	57689	exon7			GTTTTTCCGAACA	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.192G>A	chr11.hg19:g.40137651C>T		97.0	0.0		92.0	39.0	NM_001258419	A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	hg19	CCDS31464.1																																																																																			.	.		0.532	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
ALKBH3	221120	hgsc.bcm.edu	37	11	43923153	43923153	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:43923153A>T	ENST00000302708.4	+	8	958	c.547A>T	c.(547-549)Aat>Tat	p.N183Y	ALKBH3_ENST00000532410.1_Intron	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	183	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	TCTTTATCGCAATGAGAAGGA	0.502								Direct reversal of damage																													p.N183Y		Atlas-SNP	.											.	ALKBH3	33	.	0			c.A547T						.						170.0	140.0	150.0					11																	43923153		2203	4300	6503	SO:0001583	missense	221120	exon8			TATCGCAATGAGA	AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.547A>T	chr11.hg19:g.43923153A>T	ENSP00000302232:p.Asn183Tyr	104.0	0.0		65.0	26.0	NM_139178	A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Missense_Mutation	SNP	ENST00000302708.4	hg19	CCDS7906.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.85|16.85	3.237268|3.237268	0.58886|0.58886	.|.	.|.	ENSG00000166199|ENSG00000166199	ENST00000302708;ENST00000529366|ENST00000532129	T;T|.	0.14516|.	2.5;2.5|.	5.67|5.67	1.56|1.56	0.23342|0.23342	Oxoglutarate/iron-dependent oxygenase (2);|.	0.190738|.	0.56097|.	D|.	0.000039|.	T|T	0.53786|0.53786	0.1818|0.1818	M|M	0.80847|0.80847	2.515|2.515	0.24941|0.24941	N|N	0.991851|0.991851	P|.	0.46064|.	0.872|.	P|.	0.56514|.	0.8|.	T|T	0.48681|0.48681	-0.9014|-0.9014	10|5	0.72032|.	D|.	0.01|.	-5.7296|-5.7296	5.0171|5.0171	0.14343|0.14343	0.5765:0.145:0.2785:0.0|0.5765:0.145:0.2785:0.0	.|.	183|.	Q96Q83|.	ALKB3_HUMAN|.	Y|L	183;182|52	ENSP00000302232:N183Y;ENSP00000435848:N182Y|.	ENSP00000302232:N183Y|.	N|Q	+|+	1|2	0|0	ALKBH3|ALKBH3	43879729|43879729	0.906000|0.906000	0.30813|0.30813	0.003000|0.003000	0.11579|0.11579	0.900000|0.900000	0.52787|0.52787	1.880000|1.880000	0.39628|0.39628	0.012000|0.012000	0.14892|0.14892	0.533000|0.533000	0.62120|0.62120	AAT|CAA	.	.		0.502	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389693.1	NM_139178	
CTNND1	1500	hgsc.bcm.edu	37	11	57569523	57569523	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:57569523C>T	ENST00000399050.4	+	7	1811	c.1275C>T	c.(1273-1275)caC>caT	p.H425H	CTNND1_ENST00000428599.2_Silent_p.H425H|CTNND1_ENST00000399039.4_Silent_p.H425H|CTNND1_ENST00000529919.1_Silent_p.H425H|CTNND1_ENST00000532463.1_Silent_p.H324H|CTNND1_ENST00000532844.1_Silent_p.H371H|CTNND1_ENST00000532649.1_Silent_p.H371H|CTNND1_ENST00000530094.1_Silent_p.H324H|CTNND1_ENST00000524630.1_Silent_p.H425H|CTNND1_ENST00000526772.1_Silent_p.H102H|CTNND1_ENST00000358694.6_Silent_p.H425H|CTNND1_ENST00000529986.1_Silent_p.H324H|CTNND1_ENST00000361796.4_Silent_p.H425H|CTNND1_ENST00000532787.1_Silent_p.H324H|CTNND1_ENST00000530748.1_Silent_p.H371H|CTNND1_ENST00000534579.1_Silent_p.H371H|CTNND1_ENST00000527467.1_Silent_p.H102H|CTNND1_ENST00000529526.1_Silent_p.H371H|CTNND1_ENST00000529873.1_Silent_p.H371H|CTNND1_ENST00000361332.4_Silent_p.H425H|CTNND1_ENST00000533667.1_Silent_p.H102H|CTNND1_ENST00000525902.1_Silent_p.H102H|CTNND1_ENST00000426142.2_Silent_p.H324H|CTNND1_ENST00000360682.6_Silent_p.H425H|CTNND1_ENST00000528621.1_Silent_p.H371H|CTNND1_ENST00000532245.1_Silent_p.H324H|CTNND1_ENST00000531014.1_Silent_p.H102H|CTNND1_ENST00000526938.1_Silent_p.H425H|CTNND1_ENST00000361391.6_Silent_p.H425H|CTNND1_ENST00000526357.1_Silent_p.H371H|CTNND1_ENST00000528232.1_Silent_p.H324H|CTNND1_ENST00000415361.2_Silent_p.H324H	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	425					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				AGGAAGTGCACCTTGGAGCCT	0.488																																					p.H425H		Atlas-SNP	.											.	CTNND1	203	.	0			c.C1275T						.						167.0	168.0	167.0					11																	57569523		1976	4164	6140	SO:0001819	synonymous_variant	1500	exon7			AGTGCACCTTGGA	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1275C>T	chr11.hg19:g.57569523C>T		128.0	0.0		77.0	36.0	NM_001085461	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Silent	SNP	ENST00000399050.4	hg19	CCDS44604.1																																																																																			.	.		0.488	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810617	65810617	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:65810617G>A	ENST00000312006.4	-	3	938	c.657C>T	c.(655-657)gaC>gaT	p.D219D	GAL3ST3_ENST00000527878.1_Silent_p.D219D	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	219					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						AGGCGGCGTCGTCGCGCGGGC	0.667																																					p.D219D		Atlas-SNP	.											GAL3ST3,NS,carcinoma,0,1	GAL3ST3	40	.	0			c.C657T						.						33.0	38.0	36.0					11																	65810617		2199	4292	6491	SO:0001819	synonymous_variant	89792	exon3			GGCGTCGTCGCGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.657C>T	chr11.hg19:g.65810617G>A		49.0	0.0		40.0	20.0	NM_033036	Q14D05	Silent	SNP	ENST00000312006.4	hg19	CCDS8128.1																																																																																			.	.		0.667	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
GRM5	2915	hgsc.bcm.edu	37	11	88583097	88583097	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:88583097C>T	ENST00000305447.4	-	2	1037	c.888G>A	c.(886-888)gcG>gcA	p.A296A	GRM5_ENST00000393297.1_Silent_p.A296A|GRM5_ENST00000455756.2_Silent_p.A296A|GRM5_ENST00000418177.2_Silent_p.A296A|GRM5_ENST00000305432.5_Silent_p.A296A	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	296					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GAAATTCTCCCGCTAGACCCA	0.517																																					p.A296A		Atlas-SNP	.											GRM5_ENST00000418177,caecum,carcinoma,0,2	GRM5	414	.	0			c.G888A						.						61.0	68.0	66.0					11																	88583097		2201	4299	6500	SO:0001819	synonymous_variant	2915	exon3			TTCTCCCGCTAGA	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.888G>A	chr11.hg19:g.88583097C>T		193.0	0.0		146.0	78.0	NM_000842	Q6J164	Silent	SNP	ENST00000305447.4	hg19	CCDS44694.1																																																																																			.	.		0.517	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
SORL1	6653	hgsc.bcm.edu	37	11	121383718	121383718	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:121383718T>C	ENST00000260197.7	+	7	1075	c.946T>C	c.(946-948)Ttg>Ctg	p.L316L	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	316					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GCAGCATCTCTTGGGCAGTGA	0.443																																					p.L316L		Atlas-SNP	.											.	SORL1	218	.	0			c.T946C						.						70.0	69.0	70.0					11																	121383718		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon7			CATCTCTTGGGCA	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.946T>C	chr11.hg19:g.121383718T>C		97.0	0.0		90.0	32.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	hg19	CCDS8436.1																																																																																			.	.		0.443	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
TMEM225	338661	hgsc.bcm.edu	37	11	123753908	123753908	+	Silent	SNP	A	A	T	rs369698336		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:123753908A>T	ENST00000375026.2	-	4	831	c.615T>A	c.(613-615)cgT>cgA	p.R205R		NM_001013743.1	NP_001013765.1	Q6GV28	TM225_HUMAN	transmembrane protein 225	205					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	28						CAGTGTGTGCACGGACAATGC	0.398																																					p.R205R		Atlas-SNP	.											.	TMEM225	56	.	0			c.T615A						.						180.0	164.0	170.0					11																	123753908		2202	4299	6501	SO:0001819	synonymous_variant	338661	exon4			GTGTGCACGGACA	AY634366	CCDS31697.1	11q24.1	2014-06-13			ENSG00000204300	ENSG00000204300			32390	protein-coding gene	gene with protein product	"""PMP22 claudin domain containing"", ""protein phosphatase 1, regulatory subunit 154"""						Standard	XM_006718832		Approved	PMP22CD, PPP1R154	uc001pzi.3	Q6GV28	OTTHUMG00000165959	ENST00000375026.2:c.615T>A	chr11.hg19:g.123753908A>T		201.0	0.0		206.0	94.0	NM_001013743		Silent	SNP	ENST00000375026.2	hg19	CCDS31697.1																																																																																			.	.		0.398	TMEM225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387260.1	NM_001013743	
LRP1	4035	hgsc.bcm.edu	37	12	57556190	57556190	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:57556190G>T	ENST00000243077.3	+	14	2759	c.2293G>T	c.(2293-2295)Gtc>Ttc	p.V765F		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	765					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGTGGCAGTGTCTACCGCTT	0.572																																					p.V765F		Atlas-SNP	.											.	LRP1	428	.	0			c.G2293T						.						199.0	159.0	173.0					12																	57556190		2203	4300	6503	SO:0001583	missense	4035	exon14			GGCAGTGTCTACC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2293G>T	chr12.hg19:g.57556190G>T	ENSP00000243077:p.Val765Phe	105.0	0.0		72.0	30.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201835	0.58234	.	.	ENSG00000123384	ENST00000243077	D	0.94457	-3.43	4.87	4.87	0.63330	Six-bladed beta-propeller, TolB-like (1);	0.082006	0.48286	D	0.000181	D	0.91219	0.7233	M	0.70787	2.145	0.80722	D	1	P	0.41313	0.745	B	0.33295	0.161	D	0.90526	0.4492	10	0.66056	D	0.02	.	7.5064	0.27547	0.1761:0.0:0.8239:0.0	.	765	Q07954	LRP1_HUMAN	F	765	ENSP00000243077:V765F	ENSP00000243077:V765F	V	+	1	0	LRP1	55842457	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	6.058000	0.71126	2.709000	0.92574	0.563000	0.77884	GTC	.	.		0.572	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
MAB21L1	4081	hgsc.bcm.edu	37	13	36049572	36049572	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr13:36049572G>A	ENST00000379919.4	-	1	1260	c.704C>T	c.(703-705)gCg>gTg	p.A235V	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	235					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CTCTGCCTCCGCGAACTGCAG	0.602																																					p.A235V		Atlas-SNP	.											.	MAB21L1	52	.	0			c.C704T						.						57.0	63.0	61.0					13																	36049572		2203	4300	6503	SO:0001583	missense	4081	exon1			GCCTCCGCGAACT	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.704C>T	chr13.hg19:g.36049572G>A	ENSP00000369251:p.Ala235Val	52.0	0.0		21.0	18.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	hg19	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979676	0.34942	.	.	ENSG00000180660	ENST00000379919	T	0.07908	3.15	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.08758	0.0217	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33879	-0.9851	10	0.19147	T	0.46	-27.0942	19.9576	0.97228	0.0:0.0:1.0:0.0	.	235	Q13394	MB211_HUMAN	V	235	ENSP00000369251:A235V	ENSP00000369251:A235V	A	-	2	0	MAB21L1	34947572	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	9.869000	0.99810	2.736000	0.93811	0.655000	0.94253	GCG	.	.		0.602	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
NYNRIN	57523	hgsc.bcm.edu	37	14	24884257	24884257	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:24884257T>C	ENST00000382554.3	+	9	3620	c.3302T>C	c.(3301-3303)aTg>aCg	p.M1101T		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1101					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						ATGGGCTTCATGGACTCCCAC	0.612																																					p.M1101T		Atlas-SNP	.											.	NYNRIN	120	.	0			c.T3302C						.						63.0	66.0	65.0					14																	24884257		2014	4197	6211	SO:0001583	missense	57523	exon9			GCTTCATGGACTC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3302T>C	chr14.hg19:g.24884257T>C	ENSP00000371994:p.Met1101Thr	89.0	0.0		76.0	27.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	T	6.859	0.527851	0.13127	.	.	ENSG00000205978	ENST00000382554	T	0.39787	1.06	4.45	3.29	0.37713	.	.	.	.	.	T	0.22781	0.0550	N	0.11201	0.11	0.27869	N	0.9401	B	0.06786	0.001	B	0.04013	0.001	T	0.14699	-1.0463	9	0.46703	T	0.11	.	6.6051	0.22721	0.0:0.1088:0.0:0.8912	.	1101	Q9P2P1	NYNRI_HUMAN	T	1101	ENSP00000371994:M1101T	ENSP00000371994:M1101T	M	+	2	0	NYNRIN	23954097	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	1.810000	0.38932	0.739000	0.32628	0.459000	0.35465	ATG	.	.		0.612	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
AREL1	9870	hgsc.bcm.edu	37	14	75140804	75140804	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:75140804A>T	ENST00000356357.4	-	9	1606	c.1091T>A	c.(1090-1092)gTg>gAg	p.V364E	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	364					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GAACTCCTTCACTGAGAATTG	0.408																																					p.V364E		Atlas-SNP	.											.	KIAA0317	68	.	0			c.T1091A						.						73.0	71.0	72.0					14																	75140804		1881	4122	6003	SO:0001583	missense	9870	exon9			TCCTTCACTGAGA	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1091T>A	chr14.hg19:g.75140804A>T	ENSP00000348714:p.Val364Glu	105.0	0.0		50.0	14.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	hg19	CCDS41971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.7|26.7	4.758454|4.758454	0.89843|0.89843	.|.	.|.	ENSG00000119682|ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202|ENST00000490805	T;T|.	0.52526|.	0.66;0.66|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.168253|.	0.52532|.	D|.	0.000075|.	T|.	0.59555|.	0.2202|.	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	P;P|.	0.48503|.	0.557;0.911|.	B;P|.	0.51385|.	0.279;0.668|.	T|.	0.56938|.	-0.7896|.	10|.	0.72032|.	D|.	0.01|.	.|.	13.7014|13.7014	0.62611|0.62611	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	364;364|.	O15033-2;O15033|.	.;K0317_HUMAN|.	E|R	364;203;203|98	ENSP00000348714:V364E;ENSP00000452101:V203E|.	ENSP00000348714:V364E|.	V|X	-|-	2|1	0|0	KIAA0317|KIAA0317	74210557|74210557	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.782000|8.782000	0.91809|0.91809	2.159000|2.159000	0.67721|0.67721	0.477000|0.477000	0.44152|0.44152	GTG|TGA	.	.		0.408	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
ATG2B	55102	hgsc.bcm.edu	37	14	96795907	96795907	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:96795907T>G	ENST00000359933.4	-	12	2688	c.1795A>C	c.(1795-1797)Agt>Cgt	p.S599R		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	599					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATATCAGTACTAAAATATCGG	0.323																																					p.S599R		Atlas-SNP	.											.	ATG2B	169	.	0			c.A1795C						.						115.0	114.0	114.0					14																	96795907		1813	4074	5887	SO:0001583	missense	55102	exon12			CAGTACTAAAATA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.1795A>C	chr14.hg19:g.96795907T>G	ENSP00000353010:p.Ser599Arg	166.0	0.0		85.0	50.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973215	0.74246	.	.	ENSG00000066739	ENST00000359933	T	0.11385	2.78	5.68	4.41	0.53225	.	0.061259	0.64402	U	0.000007	T	0.13586	0.0329	L	0.60455	1.87	0.44117	D	0.996893	P	0.38250	0.624	B	0.37943	0.261	T	0.01528	-1.1332	10	0.62326	D	0.03	.	11.5336	0.50624	0.0:0.0756:0.0:0.9244	.	599	Q96BY7	ATG2B_HUMAN	R	599	ENSP00000353010:S599R	ENSP00000353010:S599R	S	-	1	0	ATG2B	95865660	1.000000	0.71417	0.851000	0.33527	0.868000	0.49771	4.022000	0.57203	0.962000	0.38057	0.482000	0.46254	AGT	.	.		0.323	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ACTC1	70	hgsc.bcm.edu	37	15	35085586	35085586	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:35085586G>A	ENST00000290378.4	-	3	969	c.314C>T	c.(313-315)aCc>aTc	p.T105I	RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'Flank	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	105					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TGTGAGCAGGGTGGGGTGCTC	0.572																																					p.T105I		Atlas-SNP	.											.	ACTC1	75	.	0			c.C314T						.						86.0	85.0	86.0					15																	35085586		2201	4298	6499	SO:0001583	missense	70	exon3			AGCAGGGTGGGGT	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.314C>T	chr15.hg19:g.35085586G>A	ENSP00000290378:p.Thr105Ile	155.0	0.0		88.0	62.0	NM_005159	P04270	Missense_Mutation	SNP	ENST00000290378.4	hg19	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118132	0.56505	.	.	ENSG00000159251	ENST00000290378	D	0.93247	-3.19	5.63	5.63	0.86233	.	0.000000	0.53938	U	0.000052	D	0.87537	0.6202	N	0.00092	-2.175	0.80722	D	1	D	0.54772	0.968	D	0.87578	0.998	D	0.94287	0.7525	10	0.87932	D	0	.	20.0442	0.97604	0.0:0.0:1.0:0.0	.	105	P68032	ACTC_HUMAN	I	105	ENSP00000290378:T105I	ENSP00000290378:T105I	T	-	2	0	ACTC1	32872878	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	8.062000	0.89475	2.814000	0.96858	0.655000	0.94253	ACC	.	.		0.572	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
PPIP5K1	9677	hgsc.bcm.edu	37	15	43827486	43827486	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:43827486C>G	ENST00000396923.3	-	30	3809	c.3688G>C	c.(3688-3690)Gag>Cag	p.E1230Q	PPIP5K1_ENST00000381879.4_Missense_Mutation_p.E1206Q|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.E1203Q|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.E1205Q|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.E1226Q|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.E1230Q|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.E1205Q|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.E1203Q			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1230					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						AGCTCTTGCTCCCCTTCTATG	0.557																																					p.E1230Q		Atlas-SNP	.											.	PPIP5K1	34	.	0			c.G3688C						.						94.0	92.0	92.0					15																	43827486		2201	4298	6499	SO:0001583	missense	9677	exon31			CTTGCTCCCCTTC	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3688G>C	chr15.hg19:g.43827486C>G	ENSP00000380129:p.Glu1230Gln	262.0	0.0		215.0	84.0	NM_001130858	O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	ENST00000396923.3	hg19	CCDS45252.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.603608	0.00849	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806	T;T;T;T;T;T;T;T	0.22743	1.95;1.95;2.52;1.95;1.95;1.95;1.94;2.52	5.14	-1.33	0.09172	.	1.800900	0.02664	N	0.107860	T	0.08179	0.0204	N	0.01705	-0.755	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.002	T	0.25152	-1.0140	10	0.18276	T	0.48	0.7387	6.5571	0.22466	0.0:0.4178:0.2624:0.3198	.	1203;1230;1205	Q6PFW1-7;Q6PFW1;Q6PFW1-3	.;VIP1_HUMAN;.	Q	1226;1205;1203;1205;1230;1230;1205;1230;1206;1203	ENSP00000371309:E1226Q;ENSP00000353446:E1205Q;ENSP00000353253:E1203Q;ENSP00000334779:E1205Q;ENSP00000380129:E1230Q;ENSP00000400887:E1230Q;ENSP00000371303:E1206Q;ENSP00000308773:E1203Q	ENSP00000304750:E1230Q	E	-	1	0	PPIP5K1	41614778	.	.	0.001000	0.08648	0.038000	0.13279	.	.	-0.705000	0.05035	-1.945000	0.00491	GAG	.	.		0.557	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	NM_014659	
RHBDF1	64285	hgsc.bcm.edu	37	16	111695	111695	+	Splice_Site	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:111695C>T	ENST00000262316.6	-	9	1351		c.e9-1		RHBDF1_ENST00000454039.2_Splice_Site	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GAAGAAGGGCCTGCGGGGTGG	0.677																																					.		Atlas-SNP	.											.	RHBDF1	54	.	0			c.1209-1G>A						.						54.0	53.0	53.0					16																	111695		2203	4300	6503	SO:0001630	splice_region_variant	64285	exon10			AAGGGCCTGCGGG	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1209-1G>A	chr16.hg19:g.111695C>T		45.0	0.0		45.0	21.0	NM_022450	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Splice_Site	SNP	ENST00000262316.6	hg19	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	c	15.27	2.784646	0.49997	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5704	0.84611	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RHBDF1	51695	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.312000	0.78968	2.448000	0.82819	0.462000	0.41574	.	.	.		0.677	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	NM_022450	Intron
ASPHD1	253982	hgsc.bcm.edu	37	16	29912566	29912566	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:29912566C>T	ENST00000308748.5	+	1	526	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F	SEZ6L2_ENST00000346932.5_5'Flank|ASPHD1_ENST00000483405.1_Intron|SEZ6L2_ENST00000350527.3_5'Flank|SEZ6L2_ENST00000537485.1_5'Flank|SEZ6L2_ENST00000308713.5_5'Flank	NM_181718.3	NP_859069.2	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	92					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)	dioxygenase activity (GO:0051213)			endometrium(4)|large_intestine(2)|lung(1)|prostate(1)	8						TTCCCTGTTCCTCTGGTACTG	0.677																																					p.L92F		Atlas-SNP	.											.	ASPHD1	28	.	0			c.C274T						.						54.0	59.0	57.0					16																	29912566		2196	4299	6495	SO:0001583	missense	253982	exon1			CTGTTCCTCTGGT	AF070642	CCDS10660.1	16p11.2	2008-02-05			ENSG00000174939	ENSG00000174939			27380	protein-coding gene	gene with protein product							Standard	NM_181718		Approved		uc002dut.3	Q5U4P2	OTTHUMG00000132121	ENST00000308748.5:c.274C>T	chr16.hg19:g.29912566C>T	ENSP00000311447:p.Leu92Phe	92.0	0.0		110.0	22.0	NM_181718	A0AVE3|B7ZLZ3|Q8IW63|Q8N316|Q96H00	Missense_Mutation	SNP	ENST00000308748.5	hg19	CCDS10660.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102295	0.76983	.	.	ENSG00000174939	ENST00000414952;ENST00000308748	T;T	0.56611	0.45;0.45	4.28	3.33	0.38152	.	0.000000	0.56097	D	0.000026	T	0.43255	0.1239	L	0.44542	1.39	0.44908	D	0.997928	B	0.17038	0.02	B	0.17433	0.018	T	0.42999	-0.9418	10	0.72032	D	0.01	-15.8544	9.5322	0.39200	0.0:0.8982:0.0:0.1018	.	92	Q5U4P2	ASPH1_HUMAN	F	92	ENSP00000388036:L92F;ENSP00000311447:L92F	ENSP00000311447:L92F	L	+	1	0	ASPHD1	29820067	0.998000	0.40836	1.000000	0.80357	0.929000	0.56500	1.601000	0.36773	1.151000	0.42436	0.462000	0.41574	CTC	.	.		0.677	ASPHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255163.2	NM_181718	
GPR114	221188	hgsc.bcm.edu	37	16	57596061	57596061	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:57596061C>T	ENST00000340339.4	+	2	579	c.56C>T	c.(55-57)gCa>gTa	p.A19V	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.A19V	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	19					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						TTGCAGAATGCAACAACAGGT	0.562																																					p.A19V		Atlas-SNP	.											.	GPR114	52	.	0			c.C56T						.						68.0	64.0	65.0					16																	57596061		2198	4300	6498	SO:0001583	missense	221188	exon2			AGAATGCAACAAC	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.56C>T	chr16.hg19:g.57596061C>T	ENSP00000342981:p.Ala19Val	68.0	0.0		47.0	23.0	NM_153837	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	hg19	CCDS10785.1	.	.	.	.	.	.	.	.	.	.	C	8.768	0.925292	0.18056	.	.	ENSG00000159618	ENST00000394361;ENST00000340339;ENST00000349457	T;T	0.28069	1.63;1.63	4.15	-3.43	0.04810	.	2.191750	0.02573	N	0.098001	T	0.13670	0.0331	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.08269	-1.0730	10	0.21014	T	0.42	.	0.4945	0.00569	0.205:0.2823:0.2186:0.2941	.	19;19	B4E148;Q8IZF4	.;GP114_HUMAN	V	19	ENSP00000342981:A19V;ENSP00000290823:A19V	ENSP00000342981:A19V	A	+	2	0	GPR114	56153562	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.017000	0.12590	-0.615000	0.05679	-0.367000	0.07326	GCA	.	.		0.562	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837	
ACLY	47	hgsc.bcm.edu	37	17	40024989	40024989	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:40024989C>T	ENST00000352035.2	-	28	3314	c.3184G>A	c.(3184-3186)Gtg>Atg	p.V1062M	ACLY_ENST00000590151.1_Missense_Mutation_p.V1062M|ACLY_ENST00000537919.1_Missense_Mutation_p.V791M|ACLY_ENST00000353196.1_Missense_Mutation_p.V1052M|ACLY_ENST00000588779.1_5'UTR|ACLY_ENST00000393896.2_Missense_Mutation_p.V1052M	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1062					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CTTCCCAGCACAAAGATGCCA	0.448																																					p.V1062M	Colon(64;807 1396 15971 30971)	Atlas-SNP	.											.	ACLY	85	.	0			c.G3184A						.						171.0	148.0	156.0					17																	40024989		2203	4300	6503	SO:0001583	missense	47	exon28			CCAGCACAAAGAT	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.3184G>A	chr17.hg19:g.40024989C>T	ENSP00000253792:p.Val1062Met	76.0	0.0		48.0	19.0	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	hg19	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	c	32	5.173660	0.94807	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.90620	-1.74;-1.74;-2.7;-1.74	5.53	5.53	0.82687	Citrate synthase-like, core (1);	0.059404	0.64402	D	0.000002	D	0.95701	0.8602	M	0.83384	2.64	0.80722	D	1	P;D;D;D;D	0.69078	0.942;0.991;0.991;0.997;0.968	P;P;P;D;P	0.71184	0.776;0.906;0.906;0.972;0.837	D	0.95660	0.8714	10	0.87932	D	0	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	791;1106;1116;1052;1062	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	M	1062;1116;1052;791;1052	ENSP00000253792:V1062M;ENSP00000345398:V1052M;ENSP00000445349:V791M;ENSP00000377474:V1052M	ENSP00000253792:V1062M	V	-	1	0	ACLY	37278515	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.182000	0.77689	2.882000	0.98803	0.655000	0.94253	GTG	.	.		0.448	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
GNGT2	2793	hgsc.bcm.edu	37	17	47284179	47284179	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:47284179G>A	ENST00000511277.1	-	4	329	c.150C>T	c.(148-150)ctC>ctT	p.L50L	GNGT2_ENST00000515635.1_Silent_p.L50L|GNGT2_ENST00000300406.2_Silent_p.L50L|GNGT2_ENST00000503070.1_Silent_p.L50L|GNGT2_ENST00000511673.1_Silent_p.L50L|GNGT2_ENST00000507680.1_Silent_p.L50L	NM_001198756.1	NP_001185685.1	O14610	GBGT2_HUMAN	guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2	50					G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|phototransduction (GO:0007602)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)	p.L50L(1)		endometrium(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GGATGCCTTTGAGAAAAGGAT	0.493																																					p.L50L		Atlas-SNP	.											GNGT2,bladder,carcinoma,0,1	GNGT2	12	.	1	Substitution - coding silent(1)	urinary_tract(1)	c.C150T						.						172.0	149.0	157.0					17																	47284179		2203	4300	6503	SO:0001819	synonymous_variant	2793	exon4			GCCTTTGAGAAAA		CCDS11545.1	17q21	2003-12-17				ENSG00000167083			4412	protein-coding gene	gene with protein product		139391				9286705	Standard	NM_031498		Approved	GNG9	uc021tzq.1	O14610		ENST00000511277.1:c.150C>T	chr17.hg19:g.47284179G>A		247.0	0.0		160.0	64.0	NM_031498	B2R746|D3DTW5	Silent	SNP	ENST00000511277.1	hg19	CCDS11545.1																																																																																			.	.		0.493	GNGT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364482.1	NM_031498	
CUEDC1	404093	hgsc.bcm.edu	37	17	55945598	55945598	+	Missense_Mutation	SNP	C	C	G	rs34800498	byFrequency	TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:55945598C>G	ENST00000577830.1	-	8	1360	c.947G>C	c.(946-948)cGg>cCg	p.R316P	CUEDC1_ENST00000360238.2_Missense_Mutation_p.R316P|CUEDC1_ENST00000407144.2_Missense_Mutation_p.R316P|CUEDC1_ENST00000577840.1_Missense_Mutation_p.R179P|CUEDC1_ENST00000578357.1_5'UTR	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	316			R -> Q (in dbSNP:rs34800498).							endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						CAGTTTCCTCCGGGTGGCTGG	0.547																																					p.R316P		Atlas-SNP	.											.	CUEDC1	37	.	0			c.G947C						.						103.0	86.0	91.0					17																	55945598		2203	4300	6503	SO:0001583	missense	404093	exon8			TTCCTCCGGGTGG	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.947G>C	chr17.hg19:g.55945598C>G	ENSP00000462717:p.Arg316Pro	102.0	0.0		76.0	43.0	NM_001271875	D3DTZ2|Q9NWD0	Missense_Mutation	SNP	ENST00000577830.1	hg19	CCDS11599.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963464	0.74016	.	.	ENSG00000180891	ENST00000407144;ENST00000360238	T;T	0.37411	1.2;1.2	4.5	3.52	0.40303	.	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.61703	1.905	0.58432	D	0.999999	D	0.58970	0.984	P	0.59546	0.859	T	0.54050	-0.8351	10	0.87932	D	0	-6.8965	12.0482	0.53491	0.0:0.9155:0.0:0.0845	.	316	Q9NWM3	CUED1_HUMAN	P	316	ENSP00000384712:R316P;ENSP00000353373:R316P	ENSP00000353373:R316P	R	-	2	0	CUEDC1	53300597	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.413000	0.59795	0.875000	0.35847	0.462000	0.41574	CGG	.	C|0.958;T|0.042		0.547	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1	NM_017949	
OR4D2	124538	hgsc.bcm.edu	37	17	56247344	56247344	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:56247344G>T	ENST00000545221.1	+	1	328	c.328G>T	c.(328-330)Gcc>Tcc	p.A110S		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						TTTGGGAGGTGCCATGGTCTT	0.542																																					p.A110S		Atlas-SNP	.											.	OR4D2	48	.	0			c.G328T						.						92.0	85.0	88.0					17																	56247344		2203	4300	6503	SO:0001583	missense	124538	exon1			GGAGGTGCCATGG		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.328G>T	chr17.hg19:g.56247344G>T	ENSP00000441354:p.Ala110Ser	103.0	0.0		56.0	15.0	NM_001004707	Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	hg19	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	G	4.915	0.169998	0.09339	.	.	ENSG00000255713	ENST00000545221	T	0.00882	5.58	5.71	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.242082	0.28612	N	0.014734	T	0.00784	0.0026	N	0.14661	0.345	0.09310	N	1	B	0.20368	0.044	B	0.20767	0.031	T	0.49634	-0.8919	10	0.40728	T	0.16	-23.9432	7.8601	0.29506	0.0806:0.0:0.7571:0.1622	.	110	P58180	OR4D2_HUMAN	S	110	ENSP00000441354:A110S	ENSP00000441354:A110S	A	+	1	0	OR4D2	53602343	0.000000	0.05858	0.988000	0.46212	0.208000	0.24298	-0.009000	0.12765	1.552000	0.49463	0.609000	0.83330	GCC	.	.		0.542	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1		
ANKRD12	23253	hgsc.bcm.edu	37	18	9255525	9255525	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr18:9255525A>T	ENST00000262126.4	+	9	2500	c.2260A>T	c.(2260-2262)Att>Ttt	p.I754F	ANKRD12_ENST00000400020.3_Missense_Mutation_p.I731F|ANKRD12_ENST00000383440.2_Missense_Mutation_p.I731F	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	754						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ACGAGACAAGATTAAAAAGGA	0.308																																					p.I754F		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A2260T						.						49.0	51.0	50.0					18																	9255525		2200	4291	6491	SO:0001583	missense	23253	exon9			GACAAGATTAAAA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2260A>T	chr18.hg19:g.9255525A>T	ENSP00000262126:p.Ile754Phe	64.0	0.0		24.0	11.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	0.090	-1.169146	0.01660	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000400020	T;T	0.44083	0.93;0.93	5.1	-1.93	0.07594	.	0.624489	0.15199	N	0.275134	T	0.18841	0.0452	N	0.08118	0	0.20821	N	0.999844	B;B;B	0.24882	0.113;0.091;0.028	B;B;B	0.28232	0.034;0.087;0.015	T	0.14783	-1.0460	10	0.56958	D	0.05	-30.356	4.1483	0.10225	0.5513:0.0:0.2181:0.2306	.	381;731;754	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	F	731;754;49	ENSP00000372932:I731F;ENSP00000262126:I754F	ENSP00000262126:I754F	I	+	1	0	ANKRD12	9245525	0.020000	0.18652	0.829000	0.32907	0.680000	0.39746	0.404000	0.20999	-0.230000	0.09840	-0.756000	0.03474	ATT	.	.		0.308	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ZBTB7C	201501	hgsc.bcm.edu	37	18	45555810	45555810	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr18:45555810G>A	ENST00000588982.1	-	4	2182	c.1681C>T	c.(1681-1683)Cgc>Tgc	p.R561C	ZBTB7C_ENST00000535628.2_Missense_Mutation_p.R561C|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.R561C|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.R561C|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.R561C			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	561							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						AGCTGCGCGCGCCCGAACAGC	0.721																																					p.R561C		Atlas-SNP	.											.	ZBTB7C	73	.	0			c.C1681T						.						10.0	11.0	11.0					18																	45555810		2188	4265	6453	SO:0001583	missense	201501	exon3			GCGCGCGCCCGAA	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.1681C>T	chr18.hg19:g.45555810G>A	ENSP00000468782:p.Arg561Cys	33.0	0.0		26.0	10.0	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	hg19	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761613	0.49468	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.11604	2.76;2.76	4.51	2.45	0.29901	.	0.659005	0.12970	N	0.424205	T	0.06690	0.0171	N	0.14661	0.345	0.43852	D	0.996445	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18209	-1.0344	10	0.87932	D	0	.	7.5778	0.27946	0.0966:0.0:0.6156:0.2878	.	561;561	B2RG49;A1YPR0	.;ZBT7C_HUMAN	C	561	ENSP00000439781:R561C;ENSP00000328732:R561C	ENSP00000328732:R561C	R	-	1	0	ZBTB7C	43809808	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	3.350000	0.52224	0.886000	0.36113	0.555000	0.69702	CGC	.	.		0.721	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
EMR1	2015	hgsc.bcm.edu	37	19	6919616	6919616	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:6919616G>A	ENST00000312053.4	+	13	1515	c.1478G>A	c.(1477-1479)cGc>cAc	p.R493H	EMR1_ENST00000381407.5_Missense_Mutation_p.R352H|EMR1_ENST00000450315.3_Missense_Mutation_p.R316H|EMR1_ENST00000250572.8_Missense_Mutation_p.R493H|EMR1_ENST00000381404.4_Missense_Mutation_p.R441H	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	493	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					TTAAATGAGCGCTTCTTCAAA	0.473																																					p.R493H		Atlas-SNP	.											EMR1,right_upper_lobe,carcinoma,+1,1	EMR1	153	.	0			c.G1478A						.						140.0	128.0	132.0					19																	6919616		2203	4300	6503	SO:0001583	missense	2015	exon13			ATGAGCGCTTCTT	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1478G>A	chr19.hg19:g.6919616G>A	ENSP00000311545:p.Arg493His	188.0	0.0		133.0	60.0	NM_001256253	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	hg19	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	7.865	0.726947	0.15439	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.78707	-1.14;-1.17;-1.2;0.01;0.33	3.99	0.387	0.16259	.	.	.	.	.	T	0.68943	0.3056	L	0.59436	1.845	0.09310	N	1	B;B;B;B;B	0.16603	0.018;0.006;0.007;0.004;0.002	B;B;B;B;B	0.10450	0.004;0.003;0.005;0.001;0.002	T	0.60414	-0.7268	9	0.56958	D	0.05	.	3.8521	0.08959	0.2285:0.202:0.5695:0.0	.	316;352;493;441;493	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	H	493;493;441;493;352;316	ENSP00000311545:R493H;ENSP00000370811:R441H;ENSP00000250572:R493H;ENSP00000370814:R352H;ENSP00000405974:R316H	ENSP00000250572:R493H	R	+	2	0	EMR1	6870616	0.075000	0.21258	0.060000	0.19600	0.001000	0.01503	0.811000	0.27198	0.471000	0.27319	-1.141000	0.01876	CGC	.	.		0.473	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
SLC44A2	57153	hgsc.bcm.edu	37	19	10753056	10753056	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:10753056G>A	ENST00000335757.5	+	21	2319	c.1943G>A	c.(1942-1944)gGc>gAc	p.G648D	SLC44A2_ENST00000407327.4_Missense_Mutation_p.G646D|SLC44A2_ENST00000588214.1_3'UTR|SLC44A2_ENST00000586078.1_Missense_Mutation_p.G648D			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	648					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	GTGATCGTTGGCTCCTACTTG	0.577																																					p.G648D		Atlas-SNP	.											.	SLC44A2	56	.	0			c.G1943A						.						317.0	201.0	240.0					19																	10753056		2203	4300	6503	SO:0001583	missense	57153	exon21			TCGTTGGCTCCTA	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1943G>A	chr19.hg19:g.10753056G>A	ENSP00000336888:p.Gly648Asp	310.0	0.0		205.0	82.0	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	hg19	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382023	0.82792	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.24350	1.86;1.86	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	M	0.93375	3.41	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.995	D;D;D	0.78314	0.991;0.953;0.985	T	0.72478	-0.4281	10	0.62326	D	0.03	-3.4702	18.5195	0.90947	0.0:0.0:1.0:0.0	.	648;648;646	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	D	646;648;648	ENSP00000385135:G646D;ENSP00000336888:G648D	ENSP00000336888:G648D	G	+	2	0	SLC44A2	10614056	1.000000	0.71417	0.995000	0.50966	0.480000	0.33159	9.300000	0.96151	2.668000	0.90789	0.655000	0.94253	GGC	.	.		0.577	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
IL12RB1	3594	hgsc.bcm.edu	37	19	18188364	18188364	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:18188364G>A	ENST00000600835.2	-	6	809	c.511C>T	c.(511-513)Cag>Tag	p.Q171*	IL12RB1_ENST00000322153.7_Nonsense_Mutation_p.Q171*|IL12RB1_ENST00000593993.2_Nonsense_Mutation_p.Q171*			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	171	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						TGCCGGAACTGCACCTCAGCA	0.592																																					p.Q171X		Atlas-SNP	.											.	IL12RB1	92	.	0			c.C511T						.						72.0	56.0	61.0					19																	18188364		2203	4300	6503	SO:0001587	stop_gained	3594	exon5			GGAACTGCACCTC	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.511C>T	chr19.hg19:g.18188364G>A	ENSP00000470788:p.Gln171*	71.0	0.0		58.0	22.0	NM_153701	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Nonsense_Mutation	SNP	ENST00000600835.2	hg19	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364002	0.61513	.	.	ENSG00000096996	ENST00000430026;ENST00000322153	.	.	.	3.76	2.55	0.30701	.	0.147877	0.30329	N	0.009879	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-23.4185	8.2813	0.31902	0.0:0.3301:0.6699:0.0	.	.	.	.	X	171	.	ENSP00000314425:Q171X	Q	-	1	0	IL12RB1	18049364	0.946000	0.32159	0.454000	0.27019	0.006000	0.05464	2.529000	0.45632	1.844000	0.53588	0.484000	0.47621	CAG	.	.		0.592	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
ZNF729	100287226	hgsc.bcm.edu	37	19	22499181	22499181	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:22499181G>T	ENST00000601693.1	+	4	3080	c.2962G>T	c.(2962-2964)Ggg>Tgg	p.G988W	ZNF729_ENST00000357491.6_Missense_Mutation_p.G960W			A6NN14	ZN729_HUMAN	zinc finger protein 729	988					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						AATTCATACTGGGGAGAAACC	0.353																																					p.G988W		Atlas-SNP	.											.	ZNF729	78	.	0			c.G2962T						.																																			SO:0001583	missense	100287226	exon4			CATACTGGGGAGA		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.2962G>T	chr19.hg19:g.22499181G>T	ENSP00000469582:p.Gly988Trp	221.0	0.0		115.0	42.0	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	12.02	1.811302	0.32053	.	.	ENSG00000196350	ENST00000357491	T	0.01665	4.7	0.898	0.898	0.19264	.	.	.	.	.	T	0.09992	0.0245	M	0.93550	3.43	.	.	.	.	.	.	.	.	.	T	0.03981	-1.0987	6	0.87932	D	0	.	8.542	0.33399	0.0:0.0:1.0:0.0	.	.	.	.	W	960	ENSP00000350085:G960W	ENSP00000350085:G960W	G	+	1	0	ZNF729	22291021	0.996000	0.38824	0.062000	0.19696	0.061000	0.15899	2.762000	0.47597	0.284000	0.22305	0.289000	0.19496	GGG	.	.		0.353	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
HAUS5	23354	hgsc.bcm.edu	37	19	36106172	36106172	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:36106172G>A	ENST00000203166.5	+	6	394	c.369G>A	c.(367-369)caG>caA	p.Q123Q	AC002115.9_ENST00000589603.1_lincRNA|HAUS5_ENST00000379045.2_Silent_p.Q123Q	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	123					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						AAGACACCCAGCGTCGAGCTC	0.642																																					p.Q123Q		Atlas-SNP	.											.	HAUS5	41	.	0			c.G369A						.						29.0	34.0	32.0					19																	36106172		2140	4258	6398	SO:0001819	synonymous_variant	23354	exon6			CACCCAGCGTCGA	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.369G>A	chr19.hg19:g.36106172G>A		61.0	0.0		42.0	22.0	NM_015302	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	ENST00000203166.5	hg19	CCDS42550.1																																																																																			.	.		0.642	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459055.2		
PTPRT	11122	hgsc.bcm.edu	37	20	40714481	40714481	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr20:40714481A>G	ENST00000373187.1	-	28	3858	c.3859T>C	c.(3859-3861)Tac>Cac	p.Y1287H	PTPRT_ENST00000356100.2_Missense_Mutation_p.Y1296H|PTPRT_ENST00000373193.3_Missense_Mutation_p.Y1290H|PTPRT_ENST00000373184.1_Missense_Mutation_p.Y1297H|PTPRT_ENST00000373201.1_Missense_Mutation_p.Y1277H|PTPRT_ENST00000373190.1_Missense_Mutation_p.Y1286H|PTPRT_ENST00000373198.4_Missense_Mutation_p.Y1306H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1287	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCAGGCCAGTACTGCATACAG	0.498																																					p.Y1306H		Atlas-SNP	.											.	PTPRT	372	.	0			c.T3916C						.						66.0	67.0	67.0					20																	40714481		1933	4138	6071	SO:0001583	missense	11122	exon29			GCCAGTACTGCAT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3859T>C	chr20.hg19:g.40714481A>G	ENSP00000362283:p.Tyr1287His	82.0	0.0		102.0	30.0	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.834450	0.91036	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	5.31	5.31	0.75309	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.136624	0.51477	D	0.000097	D	0.98317	0.9442	H	0.99379	4.54	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.983;0.99	D	0.99694	1.1002	10	0.87932	D	0	.	15.4285	0.75072	1.0:0.0:0.0:0.0	.	1309;1287	O14522-1;O14522	.;PTPRT_HUMAN	H	1286;1287;1290;1296;1309;1297;1277	ENSP00000362286:Y1286H;ENSP00000362283:Y1287H;ENSP00000362289:Y1290H;ENSP00000348408:Y1296H;ENSP00000362294:Y1309H;ENSP00000362280:Y1297H;ENSP00000362297:Y1277H	ENSP00000348408:Y1296H	Y	-	1	0	PTPRT	40147895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.040000	0.93783	2.232000	0.73038	0.533000	0.62120	TAC	.	.		0.498	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
TTPAL	79183	hgsc.bcm.edu	37	20	43108685	43108685	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr20:43108685T>G	ENST00000372904.3	+	3	189	c.46T>G	c.(46-48)Tca>Gca	p.S16A	TTPAL_ENST00000262605.4_Missense_Mutation_p.S16A|TTPAL_ENST00000372906.2_Missense_Mutation_p.S16A	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	16						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						TTCTGTGGCCTCACTCTCTGA	0.537																																					p.S16A		Atlas-SNP	.											.	TTPAL	31	.	0			c.T46G						.						67.0	66.0	66.0					20																	43108685		2203	4300	6503	SO:0001583	missense	79183	exon2			GTGGCCTCACTCT	BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.46T>G	chr20.hg19:g.43108685T>G	ENSP00000361995:p.Ser16Ala	59.0	0.0		60.0	35.0	NM_001039199	E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Missense_Mutation	SNP	ENST00000372904.3	hg19	CCDS13332.2	.	.	.	.	.	.	.	.	.	.	T	13.33	2.205585	0.39003	.	.	ENSG00000124120	ENST00000262605;ENST00000372904;ENST00000372906;ENST00000456317	T;T;D;D	0.94184	-1.21;-1.21;-3.37;-2.19	5.18	5.18	0.71444	.	0.350651	0.30168	N	0.010255	D	0.85124	0.5625	N	0.14661	0.345	0.28410	N	0.918245	B	0.29378	0.243	B	0.27380	0.079	T	0.76740	-0.2848	10	0.25106	T	0.35	-14.1751	10.4353	0.44433	0.1453:0.0:0.0:0.8547	.	16	Q9BTX7	TTPAL_HUMAN	A	16	ENSP00000262605:S16A;ENSP00000361995:S16A;ENSP00000361997:S16A;ENSP00000412720:S16A	ENSP00000262605:S16A	S	+	1	0	TTPAL	42542099	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.034000	0.49751	2.164000	0.68074	0.533000	0.62120	TCA	.	.		0.537	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106886.2	NM_024331	
TTC3	7267	hgsc.bcm.edu	37	21	38572587	38572587	+	Missense_Mutation	SNP	G	G	A	rs200071342		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr21:38572587G>A	ENST00000399017.2	+	45	8652	c.5905G>A	c.(5905-5907)Gtg>Atg	p.V1969M	TTC3_ENST00000355666.1_Missense_Mutation_p.V1969M|TTC3_ENST00000354749.2_Missense_Mutation_p.V1969M|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1969					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				ATCAAAAAACGTGCGTGTGCT	0.413																																					p.V1969M	Ovarian(38;194 1649 35661)	Atlas-SNP	.											.	TTC3	182	.	0			c.G5905A						.						90.0	78.0	82.0					21																	38572587		2203	4300	6503	SO:0001583	missense	7267	exon45			AAAAACGTGCGTG	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5905G>A	chr21.hg19:g.38572587G>A	ENSP00000381981:p.Val1969Met	210.0	0.0		138.0	57.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	hg19	CCDS13651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.29|13.29	2.192723|2.192723	0.38707|0.38707	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000428693|ENST00000355666;ENST00000399017;ENST00000354749	.|T;T;T	.|0.71817	.|-0.6;-0.6;-0.6	5.58|5.58	-2.2|-2.2	0.06994|0.06994	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.|1.130140	.|0.06565	.|N	.|0.747410	T|T	0.55940|0.55940	0.1952|0.1952	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	.|P	.|0.39404	.|0.672	.|B	.|0.30943	.|0.122	T|T	0.42447|0.42447	-0.9451|-0.9451	5|10	.|0.19147	.|T	.|0.46	-1.4936|-1.4936	4.8143|4.8143	0.13358|0.13358	0.4155:0.2861:0.2984:0.0|0.4155:0.2861:0.2984:0.0	.|.	.|1969	.|P53804	.|TTC3_HUMAN	H|M	260|1969	.|ENSP00000347889:V1969M;ENSP00000381981:V1969M;ENSP00000346791:V1969M	.|ENSP00000346791:V1969M	R|V	+|+	2|1	0|0	TTC3|TTC3	37494457|37494457	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.975000|0.975000	0.68041|0.68041	-0.537000|-0.537000	0.06128|0.06128	-0.233000|-0.233000	0.09797|0.09797	0.655000|0.655000	0.94253|0.94253	CGT|GTG	.	G|0.999;A|0.001		0.413	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
RRP1B	23076	hgsc.bcm.edu	37	21	45089836	45089836	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr21:45089836C>A	ENST00000340648.4	+	2	319	c.202C>A	c.(202-204)Ccc>Acc	p.P68T		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	68					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		GCAGGATGAACCCCTTCTACA	0.483																																					p.P68T		Atlas-SNP	.											.	RRP1B	51	.	0			c.C202A						.						112.0	108.0	109.0					21																	45089836		2203	4300	6503	SO:0001583	missense	23076	exon2			GATGAACCCCTTC	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.202C>A	chr21.hg19:g.45089836C>A	ENSP00000339145:p.Pro68Thr	310.0	0.0		192.0	103.0	NM_015056	Q8TBZ4	Missense_Mutation	SNP	ENST00000340648.4	hg19	CCDS33577.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.371033	0.61624	.	.	ENSG00000160208	ENST00000340648	T	0.52295	0.67	5.84	4.01	0.46588	.	0.048335	0.85682	D	0.000000	T	0.66287	0.2774	M	0.92507	3.315	0.58432	D	0.999997	P	0.47604	0.898	P	0.51974	0.686	T	0.74034	-0.3794	10	0.87932	D	0	-0.1797	10.3306	0.43820	0.0:0.7944:0.1334:0.0723	.	68	Q14684	RRP1B_HUMAN	T	68	ENSP00000339145:P68T	ENSP00000339145:P68T	P	+	1	0	RRP1B	43914264	1.000000	0.71417	0.972000	0.41901	0.813000	0.45954	2.301000	0.43628	1.473000	0.48159	-0.150000	0.13652	CCC	.	.		0.483	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
VCL	7414	hgsc.bcm.edu	37	10	75830792	75830792	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:75830792delG	ENST00000211998.4	+	4	544	c.450delG	c.(448-450)gtgfs	p.V151fs	VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_Intron|VCL_ENST00000372755.3_Frame_Shift_Del_p.V151fs	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	151	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					TGGCAGAGGTGGTGGAGACTA	0.358																																					p.V150fs		Atlas-Indel,Pindel	.											.	VCL	77	.	0			c.449delT						.						114.0	118.0	116.0					10																	75830792		2203	4300	6503	SO:0001589	frameshift_variant	7414	exon4			.	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.450delG	chr10.hg19:g.75830792delG	ENSP00000211998:p.Val151fs	201.0	0.0		105.0	61.0	NM_003373	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Frame_Shift_Del	DEL	ENST00000211998.4	hg19	CCDS7341.1																																																																																			.	.		0.358	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
OTX1	5013	hgsc.bcm.edu	37	2	63282697	63282698	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:63282697_63282698delAG	ENST00000282549.2	+	5	587_588	c.311_312delAG	c.(310-312)aagfs	p.K104fs	OTX1_ENST00000366671.3_Frame_Shift_Del_p.K104fs	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	104					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					AGCGGAACCAAGAGCCGCCCAG	0.649																																					p.104_104del		Atlas-Indel,Pindel	.											.	OTX1	49	.	0			c.310_311del						.																																			SO:0001589	frameshift_variant	5013	exon5			.		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.311_312delAG	chr2.hg19:g.63282699_63282700delAG	ENSP00000282549:p.Lys104fs	173.0	0.0		91.0	22.0	NM_014562	A6NHA2|B3KTJ4|Q53TG6	Frame_Shift_Del	DEL	ENST00000282549.2	hg19	CCDS1873.1																																																																																			.	.		0.649	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
CISH	1154	hgsc.bcm.edu	37	3	50645109	50645109	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:50645109delC	ENST00000348721.3	-	3	886	c.706delG	c.(706-708)gccfs	p.A236fs	CISH_ENST00000443053.2_Frame_Shift_Del_p.A253fs	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	236	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TCCACGTCGGCCACCAGACGG	0.627																																					p.A253fs		Atlas-Indel,Pindel	.											.	CISH	27	.	0			c.758delC						.						72.0	73.0	73.0					3																	50645109		2203	4300	6503	SO:0001589	frameshift_variant	1154	exon4			.	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.706delG	chr3.hg19:g.50645109delC	ENSP00000294173:p.Ala236fs	138.0	0.0		76.0	46.0	NM_013324	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Frame_Shift_Del	DEL	ENST00000348721.3	hg19	CCDS2831.1																																																																																			.	.		0.627	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
CAMKV	79012	hgsc.bcm.edu	37	3	49897070	49897070	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:49897070delG	ENST00000477224.1	-	11	1665	c.1187delC	c.(1186-1188)ccafs	p.P396fs	CAMKV_ENST00000488336.1_Frame_Shift_Del_p.P365fs|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000296471.7_Frame_Shift_Del_p.P368fs|CAMKV_ENST00000467248.1_Frame_Shift_Del_p.P321fs|CAMKV_ENST00000463537.1_Frame_Shift_Del_p.Q328fs|CAMKV_ENST00000466940.1_Frame_Shift_Del_p.P322fs			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	396	Ala-rich.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ATCAGTGGCTGGGGTGGCACT	0.622																																					p.P396fs		Atlas-INDEL	.											.	CAMKV	84	.	0			c.1188delA						.						103.0	106.0	105.0					3																	49897070		2203	4299	6502	SO:0001589	frameshift_variant	79012	exon11			.	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.1187delC	chr3.hg19:g.49897070delG	ENSP00000419195:p.Pro396fs	199.0	0.0		185.0	19.0	NM_024046	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Frame_Shift_Del	DEL	ENST00000477224.1	hg19	CCDS33762.1																																																																																			.	.		0.622	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
