#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WRAP73	49856	hgsc.bcm.edu	37	1	3548777	3548777	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:3548777C>T	ENST00000270708.7	-	10	1121	c.1048G>A	c.(1048-1050)Gac>Aac	p.D350N	WRAP73_ENST00000378322.3_Splice_Site_p.D350N	NM_017818.3	NP_060288.3	Q9P2S5	WRP73_HUMAN	WD repeat containing, antisense to TP73	350						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)	12						CACAACTGACCGTTCCTTGTC	0.512																																					p.D350N		Atlas-SNP	.											.	WRAP73	43	.	0			c.G1048A						.						237.0	218.0	224.0					1																	3548777		2203	4300	6503	SO:0001630	splice_region_variant	49856	exon10			ACTGACCGTTCCT	AB034912, EF494669	CCDS48.1	1p36.3	2013-05-21	2011-04-13	2011-04-13	ENSG00000116213	ENSG00000116213		"""WD repeat domain containing"""	12759	protein-coding gene	gene with protein product		606040	"""WD repeat domain 8"""	WDR8			Standard	NM_017818		Approved		uc001ako.3	Q9P2S5	OTTHUMG00000000612	ENST00000270708.7:c.1048+1G>A	chr1.hg19:g.3548777C>T		86.0	0.0		110.0	18.0	NM_017818	Q5T0D6|Q9BUH7|Q9NTK7|Q9NX56	Missense_Mutation	SNP	ENST00000270708.7	hg19	CCDS48.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760264	0.69763	.	.	ENSG00000116213	ENST00000270708;ENST00000378322	T;T	0.39592	2.91;1.07	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.48554	0.1506	M	0.83012	2.62	0.80722	D	1	D	0.58970	0.984	B	0.40825	0.341	T	0.59736	-0.7398	10	0.40728	T	0.16	-48.1724	17.1488	0.86773	0.0:1.0:0.0:0.0	.	350	Q9P2S5	WRP73_HUMAN	N	350	ENSP00000270708:D350N;ENSP00000367573:D350N	ENSP00000270708:D350N	D	-	1	0	WRAP73	3538637	1.000000	0.71417	0.450000	0.26969	0.093000	0.18481	6.835000	0.75344	2.291000	0.77112	0.655000	0.94253	GAC	.	.		0.512	WRAP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001470.1		Missense_Mutation
ARHGAP29	9411	hgsc.bcm.edu	37	1	94652058	94652058	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:94652058T>G	ENST00000260526.6	-	16	1959	c.1777A>C	c.(1777-1779)Act>Cct	p.T593P	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	593					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		ACAATACCAGTTTCTGAAGGG	0.378																																					p.T593P		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.A1777C						.						170.0	166.0	167.0					1																	94652058		2203	4300	6503	SO:0001583	missense	9411	exon16			TACCAGTTTCTGA		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1777A>C	chr1.hg19:g.94652058T>G	ENSP00000260526:p.Thr593Pro	146.0	0.0		108.0	16.0	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	hg19	CCDS748.1	.	.	.	.	.	.	.	.	.	.	T	11.94	1.787748	0.31593	.	.	ENSG00000137962	ENST00000260526	T	0.22539	1.95	5.98	1.37	0.22104	.	0.732715	0.11319	N	0.576290	T	0.04003	0.0112	L	0.29908	0.895	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.41466	-0.9507	10	0.22706	T	0.39	.	0.7096	0.00922	0.3486:0.297:0.1218:0.2326	.	593;593	F8VWZ8;Q52LW3	.;RHG29_HUMAN	P	593	ENSP00000260526:T593P	ENSP00000260526:T593P	T	-	1	0	ARHGAP29	94424646	0.994000	0.37717	1.000000	0.80357	0.978000	0.69477	1.380000	0.34351	0.837000	0.34925	-0.177000	0.13119	ACT	.	.		0.378	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
DBT	1629	hgsc.bcm.edu	37	1	100672083	100672083	+	Missense_Mutation	SNP	C	C	T	rs150934375		TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:100672083C>T	ENST00000370132.4	-	9	1140	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H		NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	376					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		TTTCTGGAGGCGGTTCAGTTC	0.423																																					p.R376H		Atlas-SNP	.											.	DBT	39	.	0			c.G1127A						.	C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	194.0	200.0	198.0		1127	5.8	1.0	1	dbSNP_134	198	0,8600		0,0,4300	no	missense	DBT	NM_001918.2	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	376/483	100672083	2,13004	2203	4300	6503	SO:0001583	missense	1629	exon9			TGGAGGCGGTTCA	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.1127G>A	chr1.hg19:g.100672083C>T	ENSP00000359151:p.Arg376His	87.0	0.0		84.0	24.0	NM_001918	B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	hg19	CCDS767.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.942921	0.92526	4.54E-4	0.0	ENSG00000137992	ENST00000543138;ENST00000370132	T	0.46819	0.86	5.84	5.84	0.93424	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73737	0.3625	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.981;0.993	T	0.78945	-0.2004	10	0.87932	D	0	-4.8811	20.1386	0.98045	0.0:1.0:0.0:0.0	.	195;376	F5H1F9;P11182	.;ODB2_HUMAN	H	195;376	ENSP00000359151:R376H	ENSP00000359151:R376H	R	-	2	0	DBT	100444671	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	7.389000	0.79806	2.767000	0.95098	0.561000	0.74099	CGC	.	C|1.000;T|0.000		0.423	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030101.2	NM_001918	
ADAMTSL4	54507	hgsc.bcm.edu	37	1	150531572	150531572	+	Silent	SNP	T	T	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:150531572T>C	ENST00000369038.2	+	14	2895	c.2694T>C	c.(2692-2694)ccT>ccC	p.P898P	ADAMTSL4_ENST00000369039.5_Silent_p.P921P|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Silent_p.P898P			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	898	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GCCGGCCCCCTGACATGCGCG	0.677																																					p.P898P		Atlas-SNP	.											.	ADAMTSL4	101	.	0			c.T2694C						.						15.0	19.0	18.0					1																	150531572		2196	4294	6490	SO:0001819	synonymous_variant	54507	exon16			GCCCCCTGACATG	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2694T>C	chr1.hg19:g.150531572T>C		71.0	0.0		90.0	45.0	NM_019032	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Silent	SNP	ENST00000369038.2	hg19	CCDS955.1																																																																																			.	.		0.677	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032	
HRNR	388697	hgsc.bcm.edu	37	1	152185637	152185637	+	Missense_Mutation	SNP	C	C	A	rs150101773	byFrequency	TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:152185637C>A	ENST00000368801.2	-	3	8543	c.8468G>T	c.(8467-8469)aGt>aTt	p.S2823I	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2823					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGCCAGAACTTCCCCCATC	0.423																																					p.S2823I		Atlas-SNP	.											.	HRNR	403	.	0			c.G8468T						.						71.0	74.0	73.0					1																	152185637		2203	4300	6503	SO:0001583	missense	388697	exon3			CCAGAACTTCCCC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8468G>T	chr1.hg19:g.152185637C>A	ENSP00000357791:p.Ser2823Ile	358.0	0.0		551.0	54.0	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	hg19	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	6.177	0.400926	0.11696	.	.	ENSG00000197915	ENST00000368801	T	0.02085	4.46	4.56	-2.24	0.06909	.	.	.	.	.	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	D	0.56968	0.978	P	0.52267	0.694	T	0.48399	-0.9039	9	0.48119	T	0.1	.	5.1577	0.15044	0.0:0.3176:0.1591:0.5233	.	2823	Q86YZ3	HORN_HUMAN	I	2823	ENSP00000357791:S2823I	ENSP00000357791:S2823I	S	-	2	0	HRNR	150452261	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.759000	0.04761	-0.556000	0.06134	-0.258000	0.10820	AGT	.	C|1.000;T|0.000		0.423	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
LY9	4063	hgsc.bcm.edu	37	1	160769681	160769681	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:160769681C>A	ENST00000263285.6	+	2	293	c.263C>A	c.(262-264)gCt>gAt	p.A88D	LY9_ENST00000368039.2_Missense_Mutation_p.A88D|LY9_ENST00000471816.1_3'UTR|LY9_ENST00000368040.1_5'UTR|LY9_ENST00000392203.4_Missense_Mutation_p.A88D|LY9_ENST00000368037.5_Missense_Mutation_p.A88D|LY9_ENST00000368041.2_Missense_Mutation_p.A48D|LY9_ENST00000341032.4_Missense_Mutation_p.A88D			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	88	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			AATGCTCTTGCTTTCGCACGT	0.488																																					p.A88D		Atlas-SNP	.											.	LY9	115	.	0			c.C263A						.						99.0	95.0	96.0					1																	160769681		2203	4300	6503	SO:0001583	missense	4063	exon2			CTCTTGCTTTCGC	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.263C>A	chr1.hg19:g.160769681C>A	ENSP00000263285:p.Ala88Asp	113.0	0.0		200.0	13.0	NM_001261457	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	hg19	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511901	0.44660	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000368039;ENST00000392203;ENST00000368037	T;T;T	0.69040	1.94;1.94;-0.37	4.04	-3.83	0.04269	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.728910	0.01644	N	0.024208	T	0.74658	0.3745	M	0.88842	2.985	0.09310	N	0.999996	D;D;D;D;D;D	0.89917	0.999;0.971;0.997;0.999;1.0;0.999	D;B;D;D;D;D	0.72338	0.974;0.445;0.916;0.952;0.963;0.977	T	0.64058	-0.6496	10	0.72032	D	0.01	0.1092	9.8667	0.41148	0.0:0.3566:0.0:0.6434	.	88;48;88;88;88;88	B4E0J5;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7;Q6P2J4	.;.;.;.;LY9_HUMAN;.	D	88;88;88;88;88;48;48	ENSP00000342921:A88D;ENSP00000263285:A88D;ENSP00000357018:A88D	ENSP00000263285:A88D	A	+	2	0	LY9	159036305	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.516000	0.02250	-1.036000	0.03287	-0.253000	0.11424	GCT	.	.		0.488	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
DARS2	55157	hgsc.bcm.edu	37	1	173825830	173825830	+	Silent	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:173825830G>A	ENST00000361951.4	+	16	2428	c.1701G>A	c.(1699-1701)ctG>ctA	p.L567L	DARS2_ENST00000239457.5_Silent_p.L112L|DARS2_ENST00000471476.1_3'UTR	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	567					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	TCTCCCATCTGCTCCAGGCTT	0.393																																					p.L567L		Atlas-SNP	.											.	DARS2	61	.	0			c.G1701A						.						86.0	87.0	87.0					1																	173825830		2203	4300	6503	SO:0001819	synonymous_variant	55157	exon16			CCATCTGCTCCAG	AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.1701G>A	chr1.hg19:g.173825830G>A		58.0	0.0		107.0	8.0	NM_018122		Silent	SNP	ENST00000361951.4	hg19	CCDS1311.1																																																																																			.	.		0.393	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084220.1	NM_018122	
NUAK2	81788	hgsc.bcm.edu	37	1	205290713	205290713	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:205290713G>A	ENST00000367157.3	-	1	170	c.44C>T	c.(43-45)tCg>tTg	p.S15L		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTCTGCGGCCGAGGGAGTGGG	0.677																																					p.S15L		Atlas-SNP	.											.	NUAK2	107	.	0			c.C44T						.						20.0	25.0	23.0					1																	205290713		2202	4299	6501	SO:0001583	missense	81788	exon1			GCGGCCGAGGGAG	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.44C>T	chr1.hg19:g.205290713G>A	ENSP00000356125:p.Ser15Leu	55.0	0.0		81.0	21.0	NM_030952		Missense_Mutation	SNP	ENST00000367157.3	hg19	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205675	0.58234	.	.	ENSG00000163545	ENST00000367157	T	0.72394	-0.65	4.68	3.76	0.43208	.	0.730137	0.11212	N	0.587637	T	0.57315	0.2045	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.51276	-0.8726	10	0.62326	D	0.03	.	8.4669	0.32962	0.1051:0.0:0.8949:0.0	.	15	Q9H093	NUAK2_HUMAN	L	15	ENSP00000356125:S15L	ENSP00000356125:S15L	S	-	2	0	NUAK2	203557336	0.255000	0.24002	0.617000	0.29091	0.224000	0.24922	1.438000	0.35002	1.197000	0.43143	0.561000	0.74099	TCG	.	.		0.677	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
RYR2	6262	hgsc.bcm.edu	37	1	237893654	237893654	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr1:237893654G>A	ENST00000366574.2	+	77	11250	c.10933G>A	c.(10933-10935)Gca>Aca	p.A3645T	RYR2_ENST00000542537.1_Missense_Mutation_p.A3629T|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.A3643T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3645					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAAGATTTAGCAGTATGTTT	0.378																																					p.A3645T		Atlas-SNP	.											RYR2,NS,chondrosarcoma,0,1	RYR2	1273	.	0			c.G10933A						.						53.0	51.0	51.0					1																	237893654		1842	4098	5940	SO:0001583	missense	6262	exon77			GATTTAGCAGTAT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10933G>A	chr1.hg19:g.237893654G>A	ENSP00000355533:p.Ala3645Thr	91.0	0.0		144.0	17.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.605009	0.28623	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96427	-4.01;-4.0;-4.0	5.52	5.52	0.82312	.	0.188612	0.32015	N	0.006710	D	0.89832	0.6829	N	0.11789	0.175	0.80722	D	1	B;B	0.23540	0.005;0.087	B;B	0.25884	0.004;0.064	D	0.85251	0.1044	10	0.02654	T	1	-16.0419	14.6196	0.68574	0.0:0.0:0.8542:0.1458	.	600;3645	B4DGV4;Q92736	.;RYR2_HUMAN	T	3645;3643;3629;600	ENSP00000355533:A3645T;ENSP00000353174:A3643T;ENSP00000443798:A3629T	ENSP00000353174:A3643T	A	+	1	0	RYR2	235960277	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.755000	0.85180	2.757000	0.94681	0.585000	0.79938	GCA	.	.		0.378	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
INO80B	83444	hgsc.bcm.edu	37	2	74683301	74683301	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr2:74683301G>A	ENST00000233331.7	+	4	536	c.442G>A	c.(442-444)Gag>Aag	p.E148K	WBP1_ENST00000233615.2_5'Flank|WBP1_ENST00000393972.3_5'Flank|INO80B_ENST00000469849.1_3'UTR|INO80B_ENST00000409917.1_Missense_Mutation_p.E148K|WBP1_ENST00000409737.1_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	148	Poly-Glu.				chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						GGAGGAAGAGGAGGAACAGAG	0.532																																					p.E148K		Atlas-SNP	.											.	INO80B	37	.	0			c.G442A						.						117.0	110.0	113.0					2																	74683301		2203	4300	6503	SO:0001583	missense	83444	exon4			GAAGAGGAGGAAC	AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.442G>A	chr2.hg19:g.74683301G>A	ENSP00000233331:p.Glu148Lys	240.0	0.0		257.0	19.0	NM_031288		Missense_Mutation	SNP	ENST00000233331.7	hg19	CCDS1942.2	.	.	.	.	.	.	.	.	.	.	G	35	5.460970	0.96240	.	.	ENSG00000115274	ENST00000233331;ENST00000431187;ENST00000409917;ENST00000409493	T;T;T;T	0.58797	0.54;0.38;0.31;0.37	5.65	5.65	0.86999	.	0.000000	0.56097	D	0.000028	T	0.71995	0.3406	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.69078	0.997;0.993;0.993;0.988	D;D;D;D	0.75020	0.985;0.968;0.956;0.981	T	0.68830	-0.5305	10	0.33940	T	0.23	-32.2379	15.2215	0.73313	0.0:0.0:1.0:0.0	.	166;133;148;148	B4DJ31;B4DJ22;Q9C086;B8ZZ93	.;.;IN80B_HUMAN;.	K	148;133;148;153	ENSP00000233331:E148K;ENSP00000389887:E133K;ENSP00000387267:E148K;ENSP00000386937:E153K	ENSP00000233331:E148K	E	+	1	0	INO80B	74536809	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.964000	0.93389	2.666000	0.90696	0.555000	0.69702	GAG	.	.		0.532	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252223.2	NM_031288	
IWS1	55677	hgsc.bcm.edu	37	2	128247508	128247508	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr2:128247508T>A	ENST00000295321.4	-	11	2318	c.2059A>T	c.(2059-2061)Agg>Tgg	p.R687W	AC010976.2_ENST00000599001.1_RNA|AC010976.2_ENST00000454503.2_RNA|AC010976.2_ENST00000595561.1_RNA|AC010976.2_ENST00000596439.1_RNA|AC010976.2_ENST00000598065.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	687	Interaction with SUPT6H and ALYREF.|TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		AATATAGGCCTAGACCACTCA	0.373																																					p.R687W		Atlas-SNP	.											.	IWS1	61	.	0			c.A2059T						.						283.0	259.0	267.0					2																	128247508		2203	4300	6503	SO:0001583	missense	55677	exon11			TAGGCCTAGACCA	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.2059A>T	chr2.hg19:g.128247508T>A	ENSP00000295321:p.Arg687Trp	357.0	0.0		391.0	50.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	hg19	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	T	19.15	3.771756	0.69992	.	.	ENSG00000163166	ENST00000295321;ENST00000433551	T	0.70164	-0.46	5.03	4.14	0.48551	Transcription factor IIS, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.83839	0.5341	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87064	0.2155	10	0.87932	D	0	-6.0033	14.5147	0.67811	0.0:0.0:0.8461:0.1539	.	687	Q96ST2	IWS1_HUMAN	W	687;640	ENSP00000295321:R687W	ENSP00000295321:R687W	R	-	1	2	IWS1	127963978	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.041000	0.49807	1.088000	0.41272	-0.445000	0.05633	AGG	.	.		0.373	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
BAZ2B	29994	hgsc.bcm.edu	37	2	160194151	160194151	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr2:160194151C>G	ENST00000392783.2	-	32	6082	c.5587G>C	c.(5587-5589)Gaa>Caa	p.E1863Q	BAZ2B_ENST00000392782.1_Missense_Mutation_p.E1827Q|BAZ2B_ENST00000355831.2_Missense_Mutation_p.E1829Q|BAZ2B_ENST00000343439.5_Missense_Mutation_p.E1763Q	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1863					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CTCTTCCGTTCTAGTGCATGT	0.438																																					p.E1863Q		Atlas-SNP	.											.	BAZ2B	196	.	0			c.G5587C						.						180.0	179.0	179.0					2																	160194151		1941	4145	6086	SO:0001583	missense	29994	exon32			TCCGTTCTAGTGC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5587G>C	chr2.hg19:g.160194151C>G	ENSP00000376534:p.Glu1863Gln	169.0	0.0		185.0	28.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445224	0.43429	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000426648	T;T;T;T	0.58652	0.41;0.38;0.41;0.32	5.78	5.78	0.91487	.	0.201250	0.23906	U	0.043384	T	0.49541	0.1563	L	0.43152	1.355	0.48341	D	0.999637	B;P	0.45531	0.277;0.86	B;B	0.35813	0.122;0.211	T	0.47459	-0.9116	10	0.24483	T	0.36	-5.0357	20.0022	0.97423	0.0:1.0:0.0:0.0	.	1827;1863	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	Q	1827;1863;1829;1763;81	ENSP00000376533:E1827Q;ENSP00000376534:E1863Q;ENSP00000348087:E1829Q;ENSP00000339670:E1763Q	ENSP00000339670:E1763Q	E	-	1	0	BAZ2B	159902397	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.462000	0.45049	2.738000	0.93877	0.655000	0.94253	GAA	.	.		0.438	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
PLCD4	84812	hgsc.bcm.edu	37	2	219501200	219501200	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr2:219501200G>A	ENST00000450993.2	+	16	2528	c.2189G>A	c.(2188-2190)cGc>cAc	p.R730H	RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000417849.1_Missense_Mutation_p.R730H|PLCD4_ENST00000432688.1_Missense_Mutation_p.R762H	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	730					acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCAGGTTACCGCCACATTCAC	0.582																																					p.R730H		Atlas-SNP	.											.	PLCD4	51	.	0			c.G2189A						.						77.0	82.0	80.0					2																	219501200		2058	4188	6246	SO:0001583	missense	84812	exon16			GTTACCGCCACAT	AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.2189G>A	chr2.hg19:g.219501200G>A	ENSP00000388631:p.Arg730His	117.0	0.0		112.0	31.0	NM_032726	Q53FS8	Missense_Mutation	SNP	ENST00000450993.2	hg19	CCDS46516.1	.	.	.	.	.	.	.	.	.	.	G	33	5.262612	0.95399	.	.	ENSG00000115556	ENST00000450993;ENST00000417849;ENST00000432688	T;T;T	0.15256	2.44;2.44;2.44	5.17	5.17	0.71159	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.48607	0.1509	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50988	-0.8762	10	0.51188	T	0.08	.	18.8753	0.92332	0.0:0.0:1.0:0.0	.	730	Q9BRC7	PLCD4_HUMAN	H	730;730;762	ENSP00000388631:R730H;ENSP00000396942:R730H;ENSP00000396185:R762H	ENSP00000396942:R730H	R	+	2	0	PLCD4	219209444	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.541000	0.98083	2.692000	0.91855	0.655000	0.94253	CGC	.	.		0.582	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1		
PLXND1	23129	hgsc.bcm.edu	37	3	129286593	129286593	+	Silent	SNP	C	C	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr3:129286593C>A	ENST00000324093.4	-	21	4099	c.3921G>T	c.(3919-3921)acG>acT	p.T1307T	PLXND1_ENST00000393239.1_Silent_p.T1307T	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1307					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TCTGCAGCAGCGTCTTCTGCC	0.602																																					p.T1307T	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.G3921T						.						67.0	59.0	61.0					3																	129286593		2203	4300	6503	SO:0001819	synonymous_variant	23129	exon21			CAGCAGCGTCTTC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3921G>T	chr3.hg19:g.129286593C>A		64.0	0.0		35.0	5.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	ENST00000324093.4	hg19	CCDS33854.1																																																																																			.	.		0.602	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
ALB	213	hgsc.bcm.edu	37	4	74283866	74283866	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr4:74283866T>A	ENST00000503124.1	+	10	1247	c.1040T>A	c.(1039-1041)gTc>gAc	p.V347D	ALB_ENST00000401494.3_Missense_Mutation_p.V382D|ALB_ENST00000415165.2_Missense_Mutation_p.V305D|ALB_ENST00000295897.4_Missense_Mutation_p.V497D|ALB_ENST00000509063.1_Missense_Mutation_p.V497D|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGTGACAGAGTCACCAAATGC	0.453																																					p.V497D		Atlas-SNP	.											.	ALB	132	.	0			c.T1490A						.						108.0	101.0	103.0					4																	74283866		2203	4300	6503	SO:0001583	missense	213	exon12			ACAGAGTCACCAA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1040T>A	chr4.hg19:g.74283866T>A	ENSP00000421027:p.Val347Asp	90.0	0.0		104.0	24.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.42|16.42	3.118606|3.118606	0.56505|0.56505	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000511370|ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	.|T;T;T;T;T	.|0.74526	.|-0.85;-0.85;-0.85;-0.85;-0.85	5.94|5.94	5.94|5.94	0.96194|0.96194	.|Serum albumin-like (1);Serum albumin, N-terminal (3);	.|0.258665	.|0.32430	.|N	.|0.006101	D|D	0.88269|0.88269	0.6391|0.6391	M|M	0.88979|0.88979	2.995|2.995	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.999;1.0;0.999;1.0;1.0	D|D	0.90320|0.90320	0.4344|0.4344	5|10	.|0.87932	.|D	.|0	-11.5788|-11.5788	15.2238|15.2238	0.73333|0.73333	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|382;305;347;497;497	.|B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.|.;.;.;.;ALBU_HUMAN	R|D	341|497;305;284;347;497;382;506	.|ENSP00000295897:V497D;ENSP00000401820:V305D;ENSP00000421027:V347D;ENSP00000422784:V497D;ENSP00000384695:V382D	.|ENSP00000295897:V497D	S|V	+|+	3|2	2|0	ALB|ALB	74502730|74502730	0.966000|0.966000	0.33281|0.33281	0.857000|0.857000	0.33713|0.33713	0.194000|0.194000	0.23727|0.23727	4.628000|4.628000	0.61282|0.61282	2.275000|2.275000	0.75901|0.75901	0.528000|0.528000	0.53228|0.53228	AGT|GTC	.	.		0.453	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
USP38	84640	hgsc.bcm.edu	37	4	144107245	144107245	+	Silent	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr4:144107245G>A	ENST00000307017.4	+	1	1148	c.642G>A	c.(640-642)ctG>ctA	p.L214L	RP11-284M14.1_ENST00000507826.1_RNA|USP38_ENST00000510377.1_Silent_p.L214L|RP11-284M14.1_ENST00000507486.1_RNA	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	214					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CCACACTACTGCCTTCCCTGC	0.458																																					p.L214L		Atlas-SNP	.											.	USP38	92	.	0			c.G642A						.						64.0	68.0	67.0					4																	144107245		2203	4300	6503	SO:0001819	synonymous_variant	84640	exon1			ACTACTGCCTTCC	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.642G>A	chr4.hg19:g.144107245G>A		124.0	0.0		126.0	33.0	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Silent	SNP	ENST00000307017.4	hg19	CCDS3758.1																																																																																			.	.		0.458	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
NR3C2	4306	hgsc.bcm.edu	37	4	149357349	149357349	+	Missense_Mutation	SNP	T	T	A	rs374672844		TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr4:149357349T>A	ENST00000358102.3	-	2	1026	c.664A>T	c.(664-666)Agt>Tgt	p.S222C	NR3C2_ENST00000355292.3_Missense_Mutation_p.S222C|NR3C2_ENST00000344721.4_Missense_Mutation_p.S222C|NR3C2_ENST00000511528.1_Missense_Mutation_p.S222C|NR3C2_ENST00000512865.1_Missense_Mutation_p.S222C	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	222	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	ACTGGAAAACTGCCAAAGCTG	0.542																																					p.S222C	Melanoma(27;428 957 40335 51025 51111)	Atlas-SNP	.											.	NR3C2	94	.	0			c.A664T						.	T	CYS/SER,CYS/SER	0,4406		0,0,2203	52.0	55.0	54.0		664,664	4.9	1.0	4		54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NR3C2	NM_001166104.1,NM_000901.4	112,112	0,1,6502	AA,AT,TT		0.0116,0.0,0.0077	benign,benign	222/868,222/985	149357349	1,13005	2203	4300	6503	SO:0001583	missense	4306	exon2			GAAAACTGCCAAA	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.664A>T	chr4.hg19:g.149357349T>A	ENSP00000350815:p.Ser222Cys	60.0	0.0		68.0	13.0	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	hg19	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	T	7.106	0.575095	0.13623	0.0	1.16E-4	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.19;-2.2;-2.6	4.86	4.86	0.63082	.	0.851640	0.11115	N	0.598089	T	0.81254	0.4784	N	0.19112	0.55	0.21697	N	0.999583	P;B	0.40000	0.698;0.153	B;B	0.35073	0.159;0.195	T	0.70153	-0.4950	9	.	.	.	.	14.7379	0.69430	0.0:0.0:0.0:1.0	.	222;222	B0ZBF5;B0ZBF6	.;.	C	222	ENSP00000341390:S222C;ENSP00000347441:S222C;ENSP00000350815:S222C;ENSP00000423510:S222C;ENSP00000343907:S222C;ENSP00000421481:S222C	.	S	-	1	0	NR3C2	149576799	1.000000	0.71417	0.970000	0.41538	0.914000	0.54420	2.595000	0.46197	1.937000	0.56155	0.482000	0.46254	AGT	.	.		0.542	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
PRR16	51334	hgsc.bcm.edu	37	5	120021723	120021723	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr5:120021723C>A	ENST00000407149.2	+	2	443	c.234C>A	c.(232-234)gaC>gaA	p.D78E	PRR16_ENST00000505123.1_Missense_Mutation_p.D8E|PRR16_ENST00000379551.2_Missense_Mutation_p.D55E|PRR16_ENST00000446965.1_Missense_Mutation_p.D8E			Q569H4	LARGN_HUMAN	proline rich 16	78					positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CCAAAACGGACACGCTGAATA	0.507																																					p.D55E		Atlas-SNP	.											.	PRR16	71	.	0			c.C165A						.						112.0	102.0	105.0					5																	120021723		2203	4300	6503	SO:0001583	missense	51334	exon3			AACGGACACGCTG	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.234C>A	chr5.hg19:g.120021723C>A	ENSP00000385118:p.Asp78Glu	71.0	0.0		97.0	24.0	NM_016644	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	hg19		.	.	.	.	.	.	.	.	.	.	C	18.03	3.531268	0.64972	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.46	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.62962	0.2471	M	0.61703	1.905	0.50313	D	0.999869	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.63238	-0.6682	9	.	.	.	-0.035	12.4978	0.55937	0.0:0.8316:0.0:0.1684	.	78;55	Q569H4;Q569H4-3	PRR16_HUMAN;.	E	78;55;8;8;8	ENSP00000385118:D78E;ENSP00000368869:D55E;ENSP00000421256:D8E;ENSP00000423446:D8E;ENSP00000405491:D8E	.	D	+	3	2	PRR16	120049622	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.999000	0.49473	1.276000	0.44395	0.555000	0.69702	GAC	.	.		0.507	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
GFOD1	54438	hgsc.bcm.edu	37	6	13365402	13365402	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr6:13365402A>G	ENST00000379287.3	-	2	1410	c.746T>C	c.(745-747)gTc>gCc	p.V249A	GFOD1_ENST00000379284.1_Missense_Mutation_p.V146A	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1	249						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			CACCACAGTGACATCCTGCTT	0.672																																					p.V249A		Atlas-SNP	.											.	GFOD1	38	.	0			c.T746C						.						37.0	37.0	37.0					6																	13365402		2203	4300	6503	SO:0001583	missense	54438	exon2			ACAGTGACATCCT	AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.746T>C	chr6.hg19:g.13365402A>G	ENSP00000368589:p.Val249Ala	38.0	0.0		38.0	10.0	NM_018988	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	hg19	CCDS4524.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672251	0.67928	.	.	ENSG00000145990	ENST00000379287;ENST00000379284	T;T	0.44881	0.91;0.91	5.73	5.73	0.89815	.	0.120685	0.53938	D	0.000044	T	0.31702	0.0805	M	0.66297	2.02	0.80722	D	1	B	0.30634	0.288	B	0.30716	0.119	T	0.27839	-1.0062	10	0.56958	D	0.05	-28.9863	15.2091	0.73206	1.0:0.0:0.0:0.0	.	249	Q9NXC2	GFOD1_HUMAN	A	249;146	ENSP00000368589:V249A;ENSP00000368586:V146A	ENSP00000368586:V146A	V	-	2	0	GFOD1	13473381	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.335000	0.96500	2.173000	0.68751	0.528000	0.53228	GTC	.	.		0.672	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988	
C6orf62	81688	hgsc.bcm.edu	37	6	24714631	24714631	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr6:24714631A>C	ENST00000378119.4	-	3	2511	c.344T>G	c.(343-345)cTt>cGt	p.L115R	C6orf62_ENST00000540769.1_Missense_Mutation_p.L57R|C6orf62_ENST00000378102.3_Missense_Mutation_p.L86R	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	115						intracellular (GO:0005622)				endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						CCGAGGCCAAAGAATGAAATC	0.348																																					p.L115R		Atlas-SNP	.											.	C6orf62	18	.	0			c.T344G						.						74.0	76.0	76.0					6																	24714631		2203	4300	6503	SO:0001583	missense	81688	exon3			GGCCAAAGAATGA	AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.344T>G	chr6.hg19:g.24714631A>C	ENSP00000367359:p.Leu115Arg	187.0	0.0		143.0	29.0	NM_030939	Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	Missense_Mutation	SNP	ENST00000378119.4	hg19	CCDS4559.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.981413	0.93044	.	.	ENSG00000112308	ENST00000378119;ENST00000540769;ENST00000378102	T;T;T	0.45668	0.89;0.89;0.89	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.51537	-0.8693	10	0.87932	D	0	-7.733	16.1413	0.81528	1.0:0.0:0.0:0.0	.	115	Q9GZU0	CF062_HUMAN	R	115;57;86	ENSP00000367359:L115R;ENSP00000446225:L57R;ENSP00000367342:L86R	ENSP00000367342:L86R	L	-	2	0	C6orf62	24822610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.244000	0.95423	2.270000	0.75569	0.482000	0.46254	CTT	.	.		0.348	C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939	
LRFN2	57497	hgsc.bcm.edu	37	6	40400289	40400289	+	Silent	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr6:40400289G>A	ENST00000338305.6	-	2	1106	c.564C>T	c.(562-564)atC>atT	p.I188I		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	188						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGCCCTCGGCGATGTGATCCA	0.622																																					p.I188I		Atlas-SNP	.											.	LRFN2	133	.	0			c.C564T						.						87.0	88.0	88.0					6																	40400289		2203	4300	6503	SO:0001819	synonymous_variant	57497	exon2			CTCGGCGATGTGA	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.564C>T	chr6.hg19:g.40400289G>A		101.0	0.0		76.0	13.0	NM_020737	A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	hg19	CCDS34443.1																																																																																			.	.		0.622	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
COL28A1	340267	hgsc.bcm.edu	37	7	7571282	7571282	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr7:7571282T>A	ENST00000399429.3	-	3	518	c.378A>T	c.(376-378)ttA>ttT	p.L126F		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	126	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CTTGCCCTATTAAATTCATAG	0.438																																					p.L126F		Atlas-SNP	.											.	COL28A1	113	.	0			c.A378T						.						77.0	70.0	72.0					7																	7571282		1885	4113	5998	SO:0001583	missense	340267	exon3			CCCTATTAAATTC	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.378A>T	chr7.hg19:g.7571282T>A	ENSP00000382356:p.Leu126Phe	106.0	0.0		168.0	59.0	NM_001037763	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	hg19	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	T	7.535	0.659402	0.14645	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.55234	0.53	4.2	-3.54	0.04653	von Willebrand factor, type A (3);	0.539313	0.17218	N	0.182452	T	0.19685	0.0473	N	0.02539	-0.55	0.26904	N	0.967057	B	0.02656	0.0	B	0.04013	0.001	T	0.14420	-1.0473	10	0.25751	T	0.34	5.6329	7.0137	0.24877	0.0768:0.0892:0.5766:0.2574	.	126	Q2UY09	COSA1_HUMAN	F	126	ENSP00000382356:L126F	ENSP00000382347:L126F	L	-	3	2	COL28A1	7537807	0.987000	0.35691	0.909000	0.35828	0.763000	0.43281	0.418000	0.21230	-0.874000	0.04027	-0.313000	0.08912	TTA	.	.		0.438	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
COBL	23242	hgsc.bcm.edu	37	7	51095517	51095517	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr7:51095517C>T	ENST00000265136.7	-	10	3441	c.3276G>A	c.(3274-3276)aaG>aaA	p.K1092K	COBL_ENST00000395542.2_Silent_p.K1174K	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1092					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TGAATTTTTTCTTCGGCCCAA	0.488																																					p.K1092K	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-SNP	.											.	COBL	167	.	0			c.G3276A						.						170.0	156.0	160.0					7																	51095517		2203	4300	6503	SO:0001819	synonymous_variant	23242	exon10			TTTTTTCTTCGGC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3276G>A	chr7.hg19:g.51095517C>T		397.0	1.0		346.0	116.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	hg19	CCDS34637.1																																																																																			.	.		0.488	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
PCLO	27445	hgsc.bcm.edu	37	7	82595462	82595462	+	Silent	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr7:82595462G>A	ENST00000333891.9	-	4	3979	c.3642C>T	c.(3640-3642)ctC>ctT	p.L1214L	PCLO_ENST00000423517.2_Silent_p.L1214L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTCTTCAGGGAGTGGCTTTT	0.368																																					p.L1214L		Atlas-SNP	.											.	PCLO	1506	.	0			c.C3642T						.						166.0	157.0	160.0					7																	82595462		1798	4072	5870	SO:0001819	synonymous_variant	27445	exon4			TTCAGGGAGTGGC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3642C>T	chr7.hg19:g.82595462G>A		785.0	2.0		843.0	325.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.368	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PTCD1	26024	hgsc.bcm.edu	37	7	99030913	99030913	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr7:99030913G>C	ENST00000292478.4	-	3	832	c.582C>G	c.(580-582)aaC>aaG	p.N194K	ATP5J2-PTCD1_ENST00000437572.1_5'Flank|PTCD1_ENST00000555673.1_Missense_Mutation_p.N243K|PTCD1_ENST00000485746.1_5'UTR|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.N243K	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	194					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGTTGTAGAGGTTGAAGGCCT	0.607																																					p.N243K		Atlas-SNP	.											.	.	.	.	0			c.C729G						.						140.0	134.0	136.0					7																	99030913		2203	4300	6503	SO:0001583	missense	100526740	exon4			GTAGAGGTTGAAG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.582C>G	chr7.hg19:g.99030913G>C	ENSP00000292478:p.Asn194Lys	78.0	0.0		81.0	34.0	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	hg19	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	G	0.055	-1.240335	0.01493	.	.	ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000413834	T;T;T	0.61627	0.09;0.1;0.1	5.23	0.251	0.15540	.	0.983767	0.08319	N	0.964237	T	0.24812	0.0602	N	0.03209	-0.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24083	-1.0170	10	0.06757	T	0.87	-1.4307	2.5943	0.04850	0.1076:0.452:0.2122:0.2283	.	243;194	G3V325;O75127	.;PTCD1_HUMAN	K	194;243;243	ENSP00000292478:N194K;ENSP00000450995:N243K;ENSP00000400168:N243K	ENSP00000400168:N243K	N	-	3	2	ATP5J2-PTCD1;PTCD1	98868849	0.000000	0.05858	0.298000	0.25002	0.043000	0.13939	-0.111000	0.10807	0.215000	0.20761	-0.891000	0.02926	AAC	.	.		0.607	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
HAS2	3037	hgsc.bcm.edu	37	8	122641077	122641077	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr8:122641077C>T	ENST00000303924.4	-	2	1041	c.504G>A	c.(502-504)tcG>tcA	p.S168S		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	168					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TTACGTGTTGCGAGCTTTCTT	0.453																																					p.S168S		Atlas-SNP	.											.	HAS2	87	.	0			c.G504A						.						376.0	326.0	343.0					8																	122641077		2203	4300	6503	SO:0001819	synonymous_variant	3037	exon2			GTGTTGCGAGCTT	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.504G>A	chr8.hg19:g.122641077C>T		128.0	0.0		307.0	174.0	NM_005328	Q32MM3	Silent	SNP	ENST00000303924.4	hg19	CCDS6335.1																																																																																			.	.		0.453	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
AKR1C1	1645	hgsc.bcm.edu	37	10	5005692	5005692	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr10:5005692T>G	ENST00000380872.4	+	1	248	c.56T>G	c.(55-57)cTg>cGg	p.L19R	AKR1C1_ENST00000434459.2_Missense_Mutation_p.L19R|U8_ENST00000459095.1_RNA|AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000380859.1_5'Flank	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	19					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	ATGCCTGTCCTGGGATTTGGC	0.458																																					p.L19R	Colon(130;2054 2316 13360 15380)	Atlas-SNP	.											.	AKR1C1	39	.	0			c.T56G						.						152.0	134.0	140.0					10																	5005692		2203	4300	6503	SO:0001583	missense	1645	exon1			CTGTCCTGGGATT	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.56T>G	chr10.hg19:g.5005692T>G	ENSP00000370254:p.Leu19Arg	222.0	0.0		180.0	16.0	NM_001353	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	ENST00000380872.4	hg19	CCDS7061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.67|18.67	3.673679|3.673679	0.67928|0.67928	.|.	.|.	ENSG00000187134|ENSG00000187134	ENST00000434459;ENST00000380872|ENST00000442997	T;T|.	0.34859|.	1.34;1.34|.	2.46|2.46	2.46|2.46	0.29980|0.29980	NADP-dependent oxidoreductase domain (3);|.	0.165908|.	0.28595|.	N|.	0.014798|.	T|T	0.66297|0.66297	0.2775|0.2775	M|M	0.81239|0.81239	2.535|2.535	0.42971|0.42971	D|D	0.99443|0.99443	D;D;D|.	0.89917|.	1.0;0.999;1.0|.	D;D;D|.	0.91635|.	0.999;0.984;0.992|.	T|T	0.66093|0.66093	-0.6009|-0.6009	10|5	0.87932|.	D|.	0|.	.|.	6.7142|6.7142	0.23294|0.23294	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	19;19;19|.	B4E0M1;Q2XPP3;Q04828|.	.;.;AK1C1_HUMAN|.	R|G	19|18	ENSP00000412248:L19R;ENSP00000370254:L19R|.	ENSP00000370254:L19R|.	L|W	+|+	2|1	0|0	AKR1C1|AKR1C1	4995692|4995692	0.533000|0.533000	0.26354|0.26354	0.163000|0.163000	0.22734|0.22734	0.471000|0.471000	0.32888|0.32888	2.373000|2.373000	0.44266|0.44266	1.131000|1.131000	0.42111|0.42111	0.254000|0.254000	0.18369|0.18369	CTG|TGG	.	.		0.458	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353	
MKI67	4288	hgsc.bcm.edu	37	10	129901194	129901194	+	Silent	SNP	G	G	A	rs371689181		TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr10:129901194G>A	ENST00000368654.3	-	13	9285	c.8910C>T	c.(8908-8910)ccC>ccT	p.P2970P	MKI67_ENST00000368653.3_Silent_p.P2610P	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2970					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CGTCTCCCACGGGTTCTACTT	0.502																																					p.P2970P		Atlas-SNP	.											.	MKI67	363	.	0			c.C8910T						.	A	,	1,4405	2.1+/-5.4	0,1,2202	90.0	90.0	90.0		7830,8910	-2.3	0.0	10		90	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	MKI67	NM_001145966.1,NM_002417.4	,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,	2610/2897,2970/3257	129901194	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	4288	exon13			TCCCACGGGTTCT	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8910C>T	chr10.hg19:g.129901194G>A		88.0	0.0		98.0	26.0	NM_002417	Q5VWH2	Silent	SNP	ENST00000368654.3	hg19	CCDS7659.1																																																																																			.	.		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
SSH3	54961	hgsc.bcm.edu	37	11	67077797	67077797	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr11:67077797G>T	ENST00000308127.4	+	13	1848	c.1670G>T	c.(1669-1671)aGt>aTt	p.S557I	SSH3_ENST00000308298.7_Missense_Mutation_p.S292I|SSH3_ENST00000376757.5_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	557					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCAGAGACCAGTGACATGCCA	0.617																																					p.S557I		Atlas-SNP	.											.	SSH3	54	.	0			c.G1670T						.						41.0	46.0	44.0					11																	67077797		2200	4295	6495	SO:0001583	missense	54961	exon13			AGACCAGTGACAT	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.1670G>T	chr11.hg19:g.67077797G>T	ENSP00000312081:p.Ser557Ile	80.0	0.0		74.0	15.0	NM_017857	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	hg19	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275638	0.23307	.	.	ENSG00000172830	ENST00000308127;ENST00000308298	T;T	0.29917	3.8;1.55	4.13	-1.32	0.09201	.	2.138560	0.02449	N	0.085412	T	0.20333	0.0489	N	0.19112	0.55	0.09310	N	1	B;B	0.32467	0.372;0.255	B;B	0.33890	0.172;0.083	T	0.14448	-1.0472	10	0.44086	T	0.13	4.549	4.3278	0.11048	0.2847:0.3177:0.3976:0.0	.	411;557	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	I	557;292	ENSP00000312081:S557I;ENSP00000310055:S292I	ENSP00000312081:S557I	S	+	2	0	SSH3	66834373	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.265000	0.08644	-0.336000	0.08438	0.555000	0.69702	AGT	.	.		0.617	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276	
FAT3	120114	hgsc.bcm.edu	37	11	92534030	92534030	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr11:92534030C>T	ENST00000298047.6	+	9	7868	c.7851C>T	c.(7849-7851)caC>caT	p.H2617H	FAT3_ENST00000525166.1_Silent_p.H2467H|FAT3_ENST00000409404.2_Silent_p.H2617H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2617	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GAAGGGGCCACTTGGTCACTC	0.488										TCGA Ovarian(4;0.039)																											p.H2617H		Atlas-SNP	.											.	FAT3	1822	.	0			c.C7851T						.						49.0	48.0	49.0					11																	92534030		1966	4158	6124	SO:0001819	synonymous_variant	120114	exon9			GGGCCACTTGGTC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7851C>T	chr11.hg19:g.92534030C>T		77.0	0.0		58.0	12.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	hg19																																																																																				.	.		0.488	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ETS1	2113	hgsc.bcm.edu	37	11	128426289	128426289	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr11:128426289G>C	ENST00000392668.4	-	3	195	c.111C>G	c.(109-111)aaC>aaG	p.N37K	ETS1_ENST00000525404.1_5'UTR	NM_001143820.1	NP_001137292.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	0					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GGAAACCACAGTTCATTCGAG	0.423																																					p.N37K		Atlas-SNP	.											.	ETS1	123	.	0			c.C111G						.						150.0	129.0	135.0					11																	128426289		1566	3579	5145	SO:0001583	missense	2113	exon3			ACCACAGTTCATT		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000392668.4:c.111C>G	chr11.hg19:g.128426289G>C	ENSP00000376436:p.Asn37Lys	147.0	0.0		164.0	38.0	NM_001143820	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000392668.4	hg19	CCDS44767.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834984	0.32421	.	.	ENSG00000134954	ENST00000392668	T	0.10960	2.82	5.89	4.98	0.66077	.	0.478249	0.20633	N	0.088545	T	0.07818	0.0196	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.08055	0.003	T	0.23655	-1.0182	9	0.30078	T	0.28	.	9.221	0.37377	0.0781:0.1479:0.774:0.0	.	37	Q6N087	.	K	37	ENSP00000376436:N37K	ENSP00000376436:N37K	N	-	3	2	ETS1	127931499	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.271000	0.33098	2.797000	0.96272	0.563000	0.77884	AAC	.	.		0.423	ETS1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386267.2	NM_005238	
USP5	8078	hgsc.bcm.edu	37	12	6974387	6974387	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:6974387G>A	ENST00000229268.8	+	19	2510	c.2458G>A	c.(2458-2460)Gtc>Atc	p.V820I	USP5_ENST00000389231.5_Missense_Mutation_p.V797I|TPI1_ENST00000229270.4_5'Flank|TPI1_ENST00000488464.2_5'Flank|TPI1_ENST00000396705.5_5'Flank|TPI1_ENST00000535434.1_5'Flank	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	820	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						TGGTCACTACGTCTGCCACAT	0.507																																					p.V820I		Atlas-SNP	.											.	USP5	124	.	0			c.G2458A						.						94.0	81.0	86.0					12																	6974387		2203	4300	6503	SO:0001583	missense	8078	exon19			CACTACGTCTGCC	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.2458G>A	chr12.hg19:g.6974387G>A	ENSP00000229268:p.Val820Ile	114.0	0.0		131.0	13.0	NM_001098536	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	hg19	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	G	35	5.478063	0.96291	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.32023	1.47;1.47	5.27	5.27	0.74061	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.52354	0.1729	M	0.78223	2.4	0.80722	D	1	P;D	0.69078	0.948;0.997	P;P	0.55545	0.591;0.778	T	0.54153	-0.8336	10	0.49607	T	0.09	-9.8578	19.0978	0.93260	0.0:0.0:1.0:0.0	.	820;797	P45974;P45974-2	UBP5_HUMAN;.	I	820;797	ENSP00000229268:V820I;ENSP00000373883:V797I	ENSP00000229268:V820I	V	+	1	0	USP5	6844648	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.657000	0.98554	2.735000	0.93741	0.655000	0.94253	GTC	.	.		0.507	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
PZP	5858	hgsc.bcm.edu	37	12	9344850	9344850	+	Silent	SNP	G	G	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:9344850G>T	ENST00000261336.2	-	13	1513	c.1485C>A	c.(1483-1485)atC>atA	p.I495I	PZP_ENST00000381997.2_Silent_p.I364I	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	495					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						CCTTAGCCATGATCTGAAATG	0.473																																					p.I495I	Melanoma(125;1402 1695 4685 34487 38571)	Atlas-SNP	.											.	PZP	422	.	0			c.C1485A						.						90.0	81.0	84.0					12																	9344850		2203	4300	6503	SO:0001819	synonymous_variant	5858	exon13			AGCCATGATCTGA	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1485C>A	chr12.hg19:g.9344850G>T		77.0	0.0		90.0	7.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Silent	SNP	ENST00000261336.2	hg19	CCDS8600.1																																																																																			.	.		0.473	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
TAS2R46	259292	hgsc.bcm.edu	37	12	11214459	11214459	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:11214459A>C	ENST00000533467.1	-	1	434	c.435T>G	c.(433-435)ttT>ttG	p.F145L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	145					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.?(1)|p.F145L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGTTTATCACAAAAAGATGAC	0.348																																					p.F145L		Atlas-SNP	.											TAS2R46,NS,carcinoma,0,1	TAS2R46	43	.	2	Substitution - Missense(1)|Unknown(1)	lung(2)	c.T435G						.						108.0	114.0	112.0					12																	11214459		2067	4259	6326	SO:0001583	missense	259292	exon1			TATCACAAAAAGA	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.435T>G	chr12.hg19:g.11214459A>C	ENSP00000436450:p.Phe145Leu	256.0	0.0		275.0	13.0	NM_176887	P59548|Q645X6	Missense_Mutation	SNP	ENST00000533467.1	hg19	CCDS53748.1	.	.	.	.	.	.	.	.	.	.	A	4.145	0.025222	0.08054	.	.	ENSG00000226761	ENST00000533467	T	0.36340	1.26	2.37	-3.71	0.04424	.	.	.	.	.	T	0.10465	0.0256	N	0.02315	-0.6	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.33369	-0.9871	9	0.11485	T	0.65	.	3.4805	0.07601	0.3727:0.0:0.3609:0.2664	.	145	P59540	T2R46_HUMAN	L	145	ENSP00000436450:F145L	ENSP00000436450:F145L	F	-	3	2	TAS2R46	11105726	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-2.787000	0.00769	-0.280000	0.09154	0.163000	0.16589	TTT	.	.		0.348	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887	
TAS2R46	259292	hgsc.bcm.edu	37	12	11214707	11214707	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:11214707C>A	ENST00000533467.1	-	1	186	c.187G>T	c.(187-189)Gta>Tta	p.V63L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	63					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		CAATTTAATACTAATACCCAG	0.383																																					p.V63L		Atlas-SNP	.											.	TAS2R46	43	.	0			c.G187T						.						57.0	56.0	56.0					12																	11214707		1962	4191	6153	SO:0001583	missense	259292	exon1			TTAATACTAATAC	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.187G>T	chr12.hg19:g.11214707C>A	ENSP00000436450:p.Val63Leu	236.0	0.0		280.0	20.0	NM_176887	P59548|Q645X6	Missense_Mutation	SNP	ENST00000533467.1	hg19	CCDS53748.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.927156	0.00493	.	.	ENSG00000226761	ENST00000533467	T	0.36699	1.24	2.54	-0.426	0.12314	.	.	.	.	.	T	0.05960	0.0155	N	0.00128	-2.045	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33727	-0.9857	9	0.02654	T	1	.	5.7688	0.18241	0.2913:0.5338:0.0:0.1749	.	63	P59540	T2R46_HUMAN	L	63	ENSP00000436450:V63L	ENSP00000436450:V63L	V	-	1	0	TAS2R46	11105974	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-2.384000	0.01063	-0.633000	0.05545	-1.227000	0.01581	GTA	.	.		0.383	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887	
TAS2R46	259292	hgsc.bcm.edu	37	12	11214720	11214720	+	Silent	SNP	T	T	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:11214720T>C	ENST00000533467.1	-	1	173	c.174A>G	c.(172-174)ttA>ttG	p.L58L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	58					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		ATACCCAGAGTAAACCAACTC	0.383																																					p.L58L		Atlas-SNP	.											.	TAS2R46	43	.	0			c.A174G						.						55.0	54.0	54.0					12																	11214720		1979	4201	6180	SO:0001819	synonymous_variant	259292	exon1			CCAGAGTAAACCA	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.174A>G	chr12.hg19:g.11214720T>C		279.0	0.0		297.0	19.0	NM_176887	P59548|Q645X6	Silent	SNP	ENST00000533467.1	hg19	CCDS53748.1																																																																																			.	.		0.383	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887	
TAS2R46	259292	hgsc.bcm.edu	37	12	11214756	11214756	+	Silent	SNP	T	T	C	rs375315747		TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:11214756T>C	ENST00000533467.1	-	1	137	c.138A>G	c.(136-138)caA>caG	p.Q46Q	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	46					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		CAGTGAGAATTTGGTCAGCAA	0.373																																					p.Q46Q		Atlas-SNP	.											.	TAS2R46	43	.	0			c.A138G						.	T		1,3949		0,1,1974	54.0	53.0	53.0		138	-2.3	0.0	12		53	0,8442		0,0,4221	no	coding-synonymous	TAS2R46	NM_176887.2		0,1,6195	CC,CT,TT		0.0,0.0253,0.0081		46/310	11214756	1,12391	1975	4221	6196	SO:0001819	synonymous_variant	259292	exon1			GAGAATTTGGTCA	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.138A>G	chr12.hg19:g.11214756T>C		308.0	0.0		343.0	20.0	NM_176887	P59548|Q645X6	Silent	SNP	ENST00000533467.1	hg19	CCDS53748.1																																																																																			.	.		0.373	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887	
NCKAP5L	57701	hgsc.bcm.edu	37	12	50185782	50185782	+	Missense_Mutation	SNP	G	G	A	rs372382126	byFrequency	TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:50185782G>A	ENST00000335999.6	-	13	4046	c.3845C>T	c.(3844-3846)aCg>aTg	p.T1282M		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1278	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GCCCTGGGGCGTAGGGGACGG	0.721													G|||	5	0.000998403	0.0	0.0	5008	,	,		14103	0.0		0.0	False		,,,				2504	0.0051				p.T1282M		Atlas-SNP	.											.	NCKAP5L	142	.	0			c.C3845T						.	G	MET/THR	1,3865		0,1,1932	12.0	16.0	14.0		3845	2.6	0.0	12		14	0,8230		0,0,4115	no	missense	NCKAP5L	NM_001037806.3	81	0,1,6047	AA,AG,GG		0.0,0.0259,0.0083	probably-damaging	1282/1335	50185782	1,12095	1933	4115	6048	SO:0001583	missense	57701	exon13			TGGGGCGTAGGGG	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.3845C>T	chr12.hg19:g.50185782G>A	ENSP00000337998:p.Thr1282Met	38.0	0.0		65.0	19.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	ENST00000335999.6	hg19	CCDS41781.2	.	.	.	.	.	.	.	.	.	.	G	1.799	-0.477609	0.04414	2.59E-4	0.0	ENSG00000167566	ENST00000335999;ENST00000354423	T	0.45668	0.89	4.46	2.57	0.30868	.	.	.	.	.	T	0.22282	0.0537	N	0.08118	0	0.09310	N	1	B;B	0.14805	0.011;0.005	B;B	0.16289	0.015;0.004	T	0.19192	-1.0313	9	0.45353	T	0.12	2.118	7.3365	0.26613	0.1744:0.1414:0.6842:0.0	.	1256;1278	E2QRB5;Q9HCH0	.;NCK5L_HUMAN	M	1282;1256	ENSP00000337998:T1282M	ENSP00000337998:T1282M	T	-	2	0	NCKAP5L	48472049	0.052000	0.20516	0.003000	0.11579	0.338000	0.28826	0.916000	0.28651	0.238000	0.21222	-1.203000	0.01651	ACG	.	.		0.721	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
NR4A1	3164	hgsc.bcm.edu	37	12	52448249	52448249	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr12:52448249C>T	ENST00000243050.1	+	3	451	c.137C>T	c.(136-138)gCc>gTc	p.A46V	NR4A1_ENST00000545748.1_Missense_Mutation_p.A100V|NR4A1_ENST00000550082.1_Missense_Mutation_p.A59V|NR4A1_ENST00000394824.2_Missense_Mutation_p.A46V|NR4A1_ENST00000360284.3_Missense_Mutation_p.A59V|NR4A1_ENST00000547206.1_3'UTR|NR4A1_ENST00000394825.1_Missense_Mutation_p.A46V|NR4A1_ENST00000548232.1_Missense_Mutation_p.A46V	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	46					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GCCCCCGCTGCCCCCACTGCC	0.657																																					p.A59V		Atlas-SNP	.											.	NR4A1	77	.	0			c.C176T						.						79.0	77.0	78.0					12																	52448249		2203	4300	6503	SO:0001583	missense	3164	exon3			CCGCTGCCCCCAC	L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.137C>T	chr12.hg19:g.52448249C>T	ENSP00000243050:p.Ala46Val	74.0	0.0		56.0	7.0	NM_001202233	B4DML7|Q15627|Q53Y00|Q6IBU8	Missense_Mutation	SNP	ENST00000243050.1	hg19	CCDS8818.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344410	0.61073	.	.	ENSG00000123358	ENST00000360284;ENST00000545748;ENST00000550082;ENST00000243050;ENST00000394825;ENST00000550763;ENST00000394824;ENST00000548232	D;D;D;D;D;T;D;D	0.96651	-3.82;-3.92;-3.82;-3.79;-3.79;0.01;-3.79;-4.08	4.59	3.68	0.42216	.	0.766780	0.12212	N	0.489206	D	0.93132	0.7813	L	0.35644	1.08	0.52501	D	0.99995	B;B;B	0.20052	0.001;0.002;0.041	B;B;B	0.17098	0.003;0.003;0.017	D	0.89744	0.3935	10	0.56958	D	0.05	.	11.2533	0.49039	0.0:0.9053:0.0:0.0947	.	59;46;46	B4DML7;P22736;Q15627	.;NR4A1_HUMAN;.	V	59;100;59;46;46;46;46;46	ENSP00000353427:A59V;ENSP00000440864:A100V;ENSP00000449539:A59V;ENSP00000243050:A46V;ENSP00000378302:A46V;ENSP00000449858:A46V;ENSP00000378301:A46V;ENSP00000449587:A46V	ENSP00000243050:A46V	A	+	2	0	NR4A1	50734516	0.997000	0.39634	0.995000	0.50966	0.882000	0.50991	4.726000	0.61986	1.250000	0.43966	0.561000	0.74099	GCC	.	.		0.657	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317922.2		
OLFM4	10562	hgsc.bcm.edu	37	13	53617269	53617269	+	Silent	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr13:53617269G>A	ENST00000219022.2	+	4	678	c.600G>A	c.(598-600)aaG>aaA	p.K200K		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	200					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		TGGTAGAGAAGCTTGAGACAC	0.383																																					p.K200K		Atlas-SNP	.											.	OLFM4	94	.	0			c.G600A						.						101.0	99.0	100.0					13																	53617269		2203	4300	6503	SO:0001819	synonymous_variant	10562	exon4			AGAGAAGCTTGAG	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.600G>A	chr13.hg19:g.53617269G>A		104.0	0.0		119.0	13.0	NM_006418	O95362|Q5VWG0|Q86T22	Silent	SNP	ENST00000219022.2	hg19	CCDS9440.1																																																																																			.	.		0.383	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
PABPN1	8106	hgsc.bcm.edu	37	14	23793427	23793427	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr14:23793427C>T	ENST00000216727.4	+	6	991	c.810C>T	c.(808-810)acC>acT	p.T270T	BCL2L2-PABPN1_ENST00000553781.1_Silent_p.T297T|PABPN1_ENST00000397276.2_Silent_p.T270T|BCL2L2-PABPN1_ENST00000557008.1_Silent_p.T297T|PABPN1_ENST00000557702.1_Silent_p.T142T|AL049829.1_ENST00000594872.1_5'Flank|PABPN1_ENST00000556821.1_Silent_p.T142T	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	270	Necessary for homooligomerization.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GCGCCCGGACCACCAACTACA	0.567																																					p.T297T		Atlas-SNP	.											.	.	.	.	0			c.C891T						.						80.0	81.0	81.0					14																	23793427		2203	4300	6503	SO:0001819	synonymous_variant	100529063	exon8			CCGGACCACCAAC	AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.810C>T	chr14.hg19:g.23793427C>T		104.0	0.0		88.0	9.0	NM_001199864	D3DS49|O43484	Silent	SNP	ENST00000216727.4	hg19	CCDS9592.1	.	.	.	.	.	.	.	.	.	.	C	6.111	0.388659	0.11581	.	.	ENSG00000100836	ENST00000555295	.	.	.	5.47	0.998	0.19857	.	.	.	.	.	T	0.42832	0.1220	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23976	-1.0173	4	.	.	.	-10.4575	2.026	0.03519	0.1279:0.4064:0.1253:0.3404	.	.	.	.	Y	70	.	.	H	+	1	0	PABPN1	22863267	0.971000	0.33674	1.000000	0.80357	0.989000	0.77384	0.324000	0.19610	0.276000	0.22118	-0.150000	0.13652	CAC	.	.		0.567	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071767.4	NM_004643	
WHAMM	123720	hgsc.bcm.edu	37	15	83491939	83491939	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr15:83491939A>G	ENST00000286760.4	+	6	1457	c.1358A>G	c.(1357-1359)gAt>gGt	p.D453G		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	453	Mediates interaction with microtubules. {ECO:0000269|PubMed:23027905}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						CTGCAGGATGATAAGAATTTG	0.438																																					p.D453G		Atlas-SNP	.											.	WHAMM	63	.	0			c.A1358G						.						40.0	39.0	39.0					15																	83491939		1908	4134	6042	SO:0001583	missense	123720	exon6			AGGATGATAAGAA	AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.1358A>G	chr15.hg19:g.83491939A>G	ENSP00000286760:p.Asp453Gly	295.0	0.0		230.0	45.0	NM_001080435	Q8N1J9	Missense_Mutation	SNP	ENST00000286760.4	hg19	CCDS45333.1	.	.	.	.	.	.	.	.	.	.	A	9.868	1.198128	0.22037	.	.	ENSG00000156232	ENST00000286760;ENST00000234505	T	0.40756	1.02	4.97	-5.53	0.02552	.	2.108940	0.01699	N	0.027094	T	0.12050	0.0293	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08785	-1.0705	10	0.23302	T	0.38	.	0.6067	0.00753	0.3247:0.2919:0.1766:0.2069	.	453	Q8TF30	WHAMM_HUMAN	G	453	ENSP00000286760:D453G	ENSP00000234505:D453G	D	+	2	0	WHAMM	81288993	0.000000	0.05858	0.000000	0.03702	0.162000	0.22319	-0.620000	0.05565	-0.789000	0.04498	0.260000	0.18958	GAT	.	.		0.438	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418463.1		
KIF7	374654	hgsc.bcm.edu	37	15	90189142	90189142	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr15:90189142C>T	ENST00000394412.3	-	8	1980	c.1904G>A	c.(1903-1905)cGg>cAg	p.R635Q		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	635	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GTGTAAGGTCCGCCTGGGCGG	0.647																																					p.R635Q		Atlas-SNP	.											.	KIF7	130	.	0			c.G1904A						.						70.0	67.0	68.0					15																	90189142		2200	4299	6499	SO:0001583	missense	374654	exon8			AAGGTCCGCCTGG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.1904G>A	chr15.hg19:g.90189142C>T	ENSP00000377934:p.Arg635Gln	48.0	0.0		36.0	5.0	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	hg19	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	c	1.109	-0.658648	0.03454	.	.	ENSG00000166813	ENST00000394412	T	0.70631	-0.5	3.84	1.92	0.25849	.	1.363710	0.05123	N	0.491022	T	0.60702	0.2289	L	0.41236	1.265	0.21499	N	0.999665	B;B	0.24533	0.012;0.105	B;B	0.10450	0.002;0.005	T	0.43081	-0.9413	10	0.33141	T	0.24	.	6.976	0.24674	0.0:0.7844:0.0:0.2156	.	122;635	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	Q	635	ENSP00000377934:R635Q	ENSP00000377934:R635Q	R	-	2	0	KIF7	87990146	0.000000	0.05858	0.087000	0.20705	0.057000	0.15508	-0.688000	0.05150	0.381000	0.24851	-0.511000	0.04467	CGG	.	.		0.647	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
CLEC19A	728276	hgsc.bcm.edu	37	16	19310149	19310149	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr16:19310149C>T	ENST00000465414.1	+	2	316	c.243C>T	c.(241-243)gcC>gcT	p.A81A	CLEC19A_ENST00000493231.1_Silent_p.A81A			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A	81	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										CCAAGCTGGCCTCCATCCACA	0.537																																					p.A81A		Atlas-SNP	.											.	CLEC19A	4	.	0			c.C243T						.																																			SO:0001819	synonymous_variant	728276	exon2			GCTGGCCTCCATC			16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000465414.1:c.243C>T	chr16.hg19:g.19310149C>T		88.0	0.0		94.0	25.0	NM_001256720	Q0VF32	Silent	SNP	ENST00000465414.1	hg19																																																																																				.	.		0.537	CLEC19A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254277.2	NM_00125672	
SALL1	6299	hgsc.bcm.edu	37	16	51173341	51173341	+	Missense_Mutation	SNP	G	G	T	rs140924793		TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr16:51173341G>T	ENST00000251020.4	-	2	2825	c.2792C>A	c.(2791-2793)cCg>cAg	p.P931Q	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.P834Q	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	931					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GCTGTTGGACGGGGACAGAGC	0.557																																					p.P931Q	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.C2792A						.						92.0	76.0	81.0					16																	51173341		2198	4300	6498	SO:0001583	missense	6299	exon2			TTGGACGGGGACA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2792C>A	chr16.hg19:g.51173341G>T	ENSP00000251020:p.Pro931Gln	122.0	0.0		125.0	5.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	hg19	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833382	0.71258	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.79940	-1.32;-1.32	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.89777	0.6813	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86891	0.2048	10	0.21014	T	0.42	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	931	Q9NSC2	SALL1_HUMAN	Q	931;834;895	ENSP00000251020:P931Q;ENSP00000407914:P834Q	ENSP00000251020:P931Q	P	-	2	0	SALL1	49730842	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	9.869000	0.99810	2.557000	0.86248	0.455000	0.32223	CCG	.	G|1.000;A|0.000		0.557	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
PRPF8	10594	hgsc.bcm.edu	37	17	1564062	1564062	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr17:1564062C>A	ENST00000572621.1	-	28	4833	c.4568G>T	c.(4567-4569)cGa>cTa	p.R1523L	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1523L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1523	Important for branch point selection. {ECO:0000250}.|Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CAGTCCTGATCGCTGAGCATT	0.507																																					p.R1523L		Atlas-SNP	.											.	PRPF8	169	.	0			c.G4568T						.						141.0	125.0	130.0					17																	1564062		2203	4300	6503	SO:0001583	missense	10594	exon29			CCTGATCGCTGAG	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4568G>T	chr17.hg19:g.1564062C>A	ENSP00000460348:p.Arg1523Leu	112.0	0.0		128.0	22.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.077009	0.76415	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	D	0.82433	-1.61	6.17	6.17	0.99709	Pre-mRNA-processing-splicing factor 8, U6-snRNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92795	0.7709	M	0.87456	2.885	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.92691	0.6166	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1523	Q6P2Q9	PRP8_HUMAN	L	1523;50	ENSP00000304350:R1523L	ENSP00000304350:R1523L	R	-	2	0	PRPF8	1510812	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.712000	0.84684	2.941000	0.99782	0.655000	0.94253	CGA	.	.		0.507	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
TDRD12	91646	hgsc.bcm.edu	37	19	33233749	33233749	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr19:33233749A>G	ENST00000444215.2	+	4	703	c.383A>G	c.(382-384)tAc>tGc	p.Y128C	TDRD12_ENST00000421545.2_Missense_Mutation_p.Y128C			Q587J7	TDR12_HUMAN	tudor domain containing 12	128					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					TTCAGCCTGTACTGCACAAAG	0.378																																					p.Y128C		Atlas-SNP	.											.	TDRD12	23	.	0			c.A383G						.						152.0	127.0	135.0					19																	33233749		692	1591	2283	SO:0001583	missense	91646	exon4			GCCTGTACTGCAC	AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.383A>G	chr19.hg19:g.33233749A>G	ENSP00000416248:p.Tyr128Cys	210.0	0.0		209.0	39.0	NM_001110822		Missense_Mutation	SNP	ENST00000444215.2	hg19		.	.	.	.	.	.	.	.	.	.	A	7.534	0.659354	0.14645	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	T;T	0.09817	2.94;2.94	5.35	3.19	0.36642	Maternal tudor protein (1);	0.304797	0.28109	N	0.016574	T	0.22437	0.0541	L	0.56769	1.78	0.32638	N	0.521138	D;D	0.76494	0.994;0.999	P;D	0.64321	0.873;0.924	T	0.15178	-1.0446	10	0.38643	T	0.18	-10.6248	8.6997	0.34318	0.696:0.0:0.0:0.304	.	128;128	E9PAY0;Q587J7	.;TDR12_HUMAN	C	128	ENSP00000416248:Y128C;ENSP00000390621:Y128C	ENSP00000390621:Y128C	Y	+	2	0	TDRD12	37925589	0.897000	0.30589	0.263000	0.24496	0.101000	0.19017	1.946000	0.40283	0.298000	0.22638	-0.327000	0.08410	TAC	.	.		0.378	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435933.1	NM_001015890	
CYP2A13	1553	hgsc.bcm.edu	37	19	41600227	41600227	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr19:41600227T>C	ENST00000330436.3	+	7	1051	c.1051T>C	c.(1051-1053)Tac>Cac	p.Y351H		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	351					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CAAGATGCCCTACACAGAGGC	0.547																																					p.Y351H		Atlas-SNP	.											.	CYP2A13	90	.	0			c.T1051C						.						130.0	114.0	119.0					19																	41600227		2203	4300	6503	SO:0001583	missense	1553	exon7			ATGCCCTACACAG	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1051T>C	chr19.hg19:g.41600227T>C	ENSP00000332679:p.Tyr351His	215.0	0.0		212.0	39.0	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	hg19	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	18.14	3.556936	0.65425	.	.	ENSG00000197838	ENST00000330436	T	0.76186	-1.0	4.19	4.19	0.49359	.	0.070853	0.64402	U	0.000019	D	0.88894	0.6561	H	0.94582	3.555	0.37014	D	0.895864	D	0.89917	1.0	D	0.79784	0.993	D	0.93053	0.6467	10	0.87932	D	0	.	12.4075	0.55449	0.0:0.0:0.0:1.0	.	351	Q16696	CP2AD_HUMAN	H	351	ENSP00000332679:Y351H	ENSP00000332679:Y351H	Y	+	1	0	CYP2A13	46292067	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	7.644000	0.83416	1.783000	0.52377	0.254000	0.18369	TAC	.	.		0.547	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
AP2A1	160	hgsc.bcm.edu	37	19	50302171	50302171	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr19:50302171C>T	ENST00000359032.5	+	8	927	c.927C>T	c.(925-927)atC>atT	p.I309I	AP2A1_ENST00000354293.5_Silent_p.I309I	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	309					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		AGAACGCCATCCTCTTCGAGA	0.607																																					p.I309I		Atlas-SNP	.											.	AP2A1	108	.	0			c.C927T						.						31.0	34.0	33.0					19																	50302171		2037	4167	6204	SO:0001819	synonymous_variant	160	exon8			CGCCATCCTCTTC	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.927C>T	chr19.hg19:g.50302171C>T		104.0	0.0		90.0	17.0	NM_130787	Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	hg19	CCDS46148.1																																																																																			.	.		0.607	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
SNRPB	6628	hgsc.bcm.edu	37	20	2443295	2443295	+	Silent	SNP	G	G	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr20:2443295G>C	ENST00000438552.2	-	6	834	c.672C>G	c.(670-672)ccC>ccG	p.P224P	SNRPB_ENST00000339610.6_Silent_p.P145P|SNRPB_ENST00000381342.2_Silent_p.P224P|SNORD119_ENST00000515997.1_RNA	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	224	Repeat-rich region.				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						GCATCCCAGGGGGAGGAGGCC	0.572																																					p.P224P		Atlas-SNP	.											.	SNRPB	29	.	0			c.C672G						.						53.0	55.0	54.0					20																	2443295		2192	4284	6476	SO:0001819	synonymous_variant	6628	exon6			CCCAGGGGGAGGA		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.672C>G	chr20.hg19:g.2443295G>C		114.0	0.0		86.0	10.0	NM_003091	Q15490|Q6IB35|Q9UIS5	Silent	SNP	ENST00000438552.2	hg19	CCDS13026.1																																																																																			.	.		0.572	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077585.2		
WFDC8	90199	hgsc.bcm.edu	37	20	44181869	44181869	+	Silent	SNP	C	C	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr20:44181869C>T	ENST00000357199.4	-	5	570	c.492G>A	c.(490-492)gaG>gaA	p.E164E	WFDC8_ENST00000289953.2_Silent_p.E164E	NM_181510.2	NP_852611.2	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8	164	WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|stomach(1)|upper_aerodigestive_tract(1)	15		Myeloproliferative disorder(115;0.0122)				AAGGTGGACACTCCTTACGTT	0.498																																					p.E164E		Atlas-SNP	.											.	WFDC8	28	.	0			c.G492A						.						137.0	110.0	119.0					20																	44181869		2203	4300	6503	SO:0001819	synonymous_variant	90199	exon5			TGGACACTCCTTA	AL031663	CCDS13361.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000158901	ENSG00000158901		"""WAP four-disulfide core domain containing"""	16163	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 170"""	C20orf170		12206714	Standard	NM_130896		Approved	dJ461P17.1, WAP8	uc002xow.3	Q8IUA0	OTTHUMG00000046342	ENST00000357199.4:c.492G>A	chr20.hg19:g.44181869C>T		108.0	0.0		91.0	9.0	NM_181510	E1P623|Q5TDV2|Q96A34	Silent	SNP	ENST00000357199.4	hg19	CCDS13361.1																																																																																			.	.		0.498	WFDC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106958.1		
RBFOX2	23543	hgsc.bcm.edu	37	22	36164375	36164375	+	Missense_Mutation	SNP	C	C	T	rs199852787		TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr22:36164375C>T	ENST00000438146.2	-	6	684	c.685G>A	c.(685-687)Gag>Aag	p.E229K	RBFOX2_ENST00000262829.7_Missense_Mutation_p.E140K|RBFOX2_ENST00000359369.4_Missense_Mutation_p.E138K|RBFOX2_ENST00000449924.2_Missense_Mutation_p.E158K|RBFOX2_ENST00000416721.2_Missense_Mutation_p.E158K|RBFOX2_ENST00000414461.2_Missense_Mutation_p.E158K|RBFOX2_ENST00000405409.2_Missense_Mutation_p.E159K|RBFOX2_ENST00000397303.2_Missense_Mutation_p.E139K	NM_001082578.1|NM_001082579.1	NP_001076047|NP_001076048.1	O43251	RFOX2_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 2	168					dendrite morphogenesis (GO:0048813)|intracellular estrogen receptor signaling pathway (GO:0030520)|mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of cell proliferation (GO:0042127)|regulation of definitive erythrocyte differentiation (GO:0010724)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(4)|large_intestine(7)|lung(7)	18						GCACTATTCTCGAAAGTTACG	0.448																																					p.E229K		Atlas-SNP	.											RBFOX2_ENST00000438146,NS,carcinoma,0,2	RBFOX2	62	.	0			c.G685A						.						151.0	135.0	140.0					22																	36164375		2203	4300	6503	SO:0001583	missense	23543	exon6			TATTCTCGAAAGT	AL009266	CCDS13921.1, CCDS43013.1, CCDS46699.1, CCDS46700.1, CCDS46701.1	22q12-q13	2013-02-12	2010-09-10	2010-09-10	ENSG00000100320	ENSG00000100320		"""RNA binding motif (RRM) containing"""	9906	protein-coding gene	gene with protein product	"""hexaribonucleotide binding protein 2"""	612149	"""RNA binding motif protein 9"""	RBM9			Standard	NM_014309		Approved	HNRBP2, FOX-2, HRNBP2	uc003aon.4	O43251	OTTHUMG00000150585	ENST00000438146.2:c.685G>A	chr22.hg19:g.36164375C>T	ENSP00000413035:p.Glu229Lys	111.0	0.0		90.0	8.0	NM_001082578	A4F5G8|A8K5Z5|B0QYY8|B0QYY9|Q0PRL5|Q0VH35|Q5TF71|Q6IC09|Q8TD00|Q8WYB1|Q96DZ6|Q96NL7|Q9UGW4|Q9UH33	Missense_Mutation	SNP	ENST00000438146.2	hg19	CCDS43013.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946211	0.73672	.	.	ENSG00000100320	ENST00000405409;ENST00000338644;ENST00000414461;ENST00000449924;ENST00000262829;ENST00000397303;ENST00000359369;ENST00000416721;ENST00000438146;ENST00000408983	T;T;T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.27524	0.0676	N	0.12471	0.22	0.80722	D	1	D;D;D;D;P;B;B;B;B	0.76494	0.998;0.999;0.981;0.995;0.89;0.22;0.127;0.325;0.244	P;D;B;D;B;B;B;B;B	0.69142	0.838;0.962;0.379;0.956;0.258;0.119;0.039;0.119;0.104	T	0.16571	-1.0398	10	0.87932	D	0	.	20.3544	0.98835	0.0:1.0:0.0:0.0	.	138;228;229;140;158;159;158;158;139	B0QYY4;O43251-6;O43251-8;O43251-3;O43251-5;O43251-9;O43251-10;O43251-4;B0QYV1	.;.;.;.;.;.;.;.;.	K	159;168;158;158;140;139;138;158;229;181	ENSP00000384944:E159K;ENSP00000407855:E158K;ENSP00000391670:E158K;ENSP00000262829:E140K;ENSP00000380470:E139K;ENSP00000352328:E138K;ENSP00000405651:E158K;ENSP00000413035:E229K;ENSP00000386177:E181K	ENSP00000262829:E140K	E	-	1	0	RBFOX2	34494321	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.773000	0.85462	2.817000	0.96982	0.655000	0.94253	GAG	.	C|1.000;G|0.000		0.448	RBFOX2-005	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319299.3		
XRCC6	2547	hgsc.bcm.edu	37	22	42042966	42042966	+	Silent	SNP	T	T	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr22:42042966T>A	ENST00000359308.4	+	6	1495	c.840T>A	c.(838-840)gcT>gcA	p.A280A	XRCC6_ENST00000405878.1_Silent_p.A280A|XRCC6_ENST00000405506.1_Silent_p.A230A|XRCC6_ENST00000402580.3_Silent_p.A239A|XRCC6_ENST00000428575.2_Silent_p.A147A|Y_RNA_ENST00000363462.1_RNA|XRCC6_ENST00000360079.3_Silent_p.A280A			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	280	Ku.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						TCCAGAAGGCTCTCAAGCCTC	0.428								Non-homologous end-joining																													p.A280A		Atlas-SNP	.											.	XRCC6	64	.	0			c.T840A						.						119.0	129.0	126.0					22																	42042966		2203	4300	6503	SO:0001819	synonymous_variant	2547	exon7			GAAGGCTCTCAAG	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.840T>A	chr22.hg19:g.42042966T>A		137.0	0.0		153.0	47.0	NM_001469	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Silent	SNP	ENST00000359308.4	hg19	CCDS14021.1																																																																																			.	.		0.428	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469	
PCDH19	57526	hgsc.bcm.edu	37	X	99662112	99662112	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chrX:99662112G>A	ENST00000373034.4	-	1	3159	c.1484C>T	c.(1483-1485)tCg>tTg	p.S495L	PCDH19_ENST00000255531.7_Missense_Mutation_p.S495L|PCDH19_ENST00000420881.2_Missense_Mutation_p.S495L	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	495	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CCGCACCTGCGACGGCACGAT	0.597																																					p.S495L		Atlas-SNP	.											.	PCDH19	269	.	0			c.C1484T						.						86.0	87.0	87.0					X																	99662112		2129	4226	6355	SO:0001583	missense	57526	exon1			ACCTGCGACGGCA	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1484C>T	chrX.hg19:g.99662112G>A	ENSP00000362125:p.Ser495Leu	94.0	0.0		101.0	47.0	NM_001184880	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	hg19	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543562	0.65198	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.52526	0.66;0.66;0.66	5.64	5.64	0.86602	Cadherin (4);Cadherin-like (1);	0.128926	0.53938	D	0.000058	T	0.65144	0.2663	L	0.56124	1.755	0.58432	D	0.999999	D;D;D	0.76494	0.994;0.999;0.999	P;D;D	0.69479	0.891;0.939;0.964	T	0.64984	-0.6278	10	0.51188	T	0.08	.	18.6745	0.91524	0.0:0.0:1.0:0.0	.	495;495;495	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	L	495	ENSP00000400327:S495L;ENSP00000362125:S495L;ENSP00000255531:S495L	ENSP00000255531:S495L	S	-	2	0	PCDH19	99548768	1.000000	0.71417	0.714000	0.30535	0.992000	0.81027	6.216000	0.72212	2.354000	0.79902	0.513000	0.50165	TCG	.	.		0.597	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
MMGT1	93380	hgsc.bcm.edu	37	X	135049605	135049605	+	Silent	SNP	T	T	G			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chrX:135049605T>G	ENST00000305963.2	-	3	567	c.180A>C	c.(178-180)atA>atC	p.I60I	MMGT1_ENST00000433339.2_Silent_p.I125I	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	60					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						CAATATGAACTATACCGTAAC	0.323																																					p.I60I		Atlas-SNP	.											.	MMGT1	14	.	0			c.A180C						.						135.0	127.0	130.0					X																	135049605		2203	4300	6503	SO:0001819	synonymous_variant	93380	exon3			ATGAACTATACCG	AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.180A>C	chrX.hg19:g.135049605T>G		193.0	0.0		220.0	106.0	NM_173470	B2R625|B4DIY3|D3DWG7|Q5JPP7	Silent	SNP	ENST00000305963.2	hg19	CCDS14653.1																																																																																			.	.		0.323	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058453.3	NM_173470	
MT-CO1	4512	hgsc.bcm.edu	37	M	6177	6177	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chrM:6177A>T	ENST00000361624.2	+	1	274	c.274A>T	c.(274-276)Atg>Ttg	p.M92L	MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	92					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GTGCCCCCGATATGGCGTTTC	0.483																																					p.M92L		Atlas-SNP	.											.	.	.	.	0			c.A274T						.																																			SO:0001583	missense	5742	exon1			CCCGATATGGCGT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.274A>T	chrM.hg19:g.6177A>T	ENSP00000354499:p.Met92Leu	1196.0	0.0		794.0	59.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.483	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND4L	4539	hgsc.bcm.edu	37	M	10635	10635	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chrM:10635G>A	ENST00000361335.1	+	1	166	c.166G>A	c.(166-168)Gcc>Acc	p.A56T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	56					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						ACTCCCTCTTAGCCAATATTG	0.478																																					p.A56T		Atlas-SNP	.											.	.	.	.	0			c.G166A						.																																			SO:0001583	missense	0	exon1			CTCTTAGCCAATA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.166G>A	chrM.hg19:g.10635G>A	ENSP00000354728:p.Ala56Thr	1292.0	0.0		1001.0	56.0	ENST00000361335		Missense_Mutation	SNP	ENST00000361335.1	hg19																																																																																				.	.		0.478	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
MT-ND5	4540	hgsc.bcm.edu	37	M	12677	12677	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chrM:12677T>C	ENST00000361567.2	+	1	341	c.341T>C	c.(340-342)aTt>aCt	p.I114T	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	114					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AGACCCAAACATTAATCAGTT	0.368																																					p.I114T		Atlas-SNP	.											.	.	.	.	0			c.T341C						.																																			SO:0001583	missense	0	exon1			CAAACATTAATCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.341T>C	chrM.hg19:g.12677T>C	ENSP00000354813:p.Ile114Thr	1353.0	0.0		947.0	144.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.368	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MSH2	4436	hgsc.bcm.edu	37	2	47707967	47707993	+	In_Frame_Del	DEL	ATATCATGGAACCAGCAGCAAAGAAGT	ATATCATGGAACCAGCAGCAAAGAAGT	-	rs587780686|rs63750709|rs549759248|rs587782214|rs587779151|rs63751400|rs63750795|rs547695133	byFrequency	TCGA-DD-A1E9-01A-21D-A152-10	TCGA-DD-A1E9-11A-11D-A152-10	ATATCATGGAACCAGCAGCAAAGAAGT	ATATCATGGAACCAGCAGCAAAGAAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a0bc36-9f29-4b23-aee1-bf5ff71f697b	f37fe995-4af3-489f-988e-ca04430e4e57	g.chr2:47707967_47707993delATATCATGGAACCAGCAGCAAAGAAGT	ENST00000233146.2	+	15	2814_2840	c.2591_2617delATATCATGGAACCAGCAGCAAAGAAGT	c.(2590-2619)gatatcatggaaccagcagcaaagaagtgc>ggc	p.864_873DIMEPAAKKC>G	MSH2_ENST00000543555.1_In_Frame_Del_p.798_807DIMEPAAKKC>G|MSH2_ENST00000461394.1_3'UTR|MSH2_ENST00000406134.1_In_Frame_Del_p.864_873DIMEPAAKKC>G	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	864			A -> G (in gastric cancer; unknown pathological significance). {ECO:0000269|PubMed:12132870}.|C -> G (in gastric cancer; unknown pathological significance). {ECO:0000269|PubMed:12132870}.|P -> A (in gastric cancer; unknown pathological significance). {ECO:0000269|PubMed:12132870}.		ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)|p.E867E(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CAAGGATATGATATCATGGAACCAGCAGCAAAGAAGTGCTATCTGGA	0.374			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.864_872del		Atlas-Indel,Pindel	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	.	MSH2	198	.	5	Whole gene deletion(2)|Unknown(2)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)|kidney(1)	c.2590_2616del	GRCh37	CD011643|CM015041|CM015042|CM015043	MSH2	D|M		.																																			SO:0001651	inframe_deletion	4436	exon15	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	.	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.2591_2617delATATCATGGAACCAGCAGCAAAGAAGT	chr2.hg19:g.47707967_47707993delATATCATGGAACCAGCAGCAAAGAAGT	ENSP00000233146:p.Asp864_Cys873delinsGly	183.0	0.0		147.0	18.0	NM_000251	B4E2Z2|O75488	In_Frame_Del	DEL	ENST00000233146.2	hg19	CCDS1834.1																																																																																			.	.		0.374	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3		
