#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SHROOM3	57619	hgsc.bcm.edu	37	4	77677614	77677618	+	Frame_Shift_Del	DEL	TTCTA	TTCTA	-	rs139635179	byFrequency	TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	TTCTA	TTCTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr4:77677614_77677618delTTCTA	ENST00000296043.6	+	8	5675_5679	c.4722_4726delTTCTA	c.(4720-4728)ctttctaaafs	p.SK1575fs	RP11-359D14.3_ENST00000449007.1_RNA|RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1575					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TCAACAAACTTTCTAAAGTGACAAT	0.424																																					p.1574_1575del		.	.											.	SHROOM3	.	.	0			c.4721_4725del						.																																			SO:0001589	frameshift_variant	57619	exon8			.	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4722_4726delTTCTA	4.37:g.77677614_77677618delTTCTA	ENSP00000296043:p.Ser1575fs	127.0	0.0		131.0	19.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Del	DEL	ENST00000296043.6	37	CCDS3579.2																																																																																			.	.		0.424	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
C1orf68	100129271	hgsc.bcm.edu	37	1	152692135	152692135	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:152692135delC	ENST00000368775.2	+	1	138	c.138delC	c.(136-138)ggcfs	p.G46fs		NM_001024679.2	NP_001019850.1	Q5T750	XP32_HUMAN	chromosome 1 open reading frame 68	46	Cys-rich.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|lung(2)|prostate(1)|stomach(3)	8						GTGTGACAGGCCCTGCTCCAT	0.542																																					p.G46fs		.	.											.	C1orf68	.	.	0			c.137delG						.						134.0	131.0	132.0					1																	152692135		692	1591	2283	SO:0001589	frameshift_variant	100129271	exon1			.	AF005081	CCDS44226.1	1q21.3	2014-05-30			ENSG00000198854	ENSG00000198854			29468	protein-coding gene	gene with protein product						11698679	Standard	NM_001024679		Approved	LEP7	uc010pdu.2	Q5T750	OTTHUMG00000012401	ENST00000368775.2:c.138delC	1.37:g.152692135delC	ENSP00000357764:p.Gly46fs	209.0	0.0		241.0	61.0	NM_001024679	O14634	Frame_Shift_Del	DEL	ENST00000368775.2	37	CCDS44226.1																																																																																			.	.		0.542	C1orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034521.2	NM_001024679	
ABCA6	23460	hgsc.bcm.edu	37	17	67110945	67110945	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:67110945delA	ENST00000284425.2	-	13	1914	c.1740delT	c.(1738-1740)tttfs	p.F580fs		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	580	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTATTTTAGCAAACAGGCTGA	0.403																																					p.A581fs		.	.											.	ABCA6	.	.	0			c.1741delG						.						184.0	163.0	170.0					17																	67110945		2203	4300	6503	SO:0001589	frameshift_variant	23460	exon13			.	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1740delT	17.37:g.67110945delA	ENSP00000284425:p.Phe580fs	194.0	0.0		286.0	81.0	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Frame_Shift_Del	DEL	ENST00000284425.2	37	CCDS11683.1																																																																																			.	.		0.403	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
PI4KB	5298	hgsc.bcm.edu	37	1	151262327	151262328	+	IGR	INS	-	-	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:151262327_151262328insC	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Frame_Shift_Ins_p.P937fs			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCTCCCCTGAGCCCCCCCGTCC	0.649																																					p.E936fs	Colon(154;765 1838 9854 28443 37492)	.	.											.	ZNF687	.	.	0			c.2808_2809insC						.																																			SO:0001628	intergenic_variant	57592	exon6			.	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151262334_151262334dupC		94.0	0.0		105.0	17.0	NM_020832	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Frame_Shift_Ins	INS	ENST00000368873.1	37																																																																																				.	.		0.649	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
FAM63A	55793	hgsc.bcm.edu	37	1	150974678	150974679	+	In_Frame_Ins	INS	-	-	GAG			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:150974678_150974679insGAG	ENST00000361936.5	-	3	1369_1370	c.415_416insCTC	c.(415-417)ctc>cCTCtc	p.138_139insP	FAM63A_ENST00000312210.5_5'UTR|FAM63A_ENST00000361738.6_In_Frame_Ins_p.186_187insP|FAM63A_ENST00000470877.1_Intron|FAM63A_ENST00000493834.2_In_Frame_Ins_p.43_44insP	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A	138						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GATGGCAAGGAGAGGGCAAGGG	0.495																																					p.L187delinsPL		.	.											.	FAM63A	.	.	0			c.560_561insCTC						.																																			SO:0001652	inframe_insertion	55793	exon3			.	BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.416_418dupCTC	1.37:g.150974679_150974681dupGAG	ENSP00000354814:p.Pro138_Pro138dup	197.0	0.0		270.0	62.0	NM_001163258	B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	In_Frame_Ins	INS	ENST00000361936.5	37	CCDS976.1																																																																																			.	.		0.495	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411753.1	NM_018379	
KCNT2	343450	hgsc.bcm.edu	37	1	196274453	196274458	+	In_Frame_Del	DEL	TAATAC	TAATAC	-			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	TAATAC	TAATAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:196274453_196274458delTAATAC	ENST00000294725.9	-	22	3416_3421	c.2501_2506delGTATTA	c.(2500-2508)agtattatc>atc	p.SI834del	KCNT2_ENST00000367433.5_In_Frame_Del_p.SI810del|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_In_Frame_Del_p.SI760del|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000367431.4_In_Frame_Del_p.SI760del			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	834					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AGCTCTGTGATAATACTGAGACTGGA	0.364																																					p.834_836del		.	.											.	KCNT2	.	.	0			c.2502_2507del						.																																			SO:0001651	inframe_deletion	343450	exon22			.	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2501_2506delGTATTA	1.37:g.196274453_196274458delTAATAC	ENSP00000294725:p.Ser834_Ile835del	84.0	0.0		106.0	17.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	In_Frame_Del	DEL	ENST00000294725.9	37	CCDS1384.1																																																																																			.	.		0.364	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
MICAL1	64780	hgsc.bcm.edu	37	6	109768571	109768571	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr6:109768571G>A	ENST00000358807.3	-	16	2370	c.2059C>T	c.(2059-2061)Caa>Taa	p.Q687*	MICAL1_ENST00000368952.4_Nonsense_Mutation_p.Q706*|MICAL1_ENST00000358577.3_Nonsense_Mutation_p.Q601*	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	687					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		TCCTGGTGTTGGGATGGGGGT	0.627																																					p.Q687X		.	.											.	MICAL1	.	.	0			c.C2059T						.						65.0	65.0	65.0					6																	109768571		2203	4300	6503	SO:0001587	stop_gained	64780	exon16			GGTGTTGGGATGG	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2059C>T	6.37:g.109768571G>A	ENSP00000351664:p.Gln687*	82.0	0.0		93.0	13.0	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Nonsense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.683992|5.683992	0.96774|0.96774	.|.	.|.	ENSG00000135596|ENSG00000135596	ENST00000433205|ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957	.|.	.|.	.|.	4.93|4.93	1.88|1.88	0.25563|0.25563	.|.	.|1.121610	.|0.06568	.|N	.|0.747923	T|.	0.10551|.	0.0258|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.08106|.	-1.0738|.	3|.	.|0.06494	.|T	.|0.89	.|.	12.4069|12.4069	0.55445|0.55445	0.0:0.5319:0.4681:0.0|0.0:0.5319:0.4681:0.0	.|.	.|.	.|.	.|.	L|X	248|687;706;601;211	.|.	.|ENSP00000351385:Q601X	P|Q	-|-	2|1	0|0	MICAL1|MICAL1	109875264|109875264	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.619000|0.619000	0.37552|0.37552	-0.164000|-0.164000	0.09983|0.09983	0.733000|0.733000	0.32492|0.32492	0.655000|0.655000	0.94253|0.94253	CCA|CAA	.	.		0.627	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
CLSTN3	9746	hgsc.bcm.edu	37	12	7281340	7281340	+	5'Flank	SNP	A	A	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:7281340A>T	ENST00000266546.6	+	0	0				RP11-273B20.1_ENST00000538062.1_RNA|RBP5_ENST00000266560.3_Missense_Mutation_p.F11Y|RP11-273B20.1_ENST00000544657.1_RNA|RBP5_ENST00000542370.1_Missense_Mutation_p.F11Y	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CTGCGAGACAAAGCGGTAGTA	0.562																																					p.F11Y		.	.											.	RBP5	.	.	0			c.T32A						.						127.0	99.0	109.0					12																	7281340		2203	4300	6503	SO:0001631	upstream_gene_variant	83758	exon1			GAGACAAAGCGGT	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281340A>T	Exception_encountered	223.0	0.0		296.0	73.0	NM_031491	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.161222	0.38119	.	.	ENSG00000139194	ENST00000266560;ENST00000542370	T;T	0.22134	1.97;1.97	2.86	2.86	0.33363	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.329652	0.35067	N	0.003464	T	0.25494	0.0620	M	0.71581	2.175	0.45439	D	0.998415	P	0.46457	0.878	B	0.41946	0.371	T	0.23440	-1.0188	10	0.87932	D	0	.	11.8957	0.52656	1.0:0.0:0.0:0.0	.	11	P82980	RET5_HUMAN	Y	11	ENSP00000266560:F11Y;ENSP00000438083:F11Y	ENSP00000266560:F11Y	F	-	2	0	RBP5	7172607	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	2.915000	0.48805	1.549000	0.49425	0.402000	0.26972	TTT	.	.		0.562	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
ZNF596	169270	hgsc.bcm.edu	37	8	195803	195803	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:195803G>A	ENST00000398612.1	+	6	1339	c.956G>A	c.(955-957)tGt>tAt	p.C319Y	ZNF596_ENST00000320552.2_Missense_Mutation_p.C249Y|ZNF596_ENST00000308811.4_Missense_Mutation_p.C319Y	NM_001042415.1|NM_001042416.1	NP_001035880.1|NP_001035881.1	Q8TC21	ZN596_HUMAN	zinc finger protein 596	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(5)	14		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		TTCAGTAAATGTTCTTACCTT	0.388																																					p.C319Y		.	.											.	ZNF596	.	.	0			c.G956A						.						51.0	51.0	51.0					8																	195803		2203	4300	6503	SO:0001583	missense	169270	exon6			GTAAATGTTCTTA	BC026190	CCDS5951.2	8p23.3	2013-01-08			ENSG00000172748	ENSG00000172748		"""Zinc fingers, C2H2-type"", ""-"""	27268	protein-coding gene	gene with protein product						12477932	Standard	NM_001287256		Approved		uc003wot.3	Q8TC21	OTTHUMG00000086931	ENST00000398612.1:c.956G>A	8.37:g.195803G>A	ENSP00000381613:p.Cys319Tyr	116.0	0.0		149.0	54.0	NM_173539	B2R8P4|O95015|Q8N9X0	Missense_Mutation	SNP	ENST00000398612.1	37	CCDS5951.2	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.165931	0.00318	.	.	ENSG00000172748	ENST00000308811;ENST00000320552;ENST00000398612	T;T;T	0.14516	2.5;3.21;2.5	2.62	-1.9	0.07665	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04907	0.0132	N	0.20685	0.6	0.09310	N	1	P	0.47302	0.893	B	0.39738	0.308	T	0.16867	-1.0388	9	0.02654	T	1	.	1.4284	0.02328	0.2628:0.3827:0.2178:0.1367	.	319	Q8TC21	ZN596_HUMAN	Y	319;249;319	ENSP00000310033:C319Y;ENSP00000318719:C249Y;ENSP00000381613:C319Y	ENSP00000310033:C319Y	C	+	2	0	ZNF596	185803	0.000000	0.05858	0.000000	0.03702	0.973000	0.67179	-2.420000	0.01032	-0.474000	0.06862	0.585000	0.79938	TGT	.	.		0.388	ZNF596-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195858.4	NM_173539	
AK7	122481	hgsc.bcm.edu	37	14	96875279	96875279	+	Splice_Site	SNP	G	G	A	rs377123131		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr14:96875279G>A	ENST00000267584.4	+	4	542		c.e4+1		AK7_ENST00000554313.1_Splice_Site	NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7						axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		CCTGGACCCCGTAAGTAGAGC	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19210	0.0		0.001	False		,,,				2504	0.0				.		.	.											.	AK7	.	.	0			c.498+1G>A						.	G		0,4406		0,0,2203	66.0	65.0	66.0			4.9	0.7	14		66	1,8599	1.2+/-3.3	0,1,4299	no	splice-5	AK7	NM_152327.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077			96875279	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	122481	exon4			GACCCCGTAAGTA	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.498+1G>A	14.37:g.96875279G>A		77.0	0.0		61.0	8.0	NM_152327	Q8IYP6	Splice_Site	SNP	ENST00000267584.4	37	CCDS9945.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.150997	0.57151	0.0	1.16E-4	ENSG00000140057	ENST00000267584	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3768	0.74610	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AK7	95945032	1.000000	0.71417	0.733000	0.30861	0.687000	0.40016	6.236000	0.72339	2.432000	0.82394	0.655000	0.94253	.	.	.		0.473	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1		Intron
CD300LG	146894	hgsc.bcm.edu	37	17	41932594	41932594	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:41932594C>T	ENST00000317310.4	+	5	780	c.739C>T	c.(739-741)Cgc>Tgc	p.R247C	CD300LG_ENST00000586233.1_Missense_Mutation_p.R162C|CD300LG_ENST00000539718.1_Missense_Mutation_p.R247C|CD300LG_ENST00000377203.4_Missense_Mutation_p.R213C|CD300LG_ENST00000293396.8_Missense_Mutation_p.R162C	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	247					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCCGATGGTCCGCATACTGGC	0.607																																					p.R247C		.	.											.	CD300LG	.	.	0			c.C739T						.						49.0	36.0	41.0					17																	41932594		2203	4299	6502	SO:0001583	missense	146894	exon5			ATGGTCCGCATAC	BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.739C>T	17.37:g.41932594C>T	ENSP00000321005:p.Arg247Cys	60.0	0.0		116.0	25.0	NM_145273	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Missense_Mutation	SNP	ENST00000317310.4	37	CCDS11470.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722740	0.68959	.	.	ENSG00000161649	ENST00000317310;ENST00000539718;ENST00000377203;ENST00000293396	T;T;T;T	0.17213	2.36;2.29;2.99;3.51	3.91	3.91	0.45181	.	0.138905	0.34046	N	0.004305	T	0.32585	0.0834	L	0.47190	1.495	0.40040	D	0.975638	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.988;0.996;0.988;0.974;0.997	T	0.04593	-1.0940	10	0.87932	D	0	-0.6434	11.7259	0.51710	0.0:1.0:0.0:0.0	.	213;162;247;247;162	F8W9M3;Q6UXG3-3;F5H7P9;Q6UXG3;Q6UXG3-2	.;.;.;CLM9_HUMAN;.	C	247;247;213;162	ENSP00000321005:R247C;ENSP00000442368:R247C;ENSP00000366408:R213C;ENSP00000293396:R162C	ENSP00000293396:R162C	R	+	1	0	CD300LG	39288120	0.201000	0.23410	0.738000	0.30950	0.240000	0.25518	1.213000	0.32407	2.484000	0.83849	0.561000	0.74099	CGC	.	.		0.607	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457646.1	NM_145273	
SLAMF6	114836	hgsc.bcm.edu	37	1	160461021	160461021	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:160461021A>G	ENST00000368057.3	-	3	600	c.540T>C	c.(538-540)acT>acC	p.T180T	SLAMF6_ENST00000368059.3_Silent_p.T180T|SLAMF6_ENST00000368055.1_Silent_p.T69T			Q96DU3	SLAF6_HUMAN	SLAM family member 6	180	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			CCCAGGAGACAGTGAGGTTTG	0.493																																					p.T180T		.	.											.	SLAMF6	.	.	0			c.T540C						.						148.0	139.0	142.0					1																	160461021		2203	4300	6503	SO:0001819	synonymous_variant	114836	exon3			GGAGACAGTGAGG	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.540T>C	1.37:g.160461021A>G		181.0	0.0		238.0	71.0	NM_052931	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Silent	SNP	ENST00000368057.3	37	CCDS53394.1																																																																																			.	.		0.493	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931	
KCNJ8	3764	hgsc.bcm.edu	37	12	21926286	21926286	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:21926286T>C	ENST00000240662.2	-	2	610	c.265A>G	c.(265-267)Atc>Gtc	p.I89V		NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	89					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	CACCACATGATAGCGAAGAGC	0.517											OREG0021704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I89V		.	.											.	KCNJ8	.	.	0			c.A265G						.						139.0	117.0	125.0					12																	21926286		2203	4300	6503	SO:0001583	missense	3764	exon2			ACATGATAGCGAA	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.265A>G	12.37:g.21926286T>C	ENSP00000240662:p.Ile89Val	75.0	0.0	752	126.0	15.0	NM_004982	O00657	Missense_Mutation	SNP	ENST00000240662.2	37	CCDS8692.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849044	0.32699	.	.	ENSG00000121361	ENST00000240662;ENST00000539350;ENST00000537950	D;D	0.95622	-3.76;-3.76	4.44	4.44	0.53790	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.051415	0.85682	D	0.000000	D	0.87434	0.6176	N	0.04669	-0.19	0.40690	D	0.982383	B	0.02656	0.0	B	0.04013	0.001	D	0.83479	0.0063	10	0.20046	T	0.44	.	13.8791	0.63672	0.0:0.0:0.0:1.0	.	89	Q15842	IRK8_HUMAN	V	89	ENSP00000240662:I89V;ENSP00000440012:I89V	ENSP00000240662:I89V	I	-	1	0	KCNJ8	21817553	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.854000	0.86942	1.868000	0.54150	0.383000	0.25322	ATC	.	.		0.517	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982	
LNPEP	4012	hgsc.bcm.edu	37	5	96358073	96358073	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:96358073A>G	ENST00000231368.5	+	14	3138	c.2446A>G	c.(2446-2448)Atg>Gtg	p.M816V	LNPEP_ENST00000395770.3_Missense_Mutation_p.M802V	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	816					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CACTCCATCTATGCGAGAGCT	0.438																																					p.M816V		.	.											.	LNPEP	.	.	0			c.A2446G						.						102.0	96.0	98.0					5																	96358073		2203	4300	6503	SO:0001583	missense	4012	exon14			CCATCTATGCGAG	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2446A>G	5.37:g.96358073A>G	ENSP00000231368:p.Met816Val	101.0	0.0		189.0	54.0	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.777424	0.31411	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.05025	3.51;3.51	5.9	-5.49	0.02584	.	0.693069	0.16311	N	0.220005	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25047	-1.0143	10	0.51188	T	0.08	.	17.7054	0.88308	0.2421:0.0:0.7579:0.0	.	816	Q9UIQ6	LCAP_HUMAN	V	816;802	ENSP00000231368:M816V;ENSP00000379117:M802V	ENSP00000231368:M816V	M	+	1	0	LNPEP	96383829	0.009000	0.17119	0.009000	0.14445	0.796000	0.44982	-0.148000	0.10219	-1.068000	0.03156	-0.256000	0.11100	ATG	.	.		0.438	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
SLITRK2	84631	hgsc.bcm.edu	37	X	144904543	144904543	+	Silent	SNP	C	C	A	rs377679182		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chrX:144904543C>A	ENST00000370490.1	+	1	4855	c.600C>A	c.(598-600)ggC>ggA	p.G200G	SLITRK2_ENST00000447897.2_Silent_p.G200G|SLITRK2_ENST00000428560.2_Silent_p.G200G|SLITRK2_ENST00000413937.2_Silent_p.G200G|SLITRK2_ENST00000434188.2_Silent_p.G200G			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	200					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTTGCTGGCGTCCTTGAAC	0.488																																					p.G200G		.	.											.	SLITRK2	.	.	0			c.C600A						.	C	,,,,,,,	1,3834		0,1,1631,571	141.0	125.0	130.0		600,600,600,600,600,600,600,600	-10.0	0.0	X		130	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLITRK2	NM_001144003.2,NM_001144004.2,NM_001144005.2,NM_001144006.2,NM_001144008.2,NM_001144009.2,NM_001144010.2,NM_032539.4	,,,,,,,	0,1,4059,2443	AA,AC,CC,C		0.0,0.0261,0.0095	,,,,,,,	200/846,200/846,200/846,200/846,200/846,200/846,200/846,200/846	144904543	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	84631	exon5			TGCTGGCGTCCTT	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.600C>A	X.37:g.144904543C>A		78.0	0.0		93.0	37.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	CCDS14680.1																																																																																			.	.		0.488	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
IL12RB2	3595	hgsc.bcm.edu	37	1	67787396	67787396	+	Missense_Mutation	SNP	C	C	A	rs149868445	byFrequency	TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:67787396C>A	ENST00000262345.1	+	3	828	c.188C>A	c.(187-189)tCc>tAc	p.S63Y	IL12RB2_ENST00000371000.1_Missense_Mutation_p.S63Y|IL12RB2_ENST00000541374.1_Missense_Mutation_p.S63Y|IL12RB2_ENST00000544434.1_Missense_Mutation_p.S63Y	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	63					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						TTTCACTATTCCAGACGTAAC	0.433																																					p.S63Y		.	.											.	IL12RB2	.	.	0			c.C188A						.						146.0	138.0	141.0					1																	67787396		2203	4300	6503	SO:0001583	missense	3595	exon3			ACTATTCCAGACG	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.188C>A	1.37:g.67787396C>A	ENSP00000262345:p.Ser63Tyr	185.0	0.0		204.0	65.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082057	0.55861	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21	5.11	5.11	0.69529	Immunoglobulin C2-set-like, ligand-binding (1);	0.644323	0.17020	N	0.190164	T	0.65821	0.2728	L	0.29908	0.895	0.09310	N	1	B;D;D;D	0.71674	0.171;0.998;0.975;0.995	B;D;P;D	0.65443	0.128;0.935;0.743;0.934	T	0.56565	-0.7958	10	0.02654	T	1	-0.6441	13.9166	0.63902	0.0:1.0:0.0:0.0	.	63;63;63;63	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	Y	63	ENSP00000262345:S63Y;ENSP00000360039:S63Y;ENSP00000445276:S63Y;ENSP00000442443:S63Y	ENSP00000262345:S63Y	S	+	2	0	IL12RB2	67559984	0.017000	0.18338	0.691000	0.30163	0.016000	0.09150	3.545000	0.53648	2.657000	0.90304	0.650000	0.86243	TCC	C|1.000;T|0.000	.		0.433	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
BCL11A	53335	hgsc.bcm.edu	37	2	60688821	60688821	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:60688821A>C	ENST00000335712.6	-	4	1453	c.1226T>G	c.(1225-1227)cTg>cGg	p.L409R	BCL11A_ENST00000538214.1_Missense_Mutation_p.L375R|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.L375R|BCL11A_ENST00000356842.4_Missense_Mutation_p.L409R|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000537768.1_Missense_Mutation_p.L78R	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	409					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GTGGTCGCACAGGTTGCACTT	0.597			T	IGH@	B-CLL																																p.L409R		.	.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	.	.	0			c.T1226G						.						97.0	92.0	94.0					2																	60688821		2203	4300	6503	SO:0001583	missense	53335	exon4			TCGCACAGGTTGC	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1226T>G	2.37:g.60688821A>C	ENSP00000338774:p.Leu409Arg	118.0	0.0		132.0	29.0	NM_018014	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.113028	0.37242	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.20881	3.01;3.01;2.04;2.04;2.04	5.54	5.54	0.83059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.083845	0.49305	D	0.000150	T	0.31136	0.0787	N	0.25201	0.72	0.80722	D	1	D;D;D;D;D	0.89917	0.973;0.998;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.941;0.951;0.998;0.996;0.993	T	0.06643	-1.0815	10	0.18710	T	0.47	-1.1401	15.6768	0.77332	1.0:0.0:0.0:0.0	.	375;78;375;409;409	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	R	409;445;375;78;409;375	ENSP00000349300:L409R;ENSP00000438303:L375R;ENSP00000443712:L78R;ENSP00000338774:L409R;ENSP00000351307:L375R	ENSP00000338774:L409R	L	-	2	0	BCL11A	60542325	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.306000	0.78905	2.110000	0.64415	0.533000	0.62120	CTG	.	.		0.597	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
ZCCHC2	54877	hgsc.bcm.edu	37	18	60242702	60242702	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr18:60242702A>C	ENST00000269499.5	+	13	3806	c.3388A>C	c.(3388-3390)Aat>Cat	p.N1130H	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.N809H	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1130						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GAAGAATGGGAATGTCTCATG	0.483																																					p.N1130H		.	.											.	ZCCHC2	.	.	0			c.A3388C						.						121.0	119.0	119.0					18																	60242702		2000	4184	6184	SO:0001583	missense	54877	exon13			AATGGGAATGTCT	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.3388A>C	18.37:g.60242702A>C	ENSP00000269499:p.Asn1130His	125.0	0.0		197.0	55.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	A	18.18	3.567109	0.65651	.	.	ENSG00000141664	ENST00000269499	T	0.77489	-1.1	5.57	5.57	0.84162	Zinc finger, CCHC retroviral-type (1);	0.335440	0.29459	N	0.012089	T	0.82245	0.4995	M	0.65498	2.005	0.52099	D	0.999944	P	0.47409	0.895	P	0.49708	0.62	D	0.84692	0.0723	10	0.87932	D	0	-3.8166	16.0262	0.80548	1.0:0.0:0.0:0.0	.	1130	Q9C0B9	ZCHC2_HUMAN	H	1130	ENSP00000269499:N1130H	ENSP00000269499:N1130H	N	+	1	0	ZCCHC2	58393682	1.000000	0.71417	0.125000	0.21846	0.982000	0.71751	8.372000	0.90127	2.243000	0.73865	0.533000	0.62120	AAT	.	.		0.483	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
MROH2B	133558	hgsc.bcm.edu	37	5	41065451	41065451	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:41065451C>T	ENST00000399564.4	-	4	793	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	115																	GTTGCCAATTCAGCCAGGGCA	0.418																																					p.E115K		.	.											.	.	.	.	0			c.G343A						.						64.0	60.0	61.0					5																	41065451		1899	4119	6018	SO:0001583	missense	133558	exon4			CCAATTCAGCCAG		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.343G>A	5.37:g.41065451C>T	ENSP00000382476:p.Glu115Lys	47.0	0.0		80.0	10.0	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466823	0.43839	.	.	ENSG00000171495	ENST00000399564	T	0.04194	3.68	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.56097	D	0.000024	T	0.09992	0.0245	N	0.25286	0.73	0.37279	D	0.90774	D	0.69078	0.997	D	0.64042	0.921	T	0.47262	-0.9131	10	0.15952	T	0.53	.	16.3599	0.83257	0.0:1.0:0.0:0.0	.	115	Q7Z745	HTRB2_HUMAN	K	115	ENSP00000382476:E115K	ENSP00000382476:E115K	E	-	1	0	HEATR7B2	41101208	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.337000	0.43947	2.937000	0.99478	0.650000	0.86243	GAA	.	.		0.418	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
ASRGL1	80150	hgsc.bcm.edu	37	11	62159568	62159568	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:62159568G>A	ENST00000415229.2	+	7	954	c.739G>A	c.(739-741)Gct>Act	p.A247T	CTD-2531D15.5_ENST00000526045.1_RNA|ASRGL1_ENST00000301776.5_Missense_Mutation_p.A247T	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	247					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	GGTAGAAGAGGCTGCGGACCT	0.453											OREG0021023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A247T		.	.											.	ASRGL1	.	.	0			c.G739A						.						123.0	121.0	122.0					11																	62159568		2202	4299	6501	SO:0001583	missense	80150	exon7			GAAGAGGCTGCGG		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.739G>A	11.37:g.62159568G>A	ENSP00000400057:p.Ala247Thr	88.0	0.0	1059	142.0	28.0	NM_001083926	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	ENST00000415229.2	37	CCDS8019.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994551	0.93167	.	.	ENSG00000162174	ENST00000415229;ENST00000301776	D;D	0.89050	-2.46;-2.46	5.24	5.24	0.73138	.	0.050242	0.85682	D	0.000000	D	0.96346	0.8808	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97615	1.0132	10	0.87932	D	0	-19.3664	16.3389	0.83075	0.0:0.0:1.0:0.0	.	247	Q7L266	ASGL1_HUMAN	T	247	ENSP00000400057:A247T;ENSP00000301776:A247T	ENSP00000301776:A247T	A	+	1	0	ASRGL1	61916144	1.000000	0.71417	0.977000	0.42913	0.949000	0.60115	8.389000	0.90172	2.424000	0.82194	0.655000	0.94253	GCT	.	.		0.453	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394865.1	NM_001083926	
TMEM106C	79022	hgsc.bcm.edu	37	12	48359720	48359720	+	Silent	SNP	C	C	T	rs370706223		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:48359720C>T	ENST00000429772.2	+	4	464	c.351C>T	c.(349-351)ggC>ggT	p.G117G	TMEM106C_ENST00000550552.1_Silent_p.G117G|TMEM106C_ENST00000552561.1_Silent_p.G117G|TMEM106C_ENST00000552546.1_Silent_p.G46G|TMEM106C_ENST00000449758.2_Silent_p.G117G|TMEM106C_ENST00000256686.6_Silent_p.G117G|TMEM106C_ENST00000549288.1_Intron	NM_001143842.1	NP_001137314.1	Q9BVX2	T106C_HUMAN	transmembrane protein 106C	117						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(13;0.11)		GBM - Glioblastoma multiforme(48;0.241)		ATGATGACGGCATCAAAGTGG	0.468																																					p.G117G		.	.											.	TMEM106C	.	.	0			c.C351T						.						316.0	284.0	295.0					12																	48359720		2203	4300	6503	SO:0001819	synonymous_variant	79022	exon4			TGACGGCATCAAA	BC000854	CCDS8758.1, CCDS44867.1	12q13.1	2005-12-19				ENSG00000134291			28775	protein-coding gene	gene with protein product							Standard	NM_024056		Approved	MGC5576	uc001rqr.3	Q9BVX2	OTTHUMG00000169892	ENST00000429772.2:c.351C>T	12.37:g.48359720C>T		453.0	0.0		740.0	47.0	NM_001143843	B2R998|B7Z5M4|Q3B761	Silent	SNP	ENST00000429772.2	37	CCDS8758.1	.	.	.	.	.	.	.	.	.	.	C	9.155	1.017150	0.19355	.	.	ENSG00000134291	ENST00000547682	.	.	.	4.48	1.63	0.23807	.	.	.	.	.	T	0.53498	0.1800	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42816	-0.9429	4	.	.	.	-5.8902	6.0324	0.19686	0.0:0.5351:0.2999:0.165	.	.	.	.	Y	4	.	.	H	+	1	0	TMEM106C	46645987	0.919000	0.31177	0.976000	0.42696	0.952000	0.60782	-0.035000	0.12205	0.381000	0.24851	-0.175000	0.13238	CAT	.	.		0.468	TMEM106C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406452.1	NM_024056	
OR5B12	390191	hgsc.bcm.edu	37	11	58207461	58207461	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:58207461G>T	ENST00000302572.2	-	1	185	c.164C>A	c.(163-165)aCc>aAc	p.T55N		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTACATGGGGGTGTGGAGACA	0.488																																					p.T55N		.	.											.	OR5B12	.	.	0			c.C164A						.						65.0	70.0	69.0					11																	58207461		2201	4295	6496	SO:0001583	missense	390191	exon1			ATGGGGGTGTGGA	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.164C>A	11.37:g.58207461G>T	ENSP00000306657:p.Thr55Asn	102.0	0.0		178.0	47.0	NM_001004733	B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	G	3.547	-0.092466	0.07053	.	.	ENSG00000172362	ENST00000302572	T	0.00478	7.13	4.61	2.71	0.32032	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000386	T	0.00608	0.0020	M	0.87456	2.885	0.09310	N	0.999996	B	0.21225	0.053	B	0.24394	0.053	T	0.41378	-0.9512	10	0.56958	D	0.05	-5.6865	5.8948	0.18933	0.078:0.1357:0.6461:0.1402	.	55	Q96R08	OR5BC_HUMAN	N	55	ENSP00000306657:T55N	ENSP00000306657:T55N	T	-	2	0	OR5B12	57964037	0.001000	0.12720	0.422000	0.26621	0.035000	0.12851	-0.061000	0.11693	0.660000	0.30964	0.462000	0.41574	ACC	.	.		0.488	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733	
NPFF	8620	hgsc.bcm.edu	37	12	53900573	53900573	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:53900573A>G	ENST00000267017.3	-	3	492	c.329T>C	c.(328-330)tTt>tCt	p.F110S	NPFF_ENST00000609999.1_Missense_Mutation_p.F113S|RP11-793H13.10_ENST00000591834.1_3'UTR	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor	110					acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						CTTCTTCCCAAAGCGTTGAGG	0.527																																					p.F110S		.	.											.	NPFF	.	.	0			c.T329C						.						100.0	96.0	98.0					12																	53900573		2203	4300	6503	SO:0001583	missense	8620	exon3			TTCCCAAAGCGTT	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856	ENST00000267017.3:c.329T>C	12.37:g.53900573A>G	ENSP00000267017:p.Phe110Ser	54.0	0.0		68.0	17.0	NM_003717	Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	37	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.256940	0.80246	.	.	ENSG00000139574	ENST00000267017	T	0.66280	-0.2	4.59	4.59	0.56863	.	0.000000	0.64402	D	0.000001	T	0.75332	0.3835	M	0.72894	2.215	0.44409	D	0.997323	D	0.61080	0.989	D	0.63957	0.92	T	0.78964	-0.1996	10	0.87932	D	0	-1.7463	13.375	0.60732	1.0:0.0:0.0:0.0	.	110	O15130	NPFF_HUMAN	S	110	ENSP00000267017:F110S	ENSP00000267017:F110S	F	-	2	0	NPFF	52186840	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.617000	0.67716	2.057000	0.61298	0.402000	0.26972	TTT	.	.		0.527	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
RBM48	84060	hgsc.bcm.edu	37	7	92158153	92158153	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:92158153G>T	ENST00000265732.5	+	1	67	c.26G>T	c.(25-27)gGg>gTg	p.G9V	PEX1_ENST00000438045.1_5'Flank|RBM48_ENST00000481551.1_Missense_Mutation_p.G9V|PEX1_ENST00000248633.4_5'Flank|PEX1_ENST00000428214.1_5'Flank	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	9						nucleus (GO:0005634)	RNA binding (GO:0003723)										GGGGAGCTAGGGAGTTTATTT	0.557																																					p.G9V		.	.											.	.	.	.	0			c.G26T						.						69.0	74.0	72.0					7																	92158153		1983	4138	6121	SO:0001583	missense	84060	exon1			AGCTAGGGAGTTT	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.26G>T	7.37:g.92158153G>T	ENSP00000265732:p.Gly9Val	134.0	0.0		176.0	46.0	NM_032120	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Missense_Mutation	SNP	ENST00000265732.5	37	CCDS43615.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016717	0.54468	.	.	ENSG00000127993	ENST00000509224;ENST00000265732;ENST00000481551;ENST00000450580	.	.	.	4.77	4.77	0.60923	.	0.223472	0.47455	D	0.000224	T	0.53642	0.1809	L	0.48362	1.52	0.38410	D	0.945893	B;D;P	0.62365	0.261;0.991;0.894	B;P;B	0.50192	0.042;0.634;0.314	T	0.57579	-0.7787	9	0.45353	T	0.12	-1.3684	13.3215	0.60436	0.0:0.0:0.8421:0.1579	.	9;9;9	B4DGJ6;B7Z2K5;Q5RL73	.;.;CG064_HUMAN	V	11;9;9;9	.	ENSP00000265732:G9V	G	+	2	0	C7orf64	91996089	1.000000	0.71417	0.121000	0.21740	0.009000	0.06853	5.556000	0.67307	2.631000	0.89168	0.561000	0.74099	GGG	.	.		0.557	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120	
MME	4311	hgsc.bcm.edu	37	3	154886382	154886382	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:154886382A>C	ENST00000460393.1	+	19	2002	c.1882A>C	c.(1882-1884)Aac>Cac	p.N628H	MME_ENST00000492661.1_Missense_Mutation_p.N628H|MME_ENST00000462745.1_Missense_Mutation_p.N628H|MME_ENST00000493237.1_Missense_Mutation_p.N628H|MME_ENST00000360490.2_Missense_Mutation_p.N628H|MME-AS1_ENST00000484721.1_RNA	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	628					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TCAGTATGGAAACTTTTCCTG	0.418																																					p.N628H		.	.											.	MME	.	.	0			c.A1882C						.						139.0	131.0	134.0					3																	154886382		2203	4300	6503	SO:0001583	missense	4311	exon19			TATGGAAACTTTT		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1882A>C	3.37:g.154886382A>C	ENSP00000418525:p.Asn628His	235.0	0.0		393.0	100.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527222	0.85706	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.25	5.25	0.73442	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91546	0.7330	M	0.85197	2.74	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	D	0.92612	0.6100	10	0.59425	D	0.04	-23.7422	15.1817	0.72965	1.0:0.0:0.0:0.0	.	628	P08473	NEP_HUMAN	H	628	ENSP00000420389:N628H;ENSP00000418525:N628H;ENSP00000419653:N628H;ENSP00000417079:N628H;ENSP00000353679:N628H	ENSP00000353679:N628H	N	+	1	0	MME	156369076	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.196000	0.94978	1.988000	0.58038	0.528000	0.53228	AAC	.	.		0.418	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
ZP1	22917	hgsc.bcm.edu	37	11	60641219	60641219	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:60641219T>G	ENST00000278853.5	+	9	1543	c.1543T>G	c.(1543-1545)Tca>Gca	p.S515A		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	515	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CCTCCTGGACTCAGGCTCCCA	0.602																																					p.S515A		.	.											.	ZP1	.	.	0			c.T1543G						.						88.0	91.0	90.0					11																	60641219		2203	4299	6502	SO:0001583	missense	22917	exon9			CTGGACTCAGGCT	BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1543T>G	11.37:g.60641219T>G	ENSP00000278853:p.Ser515Ala	36.0	0.0		50.0	12.0	NM_207341		Missense_Mutation	SNP	ENST00000278853.5	37	CCDS31572.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.751274	0.31046	.	.	ENSG00000149506	ENST00000278853;ENST00000544498	T	0.23950	1.88	5.29	-4.13	0.03904	Zona pellucida sperm-binding protein (3);	1.307360	0.04747	N	0.423896	T	0.28234	0.0697	M	0.79693	2.465	0.09310	N	1	B	0.25105	0.118	B	0.32149	0.141	T	0.37220	-0.9715	10	0.41790	T	0.15	-1.953	0.6784	0.00870	0.2335:0.3002:0.2071:0.2592	.	515	P60852	ZP1_HUMAN	A	515;222	ENSP00000278853:S515A	ENSP00000278853:S515A	S	+	1	0	ZP1	60397795	0.004000	0.15560	0.007000	0.13788	0.572000	0.35998	-0.289000	0.08365	-1.064000	0.03172	0.260000	0.18958	TCA	.	.		0.602	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396329.1	NM_207341	
ZNF365	22891	hgsc.bcm.edu	37	10	64148204	64148204	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr10:64148204G>T	ENST00000395254.3	+	3	1073	c.793G>T	c.(793-795)Gtt>Ttt	p.V265F	ZNF365_ENST00000466727.1_3'UTR|ZNF365_ENST00000410046.3_Missense_Mutation_p.V265F|ZNF365_ENST00000395255.3_Missense_Mutation_p.V265F	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGAGAAGGAGGTTCAAGGGAA	0.483																																					p.V265F		.	.											.	ZNF365	.	.	0			c.G793T						.						67.0	67.0	67.0					10																	64148204		2203	4300	6503	SO:0001583	missense	22891	exon3			AAGGAGGTTCAAG	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.793G>T	10.37:g.64148204G>T	ENSP00000378674:p.Val265Phe	125.0	0.0		160.0	23.0	NM_014951		Missense_Mutation	SNP	ENST00000395254.3	37	CCDS31209.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040020	0.35989	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.37235	1.21;1.21;1.21	5.67	4.71	0.59529	.	0.404030	0.23418	N	0.048388	T	0.29817	0.0745	L	0.48362	1.52	0.80722	D	1	B;B;B;B	0.24721	0.11;0.01;0.001;0.003	B;B;B;B	0.17433	0.018;0.004;0.003;0.004	T	0.05273	-1.0895	10	0.38643	T	0.18	-11.2452	10.3383	0.43862	0.0:0.1254:0.6271:0.2475	.	265;265;265;280	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	F	265	ENSP00000378674:V265F;ENSP00000378675:V265F;ENSP00000387091:V265F	ENSP00000378674:V265F	V	+	1	0	ZNF365	63818210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.997000	0.40786	2.836000	0.97738	0.655000	0.94253	GTT	.	.		0.483	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
COL11A1	1301	hgsc.bcm.edu	37	1	103491141	103491141	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:103491141T>C	ENST00000370096.3	-	7	1238	c.926A>G	c.(925-927)tAc>tGc	p.Y309C	COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000353414.4_Missense_Mutation_p.Y270C|COL11A1_ENST00000358392.2_Missense_Mutation_p.Y321C	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	309	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCCATAGTTGTATTCTTGAAA	0.353																																					p.Y321C		.	.											.	COL11A1	.	.	0			c.A962G						.						125.0	118.0	121.0					1																	103491141		2203	4299	6502	SO:0001583	missense	1301	exon7			TAGTTGTATTCTT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.926A>G	1.37:g.103491141T>C	ENSP00000359114:p.Tyr309Cys	329.0	0.0		443.0	67.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983984	0.35036	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000427239	D;T;D;T	0.88586	-2.38;-0.6;-2.4;-0.55	5.53	5.53	0.82687	.	0.480685	0.22400	N	0.060545	D	0.89413	0.6708	M	0.83953	2.67	0.43564	D	0.99588	D;D;P	0.54964	0.969;0.969;0.947	P;P;B	0.50378	0.54;0.639;0.339	D	0.89488	0.3755	10	0.42905	T	0.14	.	12.215	0.54402	0.0:0.0:0.1422:0.8578	.	270;321;309	P12107-3;P12107-2;P12107	.;.;COBA1_HUMAN	C	309;321;270;321	ENSP00000359114:Y309C;ENSP00000351163:Y321C;ENSP00000302551:Y270C;ENSP00000408640:Y321C	ENSP00000302551:Y270C	Y	-	2	0	COL11A1	103263729	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.758000	0.68776	2.106000	0.64143	0.519000	0.50382	TAC	.	.		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
FLT3LG	2323	hgsc.bcm.edu	37	19	49979723	49979723	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:49979723G>A	ENST00000594009.1	+	4	321	c.242G>A	c.(241-243)cGc>cAc	p.R81H	FLT3LG_ENST00000344019.3_Missense_Mutation_p.R81H|FLT3LG_ENST00000597551.1_Missense_Mutation_p.R81H|CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000204637.2_De_novo_Start_OutOfFrame|FLT3LG_ENST00000600429.1_Missense_Mutation_p.R81H|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000596435.1_Missense_Mutation_p.R81H|FLT3LG_ENST00000595510.1_De_novo_Start_OutOfFrame	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	81					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CTGGCACAGCGCTGGATGGAG	0.632											OREG0025623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R81H		.	.											.	FLT3LG	.	.	0			c.G242A						.						44.0	41.0	42.0					19																	49979723		2203	4300	6503	SO:0001583	missense	2323	exon4			CACAGCGCTGGAT	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.242G>A	19.37:g.49979723G>A	ENSP00000469613:p.Arg81His	48.0	0.0	966	68.0	16.0	NM_001204503	A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	37	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258204	0.80246	.	.	ENSG00000090554	ENST00000204637;ENST00000344019	.	.	.	4.52	3.41	0.39046	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.418278	0.21683	N	0.070696	T	0.53400	0.1794	L	0.29908	0.895	0.37468	D	0.915471	D	0.76494	0.999	P	0.58970	0.849	T	0.60999	-0.7151	9	0.72032	D	0.01	-16.2833	10.318	0.43749	0.0:0.0:0.8041:0.1959	.	81	P49771	FLT3L_HUMAN	H	81	.	ENSP00000204637:R81H	R	+	2	0	FLT3LG	54671535	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.280000	0.33202	2.215000	0.71742	0.549000	0.68633	CGC	.	.		0.632	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465305.1		
GSDMB	55876	hgsc.bcm.edu	37	17	38068752	38068752	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:38068752T>C	ENST00000394179.1	-	3	366		c.e3-2		GSDMB_ENST00000520542.1_Splice_Site|GSDMB_ENST00000418519.1_Splice_Site|GSDMB_ENST00000394175.2_Splice_Site|GSDMB_ENST00000360317.3_Splice_Site|GSDMB_ENST00000309481.7_Splice_Site			Q8TAX9	GSDMB_HUMAN	gasdermin B							cytoplasm (GO:0005737)				breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						CCTTTTGACCTGGAAAGAGAA	0.478																																					.		.	.											.	GSDMB	.	.	0			c.236-2A>G						.						98.0	96.0	97.0					17																	38068752		2203	4300	6503	SO:0001630	splice_region_variant	55876	exon4			TTGACCTGGAAAG	AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.236-2A>G	17.37:g.38068752T>C		147.0	0.0		183.0	48.0	NM_001165958	B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Splice_Site	SNP	ENST00000394179.1	37		.	.	.	.	.	.	.	.	.	.	T	13.12	2.142078	0.37825	.	.	ENSG00000073605	ENST00000420491;ENST00000360317;ENST00000394175;ENST00000309481;ENST00000520542;ENST00000418519;ENST00000394179	.	.	.	3.18	3.18	0.36537	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1197	0.30963	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GSDMB	35322278	0.141000	0.22595	0.454000	0.27019	0.457000	0.32468	2.645000	0.46621	1.686000	0.51046	0.421000	0.28195	.	.	.		0.478	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_018530	Intron
ASH1L	55870	hgsc.bcm.edu	37	1	155308071	155308071	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:155308071T>G	ENST00000368346.3	-	27	9266	c.8627A>C	c.(8626-8628)aAt>aCt	p.N2876T	ASH1L_ENST00000392403.3_Missense_Mutation_p.N2871T			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2876					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGGTATCTCATTGGCTGCTTG	0.517																																					p.N2871T		.	.											.	ASH1L	.	.	0			c.A8612C						.						150.0	139.0	143.0					1																	155308071		2203	4300	6503	SO:0001583	missense	55870	exon27			ATCTCATTGGCTG	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8627A>C	1.37:g.155308071T>G	ENSP00000357330:p.Asn2876Thr	127.0	0.0		192.0	57.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	T	5.808	0.333387	0.11013	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88124	-2.34;-2.34	5.65	0.582	0.17412	.	0.699661	0.15155	N	0.277477	T	0.44912	0.1316	N	0.02011	-0.69	0.80722	D	1	B;B	0.15473	0.008;0.013	B;B	0.16289	0.007;0.015	T	0.16600	-1.0397	10	0.12103	T	0.63	.	8.8976	0.35474	0.0:0.4142:0.0:0.5858	.	2876;2871	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	T	2876;2871	ENSP00000357330:N2876T;ENSP00000376204:N2871T	ENSP00000357330:N2876T	N	-	2	0	ASH1L	153574695	0.000000	0.05858	0.958000	0.39756	0.387000	0.30353	-0.141000	0.10327	-0.051000	0.13334	-1.139000	0.01908	AAT	.	.		0.517	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
SEMG2	6407	hgsc.bcm.edu	37	20	43851219	43851219	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr20:43851219A>T	ENST00000372769.3	+	2	1036	c.946A>T	c.(946-948)Atc>Ttc	p.I316F		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	316	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CAGCATTTCTATCCAAACTGA	0.373																																					p.I316F		.	.											.	SEMG2	.	.	0			c.A946T						.						84.0	78.0	80.0					20																	43851219		2203	4300	6503	SO:0001583	missense	6407	exon2			ATTTCTATCCAAA		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.946A>T	20.37:g.43851219A>T	ENSP00000361855:p.Ile316Phe	172.0	0.0		257.0	64.0	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.600133	0.28534	.	.	ENSG00000124157	ENST00000372769	T	0.06933	3.24	1.2	1.2	0.21068	.	.	.	.	.	T	0.09512	0.0234	L	0.39898	1.24	0.09310	N	1	P;P;P	0.37122	0.553;0.583;0.583	B;B;B	0.43916	0.436;0.36;0.36	T	0.29701	-1.0003	9	0.62326	D	0.03	.	4.5711	0.12210	1.0:0.0:0.0:0.0	.	316;316;316	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	F	316	ENSP00000361855:I316F	ENSP00000361855:I316F	I	+	1	0	SEMG2	43284633	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	0.359000	0.20233	0.799000	0.34018	0.338000	0.21704	ATC	.	.		0.373	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
CYP4Z1	199974	hgsc.bcm.edu	37	1	47571829	47571829	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:47571829C>G	ENST00000334194.3	+	9	1100	c.1097C>G	c.(1096-1098)aCg>aGg	p.T366R	CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	366						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						CCTTACACCACGATGTGCATC	0.517																																					p.T366R		.	.											.	CYP4Z1	.	.	0			c.C1097G						.						140.0	119.0	126.0					1																	47571829		2203	4300	6503	SO:0001583	missense	199974	exon9			ACACCACGATGTG	AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1097C>G	1.37:g.47571829C>G	ENSP00000334246:p.Thr366Arg	226.0	0.0		308.0	107.0	NM_178134	Q5VVE4	Missense_Mutation	SNP	ENST00000334194.3	37	CCDS545.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658365	0.67586	.	.	ENSG00000186160	ENST00000334194	T	0.68331	-0.32	3.25	3.25	0.37280	.	0.000000	0.64402	U	0.000002	T	0.76870	0.4048	L	0.55834	1.745	0.42596	D	0.993266	D	0.89917	1.0	D	0.85130	0.997	T	0.80487	-0.1361	10	0.87932	D	0	.	13.8624	0.63569	0.0:1.0:0.0:0.0	.	366	Q86W10	CP4Z1_HUMAN	R	366	ENSP00000334246:T366R	ENSP00000334246:T366R	T	+	2	0	CYP4Z1	47344416	1.000000	0.71417	0.979000	0.43373	0.689000	0.40095	5.029000	0.64121	1.847000	0.53656	0.289000	0.19496	ACG	.	.		0.517	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022020.1	NM_178134	
PTCD1	26024	hgsc.bcm.edu	37	7	99032672	99032672	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:99032672C>T	ENST00000292478.4	-	2	444	c.194G>A	c.(193-195)aGc>aAc	p.S65N	PTCD1_ENST00000555673.1_Missense_Mutation_p.S114N|ATP5J2-PTCD1_ENST00000437572.1_5'UTR|PTCD1_ENST00000485746.1_5'Flank|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.S114N	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	65					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AGAGCCCAGGCTGCCCGTGTT	0.642																																					p.S114N		.	.											.	.	.	.	0			c.G341A						.						33.0	35.0	34.0					7																	99032672		2203	4300	6503	SO:0001583	missense	100526740	exon3			CCCAGGCTGCCCG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.194G>A	7.37:g.99032672C>T	ENSP00000292478:p.Ser65Asn	46.0	0.0		47.0	15.0	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448360	0.63178	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000430982;ENST00000430029;ENST00000419981;ENST00000437572;ENST00000413834	T;T;D;D;D;D;T	0.86030	-0.18;-0.16;-1.76;-1.76;-2.06;-1.84;-0.16	5.57	3.76	0.43208	.	0.389764	0.27682	N	0.018300	D	0.83764	0.5325	M	0.73962	2.25	0.09310	N	1	P;P	0.44816	0.844;0.608	P;B	0.44359	0.447;0.261	T	0.73313	-0.4022	10	0.18710	T	0.47	-14.0754	9.9101	0.41399	0.0:0.8368:0.0:0.1632	.	114;65	G3V325;O75127	.;PTCD1_HUMAN	N	65;114;65;65;65;65;114	ENSP00000292478:S65N;ENSP00000450995:S114N;ENSP00000390530:S65N;ENSP00000408059:S65N;ENSP00000401600:S65N;ENSP00000410697:S65N;ENSP00000400168:S114N	ENSP00000400168:S114N	S	-	2	0	ATP5J2-PTCD1;PTCD1	98870608	0.014000	0.17966	0.003000	0.11579	0.001000	0.01503	0.822000	0.27352	1.361000	0.45981	-0.251000	0.11542	AGC	.	.		0.642	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
NRXN1	9378	hgsc.bcm.edu	37	2	50758388	50758388	+	Missense_Mutation	SNP	C	C	T	rs369744946		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:50758388C>T	ENST00000406316.2	-	11	3800	c.2324G>A	c.(2323-2325)cGt>cAt	p.R775H	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000405472.3_Missense_Mutation_p.R767H|NRXN1_ENST00000404971.1_Missense_Mutation_p.R815H|NRXN1_ENST00000401669.2_Missense_Mutation_p.R775H|NRXN1_ENST00000402717.3_Missense_Mutation_p.R767H|NRXN1_ENST00000406859.3_Missense_Mutation_p.R775H	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	775	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CAGTTTCACACGTCCTGCGTC	0.473																																					p.R815H		.	.											.	NRXN1	.	.	0			c.G2444A						.	C	HIS/ARG,HIS/ARG	1,4079		0,1,2039	68.0	72.0	71.0		2444,2324	5.8	1.0	2		71	0,8422		0,0,4211	no	missense,missense	NRXN1	NM_001135659.1,NM_004801.4	29,29	0,1,6250	TT,TC,CC		0.0,0.0245,0.0080	probably-damaging,probably-damaging	815/1548,775/1478	50758388	1,12501	2040	4211	6251	SO:0001583	missense	9378	exon12			TTCACACGTCCTG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2324G>A	2.37:g.50758388C>T	ENSP00000384311:p.Arg775His	78.0	0.0		101.0	20.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	35	5.473955	0.96291	2.45E-4	0.0	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.88662	0.6497	M	0.80982	2.52	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.70935	0.966;0.867;0.971	D	0.86309	0.1685	10	0.35671	T	0.21	.	20.3316	0.98722	0.0:1.0:0.0:0.0	.	815;775;767	Q9ULB1-3;F8WB18;A7E294	.;.;.	H	815;775;767;775;816;767;775	ENSP00000385142:R815H;ENSP00000384311:R775H;ENSP00000434015:R767H;ENSP00000385017:R775H;ENSP00000385434:R767H;ENSP00000385681:R775H	ENSP00000385017:R775H	R	-	2	0	NRXN1	50611892	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	7.772000	0.85439	2.871000	0.98454	0.655000	0.94253	CGT	.	.		0.473	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
DNAH1	25981	hgsc.bcm.edu	37	3	52393977	52393977	+	Nonsense_Mutation	SNP	C	C	T	rs200763734		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:52393977C>T	ENST00000420323.2	+	27	4714	c.4453C>T	c.(4453-4455)Cag>Tag	p.Q1485*		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1485	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTCCCGCATGCAGCGGGCAGT	0.577																																					p.Q1485X		.	.											.	DNAH1	.	.	0			c.C4453T						.						162.0	170.0	167.0					3																	52393977		2156	4253	6409	SO:0001587	stop_gained	25981	exon27			CGCATGCAGCGGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4453C>T	3.37:g.52393977C>T	ENSP00000401514:p.Gln1485*	111.0	0.0		129.0	38.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Nonsense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	44	11.065208	0.99511	.	.	ENSG00000114841	ENST00000420323	.	.	.	5.13	5.13	0.70059	.	0.131609	0.34386	N	0.004003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	18.7672	0.91878	0.0:1.0:0.0:0.0	.	.	.	.	X	1485	.	ENSP00000401514:Q1485X	Q	+	1	0	DNAH1	52369017	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	2.306000	0.43673	2.677000	0.91161	0.561000	0.74099	CAG	C|0.998;G|0.002	.		0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
MAGEC1	9947	hgsc.bcm.edu	37	X	140993326	140993326	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chrX:140993326G>C	ENST00000285879.4	+	4	422	c.136G>C	c.(136-138)Gac>Cac	p.D46H	MAGEC1_ENST00000406005.2_5'UTR	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	46										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGAGCGACGACACCCTGTA	0.587										HNSCC(15;0.026)																											p.D46H		.	.											.	MAGEC1	.	.	0			c.G136C						.						86.0	88.0	87.0					X																	140993326		2203	4300	6503	SO:0001583	missense	9947	exon4			AGCGACGACACCC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.136G>C	X.37:g.140993326G>C	ENSP00000285879:p.Asp46His	41.0	0.0		59.0	24.0	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	9.828	1.187711	0.21954	.	.	ENSG00000155495	ENST00000285879	T	0.03330	3.97	0.131	0.131	0.14755	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	0.18873	N	0.999989	D	0.55605	0.972	P	0.48815	0.591	T	0.47674	-0.9099	9	0.87932	D	0	.	5.9545	0.19265	6.0E-4:0.0:0.9994:0.0	.	46	O60732	MAGC1_HUMAN	H	46	ENSP00000285879:D46H	ENSP00000285879:D46H	D	+	1	0	MAGEC1	140820992	0.002000	0.14202	0.008000	0.14137	0.008000	0.06430	0.141000	0.16076	0.157000	0.19338	0.158000	0.16466	GAC	.	.		0.587	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
PCDH11Y	83259	hgsc.bcm.edu	37	Y	4968285	4968285	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chrY:4968285C>A	ENST00000333703.4	+	5	3146	c.2633C>A	c.(2632-2634)cCa>cAa	p.P878Q	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.P889Q|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.P889Q	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	889					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGGGCTACCCCAAACCCAGAA	0.413																																					p.P889Q		.	.											.	.	.	.	0			c.C2666A						.						39.0	36.0	36.0					Y																	4968285		616	1950	2566	SO:0001583	missense	83259	exon2			CTACCCCAAACCC	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2633C>A	Y.37:g.4968285C>A	ENSP00000330552:p.Pro878Gln	258.0	0.0		484.0	120.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.	.		0.413	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
ARHGEF28	64283	hgsc.bcm.edu	37	5	73048919	73048919	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:73048919G>T	ENST00000426542.2	+	3	387	c.367G>T	c.(367-369)Gcc>Tcc	p.A123S	ARHGEF28_ENST00000296794.6_Missense_Mutation_p.A123S|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.A123S|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.A123S|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.A123S|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.A123S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	123					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GACCCCATTTGCCTTGACGGC	0.597																																					p.A123S		.	.											.	.	.	.	0			c.G367T						.						38.0	41.0	40.0					5																	73048919		2144	4265	6409	SO:0001583	missense	64283	exon4			CCATTTGCCTTGA		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.367G>T	5.37:g.73048919G>T	ENSP00000412175:p.Ala123Ser	97.0	0.0		154.0	36.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737841	0.30774	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542	T;T;T;T;T;T	0.09073	3.26;3.26;3.26;3.02;3.26;3.26	5.82	5.82	0.92795	.	.	.	.	.	T	0.07593	0.0191	N	0.25647	0.755	0.27325	N	0.956933	B;B;B;B	0.29988	0.068;0.068;0.264;0.112	B;B;B;B	0.27715	0.013;0.013;0.082;0.029	T	0.21965	-1.0230	9	0.39692	T	0.17	.	12.9148	0.58200	0.078:0.0:0.922:0.0	.	123;123;123;123	Q8N1W1;E9PC75;Q8N1W1-2;Q8N1W1-4	RGNEF_HUMAN;.;.;.	S	123	ENSP00000296794:A123S;ENSP00000441913:A123S;ENSP00000441436:A123S;ENSP00000287898:A123S;ENSP00000411459:A123S;ENSP00000412175:A123S	ENSP00000287898:A123S	A	+	1	0	RP11-428C6.1	73084675	1.000000	0.71417	1.000000	0.80357	0.255000	0.26057	4.806000	0.62569	2.757000	0.94681	0.561000	0.74099	GCC	.	.		0.597	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
SPATA24	202051	hgsc.bcm.edu	37	5	138739744	138739744	+	Silent	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:138739744C>A	ENST00000451821.2	-	1	12	c.6G>T	c.(4-6)gcG>gcT	p.A2A	SPATA24_ENST00000507779.2_Silent_p.A2A|SPATA24_ENST00000509959.1_Silent_p.A2A			Q86W54	SPA24_HUMAN	spermatogenesis associated 24	2					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CGAGGGGCGTCGCCATCTTCC	0.622																																					p.A2A		.	.											.	.	.	.	0			c.G6T						.						37.0	36.0	36.0					5																	138739744		692	1591	2283	SO:0001819	synonymous_variant	202051	exon1			GGGCGTCGCCATC	AK098740	CCDS47274.1	5q31.2	2014-02-12	2009-09-30		ENSG00000170469	ENSG00000170469			27322	protein-coding gene	gene with protein product	"""coiled-coil domain containing 161"""					16146721	Standard	NM_194296		Approved	T6441, CCDC161	uc003lel.4	Q86W54	OTTHUMG00000163388	ENST00000451821.2:c.6G>T	5.37:g.138739744C>A		26.0	0.0		44.0	12.0	NM_194296		Silent	SNP	ENST00000451821.2	37																																																																																				.	.		0.622	SPATA24-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000372986.1	NM_194296	
DCLRE1C	64421	hgsc.bcm.edu	37	10	14976379	14976379	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr10:14976379C>T	ENST00000378278.2	-	8	715	c.678G>A	c.(676-678)caG>caA	p.Q226Q	DCLRE1C_ENST00000378254.1_Splice_Site_p.Q106Q|DCLRE1C_ENST00000396817.2_Splice_Site_p.Q106Q|DCLRE1C_ENST00000453695.2_Splice_Site_p.Q106Q|DCLRE1C_ENST00000378249.1_Splice_Site_p.Q111Q|DCLRE1C_ENST00000378255.1_Splice_Site_p.Q106Q|DCLRE1C_ENST00000357717.2_Splice_Site_p.Q111Q|DCLRE1C_ENST00000378258.1_Splice_Site_p.Q106Q|DCLRE1C_ENST00000378289.4_Splice_Site_p.Q226Q|DCLRE1C_ENST00000378246.2_Splice_Site_p.Q111Q			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	226					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						GTCACCATACCTGGACTCCTA	0.438								Non-homologous end-joining																													p.Q226Q		.	.											.	DCLRE1C	.	.	0			c.G678A						.						86.0	100.0	95.0					10																	14976379		2203	4300	6503	SO:0001630	splice_region_variant	64421	exon8			CCATACCTGGACT	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.678+1G>A	10.37:g.14976379C>T		166.0	0.0		242.0	75.0	NM_001033855	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	ENST00000378278.2	37	CCDS31149.1																																																																																			.	.		0.438	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487	Silent
SBNO1	55206	hgsc.bcm.edu	37	12	123825580	123825580	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:123825580T>G	ENST00000602398.1	-	5	733	c.606A>C	c.(604-606)agA>agC	p.R202S	SBNO1_ENST00000602750.1_Missense_Mutation_p.R201S|SBNO1_ENST00000267176.4_Missense_Mutation_p.R201S|SBNO1_ENST00000420886.2_Missense_Mutation_p.R202S			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	202					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TTATCCACATTCTAGCTCCTT	0.353																																					p.R202S		.	.											.	SBNO1	.	.	0			c.A606C						.						146.0	138.0	141.0					12																	123825580		2203	4300	6503	SO:0001583	missense	55206	exon4			CCACATTCTAGCT	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.606A>C	12.37:g.123825580T>G	ENSP00000473665:p.Arg202Ser	145.0	0.0		237.0	66.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.823596	0.71143	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.33654	1.4;1.4	5.49	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.46288	0.1385	L	0.51422	1.61	0.47659	D	0.999484	D;D;D	0.61697	0.981;0.99;0.981	D;P;D	0.69824	0.966;0.852;0.943	T	0.26121	-1.0112	10	0.23302	T	0.38	-29.2449	7.7316	0.28789	0.0:0.2345:0.0:0.7655	.	202;201;200	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	S	202;201;201	ENSP00000387361:R202S;ENSP00000267176:R201S	ENSP00000267176:R201S	R	-	3	2	SBNO1	122391533	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	0.538000	0.23160	0.391000	0.25143	0.459000	0.35465	AGA	.	.		0.353	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
TRHR	7201	hgsc.bcm.edu	37	8	110131669	110131669	+	Silent	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:110131669C>A	ENST00000518632.1	+	3	1533	c.1182C>A	c.(1180-1182)tcC>tcA	p.S394S	TRHR_ENST00000311762.2_Silent_p.S394S			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	394					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CTGAGGTATCCTTTAGCCAAA	0.403																																					p.S394S		.	.											TRHR,nipple,malignant_melanoma,+1	TRHR	.	.	0			c.C1182A						.						63.0	63.0	63.0					8																	110131669		2203	4299	6502	SO:0001819	synonymous_variant	7201	exon2			GGTATCCTTTAGC		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.1182C>A	8.37:g.110131669C>A		117.0	0.0		297.0	67.0	NM_003301	Q2M339	Silent	SNP	ENST00000518632.1	37	CCDS6311.1																																																																																			.	.		0.403	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
SSPO	23145	hgsc.bcm.edu	37	7	149485526	149485526	+	RNA	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:149485526G>A	ENST00000378016.2	+	0	3932							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGTGTGGAGGGCTGCTTCTGC	0.652																																					p.G1311D		.	.											.	.	.	.	0			c.G3932A						.						38.0	47.0	44.0					7																	149485526		2119	4217	6336			23145	exon27			TGGAGGGCTGCTT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149485526G>A		109.0	0.0		100.0	26.0	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				.	.		0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
TP53	7157	hgsc.bcm.edu	37	17	7578419	7578419	+	Nonsense_Mutation	SNP	C	C	A	rs587781845		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:7578419C>A	ENST00000269305.4	-	5	700	c.511G>T	c.(511-513)Gag>Tag	p.E171*	TP53_ENST00000413465.2_Nonsense_Mutation_p.E171*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E171*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E171*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E171*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E171*|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	171	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E171K(11)|p.E171*(10)|p.0?(8)|p.E171Q(4)|p.E171fs*2(3)|p.E171fs*3(2)|p.E171fs*10(2)|p.V157_C176del20(1)|p.T170fs*8(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.E171fs*9(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.E78fs*2(1)|p.H168fs*3(1)|p.H168fs*69(1)|p.T170_E171insXX(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.E39fs*2(1)|p.E171_V172delEV(1)|p.E39K(1)|p.E78K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCACAACCTCCGTCATGTGC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E171X	Pancreas(47;798 1329 9957 10801)	.	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	.	.	57	Substitution - Missense(17)|Deletion - Frameshift(15)|Substitution - Nonsense(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Insertion - In frame(1)	urinary_tract(8)|lung(8)|breast(8)|oesophagus(6)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|large_intestine(3)|stomach(3)|central_nervous_system(3)|skin(3)|upper_aerodigestive_tract(2)|thyroid(1)|kidney(1)|endometrium(1)|liver(1)|ovary(1)	c.G511T						.						52.0	52.0	52.0					17																	7578419		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAACCTCCGTCAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.511G>T	17.37:g.7578419C>A	ENSP00000269305:p.Glu171*	88.0	0.0		64.0	23.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186918	0.78789	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.47	5.47	0.80525	.	0.106949	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.8225	17.1938	0.86887	0.0:1.0:0.0:0.0	.	.	.	.	X	171;171;171;171;171;171;160;78;39;78;39	.	ENSP00000269305:E171X	E	-	1	0	TP53	7519144	1.000000	0.71417	0.689000	0.30133	0.389000	0.30415	7.775000	0.85489	2.735000	0.93741	0.563000	0.77884	GAG	.	.		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
OSGIN2	734	hgsc.bcm.edu	37	8	90937753	90937753	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:90937753T>C	ENST00000297438.2	+	6	1866	c.1511T>C	c.(1510-1512)aTa>aCa	p.I504T	OSGIN2_ENST00000451899.2_Missense_Mutation_p.I548T	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	504					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			GGAGATGGGATAGCTTAAAGC	0.383																																					p.I548T		.	.											.	OSGIN2	.	.	0			c.T1643C						.						46.0	44.0	44.0					8																	90937753		2203	4300	6503	SO:0001583	missense	734	exon6			ATGGGATAGCTTA	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.1511T>C	8.37:g.90937753T>C	ENSP00000297438:p.Ile504Thr	81.0	0.0		218.0	126.0	NM_001126111		Missense_Mutation	SNP	ENST00000297438.2	37	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083021	0.36758	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.24908	1.86;1.83	5.79	5.79	0.91817	.	0.566107	0.20520	N	0.090702	T	0.16214	0.0390	N	0.08118	0	0.80722	D	1	B;B	0.26845	0.161;0.041	B;B	0.21151	0.033;0.01	T	0.07616	-1.0763	10	0.72032	D	0.01	-6.7707	16.1325	0.81454	0.0:0.0:0.0:1.0	.	548;504	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	T	504;548	ENSP00000297438:I504T;ENSP00000396445:I548T	ENSP00000297438:I504T	I	+	2	0	OSGIN2	91006928	0.997000	0.39634	0.986000	0.45419	0.953000	0.61014	6.574000	0.74014	2.219000	0.72066	0.460000	0.39030	ATA	.	.		0.383	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
SARS2	54938	hgsc.bcm.edu	37	19	39408640	39408640	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:39408640C>A	ENST00000221431.6	-	11	1130	c.971G>T	c.(970-972)tGc>tTc	p.C324F	CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.L393F|SARS2_ENST00000430193.3_Missense_Mutation_p.C324F|SARS2_ENST00000600042.1_Missense_Mutation_p.C326F|SARS2_ENST00000448145.2_Missense_Mutation_p.C324F|SARS2_ENST00000594171.1_Missense_Mutation_p.C134F|SARS2_ENST00000598831.1_5'Flank	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	324					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGTGCTGGAGCAAACCATCCT	0.572																																					p.C326F		.	.											.	SARS2	.	.	0			c.G977T						.						112.0	85.0	94.0					19																	39408640		2203	4300	6503	SO:0001583	missense	54938	exon12			CTGGAGCAAACCA	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.971G>T	19.37:g.39408640C>A	ENSP00000221431:p.Cys324Phe	140.0	0.0		190.0	60.0	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.088615	0.76756	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000448145	T;T	0.76316	-1.01;-1.01	4.88	4.88	0.63580	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.85712	0.5760	M	0.67953	2.075	.	.	.	D;D;D;D	0.76494	0.999;0.996;0.999;0.979	D;P;D;P	0.65010	0.931;0.875;0.931;0.77	D	0.88857	0.3323	9	0.87932	D	0	.	15.5397	0.76031	0.0:1.0:0.0:0.0	.	324;326;324;324	E7EX87;B4DE10;B4DXB9;Q9NP81	.;.;.;SYSM_HUMAN	F	326;324;324	ENSP00000221431:C324F;ENSP00000399330:C324F	ENSP00000221431:C324F	C	-	2	0	FBXO17	44100480	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.079000	0.76829	2.263000	0.75096	0.424000	0.28305	TGC	.	.		0.572	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
ST3GAL1	6482	hgsc.bcm.edu	37	8	134477129	134477129	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:134477129G>C	ENST00000319914.5	-	6	1602	c.575C>G	c.(574-576)cCt>cGt	p.P192R	ST3GAL1_ENST00000522652.1_Missense_Mutation_p.P192R|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.P192R|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.P192R			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	192					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			GAAGCTCTCAGGGTACACCAG	0.582																																					p.P192R		.	.											.	ST3GAL1	.	.	0			c.C575G						.						175.0	160.0	165.0					8																	134477129		2203	4300	6503	SO:0001583	missense	6482	exon7			CTCTCAGGGTACA	L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.575C>G	8.37:g.134477129G>C	ENSP00000318445:p.Pro192Arg	168.0	0.0		336.0	176.0	NM_173344	O60677|Q9UN51	Missense_Mutation	SNP	ENST00000319914.5	37	CCDS6373.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913610	0.92178	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652;ENST00000523854	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75252	-0.3383	10	0.87932	D	0	-24.2124	17.094	0.86630	0.0:0.0:1.0:0.0	.	192	Q11201	SIA4A_HUMAN	R	192;192;192;192;62	ENSP00000318445:P192R;ENSP00000414073:P192R;ENSP00000428540:P192R;ENSP00000430515:P192R;ENSP00000429638:P62R	ENSP00000318445:P192R	P	-	2	0	ST3GAL1	134546311	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.648000	0.98483	2.271000	0.75665	0.561000	0.74099	CCT	.	.		0.582	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379132.1	NM_003033	
