#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RSC1A1	6248	hgsc.bcm.edu	37	1	15986764	15986764	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:15986764C>A	ENST00000345034.1	+	1	401	c.401C>A	c.(400-402)tCt>tAt	p.S134Y	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	134					intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCTAGTTTATCTGTCACATCT	0.438																																					p.S134Y		Atlas-SNP	.											.	RSC1A1	29	.	0			c.C401A						.						99.0	97.0	98.0					1																	15986764		2203	4300	6503	SO:0001583	missense	6248	exon1			GTTTATCTGTCAC	BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.401C>A	chr1.hg19:g.15986764C>A	ENSP00000341963:p.Ser134Tyr	128.0	0.0		134.0	65.0	NM_006511	B2RBP5	Missense_Mutation	SNP	ENST00000345034.1	hg19	CCDS161.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631392	0.46944	.	.	ENSG00000215695	ENST00000345034	T	0.48522	0.81	5.46	4.55	0.56014	.	0.460861	0.18123	N	0.150989	T	0.51890	0.1701	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.70935	0.971	T	0.39210	-0.9625	10	0.66056	D	0.02	-13.1966	6.9359	0.24466	0.1728:0.7392:0.0:0.088	.	134	Q92681	RSCA1_HUMAN	Y	134	ENSP00000341963:S134Y	ENSP00000341963:S134Y	S	+	2	0	RSC1A1	15859351	0.305000	0.24481	0.067000	0.19924	0.965000	0.64279	1.199000	0.32235	1.302000	0.44855	0.561000	0.74099	TCT	.	.		0.438	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	NM_006511	
FGGY	55277	hgsc.bcm.edu	37	1	60223627	60223627	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:60223627G>T	ENST00000303721.7	+	15	1711	c.1537G>T	c.(1537-1539)Gtt>Ttt	p.V513F	FGGY_ENST00000371210.1_Missense_Mutation_p.V214F|FGGY_ENST00000371212.1_Missense_Mutation_p.V425F|FGGY_ENST00000371218.4_Missense_Mutation_p.V537F|RP4-782L23.2_ENST00000443012.1_RNA	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	513					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					AATGAGCAAAGTTGGGAAAGT	0.393																																					p.V537F		Atlas-SNP	.											.	FGGY	99	.	0			c.G1609T						.						118.0	112.0	114.0					1																	60223627		2203	4300	6503	SO:0001583	missense	55277	exon16			AGCAAAGTTGGGA		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1537G>T	chr1.hg19:g.60223627G>T	ENSP00000305922:p.Val513Phe	61.0	0.0		71.0	27.0	NM_001113411	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	ENST00000303721.7	hg19	CCDS611.2	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853128	0.51270	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	5.3	5.3	0.74995	.	0.150542	0.44688	D	0.000437	D	0.90947	0.7154	M	0.76002	2.32	0.50632	D	0.999889	P;P;P	0.40909	0.565;0.732;0.585	P;B;B	0.45946	0.498;0.321;0.187	D	0.89622	0.3849	9	.	.	.	-8.0943	9.8208	0.40880	0.0905:0.0:0.9095:0.0	.	537;425;513	Q96C11-3;B1AK94;Q96C11	.;.;FGGY_HUMAN	F	537;513;425;214	ENSP00000360262:V537F;ENSP00000305922:V513F;ENSP00000360256:V425F;ENSP00000360254:V214F	.	V	+	1	0	FGGY	59996215	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.884000	0.39668	2.756000	0.94617	0.563000	0.77884	GTT	.	.		0.393	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	
GNG12	55970	hgsc.bcm.edu	37	1	68171260	68171260	+	Splice_Site	SNP	C	C	G			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:68171260C>G	ENST00000370982.3	-	4	293		c.e4-1			NM_018841.5	NP_061329.3	Q9UBI6	GBG12_HUMAN	guanine nucleotide binding protein (G protein), gamma 12						cellular response to glucagon stimulus (GO:0071377)|cerebral cortex development (GO:0021987)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			lung(3)	3						CCTTCGAAACCTGACATGGAG	0.413																																					.		Atlas-SNP	.											.	GNG12	11	.	0			c.94-1G>C						.						82.0	76.0	78.0					1																	68171260		2203	4300	6503	SO:0001630	splice_region_variant	55970	exon5			CGAAACCTGACAT	AF119663	CCDS30749.1	1p31.2	2008-02-05			ENSG00000172380	ENSG00000172380			19663	protein-coding gene	gene with protein product		615405				10819326	Standard	NM_018841		Approved		uc001dea.2	Q9UBI6	OTTHUMG00000009545	ENST00000370982.3:c.94-1G>C	chr1.hg19:g.68171260C>G		79.0	0.0		142.0	33.0	NM_018841	Q69YP5|Q9BRV5	Splice_Site	SNP	ENST00000370982.3	hg19	CCDS30749.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209280	0.58343	.	.	ENSG00000172380	ENST00000370982	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1311	0.89602	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GNG12	67943848	1.000000	0.71417	0.998000	0.56505	0.513000	0.34164	7.063000	0.76714	2.598000	0.87819	0.491000	0.48974	.	.	.		0.413	GNG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026355.2		Intron
KCNA2	3737	hgsc.bcm.edu	37	1	111147255	111147255	+	Silent	SNP	G	G	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:111147255G>T	ENST00000485317.1	-	3	823	c.150C>A	c.(148-150)acC>acA	p.T50T	KCNA2_ENST00000440270.1_Silent_p.T50T|KCNA2_ENST00000316361.4_Silent_p.T50T|KCNA2_ENST00000369770.3_Silent_p.T50T|KCNA2_ENST00000525120.1_Intron			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	50					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	ACTGGGCTAAGGTCTTTAGCT	0.542																																					p.T50T	Pancreas(18;568 735 10587 23710 36357)	Atlas-SNP	.											.	KCNA2	61	.	0			c.C150A						.						104.0	110.0	108.0					1																	111147255		2203	4300	6503	SO:0001819	synonymous_variant	3737	exon3			GGCTAAGGTCTTT	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.150C>A	chr1.hg19:g.111147255G>T		105.0	0.0		102.0	46.0	NM_001204269	Q86XG6	Silent	SNP	ENST00000485317.1	hg19	CCDS827.1																																																																																			.	.		0.542	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144912287	144912287	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:144912287G>A	ENST00000369354.3	-	15	2177	c.1988C>T	c.(1987-1989)gCa>gTa	p.A663V	PDE4DIP_ENST00000529945.1_Missense_Mutation_p.A826V|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.A800V|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.A663V|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.A450V|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.A663V|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.A826V|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.A800V|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.A663V|PDE4DIP_ENST00000524974.1_5'Flank|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.A729V			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	663					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAACTTCTCTGCAGCAGCCTA	0.383			T	PDGFRB	MPD																																p.A826V		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.C2477T						.						61.0	57.0	58.0					1																	144912287		2203	4300	6503	SO:0001583	missense	9659	exon11			TTCTCTGCAGCAG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1988C>T	chr1.hg19:g.144912287G>A	ENSP00000358360:p.Ala663Val	133.0	0.0		189.0	42.0	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340259	0.24339	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.70749	4.58;4.66;4.66;4.67;4.67;3.66;3.67;2.57;2.57;-0.51	5.5	4.39	0.52855	.	.	.	.	.	T	0.43188	0.1236	L	0.27053	0.805	0.19575	N	0.999967	B;B;P;B;B;B	0.37330	0.01;0.02;0.59;0.016;0.136;0.021	B;B;B;B;B;B	0.39904	0.006;0.009;0.313;0.023;0.028;0.01	T	0.18493	-1.0335	9	0.31617	T	0.26	.	10.1675	0.42888	0.1052:0.0:0.8948:0.0	.	826;450;663;826;729;663	E9PL24;E9PQG4;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;.;MYOME_HUMAN	V	729;663;663;826;800;800;663;663;826;826;450	ENSP00000327209:A729V;ENSP00000358360:A663V;ENSP00000358363:A663V;ENSP00000435654:A800V;ENSP00000358366:A800V;ENSP00000358357:A663V;ENSP00000358355:A663V;ENSP00000316434:A826V;ENSP00000433392:A826V;ENSP00000436791:A450V	ENSP00000327209:A729V	A	-	2	0	PDE4DIP	143623644	0.953000	0.32496	0.946000	0.38457	0.597000	0.36814	4.150000	0.58098	2.616000	0.88540	0.639000	0.83563	GCA	.	.		0.383	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
C1orf43	25912	hgsc.bcm.edu	37	1	154184948	154184948	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:154184948G>A	ENST00000368521.5	-	5	691	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C	C1orf43_ENST00000368516.1_Missense_Mutation_p.R131C|C1orf43_ENST00000350592.3_Missense_Mutation_p.R131C|C1orf43_ENST00000362076.4_Missense_Mutation_p.R113C|C1orf43_ENST00000368518.1_Missense_Mutation_p.R165C|C1orf43_ENST00000368519.1_Missense_Mutation_p.R147C	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	165						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					GTCCCATAGCGGGCTGTTTCA	0.488																																					p.R165C		Atlas-SNP	.											.	C1orf43	36	.	0			c.C493T						.						83.0	79.0	81.0					1																	154184948		2203	4300	6503	SO:0001583	missense	25912	exon5			CATAGCGGGCTGT	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.493C>T	chr1.hg19:g.154184948G>A	ENSP00000357507:p.Arg165Cys	88.0	0.0		95.0	4.0	NM_001098616	A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Missense_Mutation	SNP	ENST00000368521.5	hg19	CCDS41404.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.657947	0.67586	.	.	ENSG00000143612	ENST00000350592;ENST00000368521;ENST00000362076;ENST00000368519;ENST00000368518;ENST00000368516	.	.	.	5.39	5.39	0.77823	Dehydrogenase, multihelical (1);	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.80332	2.49	0.80722	D	1	B;B;B;B;B	0.16802	0.015;0.003;0.019;0.001;0.004	B;B;B;B;B	0.21708	0.004;0.002;0.036;0.001;0.003	T	0.65253	-0.6213	9	0.87932	D	0	-12.6106	18.3255	0.90252	0.0:0.0:1.0:0.0	.	147;131;165;113;131	Q9BWL3-5;Q9BWL3-2;Q9BWL3;Q9BWL3-4;Q09GN0	.;.;CA043_HUMAN;.;.	C	131;165;113;147;165;131	.	ENSP00000271925:R131C	R	-	1	0	C1orf43	152451572	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	8.872000	0.92352	2.814000	0.96858	0.585000	0.79938	CGC	.	.		0.488	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087664.2	NM_015449	
MNDA	4332	hgsc.bcm.edu	37	1	158812126	158812126	+	Silent	SNP	T	T	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:158812126T>C	ENST00000368141.4	+	2	444	c.183T>C	c.(181-183)tgT>tgC	p.C61C	MNDA_ENST00000491210.1_3'UTR	NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	61	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					GCGTTGCCTGTCTAGACAAAC	0.343																																					p.C61C		Atlas-SNP	.											.	MNDA	147	.	0			c.T183C						.						109.0	117.0	114.0					1																	158812126		2203	4300	6503	SO:0001819	synonymous_variant	4332	exon2			TGCCTGTCTAGAC	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.183T>C	chr1.hg19:g.158812126T>C		137.0	0.0		153.0	66.0	NM_002432		Silent	SNP	ENST00000368141.4	hg19	CCDS1177.1																																																																																			.	.		0.343	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432	
RYR2	6262	hgsc.bcm.edu	37	1	237758830	237758830	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:237758830C>T	ENST00000366574.2	+	34	4786	c.4469C>T	c.(4468-4470)gCg>gTg	p.A1490V	RYR2_ENST00000542537.1_Missense_Mutation_p.A1474V|RYR2_ENST00000360064.6_Missense_Mutation_p.A1488V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1490	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A1488V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGGTATGTGCGGGTGAGAGC	0.463																																					p.A1490V		Atlas-SNP	.											RYR2,NS,carcinoma,0,3	RYR2	1273	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C4469T						.						85.0	89.0	88.0					1																	237758830		2061	4190	6251	SO:0001583	missense	6262	exon34			TATGTGCGGGTGA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4469C>T	chr1.hg19:g.237758830C>T	ENSP00000355533:p.Ala1490Val	126.0	1.0		130.0	61.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566525	0.65651	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.60424	0.19;0.19;0.19	5.52	5.52	0.82312	SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000006	T	0.46425	0.1392	L	0.39397	1.21	0.80722	D	1	P	0.45827	0.867	B	0.35353	0.201	T	0.52230	-0.8603	10	0.49607	T	0.09	.	14.9817	0.71316	0.0:0.8578:0.1422:0.0	.	1490	Q92736	RYR2_HUMAN	V	1490;1488;1474	ENSP00000355533:A1490V;ENSP00000353174:A1488V;ENSP00000443798:A1474V	ENSP00000353174:A1488V	A	+	2	0	RYR2	235825453	0.997000	0.39634	0.985000	0.45067	0.997000	0.91878	3.478000	0.53158	2.598000	0.87819	0.655000	0.94253	GCG	.	.		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
KCNS3	3790	hgsc.bcm.edu	37	2	18113077	18113077	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:18113077G>T	ENST00000403915.1	+	3	1253	c.802G>T	c.(802-804)Gcc>Tcc	p.A268S	KCNS3_ENST00000304101.4_Missense_Mutation_p.A268S|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	268					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCCCTTCTATGCCACGTTGGC	0.488																																					p.A268S		Atlas-SNP	.											.	KCNS3	85	.	0			c.G802T						.						118.0	113.0	115.0					2																	18113077		2203	4300	6503	SO:0001583	missense	3790	exon3			TTCTATGCCACGT	AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.802G>T	chr2.hg19:g.18113077G>T	ENSP00000385968:p.Ala268Ser	140.0	0.0		153.0	60.0	NM_002252	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	ENST00000403915.1	hg19	CCDS1692.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931766	0.73442	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.98649	-5.05;-5.05	6.07	6.07	0.98685	Ion transport (1);	0.202236	0.51477	D	0.000090	D	0.98492	0.9497	L	0.33710	1.025	0.58432	D	0.999998	D	0.71674	0.998	D	0.67725	0.953	D	0.99895	1.1144	10	0.87932	D	0	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	268	Q9BQ31	KCNS3_HUMAN	S	268	ENSP00000385968:A268S;ENSP00000305824:A268S	ENSP00000305824:A268S	A	+	1	0	KCNS3	17976558	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.735000	0.68587	2.884000	0.98904	0.655000	0.94253	GCC	.	.		0.488	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
C2orf43	60526	hgsc.bcm.edu	37	2	20939926	20939926	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:20939926T>C	ENST00000237822.3	-	5	587	c.508A>G	c.(508-510)Atg>Gtg	p.M170V	C2orf43_ENST00000403006.2_Missense_Mutation_p.M40V|C2orf43_ENST00000440866.2_Intron|C2orf43_ENST00000541941.1_Missense_Mutation_p.M40V|C2orf43_ENST00000381090.3_Missense_Mutation_p.M170V|C2orf43_ENST00000435420.2_Missense_Mutation_p.M122V	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43	170										endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACTCAGACATTCGTTCAATT	0.393																																					p.M170V		Atlas-SNP	.											.	C2orf43	28	.	0			c.A508G						.						102.0	99.0	100.0					2																	20939926		2203	4300	6503	SO:0001583	missense	60526	exon5			CAGACATTCGTTC	AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.508A>G	chr2.hg19:g.20939926T>C	ENSP00000237822:p.Met170Val	110.0	0.0		169.0	106.0	NM_021925	B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	Missense_Mutation	SNP	ENST00000237822.3	hg19	CCDS1702.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.210186	0.58343	.	.	ENSG00000118961	ENST00000403006;ENST00000381090;ENST00000237822;ENST00000435420;ENST00000541941;ENST00000432947;ENST00000412261	T;T;T	0.70399	1.05;1.05;-0.48	5.61	0.0619	0.14342	.	0.000000	0.85682	D	0.000000	T	0.76933	0.4057	M	0.80422	2.495	0.80722	D	1	D;B;P;P	0.62365	0.991;0.149;0.642;0.642	P;B;P;P	0.59487	0.858;0.089;0.673;0.579	T	0.72074	-0.4400	10	0.40728	T	0.16	-9.8728	6.4997	0.22162	0.2506:0.0:0.2608:0.4886	.	128;122;170;170	B4DS38;B7ZAJ5;Q9H6V9;B5MDU6	.;.;CB043_HUMAN;.	V	40;170;170;122;40;40;122	ENSP00000384267:M40V;ENSP00000440570:M40V;ENSP00000396911:M40V	ENSP00000237822:M170V	M	-	1	0	C2orf43	20803407	1.000000	0.71417	0.332000	0.25469	0.910000	0.53928	2.108000	0.41854	-0.140000	0.11394	0.528000	0.53228	ATG	.	.		0.393	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242861.1	NM_021925	
APOB	338	hgsc.bcm.edu	37	2	21251347	21251347	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:21251347C>A	ENST00000233242.1	-	13	1808	c.1681G>T	c.(1681-1683)Gcc>Tcc	p.A561S	APOB_ENST00000399256.4_Missense_Mutation_p.A561S	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	561	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAAGATAGGCAGCCAGTCGC	0.448																																					p.A561S		Atlas-SNP	.											.	APOB	761	.	0			c.G1681T						.						120.0	119.0	120.0					2																	21251347		2203	4300	6503	SO:0001583	missense	338	exon13			GATAGGCAGCCAG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1681G>T	chr2.hg19:g.21251347C>A	ENSP00000233242:p.Ala561Ser	86.0	0.0		82.0	35.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880068	0.91740	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.72051	-0.62;-0.62	5.69	5.69	0.88448	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.068821	0.56097	D	0.000033	T	0.80265	0.4591	M	0.78049	2.395	0.51767	D	0.999935	D	0.67145	0.996	P	0.60345	0.873	T	0.79526	-0.1767	10	0.41790	T	0.15	.	10.8827	0.46948	0.132:0.7991:0.0:0.0689	.	561	P04114	APOB_HUMAN	S	561	ENSP00000233242:A561S;ENSP00000382200:A561S	ENSP00000233242:A561S	A	-	1	0	APOB	21104852	0.999000	0.42202	1.000000	0.80357	0.978000	0.69477	3.774000	0.55341	2.865000	0.98341	0.655000	0.94253	GCC	.	.		0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
DHX57	90957	hgsc.bcm.edu	37	2	39088480	39088480	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:39088480G>A	ENST00000295373.6	-	5	1198	c.1072C>T	c.(1072-1074)Cga>Tga	p.R358*	AC018693.6_ENST00000442829.1_RNA|DHX57_ENST00000479345.2_5'UTR	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	358							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TTAGAAAATCGAATTTCAAGT	0.368																																					p.R358X	Melanoma(191;1090 2095 4375 23729 47341)	Atlas-SNP	.											.	DHX57	127	.	0			c.C1072T						.						48.0	47.0	47.0					2																	39088480		2203	4300	6503	SO:0001587	stop_gained	90957	exon5			AAAATCGAATTTC	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.1072C>T	chr2.hg19:g.39088480G>A	ENSP00000295373:p.Arg358*	85.0	0.0		114.0	41.0	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Nonsense_Mutation	SNP	ENST00000295373.6	hg19	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	G	37	6.283569	0.97440	.	.	ENSG00000163214	ENST00000295373;ENST00000355320	.	.	.	5.55	3.49	0.39957	.	0.000000	0.48767	D	0.000169	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1348	0.59403	0.0:0.0:0.5552:0.4448	.	.	.	.	X	358;256	.	ENSP00000295373:R358X	R	-	1	2	DHX57	38941984	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.236000	0.51336	1.295000	0.44724	0.655000	0.94253	CGA	.	.		0.368	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
SPTBN1	6711	hgsc.bcm.edu	37	2	54859819	54859819	+	Silent	SNP	T	T	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:54859819T>C	ENST00000356805.4	+	17	3962	c.3681T>C	c.(3679-3681)gcT>gcC	p.A1227A	SPTBN1_ENST00000333896.5_Silent_p.A1214A	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1227					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGATCAATGCTGTGGTGGAGA	0.498																																					p.A1227A		Atlas-SNP	.											.	SPTBN1	378	.	0			c.T3681C						.						120.0	106.0	111.0					2																	54859819		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon17			CAATGCTGTGGTG		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3681T>C	chr2.hg19:g.54859819T>C		96.0	0.0		141.0	54.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	hg19	CCDS33198.1																																																																																			.	.		0.498	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
MRPL53	116540	hgsc.bcm.edu	37	2	74699318	74699318	+	Silent	SNP	G	G	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:74699318G>C	ENST00000258105.7	-	3	928	c.267C>G	c.(265-267)gcC>gcG	p.A89A	MRPL53_ENST00000409710.1_Missense_Mutation_p.L52V	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	89						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						GGGAGGCGAAGGCGGTGAGCA	0.632																																					p.A89A		Atlas-SNP	.											.	MRPL53	13	.	0			c.C267G						.						36.0	41.0	39.0					2																	74699318		2203	4299	6502	SO:0001819	synonymous_variant	116540	exon3			GGCGAAGGCGGTG	BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.267C>G	chr2.hg19:g.74699318G>C		87.0	0.0		90.0	37.0	NM_053050		Silent	SNP	ENST00000258105.7	hg19	CCDS1944.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651367	0.29336	.	.	ENSG00000204822	ENST00000409710	T	0.55930	0.49	4.99	1.03	0.20045	.	.	.	.	.	T	0.54062	0.1835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53641	-0.8410	6	0.87932	D	0	-30.6008	4.5993	0.12345	0.2726:0.1603:0.5671:0.0	.	.	.	.	V	52	ENSP00000386920:L52V	ENSP00000386920:L52V	L	-	1	0	MRPL53	74552826	1.000000	0.71417	0.995000	0.50966	0.569000	0.35902	0.772000	0.26647	0.312000	0.23038	0.643000	0.83706	CTT	.	.		0.632	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252225.2	NM_053050	
M1AP	130951	hgsc.bcm.edu	37	2	74785860	74785860	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:74785860C>T	ENST00000290536.5	-	11	1692	c.1576G>A	c.(1576-1578)Gat>Aat	p.D526N	M1AP_ENST00000409585.1_Missense_Mutation_p.D522N|M1AP_ENST00000464686.1_5'UTR|M1AP_ENST00000536235.1_Missense_Mutation_p.D522N|M1AP_ENST00000358434.2_Missense_Mutation_p.D175N	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	526					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CTTGAGGGATCCTTCTCCCAC	0.557																																					p.D526N		Atlas-SNP	.											.	.	.	.	0			c.G1576A						.						118.0	112.0	114.0					2																	74785860		2203	4300	6503	SO:0001583	missense	130951	exon11			AGGGATCCTTCTC		CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.1576G>A	chr2.hg19:g.74785860C>T	ENSP00000290536:p.Asp526Asn	114.0	0.0		123.0	64.0	NM_138804	B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	ENST00000290536.5	hg19	CCDS33229.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725305	0.48833	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235;ENST00000358434	T;T;T	0.34472	1.39;1.36;1.36	5.24	-5.63	0.02474	.	1.921840	0.02434	N	0.083853	T	0.20536	0.0494	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.24512	-1.0158	10	0.66056	D	0.02	-14.7896	1.5642	0.02601	0.2105:0.4051:0.1605:0.2239	.	522;175;526;278	E9PGG8;Q8TC57-3;Q8TC57;B3KX03	.;.;CB065_HUMAN;.	N	526;522;522;175	ENSP00000290536:D526N;ENSP00000386793:D522N;ENSP00000445662:D522N	ENSP00000290536:D526N	D	-	1	0	C2orf65	74639368	0.005000	0.15991	0.000000	0.03702	0.108000	0.19459	0.268000	0.18571	-0.469000	0.06911	-0.262000	0.10625	GAT	.	.		0.557	M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804	
RGPD8	727851	hgsc.bcm.edu	37	2	113147588	113147588	+	Silent	SNP	A	A	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:113147588A>C	ENST00000302558.3	-	20	3125	c.2934T>G	c.(2932-2934)acT>acG	p.T978T	RGPD8_ENST00000409750.1_Silent_p.T838T	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	978					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						CTTCTCCTGAAGTTGATTTTG	0.423																																					p.T978T		Atlas-SNP	.											.	RGPD8	81	.	0			c.T2934G						.						8.0	9.0	8.0					2																	113147588		675	1517	2192	SO:0001819	synonymous_variant	727851	exon20			TCCTGAAGTTGAT	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.2934T>G	chr2.hg19:g.113147588A>C		594.0	0.0		668.0	43.0	NM_001164463	Q5CZA8	Silent	SNP	ENST00000302558.3	hg19	CCDS46394.1																																																																																			.	.		0.423	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
TTN	7273	hgsc.bcm.edu	37	2	179517644	179517644	+	Intron	SNP	T	T	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:179517644T>A	ENST00000591111.1	-	157	34747				TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I12964L|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAACCTCTATGGGAGCCTCT	0.388																																					p.I12964L		Atlas-SNP	.											.	TTN	18412	.	0			c.A38890T						.						145.0	150.0	148.0					2																	179517644		876	1991	2867	SO:0001627	intron_variant	7273	exon200			CCTCTATGGGAGC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34523-376A>T	chr2.hg19:g.179517644T>A		99.0	0.0		114.0	42.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
RUFY4	285180	hgsc.bcm.edu	37	2	218940360	218940360	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:218940360C>T	ENST00000344321.7	+	9	1663	c.1145C>T	c.(1144-1146)aCa>aTa	p.T382I	RUFY4_ENST00000441828.2_3'UTR|RUFY4_ENST00000463872.1_3'UTR|RUFY4_ENST00000374155.3_Missense_Mutation_p.T402I	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	382							metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGACACGCAACAAAGGAAGAC	0.612																																					p.T382I		Atlas-SNP	.											.	RUFY4	59	.	0			c.C1145T						.						55.0	55.0	55.0					2																	218940360		1955	4134	6089	SO:0001583	missense	285180	exon9			ACGCAACAAAGGA	AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.1145C>T	chr2.hg19:g.218940360C>T	ENSP00000345900:p.Thr382Ile	77.0	0.0		149.0	76.0	NM_198483	Q6ZR96	Missense_Mutation	SNP	ENST00000344321.7	hg19		.	.	.	.	.	.	.	.	.	.	C	8.675	0.903808	0.17760	.	.	ENSG00000188282	ENST00000344321;ENST00000374155	T;T	0.48522	1.46;0.81	4.41	1.39	0.22231	.	1.548920	0.04048	N	0.304284	T	0.36358	0.0964	N	0.24115	0.695	0.09310	N	1	P	0.44578	0.838	B	0.39299	0.296	T	0.35425	-0.9789	10	0.38643	T	0.18	0.1536	10.0823	0.42397	0.5704:0.4296:0.0:0.0	.	382	Q6ZNE9	RUFY4_HUMAN	I	382;402	ENSP00000345900:T382I;ENSP00000363270:T402I	ENSP00000345900:T382I	T	+	2	0	RUFY4	218648605	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.371000	0.20450	0.075000	0.16796	0.467000	0.42956	ACA	.	.		0.612	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198483	
NGLY1	55768	hgsc.bcm.edu	37	3	25805746	25805746	+	Silent	SNP	A	A	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr3:25805746A>T	ENST00000280700.5	-	3	463	c.303T>A	c.(301-303)atT>atA	p.I101I	NGLY1_ENST00000428257.1_Silent_p.I101I|NGLY1_ENST00000417874.2_Silent_p.I59I|NGLY1_ENST00000396649.3_Silent_p.I101I|NGLY1_ENST00000422724.2_Silent_p.I24I	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	101					glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						TCAGGTCACGAATTTTTTGCA	0.403																																					p.I101I		Atlas-SNP	.											.	NGLY1	57	.	0			c.T303A						.						182.0	184.0	183.0					3																	25805746		2203	4300	6503	SO:0001819	synonymous_variant	55768	exon3			GTCACGAATTTTT	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.303T>A	chr3.hg19:g.25805746A>T		191.0	0.0		216.0	91.0	NM_018297	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Silent	SNP	ENST00000280700.5	hg19	CCDS33719.1																																																																																			.	.		0.403	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2		
FLNB	2317	hgsc.bcm.edu	37	3	57994556	57994556	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr3:57994556C>G	ENST00000295956.4	+	1	430	c.265C>G	c.(265-267)Cgt>Ggt	p.R89G	FLNB_ENST00000490882.1_Missense_Mutation_p.R89G|FLNB_ENST00000358537.3_Missense_Mutation_p.R89G|FLNB_ENST00000357272.4_Missense_Mutation_p.R89G|FLNB_ENST00000429972.2_Missense_Mutation_p.R89G|FLNB_ENST00000348383.5_Missense_Mutation_p.R89G	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	89	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GTTCCTGGACCGTGAGAGCAT	0.667																																					p.R89G		Atlas-SNP	.											.	FLNB	430	.	0			c.C265G						.						101.0	106.0	104.0					3																	57994556		2203	4300	6503	SO:0001583	missense	2317	exon1			CTGGACCGTGAGA	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.265C>G	chr3.hg19:g.57994556C>G	ENSP00000295956:p.Arg89Gly	63.0	0.0		88.0	44.0	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	hg19	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652832	0.47362	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272	D;D;D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66;-3.66;-3.66	5.34	5.34	0.76211	Calponin homology domain (5);	0.276477	0.32314	N	0.006264	D	0.88952	0.6577	N	0.17594	0.5	0.80722	D	1	B;B;B;B	0.10296	0.001;0.002;0.003;0.003	B;B;B;B	0.19946	0.001;0.027;0.002;0.002	D	0.84940	0.0865	10	0.49607	T	0.09	.	12.4557	0.55702	0.288:0.712:0.0:0.0	.	89;89;89;89	O75369-2;B2ZZ83;Q60FE7;O75369	.;.;.;FLNB_HUMAN	G	89	ENSP00000295956:R89G;ENSP00000420213:R89G;ENSP00000351339:R89G;ENSP00000415599:R89G;ENSP00000232447:R89G;ENSP00000349819:R89G	ENSP00000295956:R89G	R	+	1	0	FLNB	57969596	0.987000	0.35691	0.987000	0.45799	0.956000	0.61745	1.007000	0.29860	2.512000	0.84698	0.585000	0.79938	CGT	.	.		0.667	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
MUC4	4585	hgsc.bcm.edu	37	3	195518119	195518119	+	Missense_Mutation	SNP	A	A	T	rs201789760		TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr3:195518119A>T	ENST00000463781.3	-	2	791	c.332T>A	c.(331-333)aTg>aAg	p.M111K	MUC4_ENST00000475231.1_Missense_Mutation_p.M111K|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	111					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGCTGTCTCCATCACATTGTG	0.463																																					p.M111K		Atlas-SNP	.											.	MUC4	1505	.	0			c.T332A						.						173.0	151.0	158.0					3																	195518119		2001	4135	6136	SO:0001583	missense	4585	exon2			GTCTCCATCACAT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.332T>A	chr3.hg19:g.195518119A>T	ENSP00000417498:p.Met111Lys	167.0	0.0		458.0	38.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.439	-0.114540	0.06881	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.32023	1.47;1.47	3.35	-0.681	0.11342	.	2.861300	0.01499	N	0.017426	T	0.13372	0.0324	N	0.08118	0	0.09310	N	1	B	0.27997	0.197	B	0.27500	0.08	T	0.14035	-1.0487	10	0.05959	T	0.93	0.0033	3.9454	0.09346	0.3204:0.1801:0.4995:0.0	.	111	E7ESK3	.	K	111;111;85	ENSP00000417498:M111K;ENSP00000420243:M111K	ENSP00000376209:M85K	M	-	2	0	MUC4	197002514	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.773000	0.01786	-0.150000	0.11195	-1.819000	0.00600	ATG	.	.		0.463	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
E2F3	1871	hgsc.bcm.edu	37	6	20481646	20481646	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr6:20481646G>A	ENST00000346618.3	+	3	781	c.715G>A	c.(715-717)Gtc>Atc	p.V239I	E2F3_ENST00000535432.1_Missense_Mutation_p.V108I	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	239					mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			TAAAAACAACGTCCAATGGAT	0.478																																					p.V239I		Atlas-SNP	.											.	E2F3	30	.	0			c.G715A						.						109.0	109.0	109.0					6																	20481646		2203	4300	6503	SO:0001583	missense	1871	exon3			AACAACGTCCAAT	Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.715G>A	chr6.hg19:g.20481646G>A	ENSP00000262904:p.Val239Ile	84.0	0.0		93.0	33.0	NM_001949	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	ENST00000346618.3	hg19	CCDS4545.1	.	.	.	.	.	.	.	.	.	.	G	7.632	0.679113	0.14907	.	.	ENSG00000112242	ENST00000346618;ENST00000535432	D;D	0.86865	-2.18;-2.18	5.71	5.71	0.89125	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.151897	0.56097	D	0.000037	T	0.36220	0.0959	N	0.00427	-1.505	0.45295	D	0.998294	B;B	0.26902	0.163;0.001	B;B	0.19666	0.026;0.002	T	0.59595	-0.7425	10	0.02654	T	1	.	7.8115	0.29234	0.1913:0.0:0.8087:0.0	.	239;108	O00716;Q68DT0	E2F3_HUMAN;.	I	239;108	ENSP00000262904:V239I;ENSP00000443418:V108I	ENSP00000262904:V239I	V	+	1	0	E2F3	20589625	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.540000	0.82074	2.860000	0.98153	0.655000	0.94253	GTC	.	.		0.478	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1		
DPCR1	135656	hgsc.bcm.edu	37	6	30918729	30918729	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr6:30918729G>A	ENST00000462446.1	+	2	2516	c.2488G>A	c.(2488-2490)Gcc>Acc	p.A830T	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	275						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						AGAAAGGACAGCCAATGAGAA	0.488																																					p.A830T		Atlas-SNP	.											.	DPCR1	99	.	0			c.G2488A						.						71.0	72.0	72.0					6																	30918729		692	1591	2283	SO:0001583	missense	135656	exon2			AGGACAGCCAATG	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.2488G>A	chr6.hg19:g.30918729G>A	ENSP00000417182:p.Ala830Thr	91.0	0.0		105.0	33.0	NM_080870	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	hg19	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.795863	0.00617	.	.	ENSG00000168631	ENST00000462446	T	0.56275	0.47	0.933	-0.246	0.13022	.	.	.	.	.	T	0.11410	0.0278	L	0.29908	0.895	0.09310	N	0.999996	B	0.23058	0.079	B	0.17979	0.02	T	0.32955	-0.9887	9	0.07175	T	0.84	.	5.085	0.14676	0.2731:0.0:0.7269:0.0	.	830	E9PEI6	.	T	830	ENSP00000417182:A830T	ENSP00000417182:A830T	A	+	1	0	DPCR1	31026708	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-0.884000	0.04166	-0.052000	0.13311	0.109000	0.15622	GCC	.	.		0.488	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
SOGA3	387104	hgsc.bcm.edu	37	6	127796693	127796693	+	Silent	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr6:127796693G>A	ENST00000525778.1	-	6	3223	c.2478C>T	c.(2476-2478)ggC>ggT	p.G826G	SOGA3_ENST00000368268.2_Silent_p.G826G|SOGA3_ENST00000556132.1_Silent_p.G826G|SOGA3_ENST00000465909.2_Silent_p.G826G|SOGA3_ENST00000474293.2_5'UTR|SOGA3_ENST00000481848.2_Silent_p.G826G			Q5TF21	SOGA3_HUMAN	SOGA family member 3	826					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CGATGGTCTTGCCCAGGCGCT	0.672																																					p.G826G		Atlas-SNP	.											.	.	.	.	0			c.C2478T						.						70.0	80.0	77.0					6																	127796693		2152	4249	6401	SO:0001819	synonymous_variant	387104	exon6			GGTCTTGCCCAGG	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2478C>T	chr6.hg19:g.127796693G>A		24.0	0.0		26.0	10.0	NM_001012279		Silent	SNP	ENST00000525778.1	hg19	CCDS43505.1																																																																																			.	.		0.672	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
THSD7A	221981	hgsc.bcm.edu	37	7	11676308	11676308	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr7:11676308C>G	ENST00000423059.4	-	2	722	c.471G>C	c.(469-471)gaG>gaC	p.E157D	THSD7A_ENST00000480061.1_5'UTR	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	157					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGCACGCTATCTCCCTCACCT	0.498										HNSCC(18;0.044)																											p.E157D		Atlas-SNP	.											.	THSD7A	219	.	0			c.G471C						.						124.0	118.0	120.0					7																	11676308		2005	4202	6207	SO:0001583	missense	221981	exon2			CGCTATCTCCCTC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.471G>C	chr7.hg19:g.11676308C>G	ENSP00000406482:p.Glu157Asp	82.0	0.0		101.0	34.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	hg19	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	8.040	0.763667	0.15914	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59502	0.26	5.57	1.78	0.24846	.	0.043316	0.85682	D	0.000000	T	0.30355	0.0762	N	0.16833	0.445	0.44194	D	0.997012	B	0.06786	0.001	B	0.06405	0.002	T	0.04635	-1.0937	10	0.14252	T	0.57	.	1.9432	0.03351	0.1183:0.3959:0.128:0.3578	.	157	Q9UPZ6	THS7A_HUMAN	D	157	ENSP00000406482:E157D	ENSP00000262042:E157D	E	-	3	2	THSD7A	11642833	0.893000	0.30496	0.972000	0.41901	0.565000	0.35776	0.067000	0.14510	0.112000	0.17975	0.650000	0.86243	GAG	.	.		0.498	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
DNAJC1	64215	hgsc.bcm.edu	37	10	22207780	22207780	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr10:22207780C>T	ENST00000376980.3	-	6	947	c.657G>A	c.(655-657)tgG>tgA	p.W219*		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	219					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				GCAAATCATGCCACTGTGGTT	0.373																																					p.W219X		Atlas-SNP	.											.	DNAJC1	42	.	0			c.G657A						.						105.0	89.0	95.0					10																	22207780		2203	4300	6503	SO:0001587	stop_gained	64215	exon6			ATCATGCCACTGT	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.657G>A	chr10.hg19:g.22207780C>T	ENSP00000366179:p.Trp219*	49.0	0.0		66.0	30.0	NM_022365	B0YIZ8|Q5VX89|Q9H6B8	Nonsense_Mutation	SNP	ENST00000376980.3	hg19	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	C	40	8.263892	0.98732	.	.	ENSG00000136770	ENST00000376980	.	.	.	5.82	5.82	0.92795	.	0.060277	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-3.9738	20.0856	0.97800	0.0:1.0:0.0:0.0	.	.	.	.	X	219	.	ENSP00000366179:W219X	W	-	3	0	DNAJC1	22247786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.975000	0.76128	2.734000	0.93682	0.655000	0.94253	TGG	.	.		0.373	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365	
DMBT1	1755	hgsc.bcm.edu	37	10	124390621	124390621	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr10:124390621G>C	ENST00000338354.3	+	46	5889	c.5783G>C	c.(5782-5784)gGg>gCg	p.G1928A	DMBT1_ENST00000368909.3_Missense_Mutation_p.G1928A|DMBT1_ENST00000344338.3_Missense_Mutation_p.G1918A|DMBT1_ENST00000368956.2_Missense_Mutation_p.G1300A|DMBT1_ENST00000330163.4_Missense_Mutation_p.G1300A|DMBT1_ENST00000368955.3_Missense_Mutation_p.G1918A|DMBT1_ENST00000359586.6_Missense_Mutation_p.G648A			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1928	SRCR 14. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AGACAGCTAGGGTGTGGACGT	0.552																																					p.G1928A	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	0			c.G5783C						.						113.0	115.0	114.0					10																	124390621		2071	4214	6285	SO:0001583	missense	1755	exon46			AGCTAGGGTGTGG		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5783G>C	chr10.hg19:g.124390621G>C	ENSP00000342210:p.Gly1928Ala	136.0	0.0		124.0	35.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	hg19		.	.	.	.	.	.	.	.	.	.	G	12.16	1.854584	0.32791	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.41	0.096	0.14488	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.78641	0.4315	H	0.97829	4.085	0.09310	N	1	P;D;B;D;D;D;P	0.76494	0.806;0.999;0.129;0.999;0.991;0.998;0.933	P;D;B;D;P;D;P	0.79784	0.643;0.985;0.02;0.993;0.55;0.99;0.81	T	0.65380	-0.6182	9	0.87932	D	0	.	6.324	0.21232	0.2869:0.1202:0.593:0.0	.	648;1908;1177;2057;1300;1918;1928	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	A	1928;2057;1928;1928;1928;1928;1300;1918;1300;1300;1928;1918;1300;74;648	ENSP00000342210:G1928A;ENSP00000343175:G1918A;ENSP00000327747:G1300A;ENSP00000357905:G1928A;ENSP00000357951:G1918A;ENSP00000357952:G1300A;ENSP00000352593:G648A	ENSP00000331522:G1300A	G	+	2	0	DMBT1	124380611	0.000000	0.05858	0.003000	0.11579	0.164000	0.22412	-0.058000	0.11750	-0.267000	0.09325	-0.345000	0.07892	GGG	.	.		0.552	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
OR56B4	196335	hgsc.bcm.edu	37	11	6129479	6129479	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr11:6129479G>T	ENST00000316529.3	+	1	566	c.471G>T	c.(469-471)agG>agT	p.R157S	RP11-290F24.3_ENST00000529961.1_RNA	NM_001005181.1	NP_001005181.1	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B, member 4	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(10)|skin(6)|urinary_tract(2)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCATGCTCAGGAATGGCCTGT	0.502																																					p.R157S		Atlas-SNP	.											.	OR56B4	50	.	0			c.G471T						.						121.0	109.0	113.0					11																	6129479		2201	4296	6497	SO:0001583	missense	196335	exon1			GCTCAGGAATGGC	AB065513	CCDS31406.1	11p15.4	2012-08-09			ENSG00000180919	ENSG00000180919		"""GPCR / Class A : Olfactory receptors"""	15248	protein-coding gene	gene with protein product							Standard	NM_001005181		Approved		uc010qzx.2	Q8NH76	OTTHUMG00000165531	ENST00000316529.3:c.471G>T	chr11.hg19:g.6129479G>T	ENSP00000321196:p.Arg157Ser	81.0	0.0		110.0	47.0	NM_001005181	Q6IFD7	Missense_Mutation	SNP	ENST00000316529.3	hg19	CCDS31406.1	.	.	.	.	.	.	.	.	.	.	G	9.611	1.131233	0.21041	.	.	ENSG00000180919	ENST00000316529	T	0.36520	1.25	4.06	-0.33	0.12683	GPCR, rhodopsin-like superfamily (1);	0.177648	0.26432	U	0.024405	T	0.56031	0.1958	M	0.89715	3.055	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47535	-0.9110	10	0.87932	D	0	.	1.8156	0.03099	0.3711:0.1279:0.3709:0.1302	.	157	Q8NH76	O56B4_HUMAN	S	157	ENSP00000321196:R157S	ENSP00000321196:R157S	R	+	3	2	OR56B4	6086055	0.000000	0.05858	0.683000	0.30040	0.030000	0.12068	-2.052000	0.01401	0.052000	0.16007	-0.264000	0.10439	AGG	.	.		0.502	OR56B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384668.1	NM_001005181	
DEPDC7	91614	hgsc.bcm.edu	37	11	33037511	33037511	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr11:33037511G>A	ENST00000241051.3	+	1	102	c.10G>A	c.(10-12)Gtg>Atg	p.V4M	DEPDC7_ENST00000311388.3_5'Flank	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	4					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						CATGGCCACCGTGCAGGAGAA	0.697																																					p.V4M		Atlas-SNP	.											.	DEPDC7	94	.	0			c.G10A						.						18.0	28.0	25.0					11																	33037511		2126	4228	6354	SO:0001583	missense	91614	exon1			GCCACCGTGCAGG		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.10G>A	chr11.hg19:g.33037511G>A	ENSP00000241051:p.Val4Met	97.0	0.0		58.0	20.0	NM_001077242	G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	hg19	CCDS41632.1	.	.	.	.	.	.	.	.	.	.	G	34	5.295091	0.95574	.	.	ENSG00000121690	ENST00000241051	T	0.18338	2.22	4.08	3.17	0.36434	.	4.775170	0.00496	N	0.000147	T	0.41190	0.1148	L	0.56769	1.78	0.80722	D	1	B;D;B	0.76494	0.25;0.999;0.25	B;D;B	0.64042	0.044;0.921;0.018	T	0.01319	-1.1386	10	0.87932	D	0	-8.8706	11.9617	0.53011	0.0866:0.0:0.9134:0.0	.	4;4;4	B4DJ78;B4DH51;Q96QD5	.;.;DEPD7_HUMAN	M	4	ENSP00000241051:V4M	ENSP00000241051:V4M	V	+	1	0	DEPDC7	32994087	1.000000	0.71417	0.282000	0.24776	0.848000	0.48234	5.154000	0.64894	1.119000	0.41883	0.472000	0.43445	GTG	.	.		0.697	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1	NM_139160	
IGSF9B	22997	hgsc.bcm.edu	37	11	133815979	133815979	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr11:133815979G>A	ENST00000321016.8	-	2	469	c.239C>T	c.(238-240)cCg>cTg	p.P80L	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P80L			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	80	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GTCCACGTGCGGCGGGTAGTA	0.622																																					p.P80L		Atlas-SNP	.											.	IGSF9B	290	.	0			c.C239T						.						49.0	60.0	56.0					11																	133815979		2122	4224	6346	SO:0001583	missense	22997	exon2			ACGTGCGGCGGGT	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.239C>T	chr11.hg19:g.133815979G>A	ENSP00000317980:p.Pro80Leu	54.0	0.0		72.0	31.0	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	G	28.3	4.912262	0.92178	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160;ENST00000526663	T;T;T;T	0.65178	-0.14;-0.14;-0.14;1.96	5.68	5.68	0.88126	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000004	T	0.81206	0.4774	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81212	-0.1035	10	0.49607	T	0.09	.	19.3986	0.94619	0.0:0.0:1.0:0.0	.	80	Q9UPX0	TUTLB_HUMAN	L	80;80;70;127	ENSP00000317980:P80L;ENSP00000436576:P80L;ENSP00000434026:P70L;ENSP00000435989:P127L	ENSP00000317980:P80L	P	-	2	0	IGSF9B	133321189	1.000000	0.71417	0.187000	0.23214	0.762000	0.43233	9.738000	0.98835	2.693000	0.91896	0.655000	0.94253	CCG	.	.		0.622	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
C3AR1	719	hgsc.bcm.edu	37	12	8212610	8212610	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:8212610T>C	ENST00000307637.4	-	2	375	c.172A>G	c.(172-174)Aca>Gca	p.T58A		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	58					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AACCAAATTGTGTTCACTGTC	0.577																																					p.T58A		Atlas-SNP	.											.	C3AR1	61	.	0			c.A172G						.						104.0	87.0	93.0					12																	8212610		2203	4300	6503	SO:0001583	missense	719	exon2			AAATTGTGTTCAC	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.172A>G	chr12.hg19:g.8212610T>C	ENSP00000302079:p.Thr58Ala	85.0	0.0		94.0	37.0	NM_004054	O43771|Q92868	Missense_Mutation	SNP	ENST00000307637.4	hg19	CCDS8588.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132134	0.77662	.	.	ENSG00000171860	ENST00000307637;ENST00000546241	T;T	0.37235	1.21;1.21	5.8	5.8	0.92144	GPCR, rhodopsin-like superfamily (1);	0.079016	0.47455	D	0.000234	T	0.54481	0.1861	L	0.52206	1.635	0.51482	D	0.999928	D	0.89917	1.0	D	0.97110	1.0	T	0.56275	-0.8006	10	0.72032	D	0.01	.	14.1132	0.65137	0.0:0.0:0.0:1.0	.	58	Q16581	C3AR_HUMAN	A	58	ENSP00000302079:T58A;ENSP00000444500:T58A	ENSP00000302079:T58A	T	-	1	0	C3AR1	8103877	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.967000	0.87967	2.213000	0.71641	0.477000	0.44152	ACA	.	.		0.577	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1		
KLRK1	22914	hgsc.bcm.edu	37	12	10525808	10525808	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:10525808T>A	ENST00000240618.6	-	8	696	c.556A>T	c.(556-558)Aag>Tag	p.K186*	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Nonsense_Mutation_p.K186*|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	186	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.			K -> R (in Ref. 5; BAF84709). {ECO:0000305}.	cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CAGTCTCCCTTCTGCATTTCA	0.353																																					p.K186X		Atlas-SNP	.											.	.	.	.	0			c.A556T						.						144.0	132.0	136.0					12																	10525808		2203	4300	6503	SO:0001587	stop_gained	0	exon13			CTCCCTTCTGCAT	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.556A>T	chr12.hg19:g.10525808T>A	ENSP00000240618:p.Lys186*	149.0	0.0		146.0	58.0	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Nonsense_Mutation	SNP	ENST00000240618.6	hg19	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.261220	0.39995	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	.	.	.	5.59	4.45	0.53987	.	1.130820	0.06527	N	0.740761	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0858	0.30771	0.0:0.0915:0.0:0.9085	.	.	.	.	X	186	.	ENSP00000240618:K186X	K	-	1	0	KLRK1	10417075	0.129000	0.22400	0.003000	0.11579	0.072000	0.16883	3.105000	0.50314	0.964000	0.38108	0.528000	0.53228	AAG	.	.		0.353	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
BICD1	636	hgsc.bcm.edu	37	12	32369238	32369238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:32369238G>T	ENST00000281474.5	+	2	374	c.271G>T	c.(271-273)Gag>Tag	p.E91*	BICD1_ENST00000548411.1_Nonsense_Mutation_p.E91*	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	91					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			AGAGACTCGGGAGGAAACGCT	0.512																																					p.E91X		Atlas-SNP	.											.	BICD1	89	.	0			c.G271T						.						99.0	97.0	98.0					12																	32369238		2203	4300	6503	SO:0001587	stop_gained	636	exon2			ACTCGGGAGGAAA	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.271G>T	chr12.hg19:g.32369238G>T	ENSP00000281474:p.Glu91*	98.0	0.0		79.0	27.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Nonsense_Mutation	SNP	ENST00000281474.5	hg19	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	38	7.155287	0.98099	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	19.5182	0.95174	0.0:0.0:1.0:0.0	.	.	.	.	X	91	.	ENSP00000281474:E91X	E	+	1	0	BICD1	32260505	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.573000	0.98181	2.603000	0.88011	0.655000	0.94253	GAG	.	.		0.512	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
IFNG	3458	hgsc.bcm.edu	37	12	68553297	68553297	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:68553297G>C	ENST00000229135.3	-	1	230	c.99C>G	c.(97-99)aaC>aaG	p.N33K	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	33					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	ATTTCTTAAGGTTTTCTGCTT	0.363																																					p.N33K		Atlas-SNP	.											.	IFNG	38	.	0			c.C99G						.						44.0	42.0	43.0					12																	68553297		2203	4298	6501	SO:0001583	missense	3458	exon1			CTTAAGGTTTTCT		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.99C>G	chr12.hg19:g.68553297G>C	ENSP00000229135:p.Asn33Lys	124.0	0.0		111.0	39.0	NM_000619	B5BU88|Q53ZV4	Missense_Mutation	SNP	ENST00000229135.3	hg19	CCDS8980.1	.	.	.	.	.	.	.	.	.	.	G	4.812	0.150979	0.09185	.	.	ENSG00000111537	ENST00000229135	T	0.40476	1.03	5.12	-6.78	0.01721	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.790903	0.12266	N	0.484252	T	0.17152	0.0412	N	0.21448	0.665	0.09310	N	1	B	0.17038	0.02	B	0.12837	0.008	T	0.18871	-1.0323	9	.	.	.	-2.1183	0.4591	0.00513	0.2001:0.2077:0.2774:0.3148	.	33	P01579	IFNG_HUMAN	K	33	ENSP00000229135:N33K	.	N	-	3	2	IFNG	66839564	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.095000	0.03356	-1.531000	0.01749	-0.500000	0.04577	AAC	.	.		0.363	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1		
TPCN1	53373	hgsc.bcm.edu	37	12	113704076	113704076	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:113704076T>C	ENST00000335509.6	+	4	643	c.329T>C	c.(328-330)cTg>cCg	p.L110P	TPCN1_ENST00000392569.4_Missense_Mutation_p.L42P|TPCN1_ENST00000541517.1_Missense_Mutation_p.L182P|TPCN1_ENST00000550785.1_Missense_Mutation_p.L182P	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	110					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						CTCTTCTACCTGATGGAGCTG	0.612																																					p.L182P		Atlas-SNP	.											.	TPCN1	109	.	0			c.T545C						.						228.0	224.0	225.0					12																	113704076		2203	4300	6503	SO:0001583	missense	53373	exon5			TCTACCTGATGGA	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.329T>C	chr12.hg19:g.113704076T>C	ENSP00000335300:p.Leu110Pro	45.0	0.0		60.0	26.0	NM_001143819	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	hg19	CCDS31908.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.897901	0.72639	.	.	ENSG00000186815	ENST00000552642;ENST00000552985;ENST00000335509;ENST00000552897;ENST00000550785;ENST00000541517;ENST00000392569;ENST00000552542;ENST00000548465	T;D;D;D;D	0.97430	0.69;-4.27;-4.38;-4.38;-4.35	5.29	5.29	0.74685	.	0.201394	0.43579	D	0.000542	D	0.96112	0.8733	L	0.43152	1.355	0.80722	D	1	P;D;P	0.57257	0.911;0.979;0.938	P;P;B	0.50708	0.577;0.648;0.424	D	0.95565	0.8633	10	0.39692	T	0.17	-10.4745	15.2318	0.73395	0.0:0.0:0.0:1.0	.	110;182;110	A5PKY2;Q9ULQ1-3;Q9ULQ1	.;.;TPC1_HUMAN	P	86;196;110;42;182;182;42;42;42	ENSP00000447569:L196P;ENSP00000335300:L110P;ENSP00000448083:L182P;ENSP00000438125:L182P;ENSP00000376350:L42P	ENSP00000335300:L110P	L	+	2	0	TPCN1	112188459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.661000	0.83786	2.001000	0.58596	0.459000	0.35465	CTG	.	.		0.612	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	
TAOK3	51347	hgsc.bcm.edu	37	12	118639247	118639247	+	Silent	SNP	G	G	T	rs537291817		TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:118639247G>T	ENST00000392533.3	-	12	1331	c.841C>A	c.(841-843)Cgg>Agg	p.R281R	TAOK3_ENST00000419821.2_Silent_p.R281R	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	281					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTAGTGGCCGGTCTCGTCGA	0.393																																					p.R281R		Atlas-SNP	.											.	TAOK3	151	.	0			c.C841A						.						93.0	86.0	89.0					12																	118639247		2203	4300	6503	SO:0001819	synonymous_variant	51347	exon12			GTGGCCGGTCTCG	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.841C>A	chr12.hg19:g.118639247G>T		115.0	0.0		115.0	40.0	NM_016281	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Silent	SNP	ENST00000392533.3	hg19	CCDS9188.1																																																																																			.	.		0.393	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281	
GCN1L1	10985	hgsc.bcm.edu	37	12	120578768	120578768	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:120578768C>A	ENST00000300648.6	-	45	5901	c.5889G>T	c.(5887-5889)gaG>gaT	p.E1963D		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1963					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGGGATGATCTCGGGGAGGA	0.527																																					p.E1963D		Atlas-SNP	.											.	GCN1L1	207	.	0			c.G5889T						.						152.0	155.0	154.0					12																	120578768		2033	4200	6233	SO:0001583	missense	10985	exon45			GATGATCTCGGGG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5889G>T	chr12.hg19:g.120578768C>A	ENSP00000300648:p.Glu1963Asp	58.0	0.0		71.0	30.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	hg19	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879607	0.51801	.	.	ENSG00000089154	ENST00000300648	T	0.65364	-0.15	5.11	3.28	0.37604	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	L	0.49455	1.56	0.54753	D	0.999987	P	0.36683	0.565	B	0.34038	0.174	T	0.41770	-0.9490	10	0.29301	T	0.29	.	7.4006	0.26962	0.0:0.7064:0.0:0.2936	.	1963	Q92616	GCN1L_HUMAN	D	1963	ENSP00000300648:E1963D	ENSP00000300648:E1963D	E	-	3	2	GCN1L1	119063151	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	1.623000	0.37008	1.148000	0.42385	0.462000	0.41574	GAG	.	.		0.527	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
EP400	57634	hgsc.bcm.edu	37	12	132471242	132471242	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr12:132471242C>T	ENST00000333577.4	+	7	2330	c.2221C>T	c.(2221-2223)Cgg>Tgg	p.R741W	EP400_ENST00000332482.4_Missense_Mutation_p.R668W|EP400_ENST00000389562.2_Missense_Mutation_p.R704W|EP400_ENST00000330386.6_Missense_Mutation_p.R705W|EP400_ENST00000389561.2_Missense_Mutation_p.R705W			Q96L91	EP400_HUMAN	E1A binding protein p400	741					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGTCACTTCCCGGACCCCAGG	0.587																																					p.R705W		Atlas-SNP	.											.	EP400	370	.	0			c.C2113T						.						114.0	110.0	111.0					12																	132471242		2203	4300	6503	SO:0001583	missense	57634	exon6			ACTTCCCGGACCC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2221C>T	chr12.hg19:g.132471242C>T	ENSP00000333602:p.Arg741Trp	41.0	0.0		40.0	14.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	hg19		.	.	.	.	.	.	.	.	.	.	C	10.20	1.285411	0.23478	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.63;-2.64	5.45	5.45	0.79879	.	0.255650	0.36482	N	0.002565	D	0.93468	0.7916	L	0.56769	1.78	0.37563	D	0.919157	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999	P;P;P;D;P	0.72075	0.804;0.804;0.804;0.976;0.9	D	0.94370	0.7595	10	0.56958	D	0.05	.	12.4227	0.55529	0.2828:0.7172:0.0:0.0	.	705;705;704;741;668	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	W	668;741;705;704;668;705;741;705;705	ENSP00000333602:R741W;ENSP00000374212:R705W;ENSP00000374213:R704W;ENSP00000331737:R668W;ENSP00000330620:R705W	ENSP00000330620:R705W	R	+	1	2	EP400	131037195	1.000000	0.71417	0.998000	0.56505	0.136000	0.21042	3.137000	0.50562	2.562000	0.86427	0.563000	0.77884	CGG	.	.		0.587	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
CCDC168	643677	hgsc.bcm.edu	37	13	103385109	103385109	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr13:103385109C>A	ENST00000322527.2	-	1	4050	c.4051G>T	c.(4051-4053)Gaa>Taa	p.E1351*		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1351																	GTTTTCTCTTCTTGCAGATGT	0.408																																					p.E5980X		Atlas-SNP	.											.	.	.	.	0			c.G17938T						.						177.0	135.0	148.0					13																	103385109		692	1591	2283	SO:0001587	stop_gained	643677	exon4			TCTCTTCTTGCAG		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4051G>T	chr13.hg19:g.103385109C>A	ENSP00000320232:p.Glu1351*	154.0	0.0		170.0	67.0	NM_001146197	Q8N800	Nonsense_Mutation	SNP	ENST00000322527.2	hg19		.	.	.	.	.	.	.	.	.	.	C	38	6.726868	0.97792	.	.	ENSG00000175820	ENST00000322527	.	.	.	2.62	0.844	0.18943	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	4.8939	0.13740	0.0:0.6931:0.0:0.3069	.	.	.	.	X	1351	.	ENSP00000320232:E1351X	E	-	1	0	CCDC168	102183110	0.003000	0.15002	0.001000	0.08648	0.017000	0.09413	0.690000	0.25451	0.180000	0.19960	0.460000	0.39030	GAA	.	.		0.408	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45700393	45700393	+	Silent	SNP	A	A	G			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr14:45700393A>G	ENST00000310806.4	-	8	2003	c.1545T>C	c.(1543-1545)gaT>gaC	p.D515D		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	515					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TTTGAGCAGTATCTGTTTGGT	0.368																																					p.D515D		Atlas-SNP	.											.	MIS18BP1	92	.	0			c.T1545C						.						251.0	200.0	217.0					14																	45700393		2203	4300	6503	SO:0001819	synonymous_variant	55320	exon8			AGCAGTATCTGTT	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.1545T>C	chr14.hg19:g.45700393A>G		263.0	0.0		251.0	101.0	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Silent	SNP	ENST00000310806.4	hg19	CCDS9684.1																																																																																			.	.		0.368	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
NEK9	91754	hgsc.bcm.edu	37	14	75580093	75580093	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr14:75580093C>T	ENST00000238616.5	-	8	1045	c.887G>A	c.(886-888)aGa>aAa	p.R296K		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TGCAGTAGGTCTCTGCTCAGG	0.398																																					p.R296K		Atlas-SNP	.											.	NEK9	64	.	0			c.G887A						.						133.0	130.0	131.0					14																	75580093		2203	4300	6503	SO:0001583	missense	91754	exon8			GTAGGTCTCTGCT	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.887G>A	chr14.hg19:g.75580093C>T	ENSP00000238616:p.Arg296Lys	97.0	0.0		159.0	28.0	NM_033116	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	hg19	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	C	36	5.769402	0.96914	.	.	ENSG00000119638	ENST00000238616;ENST00000540227	T	0.70869	-0.52	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91815	0.7410	H	0.99197	4.465	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.94648	0.7836	10	0.87932	D	0	.	20.2019	0.98263	0.0:1.0:0.0:0.0	.	296	Q8TD19	NEK9_HUMAN	K	296;278	ENSP00000238616:R296K	ENSP00000238616:R296K	R	-	2	0	NEK9	74649846	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.050000	0.76620	2.776000	0.95493	0.655000	0.94253	AGA	.	.		0.398	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116	
NRXN3	9369	hgsc.bcm.edu	37	14	80328058	80328058	+	Silent	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr14:80328058C>A	ENST00000557594.1	+	6	2618	c.1665C>A	c.(1663-1665)atC>atA	p.I555I	NRXN3_ENST00000281127.7_Silent_p.I350I|NRXN3_ENST00000335750.5_Silent_p.I979I|NRXN3_ENST00000554719.1_Silent_p.I979I|NRXN3_ENST00000428277.2_Silent_p.I377I|NRXN3_ENST00000556003.1_3'UTR	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	555					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAGAGGTGATCCGGGAGTCGA	0.582																																					p.I979I		Atlas-SNP	.											.	NRXN3	342	.	0			c.C2937A						.						57.0	57.0	57.0					14																	80328058		2203	4300	6503	SO:0001819	synonymous_variant	9369	exon17			GGTGATCCGGGAG	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1665C>A	chr14.hg19:g.80328058C>A		56.0	0.0		60.0	30.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000557594.1	hg19																																																																																				.	.		0.582	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
PPP4R4	57718	hgsc.bcm.edu	37	14	94697004	94697004	+	Silent	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr14:94697004G>A	ENST00000304338.3	+	4	529	c.375G>A	c.(373-375)gtG>gtA	p.V125V	PPP4R4_ENST00000555690.1_3'UTR	NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	125					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						ACGAATCAGTGTCAATTCATG	0.468																																					p.V125V		Atlas-SNP	.											.	PPP4R4	107	.	0			c.G375A						.						142.0	121.0	128.0					14																	94697004		2203	4300	6503	SO:0001819	synonymous_variant	57718	exon4			ATCAGTGTCAATT	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.375G>A	chr14.hg19:g.94697004G>A		64.0	0.0		82.0	5.0	NM_058237	Q9BUF8|Q9HCF0	Silent	SNP	ENST00000304338.3	hg19	CCDS9921.1																																																																																			.	.		0.468	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
PLA2G4F	255189	hgsc.bcm.edu	37	15	42437866	42437866	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr15:42437866C>T	ENST00000382396.4	-	16	1773	c.1687G>A	c.(1687-1689)Gcc>Acc	p.A563T	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.A565T			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	563	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GTGGCAAAGGCGCTGCCCCAC	0.642																																					p.A563T		Atlas-SNP	.											.	PLA2G4F	75	.	0			c.G1687A						.						67.0	71.0	70.0					15																	42437866		2203	4299	6502	SO:0001583	missense	255189	exon16			CAAAGGCGCTGCC		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.1687G>A	chr15.hg19:g.42437866C>T	ENSP00000371833:p.Ala563Thr	50.0	0.0		57.0	29.0	NM_213600	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	hg19	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456514	0.63401	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.08720	3.06;3.06	5.0	5.0	0.66597	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.51477	D	0.000091	T	0.37019	0.0988	M	0.89095	3.005	0.48901	D	0.999726	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.37776	-0.9691	10	0.54805	T	0.06	-29.2667	18.6782	0.91537	0.0:1.0:0.0:0.0	.	350;563	A2RRC4;Q68DD2	.;PA24F_HUMAN	T	559;565;563;563	ENSP00000380442:A565T;ENSP00000371833:A563T	ENSP00000290497:A559T	A	-	1	0	PLA2G4F	40225158	1.000000	0.71417	0.962000	0.40283	0.037000	0.13140	5.817000	0.69229	2.499000	0.84300	0.484000	0.47621	GCC	.	.		0.642	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
JMJD8	339123	hgsc.bcm.edu	37	16	733364	733364	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr16:733364C>T	ENST00000293882.4	-	6	678	c.679G>A	c.(679-681)Ggc>Agc	p.G227S	JMJD8_ENST00000562824.1_Missense_Mutation_p.G127S|JMJD8_ENST00000454700.1_Missense_Mutation_p.G197S|JMJD8_ENST00000412368.2_Missense_Mutation_p.G178S|JMJD8_ENST00000562111.1_Missense_Mutation_p.G157S|JMJD8_ENST00000609261.1_Missense_Mutation_p.G157S			Q96S16	JMJD8_HUMAN	jumonji domain containing 8	227	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.					extracellular vesicular exosome (GO:0070062)				breast(1)	1						CCCAGCAGGCCAAATGGGGGT	0.582																																					p.G178S		Atlas-SNP	.											.	JMJD8	14	.	0			c.G532A						.						33.0	39.0	37.0					16																	733364		1938	4101	6039	SO:0001583	missense	339123	exon6			GCAGGCCAAATGG		CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.679G>A	chr16.hg19:g.733364C>T	ENSP00000293882:p.Gly227Ser	80.0	0.0		87.0	54.0	NM_001005920	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Missense_Mutation	SNP	ENST00000293882.4	hg19		.	.	.	.	.	.	.	.	.	.	C	3.053	-0.194890	0.06259	.	.	ENSG00000161999	ENST00000412368;ENST00000293882;ENST00000454700	T;T;T	0.69306	-0.39;-0.39;-0.39	4.09	-2.27	0.06846	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	1.172240	0.05931	N	0.635204	T	0.39279	0.1072	N	0.05441	-0.05	0.09310	N	1	B;B	0.17268	0.017;0.021	B;B	0.21151	0.019;0.033	T	0.30001	-0.9993	10	0.06757	T	0.87	0.0235	6.7022	0.23230	0.0:0.2065:0.3762:0.4173	.	197;227	Q96S16-2;Q96S16	.;JMJD8_HUMAN	S	178;227;197	ENSP00000399475:G178S;ENSP00000293882:G227S;ENSP00000394147:G197S	ENSP00000293882:G227S	G	-	1	0	JMJD8	673365	0.000000	0.05858	0.000000	0.03702	0.308000	0.27856	0.452000	0.21795	-0.186000	0.10533	0.556000	0.70494	GGC	.	.		0.582	JMJD8-201	KNOWN	basic	protein_coding	protein_coding		NM_001005920	
IL21R	50615	hgsc.bcm.edu	37	16	27460191	27460191	+	Silent	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr16:27460191C>T	ENST00000337929.3	+	9	1677	c.1204C>T	c.(1204-1206)Ctg>Ttg	p.L402L	IL21R_ENST00000395755.1_Silent_p.L402L|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Silent_p.L402L|IL21R_ENST00000564089.1_Silent_p.L402L	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	402					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CTACCCAGCCCTGGACCTGGA	0.632			T	BCL6	NHL																																p.L424L		Atlas-SNP	.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95	.	0			c.C1270T						.						50.0	53.0	52.0					16																	27460191		2197	4300	6497	SO:0001819	synonymous_variant	50615	exon10			CCAGCCCTGGACC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1204C>T	chr16.hg19:g.27460191C>T		48.0	0.0		91.0	39.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	ENST00000337929.3	hg19	CCDS10630.1																																																																																			.	.		0.632	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
IL21R	50615	hgsc.bcm.edu	37	16	27460214	27460214	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr16:27460214G>T	ENST00000337929.3	+	9	1700	c.1227G>T	c.(1225-1227)gaG>gaT	p.E409D	IL21R_ENST00000395755.1_Missense_Mutation_p.E409D|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Missense_Mutation_p.E409D|IL21R_ENST00000564089.1_Missense_Mutation_p.E409D	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	409					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CTGGCCTGGAGCCCAGCCCAG	0.647			T	BCL6	NHL																																p.E431D		Atlas-SNP	.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95	.	0			c.G1293T						.						46.0	51.0	49.0					16																	27460214		2197	4300	6497	SO:0001583	missense	50615	exon10			CCTGGAGCCCAGC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1227G>T	chr16.hg19:g.27460214G>T	ENSP00000338010:p.Glu409Asp	45.0	0.0		84.0	30.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	hg19	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968143	0.34754	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.35789	1.29;1.29;1.29	5.19	-1.47	0.08772	.	0.867272	0.10160	N	0.708430	T	0.31796	0.0808	L	0.50919	1.6	0.09310	N	1	D	0.56035	0.974	P	0.44946	0.465	T	0.29640	-1.0005	10	0.33141	T	0.24	-12.5197	8.583	0.33642	0.0:0.3509:0.3847:0.2644	.	409	Q9HBE5	IL21R_HUMAN	D	409	ENSP00000338010:E409D;ENSP00000379104:E409D;ENSP00000379103:E409D	ENSP00000338010:E409D	E	+	3	2	IL21R	27367715	0.016000	0.18221	0.015000	0.15790	0.003000	0.03518	0.337000	0.19841	-0.055000	0.13244	-1.083000	0.02208	GAG	.	.		0.647	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
DUSP14	11072	hgsc.bcm.edu	37	17	35872856	35872856	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr17:35872856A>G	ENST00000487847.1	+	2	1460	c.482A>G	c.(481-483)tAc>tGc	p.Y161C	DUSP14_ENST00000394386.1_Missense_Mutation_p.Y161C|DUSP14_ENST00000394389.4_Missense_Mutation_p.Y161C			O95147	DUS14_HUMAN	dual specificity phosphatase 14	161					peptidyl-tyrosine dephosphorylation (GO:0035335)		MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|poly(A) RNA binding (GO:0044822)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|urinary_tract(1)	9		Breast(25;0.00637)|Ovarian(249;0.15)				CTGATAGACTACGAGCGCCAG	0.537																																					p.Y161C		Atlas-SNP	.											.	DUSP14	16	.	0			c.A482G						.						57.0	56.0	56.0					17																	35872856		2203	4300	6503	SO:0001583	missense	11072	exon3			TAGACTACGAGCG	AF038844	CCDS11320.1	17q12	2014-05-06			ENSG00000161326	ENSG00000276023		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	17007	protein-coding gene	gene with protein product	"""MKP-1 like protein tyrosine phosphatase"""	606618				11123293	Standard	XM_005256977		Approved	MKP-L, MKP6	uc002hnx.2	O95147	OTTHUMG00000188472	ENST00000487847.1:c.482A>G	chr17.hg19:g.35872856A>G	ENSP00000466299:p.Tyr161Cys	36.0	0.0		31.0	12.0	NM_007026		Missense_Mutation	SNP	ENST00000487847.1	hg19	CCDS11320.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125984	0.77436	.	.	ENSG00000161326	ENST00000394389;ENST00000394386	T;T	0.63096	-0.02;-0.02	6.06	6.06	0.98353	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.82802	0.5116	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86040	0.1519	10	0.87932	D	0	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	161	O95147	DUS14_HUMAN	C	161	ENSP00000377912:Y161C;ENSP00000377910:Y161C	ENSP00000377910:Y161C	Y	+	2	0	DUSP14	32946969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.323000	0.78572	0.528000	0.53228	TAC	.	.		0.537	DUSP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256680.3	NM_007026	
GAST	2520	hgsc.bcm.edu	37	17	39872101	39872101	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr17:39872101C>T	ENST00000329402.3	+	3	350	c.283C>T	c.(283-285)Cgc>Tgc	p.R95C	RNA5SP442_ENST00000365050.1_RNA|JUP_ENST00000540235.1_Intron	NM_000805.4	NP_000796.1	P01350	GAST_HUMAN	gastrin	95		Cleavage.			G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.R95S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CTTCGGCCGCCGCAGTGCTGA	0.557																																					p.R95C		Atlas-SNP	.											GAST,NS,carcinoma,0,1	GAST	13	.	1	Substitution - Missense(1)	kidney(1)	c.C283T						.						64.0	66.0	65.0					17																	39872101		2203	4300	6503	SO:0001583	missense	2520	exon3			GGCCGCCGCAGTG		CCDS11404.1	17q21.2	2013-02-26	2005-06-14	2005-06-14	ENSG00000184502	ENSG00000184502		"""Endogenous ligands"""	4164	protein-coding gene	gene with protein product	"""preprogastrin"""	137250		GAS			Standard	NM_000805		Approved		uc002hxl.3	P01350	OTTHUMG00000133496	ENST00000329402.3:c.283C>T	chr17.hg19:g.39872101C>T	ENSP00000331358:p.Arg95Cys	63.0	0.0		59.0	22.0	NM_000805	P78463|P78464	Missense_Mutation	SNP	ENST00000329402.3	hg19	CCDS11404.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.495508	0.44352	.	.	ENSG00000184502	ENST00000329402	T	0.68765	-0.35	4.74	4.74	0.60224	Gastrin/cholecystokinin peptide hormone (2);	0.000000	0.51477	D	0.000084	T	0.80031	0.4549	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.82315	-0.0518	10	0.87932	D	0	-18.3216	13.1178	0.59309	0.0:1.0:0.0:0.0	.	95	P01350	GAST_HUMAN	C	95	ENSP00000331358:R95C	ENSP00000331358:R95C	R	+	1	0	GAST	37125627	0.999000	0.42202	0.998000	0.56505	0.003000	0.03518	3.303000	0.51858	2.455000	0.83008	0.655000	0.94253	CGC	.	.		0.557	GAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257409.1		
NKIRAS2	28511	hgsc.bcm.edu	37	17	40179065	40179065	+	IGR	SNP	G	G	T	rs71373480		TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr17:40179065G>T	ENST00000307641.5	+	0	2945				ZNF385C_ENST00000461831.1_5'UTR|ZNF385C_ENST00000436535.3_Silent_p.I450I	NM_001001349.2	NP_001001349.1	Q9NYR9	KBRS2_HUMAN	NFKB inhibitor interacting Ras-like 2						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	9		all_cancers(22;1.1e-05)|Breast(137;0.000143)|all_epithelial(22;0.000319)				GCAGAGCACAGATGGCAGTGG	0.652																																					p.I375I		Atlas-SNP	.											.	ZNF385C	7	.	0			c.C1125A						.						42.0	48.0	46.0					17																	40179065		2203	4298	6501	SO:0001628	intergenic_variant	201181	exon8			AGCACAGATGGCA	AF229840	CCDS11415.1, CCDS45679.1, CCDS45680.1	17q21.31	2014-05-09	2004-05-20		ENSG00000168256	ENSG00000168256			17898	protein-coding gene	gene with protein product		604497	"""NFKB inhibitor interacting Ras-like protein 2"""			10657303	Standard	NM_001001349		Approved	KBRAS2, DKFZP434N1526, kappaB-Ras2	uc002hys.3	Q9NYR9	OTTHUMG00000133503		chr17.hg19:g.40179065G>T		82.0	0.0		90.0	39.0	NM_001242704	A6NCZ5|B3KNN0|B4DNM3|Q6PK52|Q96KC7|Q9NSX1	Silent	SNP	ENST00000307641.5	hg19	CCDS11415.1																																																																																			.	G|0.500;A|0.500		0.652	NKIRAS2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257457.1	NM_017595	
DNAH17	8632	hgsc.bcm.edu	37	17	76462860	76462860	+	Silent	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr17:76462860C>A	ENST00000585328.1	-	56	8926	c.8802G>T	c.(8800-8802)cgG>cgT	p.R2934R	DNAH17_ENST00000389840.5_Silent_p.R2925R|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2925	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGCTCGTACCCGCAGCACGG	0.627																																					p.R2939R		Atlas-SNP	.											.	DNAH17	347	.	0			c.G8817T						.						33.0	42.0	39.0					17																	76462860		2139	4264	6403	SO:0001819	synonymous_variant	8632	exon56			TCGTACCCGCAGC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8802G>T	chr17.hg19:g.76462860C>A		37.0	0.0		41.0	21.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	hg19																																																																																				.	.		0.627	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
TSHZ1	10194	hgsc.bcm.edu	37	18	72998476	72998476	+	Missense_Mutation	SNP	G	G	A	rs574385316		TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr18:72998476G>A	ENST00000580243.1	+	2	1462	c.1114G>A	c.(1114-1116)Gca>Aca	p.A372T	TSHZ1_ENST00000322038.5_Missense_Mutation_p.A327T			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	372					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		AGGAATGGCCGCAGAGGTGGC	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19208	0.0		0.0	False		,,,				2504	0.0				p.A327T		Atlas-SNP	.											.	TSHZ1	104	.	0			c.G979A						.						74.0	82.0	79.0					18																	72998476		2203	4300	6503	SO:0001583	missense	10194	exon2			ATGGCCGCAGAGG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1114G>A	chr18.hg19:g.72998476G>A	ENSP00000464391:p.Ala372Thr	78.0	0.0		79.0	34.0	NM_005786	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	hg19		.	.	.	.	.	.	.	.	.	.	G	1.242	-0.621015	0.03636	.	.	ENSG00000179981	ENST00000322038	T	0.11277	2.79	5.27	-2.73	0.05950	.	0.571079	0.17601	N	0.168404	T	0.04452	0.0122	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43310	-0.9399	10	0.06757	T	0.87	-2.434	0.0607	0.00015	0.2732:0.1957:0.2408:0.2903	.	372	Q6ZSZ6	TSH1_HUMAN	T	327	ENSP00000323584:A327T	ENSP00000323584:A327T	A	+	1	0	TSHZ1	71127464	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.712000	0.05013	1.206000	0.43276	0.561000	0.74099	GCA	.	.		0.627	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
MISP	126353	hgsc.bcm.edu	37	19	758170	758170	+	Silent	SNP	C	C	T	rs530131211		TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr19:758170C>T	ENST00000215582.6	+	2	1327	c.1224C>T	c.(1222-1224)gcC>gcT	p.A408A		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	408					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CCCGTGCGGCCGACCCAGCTC	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13659	0.0		0.0	False		,,,				2504	0.0				p.A408A		Atlas-SNP	.											.	C19orf21	56	.	0			c.C1224T						.						19.0	17.0	18.0					19																	758170		2192	4285	6477	SO:0001819	synonymous_variant	126353	exon2			TGCGGCCGACCCA	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1224C>T	chr19.hg19:g.758170C>T		36.0	0.0		49.0	17.0	NM_173481		Silent	SNP	ENST00000215582.6	hg19	CCDS12042.1																																																																																			.	.		0.667	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
CEACAM6	4680	hgsc.bcm.edu	37	19	42266039	42266039	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr19:42266039T>C	ENST00000199764.6	+	4	1084	c.866T>C	c.(865-867)aTc>aCc	p.I289T	AC011513.4_ENST00000601409.1_RNA	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	289	Ig-like C2-type 2.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		ATCCCCAACATCACTGTGAAT	0.498																																					p.I289T		Atlas-SNP	.											.	CEACAM6	52	.	0			c.T866C						.						137.0	120.0	126.0					19																	42266039		2203	4300	6503	SO:0001583	missense	4680	exon4			CCAACATCACTGT	M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.866T>C	chr19.hg19:g.42266039T>C	ENSP00000199764:p.Ile289Thr	138.0	0.0		150.0	56.0	NM_002483	Q13774|Q14920|Q53XP7	Missense_Mutation	SNP	ENST00000199764.6	hg19	CCDS12585.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.287950	0.40494	.	.	ENSG00000086548	ENST00000199764	T	0.13901	2.55	1.87	1.87	0.25490	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33118	0.0852	M	0.81179	2.53	0.09310	N	1	D	0.65815	0.995	D	0.71184	0.972	T	0.05566	-1.0877	9	0.87932	D	0	.	5.677	0.17753	0.0:0.0:0.0:1.0	.	289	P40199	CEAM6_HUMAN	T	289	ENSP00000199764:I289T	ENSP00000199764:I289T	I	+	2	0	CEACAM6	46957879	0.004000	0.15560	0.681000	0.30009	0.115000	0.19883	1.621000	0.36986	0.858000	0.35431	0.254000	0.18369	ATC	.	.		0.498	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1		
CARD8	22900	hgsc.bcm.edu	37	19	48718639	48718639	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr19:48718639C>A	ENST00000359009.4	-	9	1300	c.988G>T	c.(988-990)Gat>Tat	p.D330Y	CARD8_ENST00000521613.1_Missense_Mutation_p.D386Y|CARD8_ENST00000520153.1_Missense_Mutation_p.D386Y|ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000519940.1_Missense_Mutation_p.D436Y|CARD8_ENST00000447740.2_Missense_Mutation_p.D386Y|CARD8_ENST00000520015.1_Missense_Mutation_p.W388C|CTC-453G23.8_ENST00000595201.1_RNA|CARD8_ENST00000391898.3_Missense_Mutation_p.D436Y|CARD8_ENST00000357778.5_Missense_Mutation_p.D161Y|CARD8_ENST00000520753.1_Missense_Mutation_p.W388C			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	330					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		AGCTGGAGATCCACTACAAAA	0.373																																					p.D436Y		Atlas-SNP	.											.	CARD8	53	.	0			c.G1306T						.						73.0	69.0	70.0					19																	48718639		2203	4300	6503	SO:0001583	missense	22900	exon10			GGAGATCCACTAC	AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.988G>T	chr19.hg19:g.48718639C>A	ENSP00000351901:p.Asp330Tyr	72.0	0.0		72.0	26.0	NM_001184900	B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Missense_Mutation	SNP	ENST00000359009.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.61|10.61	1.397879|1.397879	0.25205|0.25205	.|.	.|.	ENSG00000105483|ENSG00000105483	ENST00000357778;ENST00000447740;ENST00000391898;ENST00000359009;ENST00000520153;ENST00000521613;ENST00000519940|ENST00000520753;ENST00000520015	T;T;T;T;T;T;T|T;T	0.26810|0.16743	1.71;1.71;1.71;1.71;1.71;1.71;1.71|2.32;2.32	1.57|1.57	0.503|0.503	0.16940|0.16940	.|.	.|.	.|.	.|.	.|.	T|T	0.32194|0.32194	0.0821|0.0821	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D;D;D;D;D|B;D;D	0.76494|0.76494	0.997;0.999;0.999;0.997;0.997|0.013;0.999;0.998	D;D;D;D;D|B;D;D	0.71870|0.74674	0.954;0.975;0.975;0.923;0.954|0.001;0.984;0.938	T|T	0.10109|0.10109	-1.0644|-1.0644	8|8	0.87932|0.87932	D|D	0|0	.|.	4.009|4.009	0.09615|0.09615	0.0:0.7732:0.0:0.2268|0.0:0.7732:0.0:0.2268	.|.	355;436;436;386;330|279;388;282	B5KVR7;E9PEM7;B5KVR6;G3XAM9;Q9Y2G2|Q6MZI8;Q9Y2G2-3;Q9Y2G2-2	.;.;.;.;CARD8_HUMAN|.;.;.	Y|C	161;386;436;330;386;386;436|388	ENSP00000350423:D161Y;ENSP00000391248:D386Y;ENSP00000375767:D436Y;ENSP00000351901:D330Y;ENSP00000428736:D386Y;ENSP00000427858:D386Y;ENSP00000428883:D436Y|ENSP00000429839:W388C;ENSP00000430747:W388C	ENSP00000350423:D161Y|ENSP00000430747:W388C	D|W	-|-	1|3	0|0	CARD8|CARD8	53410451|53410451	0.009000|0.009000	0.17119|0.17119	0.072000|0.072000	0.20136|0.20136	0.061000|0.061000	0.15899|0.15899	0.229000|0.229000	0.17833|0.17833	0.239000|0.239000	0.21243|0.21243	0.313000|0.313000	0.20887|0.20887	GAT|TGG	.	.		0.373	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014959	
ZNF534	147658	hgsc.bcm.edu	37	19	52938382	52938382	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr19:52938382G>A	ENST00000332323.6	+	3	291	c.230G>A	c.(229-231)aGa>aAa	p.R77K	ZNF534_ENST00000301085.4_Missense_Mutation_p.R64K|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.R64K	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	77	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						GAGCAAAAGAGAGATCCCTGG	0.453																																					p.R77K		Atlas-SNP	.											.	ZNF534	105	.	0			c.G230A						.						126.0	104.0	110.0					19																	52938382		1568	3582	5150	SO:0001583	missense	147658	exon3			AAAAGAGAGATCC	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.230G>A	chr19.hg19:g.52938382G>A	ENSP00000327538:p.Arg77Lys	143.0	0.0		104.0	44.0	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	hg19	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.091411	0.00367	.	.	ENSG00000198633	ENST00000301085;ENST00000332323;ENST00000433050;ENST00000391790	T;T;T	0.05649	5.79;3.41;3.43	1.67	-3.34	0.04943	Krueppel-associated box (2);	.	.	.	.	T	0.01730	0.0055	N	0.02751	-0.505	0.09310	N	1	B;B;B	0.17852	0.001;0.0;0.024	B;B;B	0.11329	0.0;0.0;0.006	T	0.40213	-0.9575	9	0.02654	T	1	.	3.3017	0.06985	0.4699:0.2187:0.3114:0.0	.	64;77;64	Q76KX8-2;Q76KX8;Q1T7F5	.;ZN534_HUMAN;.	K	64;77;64;76	ENSP00000301085:R64K;ENSP00000327538:R77K;ENSP00000391358:R64K	ENSP00000301085:R64K	R	+	2	0	ZNF534	57630194	0.005000	0.15991	0.001000	0.08648	0.024000	0.10985	-0.185000	0.09684	-1.449000	0.01938	-0.474000	0.04947	AGA	.	.		0.453	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
SGSM1	129049	hgsc.bcm.edu	37	22	25275471	25275471	+	Silent	SNP	C	C	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr22:25275471C>A	ENST00000400359.4	+	15	1645	c.1638C>A	c.(1636-1638)atC>atA	p.I546I	SGSM1_ENST00000400358.4_Silent_p.I491I	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	546						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						AGTACCAGATCCTCTCCAGAG	0.488																																					p.I546I		Atlas-SNP	.											.	SGSM1	150	.	0			c.C1638A						.						79.0	74.0	76.0					22																	25275471		1881	4113	5994	SO:0001819	synonymous_variant	129049	exon15			CCAGATCCTCTCC	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.1638C>A	chr22.hg19:g.25275471C>A		84.0	0.0		90.0	44.0	NM_133454	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Silent	SNP	ENST00000400359.4	hg19	CCDS46674.1																																																																																			.	.		0.488	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	
MTMR3	8897	hgsc.bcm.edu	37	22	30418642	30418642	+	Silent	SNP	G	G	C			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr22:30418642G>C	ENST00000401950.2	+	19	3723	c.3381G>C	c.(3379-3381)gcG>gcC	p.A1127A	MTMR3_ENST00000351488.3_Silent_p.A1090A|CTA-85E5.10_ENST00000453743.2_RNA|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Silent_p.A1090A|MTMR3_ENST00000406629.1_Silent_p.A1090A|MTMR3_ENST00000323630.5_Silent_p.A991A	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	1127					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ACTGCTATGCGTGCGACAGTG	0.617																																					p.A1127A		Atlas-SNP	.											MTMR3_ENST00000401950,NS,carcinoma,0,1	MTMR3	106	.	0			c.G3381C						.						81.0	62.0	68.0					22																	30418642		2203	4300	6503	SO:0001819	synonymous_variant	8897	exon19			CTATGCGTGCGAC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.3381G>C	chr22.hg19:g.30418642G>C		6.0	1.0		21.0	10.0	NM_021090	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	hg19	CCDS13870.1																																																																																			.	.		0.617	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
RFPL2	10739	hgsc.bcm.edu	37	22	32588963	32588963	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr22:32588963G>A	ENST00000400237.1	-	4	1417	c.482C>T	c.(481-483)gCt>gTt	p.A161V	RFPL2_ENST00000400236.3_Missense_Mutation_p.A71V|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248983.4_Missense_Mutation_p.A71V|RFPL2_ENST00000248980.4_Missense_Mutation_p.A100V			O75678	RFPL2_HUMAN	ret finger protein-like 2	161							zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						GATGTGGGAAGCCAGCCTCTC	0.537																																					p.A161V		Atlas-SNP	.											RFPL2_ENST00000400237,NS,neuroblastoma,0,3	RFPL2	81	.	0			c.C482T						.						94.0	97.0	96.0					22																	32588963		2203	4300	6503	SO:0001583	missense	10739	exon4			TGGGAAGCCAGCC	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.482C>T	chr22.hg19:g.32588963G>A	ENSP00000383096:p.Ala161Val	125.0	0.0		156.0	7.0	NM_001098527		Missense_Mutation	SNP	ENST00000400237.1	hg19	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.303198	0.00240	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	0.636	-0.54	0.11861	Zinc finger, RING/FYVE/PHD-type (1);RDM domain, Ret finger protein-like (1);	.	.	.	.	T	0.02047	0.0064	N	0.00217	-1.83	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.41893	-0.9483	8	0.02654	T	1	.	.	.	.	.	161;100	O75678;O75678-3	RFPL2_HUMAN;.	V	100;71;71;161	ENSP00000248980:A100V;ENSP00000248983:A71V;ENSP00000383095:A71V;ENSP00000383096:A161V	ENSP00000248980:A100V	A	-	2	0	RFPL2	30918963	0.002000	0.14202	0.001000	0.08648	0.006000	0.05464	-0.065000	0.11617	-0.330000	0.08514	-0.606000	0.04082	GCT	.	.		0.537	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
SMARCA1	6594	hgsc.bcm.edu	37	X	128641995	128641995	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chrX:128641995T>A	ENST00000371122.4	-	7	1018	c.889A>T	c.(889-891)Aaa>Taa	p.K297*	SMARCA1_ENST00000478420.1_5'Flank|SMARCA1_ENST00000371123.1_Nonsense_Mutation_p.K297*|SMARCA1_ENST00000371121.3_Nonsense_Mutation_p.K297*	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	297	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						AATACAGATTTTTCTTTAATT	0.323																																					p.K297X		Atlas-SNP	.											.	SMARCA1	126	.	0			c.A889T						.						45.0	39.0	41.0					X																	128641995		2203	4296	6499	SO:0001587	stop_gained	6594	exon7			CAGATTTTTCTTT	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.889A>T	chrX.hg19:g.128641995T>A	ENSP00000360163:p.Lys297*	362.0	1.0		349.0	139.0	NM_139035	Q5JV41|Q5JV42	Nonsense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	T	37	6.413170	0.97546	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	.	.	.	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.4118	14.8541	0.70323	0.0:0.0:0.0:1.0	.	.	.	.	X	297;297;297;276	.	ENSP00000360162:K297X	K	-	1	0	SMARCA1	128469676	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	1.958000	0.56883	0.441000	0.28932	AAA	.	.		0.323	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
POTEE	445582	hgsc.bcm.edu	37	2	132021205	132021207	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr2:132021205_132021207delCCC	ENST00000356920.5	+	15	2271_2273	c.2177_2179delCCC	c.(2176-2181)gccccc>gcc	p.P727del	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	727	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GGCGACGATGCCCCCCGGGCTGT	0.611																																					p.726_726del		Atlas-INDEL	.											.	.	.	.	0			c.2176_2178del						.																																			SO:0001651	inframe_deletion	445582	exon15			.	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2177_2179delCCC	chr2.hg19:g.132021208_132021210delCCC	ENSP00000439189:p.Pro727del	279.0	0.0		261.0	73.0	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	In_Frame_Del	DEL	ENST00000356920.5	hg19	CCDS46414.1																																																																																			.	.		0.611	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
LCA5L	150082	hgsc.bcm.edu	37	21	40794906	40794907	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr21:40794906_40794907insT	ENST00000358268.2	-	5	1360_1361	c.832_833insA	c.(832-834)atafs	p.I278fs	LCA5L_ENST00000485895.2_Frame_Shift_Ins_p.I278fs|LCA5L_ENST00000380671.2_Frame_Shift_Ins_p.I278fs|LCA5L_ENST00000288350.3_Frame_Shift_Ins_p.I278fs			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	278										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				ACAGACCTGTATTTTTTTGTCA	0.381																																					p.I278fs		Atlas-INDEL	.											.	LCA5L	57	.	0			c.833_834insA						.																																			SO:0001589	frameshift_variant	150082	exon5			.	AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.833dupA	chr21.hg19:g.40794913_40794913dupT	ENSP00000351008:p.Ile278fs	174.0	0.0		240.0	75.0	NM_152505	D3DSI0|Q3ZCT0	Frame_Shift_Ins	INS	ENST00000358268.2	hg19	CCDS13665.1																																																																																			.	.		0.381	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505	
ZNF132	7691	hgsc.bcm.edu	37	19	58944869	58944870	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr19:58944869_58944870delCT	ENST00000254166.3	-	3	2341_2342	c.1941_1942delAG	c.(1939-1944)agagttfs	p.RV647fs	CTD-2619J13.17_ENST00000594816.1_lincRNA	NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	647					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		TGTGTGTGAACTCTCTGATGAC	0.465																																					p.648_648del		Atlas-Indel,Pindel	.											.	ZNF132	56	.	0			c.1942_1943del						.																																			SO:0001589	frameshift_variant	7691	exon3			.	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1941_1942delAG	chr19.hg19:g.58944873_58944874delCT	ENSP00000254166:p.Arg647fs	68.0	0.0		75.0	30.0	NM_003433	Q32MI9	Frame_Shift_Del	DEL	ENST00000254166.3	hg19	CCDS12980.1																																																																																			.	.		0.465	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
PIK3C2B	5287	hgsc.bcm.edu	37	1	204394045	204394058	+	Frame_Shift_Del	DEL	GCTCTCGCAGGCGG	GCTCTCGCAGGCGG	-	rs373485341|rs193298214	byFrequency	TCGA-DD-A3A5-01A-11D-A22F-10	TCGA-DD-A3A5-11A-11D-A22F-10	GCTCTCGCAGGCGG	GCTCTCGCAGGCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d536aaa-3e77-409a-a97c-a0e525c3a267	634467ec-6024-4df4-9b0a-399177ac8ba2	g.chr1:204394045_204394058delGCTCTCGCAGGCGG	ENST00000367187.3	-	34	5383_5396	c.4827_4840delCCGCCTGCGAGAGC	c.(4825-4842)atccgcctgcgagagctgfs	p.RLREL1610fs	PIK3C2B_ENST00000424712.2_Frame_Shift_Del_p.RLREL1582fs|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1610					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.R1612*(1)|p.R1610C(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GCCAGGTCCAGCTCTCGCAGGCGGATGTTCACCT	0.636																																					p.1610_1614del		Pindel	.											.	PIK3C2B	142	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	lung(2)	c.4828_4841del						.																																			SO:0001589	frameshift_variant	5287	exon34			.	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4827_4840delCCGCCTGCGAGAGC	chr1.hg19:g.204394045_204394058delGCTCTCGCAGGCGG	ENSP00000356155:p.Arg1610fs	79.0	0.0		79.0	22.0	NM_002646	O95666|Q5SW99	Frame_Shift_Del	DEL	ENST00000367187.3	hg19	CCDS1446.1																																																																																			.	.		0.636	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
