#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WASF2	10163	hgsc.bcm.edu	37	1	27734780	27734780	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:27734780T>C	ENST00000430629.2	-	9	1615	c.1400A>G	c.(1399-1401)aAt>aGt	p.N467S	WASF2_ENST00000536657.1_3'UTR	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	467					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		GGCCACGTCATTGCCCACAAC	0.527																																					p.N467S		Atlas-SNP	.											.	WASF2	41	.	0			c.A1400G						.						154.0	130.0	138.0					1																	27734780		2203	4300	6503	SO:0001583	missense	10163	exon9			ACGTCATTGCCCA	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.1400A>G	chr1.hg19:g.27734780T>C	ENSP00000396211:p.Asn467Ser	119.0	0.0		88.0	35.0	NM_006990	B4DZN0|O60794|Q9UDY7	Missense_Mutation	SNP	ENST00000430629.2	hg19	CCDS304.1	.	.	.	.	.	.	.	.	.	.	T	33	5.273046	0.95429	.	.	ENSG00000158195	ENST00000430629	T	0.55052	0.54	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.73009	0.3532	M	0.79475	2.455	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.76798	-0.2826	10	0.72032	D	0.01	-13.095	15.6004	0.76620	0.0:0.0:0.0:1.0	.	467	Q9Y6W5	WASF2_HUMAN	S	467	ENSP00000396211:N467S	ENSP00000396211:N467S	N	-	2	0	WASF2	27607367	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.163000	0.67991	0.528000	0.53228	AAT	.	.		0.527	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
BAI2	576	hgsc.bcm.edu	37	1	32206014	32206014	+	Silent	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:32206014G>A	ENST00000373658.3	-	12	2264	c.1923C>T	c.(1921-1923)gaC>gaT	p.D641D	BAI2_ENST00000440175.2_Silent_p.D283D|BAI2_ENST00000398547.1_Silent_p.D574D|BAI2_ENST00000398556.3_Silent_p.D589D|BAI2_ENST00000373655.2_Silent_p.D641D|BAI2_ENST00000398542.1_Silent_p.D574D|BAI2_ENST00000527361.1_Silent_p.D641D|BAI2_ENST00000257070.4_Silent_p.D641D|BAI2_ENST00000398538.1_Silent_p.D629D	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	641					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TCCTCAGAATGTCCACAGAGA	0.612																																					p.D641D		Atlas-SNP	.											.	BAI2	128	.	0			c.C1923T						.						40.0	39.0	40.0					1																	32206014		2203	4300	6503	SO:0001819	synonymous_variant	576	exon12			CAGAATGTCCACA	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1923C>T	chr1.hg19:g.32206014G>A		88.0	0.0		65.0	22.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	hg19	CCDS346.2																																																																																			.	.		0.612	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
NRD1	4898	hgsc.bcm.edu	37	1	52272522	52272522	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:52272522T>C	ENST00000354831.7	-	20	2447	c.2258A>G	c.(2257-2259)aAt>aGt	p.N753S	NRD1_ENST00000544028.1_Missense_Mutation_p.N553S|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Missense_Mutation_p.N685S|NRD1_ENST00000539524.1_Missense_Mutation_p.N621S	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	684					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TTGTGGAGTATTCACAATTTT	0.383																																					p.N753S		Atlas-SNP	.											.	NRD1	89	.	0			c.A2258G						.						190.0	191.0	191.0					1																	52272522		2203	4300	6503	SO:0001583	missense	4898	exon20			GGAGTATTCACAA	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2258A>G	chr1.hg19:g.52272522T>C	ENSP00000346890:p.Asn753Ser	288.0	0.0		205.0	80.0	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.773179	0.31411	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.3	4.18	0.49190	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.377447	0.30639	N	0.009195	T	0.28732	0.0712	N	0.24115	0.695	0.29402	N	0.861889	B;B;B	0.13594	0.004;0.004;0.008	B;B;B	0.12837	0.008;0.001;0.003	T	0.09751	-1.0660	10	0.23302	T	0.38	-10.2704	6.4935	0.22130	0.0:0.1836:0.0:0.8164	.	685;684;753	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	S	685;753;621;685;553	ENSP00000262679:N685S;ENSP00000346890:N753S;ENSP00000444416:N621S;ENSP00000442262:N553S	ENSP00000262679:N685S	N	-	2	0	NRD1	52045110	0.961000	0.32948	0.995000	0.50966	0.992000	0.81027	1.441000	0.35035	2.015000	0.59207	0.477000	0.44152	AAT	.	.		0.383	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
HRNR	388697	hgsc.bcm.edu	37	1	152191055	152191055	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:152191055C>G	ENST00000368801.2	-	3	3125	c.3050G>C	c.(3049-3051)gGt>gCt	p.G1017A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1017					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCCCGGAACCAGACCCATG	0.607																																					p.G1017A		Atlas-SNP	.											.	HRNR	403	.	0			c.G3050C						.						134.0	148.0	143.0					1																	152191055		2203	4300	6503	SO:0001583	missense	388697	exon3			CCGGAACCAGACC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.3050G>C	chr1.hg19:g.152191055C>G	ENSP00000357791:p.Gly1017Ala	187.0	0.0		274.0	23.0	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	hg19	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	6.450	0.451150	0.12223	.	.	ENSG00000197915	ENST00000368801	T	0.11277	2.79	3.6	2.64	0.31445	.	.	.	.	.	T	0.02193	0.0068	L	0.44542	1.39	0.09310	N	1	P	0.42908	0.793	B	0.35655	0.207	T	0.33214	-0.9877	9	0.08599	T	0.76	.	8.2385	0.31640	0.2376:0.7624:0.0:0.0	.	1017	Q86YZ3	HORN_HUMAN	A	1017	ENSP00000357791:G1017A	ENSP00000357791:G1017A	G	-	2	0	HRNR	150457679	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.260000	0.08708	0.810000	0.34279	0.558000	0.71614	GGT	.	.		0.607	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
LCE6A	448835	hgsc.bcm.edu	37	1	152816050	152816050	+	Silent	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:152816050C>T	ENST00000431011.2	+	2	219	c.54C>T	c.(52-54)tcC>tcT	p.S18S		NM_001128600.1	NP_001122072.1	A0A183	LCE6A_HUMAN	late cornified envelope 6A	18					keratinization (GO:0031424)												CCAAATGCTCCCCTCCCCAAA	0.502																																					p.S18S		Atlas-SNP	.											.	LCE6A	10	.	0			c.C54T						.						133.0	128.0	129.0					1																	152816050		692	1591	2283	SO:0001819	synonymous_variant	448835	exon2			ATGCTCCCCTCCC	DQ991251	CCDS44227.1	1q21.3	2011-05-24	2006-09-18	2006-09-18	ENSG00000235942	ENSG00000235942		"""Late cornified envelopes"""	31824	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 44"""	C1orf44			Standard	NM_001128600		Approved		uc001fas.4	A0A183	OTTHUMG00000012448	ENST00000431011.2:c.54C>T	chr1.hg19:g.152816050C>T		164.0	0.0		211.0	43.0	NM_001128600		Silent	SNP	ENST00000431011.2	hg19	CCDS44227.1																																																																																			.	.		0.502	LCE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034661.2		
GON4L	54856	hgsc.bcm.edu	37	1	155823310	155823310	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:155823310T>G	ENST00000368331.1	-	2	310	c.262A>C	c.(262-264)Aat>Cat	p.N88H	GON4L_ENST00000361040.5_Missense_Mutation_p.N88H|GON4L_ENST00000437809.1_Missense_Mutation_p.N88H|GON4L_ENST00000271883.5_Missense_Mutation_p.N88H|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	88					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATTGGTACATTTGTGTTCTGG	0.463																																					p.N88H		Atlas-SNP	.											.	GON4L	392	.	0			c.A262C						.						183.0	169.0	174.0					1																	155823310		2203	4300	6503	SO:0001583	missense	54856	exon2			GTACATTTGTGTT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.262A>C	chr1.hg19:g.155823310T>G	ENSP00000357315:p.Asn88His	190.0	0.0		382.0	33.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	hg19		.	.	.	.	.	.	.	.	.	.	T	4.081	0.012862	0.07912	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040	T;T;T;T	0.14640	2.68;2.68;2.68;2.49	4.38	-3.72	0.04411	.	1.396580	0.04648	N	0.406481	T	0.03053	0.0090	L	0.32530	0.975	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.002	B;B;B	0.08055	0.003;0.001;0.003	T	0.45702	-0.9243	10	0.39692	T	0.17	.	7.1388	0.25543	0.0:0.5516:0.1743:0.2741	.	88;88;88	Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;GON4L_HUMAN;.	H	88	ENSP00000396117:N88H;ENSP00000357315:N88H;ENSP00000271883:N88H;ENSP00000354322:N88H	ENSP00000271883:N88H	N	-	1	0	GON4L	154089934	0.000000	0.05858	0.000000	0.03702	0.119000	0.20118	-0.453000	0.06778	-0.643000	0.05473	0.459000	0.35465	AAT	.	.		0.463	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
OR6K2	81448	hgsc.bcm.edu	37	1	158669566	158669566	+	Silent	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:158669566G>A	ENST00000359610.2	-	1	920	c.877C>T	c.(877-879)Ctg>Ttg	p.L293L		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					TTATTCCTCAGGCTATAGATA	0.393																																					p.L293L		Atlas-SNP	.											.	OR6K2	104	.	0			c.C877T						.						73.0	72.0	72.0					1																	158669566		2203	4300	6503	SO:0001819	synonymous_variant	81448	exon1			TCCTCAGGCTATA	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.877C>T	chr1.hg19:g.158669566G>A		194.0	0.0		232.0	157.0	NM_001005279	B9EH33|Q6IFR6	Silent	SNP	ENST00000359610.2	hg19	CCDS30902.1																																																																																			.	.		0.393	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
PBX1	5087	hgsc.bcm.edu	37	1	164789392	164789392	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:164789392G>A	ENST00000420696.2	+	7	1269	c.1081G>A	c.(1081-1083)Gcc>Acc	p.A361T	PBX1_ENST00000560641.1_Missense_Mutation_p.A256T|PBX1_ENST00000401534.1_Intron|PBX1_ENST00000540236.1_Missense_Mutation_p.A361T|PBX1_ENST00000367897.1_Intron|PBX1_ENST00000540246.1_Missense_Mutation_p.A256T|PBX1_ENST00000559240.1_Intron	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	361					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						TTACCAAGGGGCCCAGGTTGG	0.488			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.A361T		Atlas-SNP	.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	60	.	0			c.G1081A						.						84.0	84.0	84.0					1																	164789392		2203	4300	6503	SO:0001583	missense	5087	exon7			CAAGGGGCCCAGG	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.1081G>A	chr1.hg19:g.164789392G>A	ENSP00000405890:p.Ala361Thr	153.0	0.0		160.0	25.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	hg19	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550454	0.65311	.	.	ENSG00000185630	ENST00000420696;ENST00000540236;ENST00000540246	D;D;D	0.88896	-2.33;-2.33;-2.44	5.61	5.61	0.85477	.	0.207703	0.49916	D	0.000127	T	0.74786	0.3762	N	0.17474	0.49	.	.	.	B;B;B;B	0.25390	0.002;0.002;0.125;0.009	B;B;B;B	0.25614	0.004;0.002;0.062;0.04	T	0.71185	-0.4667	9	0.25751	T	0.34	-10.9742	19.237	0.93864	0.0:0.0:1.0:0.0	.	256;361;361;361	B7Z774;A8K5V0;F5H4U9;P40424	.;.;.;PBX1_HUMAN	T	361;361;256	ENSP00000405890:A361T;ENSP00000439943:A361T;ENSP00000440869:A256T	ENSP00000405890:A361T	A	+	1	0	PBX1	163056016	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.170000	0.71920	2.640000	0.89533	0.655000	0.94253	GCC	.	.		0.488	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
NUP133	55746	hgsc.bcm.edu	37	1	229636533	229636533	+	Silent	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr1:229636533A>G	ENST00000261396.3	-	4	574	c.483T>C	c.(481-483)tcT>tcC	p.S161S	NUP133_ENST00000537506.1_Silent_p.S145S|NUP133_ENST00000366678.3_Silent_p.S161S	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	161					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CTGAGGGAGAAGAGTAAGAAA	0.403																																					p.S161S		Atlas-SNP	.											.	NUP133	111	.	0			c.T483C						.						60.0	58.0	59.0					1																	229636533		2203	4300	6503	SO:0001819	synonymous_variant	55746	exon4			GGGAGAAGAGTAA		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.483T>C	chr1.hg19:g.229636533A>G		41.0	0.0		102.0	22.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Silent	SNP	ENST00000261396.3	hg19	CCDS1579.1																																																																																			.	.		0.403	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
ASAP2	8853	hgsc.bcm.edu	37	2	9508603	9508603	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:9508603G>A	ENST00000281419.3	+	16	1851	c.1511G>A	c.(1510-1512)tGc>tAc	p.C504Y	ASAP2_ENST00000315273.4_Missense_Mutation_p.C504Y	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	504	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ATGGAATGTTGCCTACCAGCT	0.428																																					p.C504Y		Atlas-SNP	.											.	ASAP2	91	.	0			c.G1511A						.						99.0	95.0	97.0					2																	9508603		2203	4300	6503	SO:0001583	missense	8853	exon16			AATGTTGCCTACC	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1511G>A	chr2.hg19:g.9508603G>A	ENSP00000281419:p.Cys504Tyr	86.0	0.0		78.0	30.0	NM_001135191	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	hg19	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105651	0.77096	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.40476	1.03;1.03	5.61	5.61	0.85477	.	0.175663	0.64402	D	0.000005	T	0.50990	0.1648	N	0.20328	0.56	0.80722	D	1	P;D	0.65815	0.778;0.995	B;D	0.65140	0.136;0.932	T	0.53005	-0.8499	10	0.56958	D	0.05	.	20.0086	0.97443	0.0:0.0:1.0:0.0	.	504;504	O43150-2;O43150	.;ASAP2_HUMAN	Y	504	ENSP00000281419:C504Y;ENSP00000316404:C504Y	ENSP00000281419:C504Y	C	+	2	0	ASAP2	9426054	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.613000	0.67688	2.808000	0.96608	0.655000	0.94253	TGC	.	.		0.428	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
ADAM17	6868	hgsc.bcm.edu	37	2	9630394	9630394	+	Missense_Mutation	SNP	G	G	A	rs572250428		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:9630394G>A	ENST00000310823.3	-	19	2569	c.2387C>T	c.(2386-2388)aCg>aTg	p.T796M	IAH1_ENST00000545602.1_Intron	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	796					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CGGATGGTCCGTGAGATCCTC	0.498																																					p.T796M		Atlas-SNP	.											.	ADAM17	61	.	0			c.C2387T						.						104.0	94.0	97.0					2																	9630394		2203	4300	6503	SO:0001583	missense	6868	exon19			TGGTCCGTGAGAT	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.2387C>T	chr2.hg19:g.9630394G>A	ENSP00000309968:p.Thr796Met	153.0	0.0		133.0	61.0	NM_003183	O60226	Missense_Mutation	SNP	ENST00000310823.3	hg19	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.758600	0.89843	.	.	ENSG00000151694	ENST00000310823	T	0.29655	1.56	5.35	5.35	0.76521	.	0.102863	0.64402	D	0.000003	T	0.46268	0.1384	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.978;0.978	T	0.47586	-0.9106	10	0.87932	D	0	.	19.0868	0.93206	0.0:0.0:1.0:0.0	.	515;796;796	Q53RS1;B2RNB2;P78536	.;.;ADA17_HUMAN	M	796	ENSP00000309968:T796M	ENSP00000309968:T796M	T	-	2	0	ADAM17	9547845	1.000000	0.71417	0.947000	0.38551	0.988000	0.76386	9.476000	0.97823	2.503000	0.84419	0.561000	0.74099	ACG	.	.		0.498	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
CLEC4F	165530	hgsc.bcm.edu	37	2	71043463	71043463	+	Silent	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:71043463G>A	ENST00000272367.2	-	4	1126	c.1050C>T	c.(1048-1050)ggC>ggT	p.G350G	CLEC4F_ENST00000426626.1_Silent_p.G350G	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	350					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						GGTCCAGACGGCCATTTGCTT	0.408																																					p.G350G	Colon(107;10 2157 6841 26035)	Atlas-SNP	.											.	CLEC4F	95	.	0			c.C1050T						.						86.0	82.0	83.0					2																	71043463		2203	4300	6503	SO:0001819	synonymous_variant	165530	exon4			CAGACGGCCATTT	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1050C>T	chr2.hg19:g.71043463G>A		213.0	0.0		179.0	69.0	NM_173535	A4QPA5	Silent	SNP	ENST00000272367.2	hg19	CCDS1910.1																																																																																			.	.		0.408	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
ALMS1	7840	hgsc.bcm.edu	37	2	73679731	73679731	+	Missense_Mutation	SNP	A	A	G	rs367904732		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:73679731A>G	ENST00000264448.6	+	8	6185	c.6074A>G	c.(6073-6075)aAg>aGg	p.K2025R	ALMS1_ENST00000409009.1_Missense_Mutation_p.K1983R|ALMS1_ENST00000377715.1_Missense_Mutation_p.K2025R	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2025	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GAGAAGCCCAAGATTTCAACT	0.388																																					p.K2025R		Atlas-SNP	.											.	ALMS1	384	.	0			c.A6074G						.	A	ARG/LYS	0,3696		0,0,1848	124.0	119.0	121.0		6074	-0.8	0.0	2		121	1,8169		0,1,4084	no	missense	ALMS1	NM_015120.4	26	0,1,5932	GG,GA,AA		0.0122,0.0,0.0084	probably-damaging	2025/4168	73679731	1,11865	1848	4085	5933	SO:0001583	missense	7840	exon8			AGCCCAAGATTTC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.6074A>G	chr2.hg19:g.73679731A>G	ENSP00000264448:p.Lys2025Arg	136.0	0.0		80.0	33.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	9.718	1.158894	0.21454	0.0	1.22E-4	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.15603	3.3;3.3;2.41	4.59	-0.788	0.10939	.	0.863437	0.10007	N	0.727676	T	0.26304	0.0642	L	0.54323	1.7	0.09310	N	1	D;D;D	0.67145	0.992;0.992;0.996	D;P;D	0.63192	0.912;0.893;0.912	T	0.17806	-1.0357	10	0.33940	T	0.23	.	4.2435	0.10660	0.4154:0.369:0.2156:0.0	.	2025;1983;2025	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	R	1983;2025;2025	ENSP00000386627:K1983R;ENSP00000264448:K2025R;ENSP00000366944:K2025R	ENSP00000264448:K2025R	K	+	2	0	ALMS1	73533239	0.002000	0.14202	0.001000	0.08648	0.171000	0.22731	0.001000	0.13038	-0.105000	0.12132	-0.417000	0.06048	AAG	.	.		0.388	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ALMS1	7840	hgsc.bcm.edu	37	2	73679798	73679798	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:73679798T>A	ENST00000264448.6	+	8	6252	c.6141T>A	c.(6139-6141)taT>taA	p.Y2047*	ALMS1_ENST00000409009.1_Nonsense_Mutation_p.Y2005*|ALMS1_ENST00000377715.1_Nonsense_Mutation_p.Y2047*	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2047	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ATAGTTCCTATTCTCAAACAG	0.393																																					p.Y2047X		Atlas-SNP	.											.	ALMS1	384	.	0			c.T6141A						.						86.0	84.0	85.0					2																	73679798		1835	4073	5908	SO:0001587	stop_gained	7840	exon8			TTCCTATTCTCAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.6141T>A	chr2.hg19:g.73679798T>A	ENSP00000264448:p.Tyr2047*	144.0	0.0		86.0	35.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Nonsense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	T	44	11.099568	0.99515	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	.	.	.	4.05	1.71	0.24356	.	0.547071	0.15440	N	0.262260	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	5.5971	0.17333	0.0:0.2185:0.0:0.7815	.	.	.	.	X	2005;2047;2047	.	ENSP00000264448:Y2047X	Y	+	3	2	ALMS1	73533306	0.017000	0.18338	0.221000	0.23827	0.182000	0.23217	1.050000	0.30404	0.379000	0.24794	0.528000	0.53228	TAT	.	.		0.393	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ANKRD36	375248	hgsc.bcm.edu	37	2	97869996	97869996	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:97869996G>T	ENST00000461153.2	+	50	3301	c.3057G>T	c.(3055-3057)agG>agT	p.R1019S	ANKRD36_ENST00000420699.2_Missense_Mutation_p.R1019S			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1019										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						AAAAAACTAGGACAGGTAATT	0.358																																					p.R1019S		Atlas-SNP	.											.	ANKRD36	170	.	0			c.G3057T						.						28.0	33.0	31.0					2																	97869996		692	1589	2281	SO:0001583	missense	375248	exon50			AACTAGGACAGGT	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3057G>T	chr2.hg19:g.97869996G>T	ENSP00000419530:p.Arg1019Ser	58.0	0.0		58.0	11.0	NM_001164315	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	hg19	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	9.403	1.078541	0.20227	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.76186	-1.0;-1.0	0.63	-1.26	0.09376	.	.	.	.	.	T	0.50990	0.1648	N	0.22421	0.69	0.09310	N	1	B	0.16802	0.019	B	0.06405	0.002	T	0.30650	-0.9971	8	0.09338	T	0.73	.	.	.	.	.	1019	A6QL64	AN36A_HUMAN	S	1019;1019;381	ENSP00000419530:R1019S;ENSP00000391950:R1019S	ENSP00000391950:R1019S	R	+	3	2	ANKRD36	97233723	0.009000	0.17119	0.005000	0.12908	0.014000	0.08584	-0.225000	0.09151	-0.424000	0.07382	0.175000	0.17021	AGG	.	.		0.358	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5		
SLC4A10	57282	hgsc.bcm.edu	37	2	162799343	162799343	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:162799343T>G	ENST00000446997.1	+	16	2132	c.2039T>G	c.(2038-2040)tTg>tGg	p.L680W	SLC4A10_ENST00000415876.2_Missense_Mutation_p.L650W|SLC4A10_ENST00000375514.5_Missense_Mutation_p.L661W|SLC4A10_ENST00000421911.1_Missense_Mutation_p.L680W|SLC4A10_ENST00000272716.5_Missense_Mutation_p.L650W	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	680					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	AATGGCACATTGAAGGAATGG	0.388																																					p.L680W		Atlas-SNP	.											.	SLC4A10	309	.	0			c.T2039G						.						72.0	70.0	71.0					2																	162799343		1886	4103	5989	SO:0001583	missense	57282	exon16			GCACATTGAAGGA		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2039T>G	chr2.hg19:g.162799343T>G	ENSP00000393066:p.Leu680Trp	34.0	0.0		61.0	23.0	NM_001178015	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	hg19	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.714272	0.89112	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	5.78	5.78	0.91487	Bicarbonate transporter, C-terminal (1);	0.072239	0.56097	D	0.000028	D	0.89767	0.6810	M	0.84156	2.68	0.54753	D	0.999988	D;D;D	0.67145	0.996;0.996;0.996	D;D;P	0.65987	0.94;0.94;0.895	D	0.91047	0.4875	10	0.66056	D	0.02	.	16.1042	0.81209	0.0:0.0:0.0:1.0	.	661;650;680	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	W	661;650;650;649;680;680;679	ENSP00000364664:L661W;ENSP00000395797:L650W;ENSP00000272716:L650W;ENSP00000393066:L680W;ENSP00000404486:L680W	ENSP00000272716:L650W	L	+	2	0	SLC4A10	162507589	0.997000	0.39634	0.903000	0.35520	0.936000	0.57629	5.024000	0.64090	2.211000	0.71520	0.374000	0.22700	TTG	.	.		0.388	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
TTN	7273	hgsc.bcm.edu	37	2	179560596	179560596	+	Silent	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:179560596A>G	ENST00000591111.1	-	112	30476	c.30252T>C	c.(30250-30252)taT>taC	p.Y10084Y	TTN_ENST00000589042.1_Silent_p.Y10401Y|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.Y9157Y|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACATACCTTCATAGACCTCCT	0.373																																					p.Y10401Y		Atlas-SNP	.											.	TTN	18412	.	0			c.T31203C						.						122.0	117.0	118.0					2																	179560596		1346	2805	4151	SO:0001819	synonymous_variant	7273	exon114			ACCTTCATAGACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30252T>C	chr2.hg19:g.179560596A>G		253.0	0.0		338.0	77.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	hgsc.bcm.edu	37	2	196682482	196682482	+	Silent	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:196682482T>C	ENST00000312428.6	-	50	9463	c.9363A>G	c.(9361-9363)caA>caG	p.Q3121Q		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3121	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTGGCCTTTCTTGTGCCACCA	0.328																																					p.Q3121Q		Atlas-SNP	.											.	DNAH7	512	.	0			c.A9363G						.						97.0	91.0	93.0					2																	196682482		1852	4095	5947	SO:0001819	synonymous_variant	56171	exon50			CCTTTCTTGTGCC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9363A>G	chr2.hg19:g.196682482T>C		84.0	0.0		135.0	42.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.		0.328	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
IQCF1	132141	hgsc.bcm.edu	37	3	51937031	51937031	+	Silent	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr3:51937031A>G	ENST00000310914.5	-	2	140	c.78T>C	c.(76-78)caT>caC	p.H26H		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	26										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTAAGGACAAATGGGTTGGCA	0.502																																					p.H26H		Atlas-SNP	.											IQCF1,NS,carcinoma,0,1	IQCF1	26	.	0			c.T78C						.						457.0	423.0	435.0					3																	51937031		2203	4300	6503	SO:0001819	synonymous_variant	132141	exon2			GGACAAATGGGTT	BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.78T>C	chr3.hg19:g.51937031A>G		296.0	0.0		240.0	84.0	NM_152397	Q8N711	Silent	SNP	ENST00000310914.5	hg19	CCDS2836.1																																																																																			.	.		0.502	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346568.1	NM_152397	
KCNAB1	7881	hgsc.bcm.edu	37	3	156234115	156234115	+	Missense_Mutation	SNP	G	G	A	rs370046885		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr3:156234115G>A	ENST00000490337.1	+	11	986	c.922G>A	c.(922-924)Gga>Aga	p.G308R	KCNAB1_ENST00000389636.5_Missense_Mutation_p.G279R|KCNAB1_ENST00000302490.8_Missense_Mutation_p.G290R|KCNAB1_ENST00000471742.1_Missense_Mutation_p.G297R|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Missense_Mutation_p.G261R	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	308					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGGAAAATACGGAAACGGGGT	0.448																																					p.G308R		Atlas-SNP	.											.	KCNAB1	176	.	0			c.G922A						.	G	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	100.0	101.0	101.0		889,868,922	4.8	1.0	3		101	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	KCNAB1	NM_003471.3,NM_172159.3,NM_172160.2	125,125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	297/409,290/402,308/420	156234115	1,13005	2203	4300	6503	SO:0001583	missense	7881	exon11			AAATACGGAAACG	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.922G>A	chr3.hg19:g.156234115G>A	ENSP00000419952:p.Gly308Arg	104.0	0.0		72.0	34.0	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	hg19	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.909624	0.52439	0.0	1.16E-4	ENSG00000169282	ENST00000490337;ENST00000389636;ENST00000471742;ENST00000302490;ENST00000389634	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	4.77	4.77	0.60923	NADP-dependent oxidoreductase domain (3);	0.056414	0.64402	D	0.000001	T	0.17066	0.0410	N	0.13043	0.29	0.58432	D	0.999993	B;B;B;B;B	0.27380	0.057;0.177;0.016;0.046;0.057	B;B;B;B;B	0.25405	0.022;0.06;0.009;0.013;0.022	T	0.06445	-1.0826	10	0.29301	T	0.29	-0.3472	16.9559	0.86259	0.0:0.0:1.0:0.0	.	279;261;290;297;308	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	R	308;279;297;290;261	ENSP00000419952:G308R;ENSP00000374287:G279R;ENSP00000418956:G297R;ENSP00000305858:G290R;ENSP00000374285:G261R	ENSP00000305858:G290R	G	+	1	0	KCNAB1	157716809	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	9.392000	0.97252	2.364000	0.80123	0.561000	0.74099	GGA	.	.		0.448	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
SLC26A1	10861	hgsc.bcm.edu	37	4	982779	982779	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:982779T>G	ENST00000361661.2	-	4	2325	c.1948A>C	c.(1948-1950)Agc>Cgc	p.S650R	SLC26A1_ENST00000513138.1_5'Flank|SLC26A1_ENST00000398520.2_Intron|IDUA_ENST00000453894.1_Intron|IDUA_ENST00000509744.1_Intron|SLC26A1_ENST00000398516.2_Missense_Mutation_p.S650R|IDUA_ENST00000247933.4_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	650	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACAGGCGGGCTGCAGCAGGCT	0.677																																					p.S650R		Atlas-SNP	.											.	SLC26A1	44	.	0			c.A1948C						.						19.0	20.0	20.0					4																	982779		2178	4285	6463	SO:0001583	missense	10861	exon3			GCGGGCTGCAGCA	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.1948A>C	chr4.hg19:g.982779T>G	ENSP00000354721:p.Ser650Arg	46.0	0.0		45.0	16.0	NM_022042	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000361661.2	hg19	CCDS33934.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.478862	0.63849	.	.	ENSG00000145217	ENST00000361661;ENST00000398516	T;T	0.61392	0.11;0.11	4.25	3.02	0.34903	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.134260	0.64402	D	0.000003	T	0.58047	0.2095	L	0.41415	1.275	0.80722	D	1	P	0.49447	0.924	P	0.55161	0.77	T	0.56842	-0.7912	10	0.66056	D	0.02	.	8.0714	0.30691	0.0:0.1013:0.0:0.8986	.	650	Q9H2B4	S26A1_HUMAN	R	650	ENSP00000354721:S650R;ENSP00000381528:S650R	ENSP00000354721:S650R	S	-	1	0	SLC26A1	972779	1.000000	0.71417	0.996000	0.52242	0.637000	0.38172	4.976000	0.63785	0.483000	0.27608	0.454000	0.30748	AGC	.	.		0.677	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
EVC2	132884	hgsc.bcm.edu	37	4	5578055	5578055	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:5578055C>A	ENST00000344408.5	-	18	3237	c.3184G>T	c.(3184-3186)Ggg>Tgg	p.G1062W	EVC2_ENST00000310917.2_Missense_Mutation_p.G982W|EVC2_ENST00000344938.1_Missense_Mutation_p.G1062W	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1062					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G1062W(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TCCACCTCCCCAGGTTCGTTC	0.622																																					p.G1062W		Atlas-SNP	.											.	EVC2	202	.	1	Substitution - Missense(1)	lung(1)	c.G3184T						.						83.0	77.0	79.0					4																	5578055		2203	4300	6503	SO:0001583	missense	132884	exon18			CCTCCCCAGGTTC	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3184G>T	chr4.hg19:g.5578055C>A	ENSP00000342144:p.Gly1062Trp	79.0	0.0		55.0	6.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	hg19	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561986	0.65538	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74526	-0.85;-0.84;-0.85	5.38	4.53	0.55603	.	2.035800	0.01922	N	0.040580	T	0.76933	0.4057	N	0.19112	0.55	0.24941	N	0.991855	D	0.63880	0.993	P	0.55923	0.787	T	0.65784	-0.6084	10	0.62326	D	0.03	-14.522	12.0681	0.53601	0.0:0.8266:0.1734:0.0	.	1062	Q86UK5	LBN_HUMAN	W	1062;982;1062	ENSP00000339954:G1062W;ENSP00000311683:G982W;ENSP00000342144:G1062W	ENSP00000311683:G982W	G	-	1	0	EVC2	5628956	0.136000	0.22515	0.088000	0.20740	0.296000	0.27459	4.188000	0.58351	1.256000	0.44068	0.491000	0.48974	GGG	.	.		0.622	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
NCAPG	64151	hgsc.bcm.edu	37	4	17841380	17841380	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:17841380T>C	ENST00000251496.2	+	17	2724	c.2548T>C	c.(2548-2550)Tat>Cat	p.Y850H		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	850					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		AATTCGAGTCTATACAAAAGC	0.358																																					p.Y850H		Atlas-SNP	.											.	NCAPG	76	.	0			c.T2548C						.						51.0	52.0	52.0					4																	17841380		2203	4300	6503	SO:0001583	missense	64151	exon17			CGAGTCTATACAA	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2548T>C	chr4.hg19:g.17841380T>C	ENSP00000251496:p.Tyr850His	131.0	0.0		77.0	22.0	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	hg19	CCDS3424.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.547545	0.45383	.	.	ENSG00000109805	ENST00000251496	T	0.47528	0.84	5.83	4.65	0.58169	.	0.055206	0.85682	N	0.000000	T	0.65893	0.2735	M	0.72894	2.215	0.58432	D	0.999992	D	0.89917	1.0	D	0.81914	0.995	T	0.68511	-0.5389	10	0.87932	D	0	-10.509	11.8182	0.52224	0.0:0.0682:0.0:0.9318	.	850	Q9BPX3	CND3_HUMAN	H	850	ENSP00000251496:Y850H	ENSP00000251496:Y850H	Y	+	1	0	NCAPG	17450478	1.000000	0.71417	0.998000	0.56505	0.098000	0.18820	4.549000	0.60726	1.045000	0.40225	-0.256000	0.11100	TAT	.	.		0.358	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
GRXCR1	389207	hgsc.bcm.edu	37	4	42965098	42965098	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:42965098G>T	ENST00000399770.2	+	2	574	c.574G>T	c.(574-576)Gtt>Ttt	p.V192F		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	192	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						ATGCCGACGAGTTTCTGAAGC	0.438																																					p.V192F		Atlas-SNP	.											.	GRXCR1	78	.	0			c.G574T						.						355.0	355.0	355.0					4																	42965098		1914	4124	6038	SO:0001583	missense	389207	exon2			CGACGAGTTTCTG		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.574G>T	chr4.hg19:g.42965098G>T	ENSP00000382670:p.Val192Phe	228.0	0.0		158.0	34.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	hg19	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483960	0.63962	.	.	ENSG00000215203	ENST00000399770	T	0.36157	1.27	6.07	5.24	0.73138	Glutaredoxin (2);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000009	T	0.42359	0.1199	N	0.22421	0.69	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.19778	-1.0295	10	0.09843	T	0.71	-20.512	14.2764	0.66181	0.0705:0.0:0.9295:0.0	.	192	A8MXD5	GRCR1_HUMAN	F	192	ENSP00000382670:V192F	ENSP00000382670:V192F	V	+	1	0	GRXCR1	42659855	1.000000	0.71417	0.948000	0.38648	0.340000	0.28889	7.658000	0.83755	1.583000	0.49898	0.655000	0.94253	GTT	.	.		0.438	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
GRXCR1	389207	hgsc.bcm.edu	37	4	42965111	42965111	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:42965111C>T	ENST00000399770.2	+	2	587	c.587C>T	c.(586-588)cCt>cTt	p.P196L		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	196	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						TCTGAAGCTCCTTCCCTCCCT	0.438																																					p.P196L		Atlas-SNP	.											.	GRXCR1	78	.	0			c.C587T						.						356.0	356.0	356.0					4																	42965111		1916	4125	6041	SO:0001583	missense	389207	exon2			AAGCTCCTTCCCT		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.587C>T	chr4.hg19:g.42965111C>T	ENSP00000382670:p.Pro196Leu	229.0	0.0		155.0	33.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	hg19	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	C	4.945	0.175579	0.09391	.	.	ENSG00000215203	ENST00000399770	T	0.32515	1.45	6.07	6.07	0.98685	Glutaredoxin (2);Thioredoxin-like fold (2);	0.077693	0.52532	U	0.000071	T	0.17066	0.0410	N	0.04768	-0.165	0.80722	D	1	P	0.34757	0.467	B	0.33620	0.167	T	0.09907	-1.0653	10	0.08179	T	0.78	-7.83	19.6475	0.95784	0.0:1.0:0.0:0.0	.	196	A8MXD5	GRCR1_HUMAN	L	196	ENSP00000382670:P196L	ENSP00000382670:P196L	P	+	2	0	GRXCR1	42659868	1.000000	0.71417	0.761000	0.31378	0.693000	0.40251	5.741000	0.68638	2.885000	0.99019	0.655000	0.94253	CCT	.	.		0.438	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
BMP3	651	hgsc.bcm.edu	37	4	81967179	81967179	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:81967179A>G	ENST00000282701.2	+	2	924	c.604A>G	c.(604-606)Atc>Gtc	p.I202V		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	202					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						GTCTAAAGATATCACTCAACT	0.443																																					p.I202V		Atlas-SNP	.											.	BMP3	59	.	0			c.A604G						.						126.0	137.0	133.0					4																	81967179		2203	4300	6503	SO:0001583	missense	651	exon2			AAAGATATCACTC	M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.604A>G	chr4.hg19:g.81967179A>G	ENSP00000282701:p.Ile202Val	76.0	0.0		47.0	23.0	NM_001201	Q4VAS5	Missense_Mutation	SNP	ENST00000282701.2	hg19	CCDS3588.1	.	.	.	.	.	.	.	.	.	.	A	4.305	0.055947	0.08291	.	.	ENSG00000152785	ENST00000282701	T	0.58652	0.32	5.08	3.89	0.44902	Transforming growth factor-beta, N-terminal (1);	0.089531	0.85682	N	0.000000	T	0.51432	0.1674	M	0.66297	2.02	0.53688	D	0.999977	B	0.28026	0.198	B	0.30316	0.114	T	0.41233	-0.9520	10	0.10377	T	0.69	.	10.8824	0.46946	0.925:0.0:0.075:0.0	.	202	P12645	BMP3_HUMAN	V	202	ENSP00000282701:I202V	ENSP00000282701:I202V	I	+	1	0	BMP3	82186203	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	3.236000	0.51336	1.058000	0.40530	-0.290000	0.09829	ATC	.	.		0.443	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1		
EMCN	51705	hgsc.bcm.edu	37	4	101331438	101331438	+	Splice_Site	SNP	C	C	T	rs374744629		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:101331438C>T	ENST00000296420.4	-	11	1004		c.e11+1		EMCN_ENST00000511970.1_Splice_Site|EMCN_ENST00000305864.3_Splice_Site	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin							extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		GGGAAACTTACGTAATTATTG	0.383																																					.		Atlas-SNP	.											.	EMCN	37	.	0			c.825+1G>A						.						175.0	164.0	168.0					4																	101331438		2203	4300	6503	SO:0001630	splice_region_variant	51705	exon12			AACTTACGTAATT	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.783+1G>A	chr4.hg19:g.101331438C>T		98.0	0.0		55.0	26.0	NM_016242	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Splice_Site	SNP	ENST00000296420.4	hg19	CCDS3655.1																																																																																			.	.		0.383	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	Intron
PRDM5	11107	hgsc.bcm.edu	37	4	121737607	121737607	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:121737607C>A	ENST00000264808.3	-	7	1106		c.e7+1		PRDM5_ENST00000515109.1_Splice_Site|PRDM5_ENST00000428209.2_Splice_Site	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5						histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CGACTCCTCACCAGTGTGGAC	0.547																																					.		Atlas-SNP	.											.	PRDM5	76	.	0			c.865+1G>T						.						108.0	84.0	92.0					4																	121737607		2203	4300	6503	SO:0001630	splice_region_variant	11107	exon8			TCCTCACCAGTGT	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.865+1G>T	chr4.hg19:g.121737607C>A		116.0	0.0		85.0	36.0	NM_018699	Q0VAI9|Q0VAJ0|Q6NXQ7	Splice_Site	SNP	ENST00000264808.3	hg19	CCDS3716.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.964799	0.92791	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6396	0.99537	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRDM5	121957057	1.000000	0.71417	0.981000	0.43875	0.929000	0.56500	7.818000	0.86416	2.881000	0.98747	0.650000	0.86243	.	.	.		0.547	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2		Intron
RNF175	285533	hgsc.bcm.edu	37	4	154649420	154649420	+	Missense_Mutation	SNP	C	C	T	rs370409419		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr4:154649420C>T	ENST00000347063.4	-	4	712	c.340G>A	c.(340-342)Gtt>Att	p.V114I	RNF175_ENST00000274068.4_Intron|RP11-153M7.5_ENST00000505051.1_RNA|RNF175_ENST00000506505.1_Intron	NM_173662.2	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175	114						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.V114I(3)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	13	all_hematologic(180;0.093)	Renal(120;0.118)				CTGGTAATAACGGAGAACATC	0.478																																					p.V114I		Atlas-SNP	.											RNF175_ENST00000347063,NS,carcinoma,0,3	RNF175	40	.	3	Substitution - Missense(3)	large_intestine(2)|prostate(1)	c.G340A						.	C	ILE/VAL	0,3738		0,0,1869	117.0	116.0	116.0		340	-2.6	0.0	4		116	1,8203		0,1,4101	no	missense	RNF175	NM_173662.2	29	0,1,5970	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging	114/329	154649420	1,11941	1869	4102	5971	SO:0001583	missense	285533	exon4			TAATAACGGAGAA	BC034385	CCDS47149.1	4q31.3	2008-02-05			ENSG00000145428	ENSG00000145428		"""RING-type (C3HC4) zinc fingers"""	27735	protein-coding gene	gene with protein product							Standard	NM_173662		Approved	FLJ34190	uc003int.3	Q8N4F7	OTTHUMG00000161557	ENST00000347063.4:c.340G>A	chr4.hg19:g.154649420C>T	ENSP00000340979:p.Val114Ile	82.0	0.0		62.0	31.0	NM_173662	C9JL66|Q8NB61	Missense_Mutation	SNP	ENST00000347063.4	hg19	CCDS47149.1	.	.	.	.	.	.	.	.	.	.	C	1.441	-0.567588	0.03910	0.0	1.22E-4	ENSG00000145428	ENST00000347063;ENST00000508248	T;T	0.61274	0.12;0.12	4.69	-2.58	0.06228	.	0.074861	0.52532	D	0.000078	T	0.17450	0.0419	N	0.02802	-0.49	0.19300	N	0.999973	B	0.15719	0.014	B	0.09377	0.004	T	0.21518	-1.0243	10	0.02654	T	1	-2.9588	0.1241	0.00067	0.2456:0.21:0.2406:0.3038	.	114	Q8N4F7	RN175_HUMAN	I	114;54	ENSP00000340979:V114I;ENSP00000427472:V54I	ENSP00000340979:V114I	V	-	1	0	RNF175	154868870	0.000000	0.05858	0.000000	0.03702	0.889000	0.51656	0.001000	0.13038	-0.602000	0.05775	-0.136000	0.14681	GTT	.	.		0.478	RNF175-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365286.1	NM_173662	
CDH6	1004	hgsc.bcm.edu	37	5	31294184	31294184	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:31294184G>A	ENST00000265071.2	+	3	609	c.344G>A	c.(343-345)aGg>aAg	p.R115K	CDH6_ENST00000514738.1_Missense_Mutation_p.R60K	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	115	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GCCACCAAGAGGCTGGACAGG	0.458																																					p.R115K		Atlas-SNP	.											.	CDH6	175	.	0			c.G344A						.						107.0	108.0	108.0					5																	31294184		2203	4300	6503	SO:0001583	missense	1004	exon3			CCAAGAGGCTGGA	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.344G>A	chr5.hg19:g.31294184G>A	ENSP00000265071:p.Arg115Lys	112.0	0.0		143.0	12.0	NM_004932	A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	hg19	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654749	0.67472	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.52295	0.67;0.67	5.77	5.77	0.91146	Cadherin (5);Cadherin-like (1);	0.040499	0.85682	D	0.000000	T	0.46171	0.1379	L	0.49640	1.575	0.58432	D	0.999997	B;B	0.18166	0.003;0.026	B;B	0.20577	0.014;0.03	T	0.31503	-0.9941	10	0.18710	T	0.47	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	115;115	P55285;P55285-2	CADH6_HUMAN;.	K	60;115	ENSP00000424843:R60K;ENSP00000265071:R115K	ENSP00000265071:R115K	R	+	2	0	CDH6	31329941	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	6.366000	0.73095	2.885000	0.99019	0.655000	0.94253	AGG	.	.		0.458	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
JMY	133746	hgsc.bcm.edu	37	5	78610232	78610232	+	Missense_Mutation	SNP	A	A	C	rs376215787		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:78610232A>C	ENST00000396137.4	+	9	2679	c.2217A>C	c.(2215-2217)gaA>gaC	p.E739D	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	739					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		AGGTGGGAGAAGGAAGAGTCA	0.458																																					p.E739D		Atlas-SNP	.											.	JMY	82	.	0			c.A2217C						.						113.0	121.0	118.0					5																	78610232		2100	4251	6351	SO:0001583	missense	133746	exon9			GGGAGAAGGAAGA	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2217A>C	chr5.hg19:g.78610232A>C	ENSP00000379441:p.Glu739Asp	131.0	0.0		160.0	70.0	NM_152405	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	hg19	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	A	2.652	-0.281736	0.05642	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.74106	-0.81	4.57	2.03	0.26663	.	1.603640	0.04196	N	0.329215	T	0.61949	0.2388	L	0.40543	1.245	0.09310	N	1	B	0.22211	0.066	B	0.18871	0.023	T	0.47114	-0.9142	10	0.13108	T	0.6	.	3.908	0.09191	0.5791:0.1888:0.2321:0.0	.	739	Q8N9B5	JMY_HUMAN	D	739	ENSP00000379441:E739D	ENSP00000282259:E739D	E	+	3	2	JMY	78645988	0.014000	0.17966	0.013000	0.15412	0.173000	0.22820	0.428000	0.21395	1.697000	0.51169	0.477000	0.44152	GAA	.	.		0.458	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
RASA1	5921	hgsc.bcm.edu	37	5	86685321	86685321	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:86685321A>G	ENST00000274376.6	+	24	3601	c.3037A>G	c.(3037-3039)Agt>Ggt	p.S1013G	RASA1_ENST00000456692.2_Missense_Mutation_p.S836G|RASA1_ENST00000512763.1_Missense_Mutation_p.S846G|RASA1_ENST00000506290.1_Missense_Mutation_p.S847G	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	1013					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		TCGAACGCTCAGTAATGAGCG	0.443																																					p.S1013G		Atlas-SNP	.											.	RASA1	213	.	0			c.A3037G						.						137.0	123.0	128.0					5																	86685321		2203	4300	6503	SO:0001583	missense	5921	exon24			ACGCTCAGTAATG		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.3037A>G	chr5.hg19:g.86685321A>G	ENSP00000274376:p.Ser1013Gly	101.0	0.0		115.0	31.0	NM_002890	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	hg19	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.578890	0.86645	.	.	ENSG00000145715	ENST00000274376;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.75	5.75	0.90469	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.073152	0.85682	D	0.000000	T	0.43809	0.1264	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D	0.71674	0.997;0.991;0.991;0.998;0.997	P;P;P;P;P	0.62382	0.798;0.729;0.729;0.901;0.77	T	0.30357	-0.9981	10	0.46703	T	0.11	.	16.0379	0.80642	1.0:0.0:0.0:0.0	.	847;846;847;836;1013	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	G	1013;836;846;847	ENSP00000274376:S1013G;ENSP00000411221:S836G;ENSP00000422008:S846G;ENSP00000420905:S847G	ENSP00000274376:S1013G	S	+	1	0	RASA1	86721077	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.691000	0.91279	2.192000	0.70111	0.477000	0.44152	AGT	.	.		0.443	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
GIN1	54826	hgsc.bcm.edu	37	5	102440400	102440400	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:102440400T>C	ENST00000399004.2	-	4	578	c.484A>G	c.(484-486)Ata>Gta	p.I162V	GIN1_ENST00000508629.1_Missense_Mutation_p.I162V|GIN1_ENST00000511400.1_5'Flank	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	162	Integrase catalytic. {ECO:0000255|PROSITE-ProRule:PRU00457}.				DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)	p.I162V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		GTCATGATTATAGCATATACA	0.358																																					p.I162V		Atlas-SNP	.											GIN1,NS,carcinoma,0,1	GIN1	53	.	1	Substitution - Missense(1)	lung(1)	c.A484G						.						111.0	103.0	105.0					5																	102440400		1857	4097	5954	SO:0001583	missense	54826	exon4			TGATTATAGCATA	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.484A>G	chr5.hg19:g.102440400T>C	ENSP00000381970:p.Ile162Val	151.0	0.0		166.0	36.0	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	hg19	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	T	0.843	-0.741096	0.03088	.	.	ENSG00000145723	ENST00000399004;ENST00000508629	T;T	0.40756	1.02;1.02	5.88	-2.62	0.06152	Integrase, catalytic core (2);Ribonuclease H-like (1);	0.731785	0.12470	N	0.466060	T	0.23289	0.0563	N	0.19112	0.55	0.24200	N	0.995515	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.17167	-1.0378	10	0.62326	D	0.03	-20.9525	6.7363	0.23411	0.0:0.3263:0.118:0.5557	.	162;162	Q9NXP7-3;Q9NXP7	.;GIN1_HUMAN	V	162	ENSP00000381970:I162V;ENSP00000427162:I162V	ENSP00000381970:I162V	I	-	1	0	GIN1	102468299	0.923000	0.31300	0.820000	0.32676	0.019000	0.09904	-0.151000	0.10175	-0.366000	0.08064	-1.273000	0.01405	ATA	.	.		0.358	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
ETF1	2107	hgsc.bcm.edu	37	5	137844022	137844022	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:137844022T>A	ENST00000360541.5	-	11	1507	c.1286A>T	c.(1285-1287)gAt>gTt	p.D429V	ETF1_ENST00000499810.2_Missense_Mutation_p.D396V|ETF1_ENST00000503014.1_Missense_Mutation_p.D415V	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	429					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAAAAATTCATCGTCTCCTCC	0.488																																					p.D429V		Atlas-SNP	.											.	ETF1	38	.	0			c.A1286T						.						63.0	52.0	56.0					5																	137844022		2203	4300	6503	SO:0001583	missense	2107	exon11			AATTCATCGTCTC	AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.1286A>T	chr5.hg19:g.137844022T>A	ENSP00000353741:p.Asp429Val	60.0	0.0		77.0	14.0	NM_004730	B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Missense_Mutation	SNP	ENST00000360541.5	hg19	CCDS4207.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.866871	0.72065	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014	.	.	.	6.17	6.17	0.99709	.	0.043633	0.85682	D	0.000000	T	0.59945	0.2231	L	0.49513	1.565	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.16289	0.001;0.015	T	0.56238	-0.8012	9	0.62326	D	0.03	-8.966	16.4837	0.84171	0.0:0.0:0.0:1.0	.	415;429	B7Z7P8;P62495	.;ERF1_HUMAN	V	396;429;415	.	ENSP00000353741:D429V	D	-	2	0	ETF1	137871921	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.823000	0.86660	2.371000	0.80710	0.533000	0.62120	GAT	.	.		0.488	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2	NM_004730	
PCDHA4	56144	hgsc.bcm.edu	37	5	140187339	140187339	+	Silent	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:140187339A>G	ENST00000530339.1	+	1	567	c.567A>G	c.(565-567)gtA>gtG	p.V189V	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Silent_p.V189V|PCDHA4_ENST00000512229.2_Silent_p.V189V|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	189	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGAGCTGGTAAAAGGTCTTG	0.478																																					p.V189V		Atlas-SNP	.											.	PCDHA4	419	.	0			c.A567G						.						47.0	55.0	52.0					5																	140187339		2203	4300	6503	SO:0001819	synonymous_variant	56144	exon1			GCTGGTAAAAGGT	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.567A>G	chr5.hg19:g.140187339A>G		171.0	0.0		191.0	49.0	NM_031500	O75285|Q2M253	Silent	SNP	ENST00000530339.1	hg19	CCDS54916.1																																																																																			.	.		0.478	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PCDHGA3	56112	hgsc.bcm.edu	37	5	140724102	140724102	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:140724102C>A	ENST00000253812.6	+	1	502	c.502C>A	c.(502-504)Cag>Aag	p.Q168K	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	168	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAACTCCCTGCAGAACTACAA	0.483																																					p.Q168K		Atlas-SNP	.											.	PCDHGA3	246	.	0			c.C502A						.						88.0	86.0	87.0					5																	140724102		1959	4144	6103	SO:0001583	missense	56112	exon1			TCCCTGCAGAACT	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.502C>A	chr5.hg19:g.140724102C>A	ENSP00000253812:p.Gln168Lys	113.0	0.0		149.0	34.0	NM_032011	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	hg19	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	14.32	2.498843	0.44455	.	.	ENSG00000254245	ENST00000253812	T	0.19806	2.12	5.65	5.65	0.86999	Cadherin (3);Cadherin-like (1);	0.000000	0.31772	U	0.007086	T	0.32763	0.0840	M	0.78223	2.4	0.25891	N	0.983474	P;B	0.42827	0.791;0.442	B;B	0.40506	0.331;0.178	T	0.30504	-0.9976	10	0.51188	T	0.08	.	19.7068	0.96076	0.0:1.0:0.0:0.0	.	168;168	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	K	168	ENSP00000253812:Q168K	ENSP00000253812:Q168K	Q	+	1	0	PCDHGA3	140704286	0.997000	0.39634	1.000000	0.80357	0.983000	0.72400	2.996000	0.49449	2.824000	0.97209	0.655000	0.94253	CAG	.	.		0.483	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
CYFIP2	26999	hgsc.bcm.edu	37	5	156727773	156727773	+	Silent	SNP	C	C	G	rs375762537		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:156727773C>G	ENST00000521420.1	+	5	451	c.360C>G	c.(358-360)gcC>gcG	p.A120A	CYFIP2_ENST00000377576.3_Silent_p.A146A|CYFIP2_ENST00000318218.6_Silent_p.A146A|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000347377.6_Silent_p.A146A|CYFIP2_ENST00000541131.1_Silent_p.A71A					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTGCCATGCCGAGCGCAGGA	0.577																																					p.A146A		Atlas-SNP	.											.	CYFIP2	354	.	0			c.C438G						.						80.0	81.0	81.0					5																	156727773		2124	4263	6387	SO:0001819	synonymous_variant	26999	exon6			CCATGCCGAGCGC	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.360C>G	chr5.hg19:g.156727773C>G		112.0	0.0		133.0	86.0	NM_001037332		Silent	SNP	ENST00000521420.1	hg19																																																																																				.	.		0.577	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
TENM2	57451	hgsc.bcm.edu	37	5	167420042	167420042	+	Silent	SNP	C	C	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:167420042C>G	ENST00000518659.1	+	5	1080	c.1041C>G	c.(1039-1041)ccC>ccG	p.P347P	TENM2_ENST00000545108.1_Silent_p.P347P|TENM2_ENST00000403607.2_Silent_p.P180P|TENM2_ENST00000520394.1_Silent_p.P156P|TENM2_ENST00000519204.1_Silent_p.P226P	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	347	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TTTACACGCCCCCGCCCCGCC	0.587																																					p.P347P		Atlas-SNP	.											.	.	.	.	0			c.C1041G						.						65.0	68.0	67.0					5																	167420042		1896	4100	5996	SO:0001819	synonymous_variant	57451	exon5			CACGCCCCCGCCC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1041C>G	chr5.hg19:g.167420042C>G		128.0	0.0		122.0	52.0	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	hg19																																																																																				.	.		0.587	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
FOXI1	2299	hgsc.bcm.edu	37	5	169535372	169535372	+	Silent	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:169535372C>A	ENST00000306268.6	+	2	955	c.894C>A	c.(892-894)ccC>ccA	p.P298P	FOXI1_ENST00000449804.2_Silent_p.P203P			Q12951	FOXI1_HUMAN	forkhead box I1	298					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGAGCCACCCCTTGGTCACAC	0.617									Pendred syndrome																												p.P298P		Atlas-SNP	.											.	FOXI1	70	.	0			c.C894A						.						68.0	65.0	66.0					5																	169535372		2203	4300	6503	SO:0001819	synonymous_variant	2299	exon2	Familial Cancer Database	Goiter-Deafness syndrome	CCACCCCTTGGTC	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.894C>A	chr5.hg19:g.169535372C>A		109.0	0.0		128.0	29.0	NM_012188	Q14518|Q66SR7|Q8N6L8	Silent	SNP	ENST00000306268.6	hg19	CCDS4372.1																																																																																			.	.		0.617	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
MSX2	4488	hgsc.bcm.edu	37	5	174151962	174151962	+	Silent	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:174151962G>A	ENST00000239243.6	+	1	427	c.300G>A	c.(298-300)gaG>gaA	p.E100E	MSX2_ENST00000507785.1_Silent_p.E100E	NM_002449.4	NP_002440.2	P35548	MSX2_HUMAN	msh homeobox 2	100					activation of meiosis (GO:0090427)|anagen (GO:0042640)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone trabecula formation (GO:0060346)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte development (GO:0002063)|cranial suture morphogenesis (GO:0060363)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|enamel mineralization (GO:0070166)|endochondral bone growth (GO:0003416)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|frontal suture morphogenesis (GO:0060364)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of catagen (GO:0051795)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of osteoblast differentiation (GO:0045669)|signal transduction involved in regulation of gene expression (GO:0023019)|wound healing, spreading of epidermal cells (GO:0035313)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AGCCCTTCGAGACCGCCTCGG	0.706																																					p.E100E		Atlas-SNP	.											.	MSX2	24	.	0			c.G300A						.						7.0	10.0	9.0					5																	174151962		2060	4004	6064	SO:0001819	synonymous_variant	4488	exon1			CTTCGAGACCGCC	D26145	CCDS4392.1	5q35.2	2011-06-20	2006-11-21		ENSG00000120149	ENSG00000120149		"""Homeoboxes / ANTP class : NKL subclass"""	7392	protein-coding gene	gene with protein product	"""craniosynostosis, type 2"""	123101	"""msh (Drosophila) homeo box homolog 2"", ""parietal foramina 1"", ""msh homeobox homolog 2 (Drosophila)"""	PFM1		8668339, 8786091	Standard	XM_006714868		Approved	CRS2, FPP, HOX8, MSH, PFM	uc003mcy.3	P35548	OTTHUMG00000130556	ENST00000239243.6:c.300G>A	chr5.hg19:g.174151962G>A		39.0	0.0		35.0	7.0	NM_002449	D3DQN1|Q53XM4|Q9UD60	Silent	SNP	ENST00000239243.6	hg19	CCDS4392.1																																																																																			.	.		0.706	MSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252981.3		
HK3	3101	hgsc.bcm.edu	37	5	176308352	176308352	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:176308352G>T	ENST00000292432.5	-	18	2669	c.2578C>A	c.(2578-2580)Ctg>Atg	p.L860M		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	860	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACACTGCCAGCTCTTCCAGG	0.677																																					p.L860M		Atlas-SNP	.											.	HK3	210	.	0			c.C2578A						.						101.0	108.0	106.0					5																	176308352		2203	4300	6503	SO:0001583	missense	3101	exon18			CTGCCAGCTCTTC		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2578C>A	chr5.hg19:g.176308352G>T	ENSP00000292432:p.Leu860Met	59.0	0.0		84.0	21.0	NM_002115	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	hg19	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096542	0.56075	.	.	ENSG00000160883	ENST00000292432	D	0.98178	-4.77	5.35	3.58	0.41010	Hexokinase, C-terminal (1);	0.000000	0.41605	D	0.000854	D	0.98178	0.9398	M	0.64997	1.995	0.48040	D	0.999572	D	0.54964	0.969	D	0.64144	0.922	D	0.97317	0.9941	10	0.41790	T	0.15	.	11.8579	0.52449	0.1444:0.0:0.8556:0.0	.	860	P52790	HXK3_HUMAN	M	860	ENSP00000292432:L860M	ENSP00000292432:L860M	L	-	1	2	HK3	176240958	1.000000	0.71417	0.940000	0.37924	0.870000	0.49936	4.145000	0.58065	0.755000	0.32990	0.561000	0.74099	CTG	.	.		0.677	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
MB21D1	115004	hgsc.bcm.edu	37	6	74161257	74161257	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr6:74161257C>A	ENST00000370315.3	-	1	742	c.648G>T	c.(646-648)gaG>gaT	p.E216D	MB21D1_ENST00000370318.1_Missense_Mutation_p.E216D	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	216					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						CCTTCACGTGCTCATAGTAGC	0.662																																					p.E216D		Atlas-SNP	.											.	MB21D1	33	.	0			c.G648T						.						17.0	17.0	17.0					6																	74161257		2186	4278	6464	SO:0001583	missense	115004	exon1			CACGTGCTCATAG	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.648G>T	chr6.hg19:g.74161257C>A	ENSP00000359339:p.Glu216Asp	63.0	0.0		56.0	19.0	NM_138441	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Missense_Mutation	SNP	ENST00000370315.3	hg19	CCDS4978.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316545	0.60524	.	.	ENSG00000164430	ENST00000370318;ENST00000370315;ENST00000296913	T;T	0.09445	2.98;2.98	4.88	3.09	0.35607	.	0.000000	0.64402	D	0.000005	T	0.17195	0.0413	M	0.80183	2.485	0.31647	N	0.64731	D	0.89917	1.0	D	0.87578	0.998	T	0.03608	-1.1020	10	0.52906	T	0.07	-30.3485	7.0317	0.24970	0.0:0.7908:0.0:0.2092	.	216	Q8N884	M21D1_HUMAN	D	216	ENSP00000359342:E216D;ENSP00000359339:E216D	ENSP00000296913:E216D	E	-	3	2	MB21D1	74217978	0.996000	0.38824	0.949000	0.38748	0.351000	0.29236	0.768000	0.26590	0.487000	0.27698	0.561000	0.74099	GAG	.	.		0.662	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
SENP6	26054	hgsc.bcm.edu	37	6	76376480	76376481	+	Missense_Mutation	DNP	AA	AA	TC			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr6:76376480_76376481AA>TC	ENST00000447266.2	+	10	1525_1526	c.1047_1048AA>TC	c.(1045-1050)gaAAgc>gaTCgc	p.349_350ES>DR	SENP6_ENST00000327284.8_Missense_Mutation_p.342_343ES>DR|SENP6_ENST00000541192.1_5'Flank|SENP6_ENST00000370014.3_Missense_Mutation_p.349_350ES>DR|SENP6_ENST00000370010.2_Missense_Mutation_p.342_343ES>DR	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	349					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				ACAGAAGAGAAAGCATATCTCC	0.361																																					p.E349D|p.S350R		Atlas-SNP	.											.	SENP6	189	.	0			c.A1047T|c.A1048C						.																																			SO:0001583	missense	26054	exon10			AAGAGAAAGCATA|AGAGAAAGCATAT		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	Exception_encountered	chr6.hg19:g.76376480_76376481delinsTC	ENSP00000402527:p.E349_S350delinsDR	71.0|72.0	0.0		44.0|45.0	19.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	hg19	CCDS47454.1																																																																																			.	.		0.361	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
INTS1	26173	hgsc.bcm.edu	37	7	1525069	1525069	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:1525069C>A	ENST00000404767.3	-	23	3098	c.3013G>T	c.(3013-3015)Gac>Tac	p.D1005Y	INTS1_ENST00000389470.4_Missense_Mutation_p.D1167Y	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1005					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TCCTCCCCGTCCCGCAGGCTG	0.667																																					p.D1005Y		Atlas-SNP	.											.	INTS1	145	.	0			c.G3013T						.						31.0	40.0	37.0					7																	1525069		2078	4205	6283	SO:0001583	missense	26173	exon23			CCCCGTCCCGCAG	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.3013G>T	chr7.hg19:g.1525069C>A	ENSP00000385722:p.Asp1005Tyr	40.0	0.0		47.0	33.0	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	hg19	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403493	0.62288	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.55588	0.51;0.66	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.68384	0.2995	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.67548	0.929;0.952	T	0.71712	-0.4510	10	0.72032	D	0.01	.	18.3337	0.90280	0.0:1.0:0.0:0.0	.	1173;1005	A4D213;Q8N201	.;INT1_HUMAN	Y	1005;1167	ENSP00000385722:D1005Y;ENSP00000374121:D1167Y	ENSP00000374121:D1167Y	D	-	1	0	INTS1	1491595	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	7.420000	0.80191	2.334000	0.79466	0.561000	0.74099	GAC	.	.		0.667	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
KLHL7	55975	hgsc.bcm.edu	37	7	23207527	23207527	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:23207527T>C	ENST00000339077.5	+	9	1493	c.1250T>C	c.(1249-1251)cTg>cCg	p.L417P	KLHL7_ENST00000322231.7_Missense_Mutation_p.L395P|KLHL7_ENST00000542558.1_Missense_Mutation_p.L192P|KLHL7_ENST00000409689.1_Missense_Mutation_p.L369P|KLHL7_ENST00000539124.1_Missense_Mutation_p.L341P|KLHL7_ENST00000545443.1_Missense_Mutation_p.L395P	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	417					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CCCAGCATGCTGACCCAGCGC	0.463																																					p.L417P		Atlas-SNP	.											.	KLHL7	102	.	0			c.T1250C						.						113.0	112.0	112.0					7																	23207527		2203	4300	6503	SO:0001583	missense	55975	exon9			GCATGCTGACCCA		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.1250T>C	chr7.hg19:g.23207527T>C	ENSP00000343273:p.Leu417Pro	127.0	0.0		158.0	32.0	NM_001031710	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	hg19	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.380654	0.82792	.	.	ENSG00000122550	ENST00000538858;ENST00000322231;ENST00000339077;ENST00000539124;ENST00000542558;ENST00000409689;ENST00000545443	T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31	5.69	5.69	0.88448	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	N	0.16567	0.415	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.81914	0.995;0.766	T	0.68387	-0.5422	10	0.62326	D	0.03	.	15.9494	0.79820	0.0:0.0:0.0:1.0	.	417;395	Q8IXQ5;Q8IXQ5-2	KLHL7_HUMAN;.	P	258;395;417;341;192;369;395	ENSP00000322958:L395P;ENSP00000343273:L417P;ENSP00000441136:L341P;ENSP00000442367:L192P;ENSP00000386263:L369P;ENSP00000442366:L395P	ENSP00000322958:L395P	L	+	2	0	KLHL7	23174052	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.698000	0.84413	2.167000	0.68274	0.482000	0.46254	CTG	.	.		0.463	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
NPVF	64111	hgsc.bcm.edu	37	7	25267920	25267920	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:25267920C>T	ENST00000222674.2	-	1	185		c.e1+1			NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor						negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						AAAAAACTTACCTCAGAATAT	0.294																																					.		Atlas-SNP	.											.	NPVF	36	.	0			c.138+1G>A						.						47.0	52.0	50.0					7																	25267920		2199	4292	6491	SO:0001630	splice_region_variant	64111	exon2			AACTTACCTCAGA	AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.138+1G>A	chr7.hg19:g.25267920C>T		154.0	0.0		245.0	63.0	NM_022150	A4D164|Q7LE27|Q96PI9	Splice_Site	SNP	ENST00000222674.2	hg19	CCDS5395.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.776077	0.49786	.	.	ENSG00000105954	ENST00000222674	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7041	0.85367	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NPVF	25234445	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	3.274000	0.51631	2.612000	0.88384	0.650000	0.86243	.	.	.		0.294	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250315.1	NM_022150	Intron
NACAD	23148	hgsc.bcm.edu	37	7	45124554	45124554	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:45124554G>A	ENST00000490531.2	-	2	1244	c.1225C>T	c.(1225-1227)Ccc>Tcc	p.P409S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	409					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TGGGCATGGGGCTCCCCGCTG	0.622																																					p.P409S		Atlas-SNP	.											.	NACAD	44	.	0			c.C1225T						.						31.0	31.0	31.0					7																	45124554		692	1591	2283	SO:0001583	missense	23148	exon2			CATGGGGCTCCCC	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.1225C>T	chr7.hg19:g.45124554G>A	ENSP00000420477:p.Pro409Ser	62.0	0.0		79.0	20.0	NM_001146334		Missense_Mutation	SNP	ENST00000490531.2	hg19	CCDS47582.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245966	0.39697	.	.	ENSG00000136274	ENST00000490531	T	0.17528	2.27	3.72	3.72	0.42706	.	0.000000	0.32703	U	0.005751	T	0.22898	0.0553	L	0.27053	0.805	0.27721	N	0.945115	D	0.69078	0.997	P	0.60789	0.879	T	0.01814	-1.1268	10	0.87932	D	0	-8.8374	10.4386	0.44450	0.0:0.1996:0.8004:0.0	.	409	O15069	NACAD_HUMAN	S	409	ENSP00000420477:P409S	ENSP00000420477:P409S	P	-	1	0	NACAD	45091079	1.000000	0.71417	0.975000	0.42487	0.377000	0.30045	3.630000	0.54273	1.926000	0.55796	0.462000	0.41574	CCC	.	.		0.622	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
COBL	23242	hgsc.bcm.edu	37	7	51098538	51098538	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:51098538G>C	ENST00000265136.7	-	9	1640	c.1475C>G	c.(1474-1476)aCc>aGc	p.T492S	COBL_ENST00000395542.2_Missense_Mutation_p.T574S	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	492					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TTCTGCAAGGGTTTTACGGAA	0.438																																					p.T492S	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-SNP	.											.	COBL	167	.	0			c.C1475G						.						188.0	176.0	180.0					7																	51098538		2203	4300	6503	SO:0001583	missense	23242	exon9			GCAAGGGTTTTAC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1475C>G	chr7.hg19:g.51098538G>C	ENSP00000265136:p.Thr492Ser	191.0	0.0		201.0	54.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	hg19	CCDS34637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.00|17.00	3.275753|3.275753	0.59649|0.59649	.|.	.|.	ENSG00000106078|ENSG00000106078	ENST00000452534|ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	.|T;T;T;T	.|0.22539	.|1.95;1.95;1.95;1.95	5.38|5.38	3.54|3.54	0.40534|0.40534	.|.	.|0.501238	.|0.17011	.|N	.|0.190496	T|T	0.28797|0.28797	0.0714|0.0714	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	.|P;P;D;D;D	.|0.69078	.|0.773;0.773;0.966;0.997;0.986	.|B;B;P;P;P	.|0.61800	.|0.189;0.189;0.77;0.894;0.73	T|T	0.06391|0.06391	-1.0829|-1.0829	5|10	.|0.39692	.|T	.|0.17	.|.	9.7435|9.7435	0.40433|0.40433	0.0782:0.1418:0.78:0.0|0.0782:0.1418:0.78:0.0	.|.	.|492;549;492;574;34	.|O75128-3;O75128-7;O75128;O75128-2;O75128-6	.|.;.;COBL_HUMAN;.;.	K|S	467|492;384;377;574	.|ENSP00000265136:T492S;ENSP00000401204:T384S;ENSP00000413498:T377S;ENSP00000378912:T574S	.|ENSP00000265136:T492S	N|T	-|-	3|2	2|0	COBL|COBL	51066032|51066032	0.671000|0.671000	0.27521|0.27521	0.001000|0.001000	0.08648|0.08648	0.292000|0.292000	0.27327|0.27327	3.204000|3.204000	0.51082|0.51082	0.610000|0.610000	0.30035|0.30035	0.650000|0.650000	0.86243|0.86243	AAC|ACC	.	.		0.438	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
AUTS2	26053	hgsc.bcm.edu	37	7	70228060	70228060	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:70228060G>A	ENST00000342771.4	+	7	1268	c.947G>A	c.(946-948)cGa>cAa	p.R316Q	AUTS2_ENST00000406775.2_Missense_Mutation_p.R316Q	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	316										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCCCAACTCCGAGCTCCTTCT	0.627																																					p.R316Q		Atlas-SNP	.											.	AUTS2	173	.	0			c.G947A						.						52.0	57.0	55.0					7																	70228060		2203	4300	6503	SO:0001583	missense	26053	exon7			AACTCCGAGCTCC	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.947G>A	chr7.hg19:g.70228060G>A	ENSP00000344087:p.Arg316Gln	66.0	0.0		67.0	11.0	NM_001127231	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	hg19	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	G	5.070	0.198558	0.09652	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.31247	1.5;1.5	5.58	-8.92	0.00774	.	1.342300	0.04746	N	0.423738	T	0.10208	0.0250	N	0.03608	-0.345	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21415	-1.0246	9	.	.	.	1.0014	6.6852	0.23142	0.5927:0.2215:0.104:0.0818	.	316;316	Q8WXX7-2;Q8WXX7	.;AUTS2_HUMAN	Q	316	ENSP00000385263:R316Q;ENSP00000344087:R316Q	.	R	+	2	0	AUTS2	69865996	0.000000	0.05858	0.000000	0.03702	0.321000	0.28281	-0.381000	0.07417	-1.197000	0.02673	-0.259000	0.10710	CGA	.	.		0.627	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
ADAM22	53616	hgsc.bcm.edu	37	7	87780308	87780308	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:87780308A>T	ENST00000265727.7	+	19	1658	c.1579A>T	c.(1579-1581)Att>Ttt	p.I527F	ADAM22_ENST00000398209.3_Missense_Mutation_p.I527F|ADAM22_ENST00000398204.4_Missense_Mutation_p.I527F|ADAM22_ENST00000315984.7_Missense_Mutation_p.I527F|ADAM22_ENST00000398201.4_Missense_Mutation_p.I527F			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	527	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TGCCCCTAATATTCATAAAAT	0.333																																					p.I527F		Atlas-SNP	.											.	ADAM22	280	.	0			c.A1579T						.						199.0	184.0	189.0					7																	87780308		1837	4082	5919	SO:0001583	missense	53616	exon19			CCTAATATTCATA	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1579A>T	chr7.hg19:g.87780308A>T	ENSP00000265727:p.Ile527Phe	314.0	0.0		220.0	83.0	NM_021722	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	hg19	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.735625	0.49045	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78;2.78	4.95	-0.117	0.13551	Blood coagulation inhibitor, Disintegrin (5);	0.203493	0.43416	D	0.000568	T	0.07413	0.0187	N	0.20530	0.585	0.45464	D	0.998438	P;B;P;B	0.39920	0.695;0.417;0.472;0.444	B;B;B;B	0.43754	0.43;0.1;0.162;0.19	T	0.30504	-0.9976	10	0.87932	D	0	.	4.9137	0.13835	0.4843:0.2809:0.2348:0.0	.	579;527;527;527	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2	.;.;ADA22_HUMAN;.	F	527;527;527;527;527;494	ENSP00000381262:I527F;ENSP00000381260:I527F;ENSP00000265727:I527F;ENSP00000315900:I527F;ENSP00000381267:I527F;ENSP00000381261:I494F	ENSP00000265727:I527F	I	+	1	0	ADAM22	87618244	1.000000	0.71417	0.979000	0.43373	0.996000	0.88848	1.892000	0.39748	0.018000	0.15052	0.533000	0.62120	ATT	.	.		0.333	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
TAS2R38	5726	hgsc.bcm.edu	37	7	141672569	141672569	+	Silent	SNP	A	A	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:141672569A>T	ENST00000547270.1	-	1	1004	c.921T>A	c.(919-921)gcT>gcA	p.A307A		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	307					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					TGGTCATCACAGCTCTCCTCA	0.532																																					p.A307A		Atlas-SNP	.											.	TAS2R38	51	.	0			c.T921A						.						76.0	65.0	69.0					7																	141672569		2203	4300	6503	SO:0001819	synonymous_variant	5726	exon1			CATCACAGCTCTC	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.921T>A	chr7.hg19:g.141672569A>T		98.0	0.0		67.0	23.0	NM_176817	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Silent	SNP	ENST00000547270.1	hg19	CCDS34765.1																																																																																			.	.		0.532	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817	
KMT2C	58508	hgsc.bcm.edu	37	7	151970850	151970850	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr7:151970850G>T	ENST00000262189.6	-	7	1170	c.952C>A	c.(952-954)Cag>Aag	p.Q318K	KMT2C_ENST00000355193.2_Missense_Mutation_p.Q318K	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	318					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTGAAATCCTGAAAGGTGCCG	0.423																																					p.Q318K		Atlas-SNP	.											.	MLL3	1564	.	0			c.C952A						.						261.0	244.0	249.0					7																	151970850		2203	4300	6503	SO:0001583	missense	58508	exon7			AATCCTGAAAGGT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.952C>A	chr7.hg19:g.151970850G>T	ENSP00000262189:p.Gln318Lys	484.0	0.0		334.0	20.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995227	0.74703	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.70749	-0.51;-0.51	4.87	4.87	0.63330	Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.164580	0.28442	N	0.015327	T	0.77294	0.4109	M	0.86502	2.82	0.80722	D	1	P	0.39576	0.679	P	0.45794	0.493	T	0.76735	-0.2850	10	0.02654	T	1	.	18.3751	0.90433	0.0:0.0:1.0:0.0	.	318	Q8NEZ4	MLL3_HUMAN	K	318	ENSP00000262189:Q318K;ENSP00000347325:Q318K	ENSP00000262189:Q318K	Q	-	1	0	MLL3	151601783	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.781000	0.99029	2.423000	0.82170	0.650000	0.86243	CAG	.	.		0.423	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ZHX2	22882	hgsc.bcm.edu	37	8	123963936	123963936	+	Silent	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr8:123963936G>A	ENST00000314393.4	+	3	1021	c.186G>A	c.(184-186)gaG>gaA	p.E62E		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	62					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AAGTGATAGAGGTGAAATCTA	0.498																																					p.E62E	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.G186A						.						70.0	65.0	67.0					8																	123963936		2203	4300	6503	SO:0001819	synonymous_variant	22882	exon3			GATAGAGGTGAAA	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.186G>A	chr8.hg19:g.123963936G>A		62.0	0.0		82.0	16.0	NM_014943		Silent	SNP	ENST00000314393.4	hg19	CCDS6336.1																																																																																			.	.		0.498	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
FAM122A	116224	hgsc.bcm.edu	37	9	71395649	71395649	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr9:71395649C>A	ENST00000394264.3	+	1	686	c.569C>A	c.(568-570)cCc>cAc	p.P190H	PIP5K1B_ENST00000265382.3_Intron|PIP5K1B_ENST00000541509.1_Intron	NM_138333.3	NP_612206.3	Q96E09	F122A_HUMAN	family with sequence similarity 122A	190										endometrium(1)|lung(2)	3						AGCCAGAGCCCCATCAATTGC	0.458																																					p.P190H		Atlas-SNP	.											.	FAM122A	14	.	0			c.C569A						.						81.0	80.0	81.0					9																	71395649		2203	4300	6503	SO:0001583	missense	116224	exon1			AGAGCCCCATCAA	AK126379	CCDS6623.1	9q21.13	2011-02-10	2006-07-11	2006-07-11	ENSG00000187866	ENSG00000187866			23490	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 42"""	C9orf42		12477932	Standard	NM_138333		Approved	MGC17347	uc004agw.1	Q96E09	OTTHUMG00000019971	ENST00000394264.3:c.569C>A	chr9.hg19:g.71395649C>A	ENSP00000377807:p.Pro190His	155.0	0.0		118.0	49.0	NM_138333		Missense_Mutation	SNP	ENST00000394264.3	hg19	CCDS6623.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.145539	0.57044	.	.	ENSG00000187866	ENST00000394264;ENST00000377279	T	0.66995	-0.24	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.83128	0.5187	M	0.88105	2.93	0.43662	D	0.996088	D	0.89917	1.0	D	0.87578	0.998	D	0.85637	0.1274	10	0.87932	D	0	-5.7978	12.8382	0.57786	0.0:1.0:0.0:0.0	.	190	Q96E09	F122A_HUMAN	H	190;174	ENSP00000377807:P190H	ENSP00000366492:P174H	P	+	2	0	FAM122A	70585469	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.382000	0.66213	2.758000	0.94735	0.563000	0.77884	CCC	.	.		0.458	FAM122A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052556.1	NM_138333	
ZFP37	7539	hgsc.bcm.edu	37	9	115805121	115805121	+	Nonsense_Mutation	SNP	G	G	A	rs373174435		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr9:115805121G>A	ENST00000374227.3	-	4	1804	c.1777C>T	c.(1777-1779)Cga>Tga	p.R593*	ZFP37_ENST00000553380.1_Nonsense_Mutation_p.R608*|ZFP37_ENST00000555206.1_Nonsense_Mutation_p.R594*	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	593					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GTGTGGGATCGCTGATGTATA	0.373																																					p.R593X		Atlas-SNP	.											.	ZFP37	93	.	0			c.C1777T						.	G	stop/ARG	0,4406		0,0,2203	188.0	171.0	176.0		1777	3.0	1.0	9		176	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	ZFP37	NM_003408.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		593/631	115805121	1,13005	2203	4300	6503	SO:0001587	stop_gained	7539	exon4			GGGATCGCTGATG	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.1777C>T	chr9.hg19:g.115805121G>A	ENSP00000363344:p.Arg593*	126.0	0.0		102.0	39.0	NM_003408	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Nonsense_Mutation	SNP	ENST00000374227.3	hg19	CCDS6787.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261248	0.80246	0.0	1.16E-4	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	.	.	.	4.14	3.01	0.34805	.	0.000000	0.44483	D	0.000447	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.1634	9.3304	0.38018	0.0:0.0:0.192:0.808	.	.	.	.	X	593;594;608	.	ENSP00000363344:R593X	R	-	1	2	ZFP37	114844942	0.001000	0.12720	0.994000	0.49952	0.894000	0.52154	-0.032000	0.12266	0.928000	0.37168	-0.262000	0.10625	CGA	.	.		0.373	ZFP37-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055439.1	NM_003408	
TAF3	83860	hgsc.bcm.edu	37	10	8006438	8006438	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr10:8006438A>G	ENST00000344293.5	+	3	1171	c.965A>G	c.(964-966)aAg>aGg	p.K322R		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	322					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						aagagtcccaagagccccaag	0.493																																					p.K322R		Atlas-SNP	.											.	TAF3	93	.	0			c.A965G						.						38.0	39.0	39.0					10																	8006438		1870	4094	5964	SO:0001583	missense	83860	exon3			GTCCCAAGAGCCC	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.965A>G	chr10.hg19:g.8006438A>G	ENSP00000340271:p.Lys322Arg	47.0	0.0		42.0	18.0	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	hg19	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.267658	0.59540	.	.	ENSG00000165632	ENST00000344293	T	0.28454	1.61	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	T	0.31606	0.0802	M	0.71296	2.17	0.51012	D	0.9999	P	0.42409	0.779	B	0.32149	0.141	T	0.23226	-1.0194	10	0.44086	T	0.13	-27.1049	15.7154	0.77663	1.0:0.0:0.0:0.0	.	322	Q5VWG9	TAF3_HUMAN	R	322	ENSP00000340271:K322R	ENSP00000340271:K322R	K	+	2	0	TAF3	8046444	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.730000	0.91510	2.123000	0.65237	0.533000	0.62120	AAG	.	.		0.493	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
LYZL1	84569	hgsc.bcm.edu	37	10	29581509	29581509	+	Silent	SNP	C	C	T	rs141824789		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr10:29581509C>T	ENST00000375500.3	+	3	396	c.339C>T	c.(337-339)gaC>gaT	p.D113D		NM_032517.4	NP_115906.3	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	67					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			central_nervous_system(1)|cervix(2)|large_intestine(2)|lung(5)|skin(1)	11		Breast(68;0.203)				TCCTGGATGACGGCAGCATCG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18325	0.0		0.001	False		,,,				2504	0.0				p.D113D		Atlas-SNP	.											LYZL1,NS,adenocarcinoma,0,1	LYZL1	25	.	0			c.C339T						.	C		1,4405	2.1+/-5.4	0,1,2202	147.0	114.0	125.0		339	-8.8	0.0	10	dbSNP_134	125	0,8600		0,0,4300	no	coding-synonymous	LYZL1	NM_032517.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		113/195	29581509	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84569	exon3			GGATGACGGCAGC		CCDS31174.1	10p12.1	2004-08-02			ENSG00000120563	ENSG00000120563	3.2.1.1		30502	protein-coding gene	gene with protein product						12477932	Standard	XM_005252627		Approved	MGC33408, LYC2	uc001iul.3	Q6UWQ5	OTTHUMG00000017880	ENST00000375500.3:c.339C>T	chr10.hg19:g.29581509C>T		140.0	0.0		89.0	5.0	NM_032517	Q5T921|Q8WW16	Silent	SNP	ENST00000375500.3	hg19	CCDS31174.1																																																																																			.	C|1.000;T|0.000		0.567	LYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047381.1	NM_032517	
CCAR1	55749	hgsc.bcm.edu	37	10	70508892	70508893	+	Splice_Site	DNP	GC	GC	TT			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr10:70508892_70508893GC>TT	ENST00000265872.6	+	9	945_946	c.826_827GC>TT	c.(826-828)GCt>TTt	p.A276F	CCAR1_ENST00000535016.1_Splice_Site_p.A261F|CCAR1_ENST00000543719.1_Splice_Site_p.A261F	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	276					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						ATCTTTTAAAGCTGGTTTATTG	0.401																																					.|p.A276V		Atlas-SNP	.											.	CCAR1	118	.	0			c.827-1G>T|c.C827T						.																																			SO:0001630	splice_region_variant	55749	exon9			TTTAAAGCTGGTT|TTAAAGCTGGTTT	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	Exception_encountered	chr10.hg19:g.70508892_70508893delinsTT		34.0	0.0		48.0|49.0	24.0	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Splice_Site|Missense_Mutation	SNP	ENST00000265872.6	hg19	CCDS7282.1																																																																																			.	.		0.401	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	Missense_Mutation
DNHD1	144132	hgsc.bcm.edu	37	11	6579425	6579425	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:6579425C>T	ENST00000527990.2	+	23	8900	c.8900C>T	c.(8899-8901)cCt>cTt	p.P2967L	DNHD1_ENST00000254579.6_Missense_Mutation_p.P2967L			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2967					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGCAGTTTCCCTGGCCAGTAC	0.542																																					p.P2967L		Atlas-SNP	.											.	DNHD1	198	.	0			c.C8900T						.						69.0	59.0	62.0					11																	6579425		692	1591	2283	SO:0001583	missense	144132	exon25			GTTTCCCTGGCCA	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.8900C>T	chr11.hg19:g.6579425C>T	ENSP00000436180:p.Pro2967Leu	61.0	0.0		45.0	16.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	hg19	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925512	0.34002	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000534210;ENST00000524401	T;T	0.50813	0.73;0.73	5.19	5.19	0.71726	.	.	.	.	.	T	0.53012	0.1770	N	0.14661	0.345	0.49483	D	0.999798	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.60682	-0.7215	9	0.87932	D	0	.	16.0007	0.80290	0.0:1.0:0.0:0.0	.	2967;714	Q96M86;E9PHZ7	DNHD1_HUMAN;.	L	2967;2967;714;32	ENSP00000254579:P2967L;ENSP00000436180:P2967L	ENSP00000254579:P2967L	P	+	2	0	DNHD1	6536001	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.067000	0.57527	2.569000	0.86673	0.650000	0.86243	CCT	.	.		0.542	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
MYOD1	4654	hgsc.bcm.edu	37	11	17742472	17742472	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:17742472C>A	ENST00000250003.3	+	2	869	c.654C>A	c.(652-654)agC>agA	p.S218R		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	218					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						gccccccgagcggcgcccggc	0.687																																					p.S218R		Atlas-SNP	.											.	MYOD1	50	.	0			c.C654A						.						12.0	18.0	16.0					11																	17742472		2193	4276	6469	SO:0001583	missense	4654	exon2			CCCGAGCGGCGCC	AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.654C>A	chr11.hg19:g.17742472C>A	ENSP00000250003:p.Ser218Arg	41.0	0.0		40.0	24.0	NM_002478	O75321	Missense_Mutation	SNP	ENST00000250003.3	hg19	CCDS7826.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475664	0.63737	.	.	ENSG00000129152	ENST00000250003	D	0.97352	-4.35	4.45	0.499	0.16914	.	0.046170	0.85682	D	0.000000	D	0.93628	0.7965	N	0.13003	0.285	0.30094	N	0.808022	D	0.61080	0.989	P	0.56788	0.806	D	0.89911	0.4052	10	0.18710	T	0.47	-29.2492	8.2127	0.31492	0.0:0.5685:0.0:0.4315	.	218	P15172	MYOD1_HUMAN	R	218	ENSP00000250003:S218R	ENSP00000250003:S218R	S	+	3	2	MYOD1	17699048	0.992000	0.36948	0.995000	0.50966	0.975000	0.68041	0.077000	0.14738	-0.067000	0.12976	-0.140000	0.14226	AGC	.	.		0.687	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389387.1	NM_002478	
OR5T3	390154	hgsc.bcm.edu	37	11	56019970	56019970	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:56019970T>A	ENST00000303059.3	+	1	295	c.295T>A	c.(295-297)Ttg>Atg	p.L99M		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TTTATCATTCTTGGATGCTTG	0.383																																					p.L99M		Atlas-SNP	.											.	OR5T3	98	.	0			c.T295A						.						100.0	100.0	100.0					11																	56019970		2201	4296	6497	SO:0001583	missense	390154	exon1			TCATTCTTGGATG	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.295T>A	chr11.hg19:g.56019970T>A	ENSP00000305403:p.Leu99Met	284.0	0.0		155.0	61.0	NM_001004747	Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	hg19	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	t	9.776	1.173895	0.21704	.	.	ENSG00000172489	ENST00000303059	T	0.14391	2.51	4.55	-9.1	0.00714	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31721	U	0.007165	T	0.13286	0.0322	L	0.42008	1.315	0.09310	N	1	P	0.52842	0.956	P	0.60345	0.873	T	0.03728	-1.1009	10	0.66056	D	0.02	.	1.8022	0.03073	0.2488:0.3608:0.1751:0.2153	.	99	Q8NGG3	OR5T3_HUMAN	M	99	ENSP00000305403:L99M	ENSP00000305403:L99M	L	+	1	2	OR5T3	55776546	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-7.641000	0.00032	-1.491000	0.01840	-1.045000	0.02358	TTG	.	.		0.383	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747	
SLC29A2	3177	hgsc.bcm.edu	37	11	66135010	66135010	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:66135010G>A	ENST00000357440.2	-	7	886	c.658C>T	c.(658-660)Cgc>Tgc	p.R220C	SLC29A2_ENST00000544554.1_Missense_Mutation_p.R220C|SLC29A2_ENST00000311161.7_Missense_Mutation_p.R220C|SLC29A2_ENST00000546034.1_Missense_Mutation_p.R220C	NM_001532.2	NP_001523.2	Q14542	S29A2_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 2	220					cell proliferation (GO:0008283)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10					Didanosine(DB00900)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Zalcitabine(DB00943)|Zidovudine(DB00495)	AGGTAGTAGCGGGCAAACTTC	0.602																																					p.R220C		Atlas-SNP	.											.	SLC29A2	24	.	0			c.C658T						.						124.0	113.0	117.0					11																	66135010		2200	4295	6495	SO:0001583	missense	3177	exon7			AGTAGCGGGCAAA	X86681	CCDS8137.1, CCDS73326.1	11q13	2013-07-17	2013-07-17		ENSG00000174669	ENSG00000174669		"""Solute carriers"""	11004	protein-coding gene	gene with protein product		602110	"""solute carrier family 29 (nucleoside transporters), member 2"""	ENT2, HNP36		9192854, 9478986	Standard	NM_001532		Approved	DER12	uc001oht.3	Q14542	OTTHUMG00000169056	ENST00000357440.2:c.658C>T	chr11.hg19:g.66135010G>A	ENSP00000350024:p.Arg220Cys	97.0	0.0		84.0	30.0	NM_001532	B3KPY7|O43530|Q52M84|Q96R00|Q9UPE0	Missense_Mutation	SNP	ENST00000357440.2	hg19	CCDS8137.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.834739	0.71373	.	.	ENSG00000174669	ENST00000311161;ENST00000357440;ENST00000544554;ENST00000546034	T;T;T;T	0.81330	-0.19;-1.48;-1.48;-1.48	4.95	4.95	0.65309	.	0.599930	0.17966	N	0.156010	D	0.87485	0.6189	M	0.82630	2.6	0.51767	D	0.999936	D;D	0.76494	0.999;0.986	P;P	0.57776	0.827;0.625	D	0.88646	0.3179	10	0.87932	D	0	-11.0795	10.935	0.47241	0.0:0.0:0.8127:0.1873	.	220;220	G5E943;Q14542	.;S29A2_HUMAN	C	220	ENSP00000311250:R220C;ENSP00000350024:R220C;ENSP00000439456:R220C;ENSP00000440329:R220C	ENSP00000311250:R220C	R	-	1	0	SLC29A2	65891586	0.971000	0.33674	1.000000	0.80357	0.983000	0.72400	2.182000	0.42556	2.314000	0.78098	0.456000	0.33151	CGC	.	.		0.602	SLC29A2-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402093.1	NM_001532	
PRKRIR	5612	hgsc.bcm.edu	37	11	76063257	76063257	+	Missense_Mutation	SNP	T	T	C	rs148924079		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:76063257T>C	ENST00000260045.3	-	5	1042	c.937A>G	c.(937-939)Atg>Gtg	p.M313V	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	313					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M313V(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TCAGTTATCATAGTGTGAAAT	0.393																																					p.M313V		Atlas-SNP	.											PRKRIR,NS,carcinoma,0,1	PRKRIR	65	.	1	Substitution - Missense(1)	prostate(1)	c.A937G						.	T	VAL/MET	1,4377		0,1,2188	48.0	51.0	50.0		937	5.0	0.7	11	dbSNP_134	50	1,8559		0,1,4279	no	missense	PRKRIR	NM_004705.2	21	0,2,6467	CC,CT,TT		0.0117,0.0228,0.0155	benign	313/762	76063257	2,12936	2189	4280	6469	SO:0001583	missense	5612	exon5			TTATCATAGTGTG	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.937A>G	chr11.hg19:g.76063257T>C	ENSP00000260045:p.Met313Val	425.0	0.0		347.0	129.0	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	hg19	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	T	4.484	0.089738	0.08632	2.28E-4	1.17E-4	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.17528	2.27;2.27	4.99	4.99	0.66335	Ribonuclease H-like (1);	0.366505	0.33732	N	0.004609	T	0.06690	0.0171	N	0.01874	-0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28106	-1.0054	10	0.31617	T	0.26	.	10.3794	0.44101	0.0:0.0773:0.0:0.9226	.	313	O43422	P52K_HUMAN	V	138;313	ENSP00000436249:M138V;ENSP00000260045:M313V	ENSP00000260045:M313V	M	-	1	0	PRKRIR	75740905	0.747000	0.28283	0.736000	0.30914	0.924000	0.55760	1.077000	0.30741	2.043000	0.60533	0.524000	0.50904	ATG	.	T|1.000;C|0.000		0.393	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
USP35	57558	hgsc.bcm.edu	37	11	77920573	77920573	+	Missense_Mutation	SNP	C	C	A	rs202205531		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:77920573C>A	ENST00000529308.1	+	10	1933	c.1672C>A	c.(1672-1674)Ccc>Acc	p.P558T	USP35_ENST00000530535.1_3'UTR|USP35_ENST00000526425.1_Missense_Mutation_p.P289T|USP35_ENST00000441408.2_Missense_Mutation_p.P144T|USP35_ENST00000530267.1_Missense_Mutation_p.P126T	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	558	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			GCCCGAGGAGCCCCCGGCCCC	0.587																																					p.P558T		Atlas-SNP	.											.	USP35	179	.	0			c.C1672A						.						37.0	42.0	40.0					11																	77920573		1946	4120	6066	SO:0001583	missense	57558	exon10			GAGGAGCCCCCGG	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1672C>A	chr11.hg19:g.77920573C>A	ENSP00000431876:p.Pro558Thr	96.0	0.0		93.0	39.0	NM_020798		Missense_Mutation	SNP	ENST00000529308.1	hg19	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	c	0.901	-0.722173	0.03182	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	4.57	2.59	0.31030	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.298620	0.05240	N	0.511985	T	0.19805	0.0476	N	0.17838	0.53	0.22827	N	0.998683	B;B	0.19445	0.007;0.036	B;B	0.18871	0.014;0.023	T	0.21143	-1.0254	10	0.07325	T	0.83	-12.6195	9.571	0.39427	0.1514:0.5557:0.2929:0.0	.	558;144	Q9P2H5;E7EWV7	UBP35_HUMAN;.	T	126;558;144;289	ENSP00000435468:P126T;ENSP00000431876:P558T;ENSP00000400825:P144T;ENSP00000434942:P289T	ENSP00000400825:P144T	P	+	1	0	USP35	77598221	0.002000	0.14202	0.951000	0.38953	0.059000	0.15707	-0.243000	0.08915	0.475000	0.27415	0.586000	0.80456	CCC	.	C|0.999;T|0.001		0.587	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527	
GRIA4	2893	hgsc.bcm.edu	37	11	105789505	105789505	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:105789505A>G	ENST00000530497.1	+	10	1337	c.1337A>G	c.(1336-1338)tAc>tGc	p.Y446C	GRIA4_ENST00000282499.5_Missense_Mutation_p.Y446C|GRIA4_ENST00000525187.1_Missense_Mutation_p.Y446C|GRIA4_ENST00000393127.2_Missense_Mutation_p.Y446C			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	446					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TATGAAGGATACTGTGTAGAT	0.348																																					p.Y446C		Atlas-SNP	.											.	GRIA4	380	.	0			c.A1337G						.						78.0	75.0	76.0					11																	105789505		2202	4299	6501	SO:0001583	missense	2893	exon11			AAGGATACTGTGT	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1337A>G	chr11.hg19:g.105789505A>G	ENSP00000435775:p.Tyr446Cys	121.0	0.0		81.0	32.0	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.181026	0.78677	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.68	5.68	0.88126	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.64402	D	0.000001	D	0.95538	0.8550	H	0.96430	3.82	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.69479	0.964;0.952	D	0.96912	0.9668	10	0.87932	D	0	.	16.2322	0.82352	1.0:0.0:0.0:0.0	.	446;446	P48058;G3V164	GRIA4_HUMAN;.	C	446	ENSP00000282499:Y446C;ENSP00000376835:Y446C;ENSP00000435775:Y446C;ENSP00000432180:Y446C	ENSP00000282499:Y446C	Y	+	2	0	GRIA4	105294715	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.288000	0.76882	0.528000	0.53228	TAC	.	.		0.348	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
HSPA8	3312	hgsc.bcm.edu	37	11	122931847	122931847	+	Silent	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:122931847G>A	ENST00000532636.1	-	2	305	c.186C>T	c.(184-186)aaC>aaT	p.N62N	HSPA8_ENST00000227378.3_Silent_p.N62N|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534624.1_Silent_p.N62N|SNORD14C_ENST00000365382.1_RNA|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000453788.2_Silent_p.N62N|HSPA8_ENST00000526110.1_Silent_p.N62N|HSPA8_ENST00000534319.1_5'Flank|HSPA8_ENST00000533540.1_Silent_p.N62N|HSPA8_ENST00000526862.1_5'Flank			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	62					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGTTGGTGGGGTTCATTGCAA	0.438																																					p.N62N	Colon(21;486 594 5900 6733 14272)	Atlas-SNP	.											.	HSPA8	168	.	0			c.C186T						.						70.0	61.0	64.0					11																	122931847		2202	4299	6501	SO:0001819	synonymous_variant	3312	exon2			GGTGGGGTTCATT	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.186C>T	chr11.hg19:g.122931847G>A		62.0	0.0		44.0	6.0	NM_006597	Q9H3R6	Silent	SNP	ENST00000532636.1	hg19	CCDS8440.1																																																																																			.	.		0.438	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
GLB1L3	112937	hgsc.bcm.edu	37	11	134158769	134158769	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:134158769G>A	ENST00000431683.2	+	7	714	c.714G>A	c.(712-714)atG>atA	p.M238I	GLB1L3_ENST00000389887.5_Missense_Mutation_p.M238I	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	238					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		AAACATACATGCCGTATCTCC	0.507																																					p.M238I		Atlas-SNP	.											.	GLB1L3	102	.	0			c.G714A						.						69.0	70.0	70.0					11																	134158769		2000	4161	6161	SO:0001583	missense	112937	exon7			ATACATGCCGTAT		CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.714G>A	chr11.hg19:g.134158769G>A	ENSP00000396615:p.Met238Ile	38.0	0.0		28.0	11.0	NM_001080407	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	ENST00000431683.2	hg19	CCDS44780.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349231	0.61183	.	.	ENSG00000166105	ENST00000389887;ENST00000431683	D;D	0.97994	-4.65;-4.65	5.01	5.01	0.66863	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.97864	0.9298	M	0.69358	2.11	0.39725	D	0.971523	P;P	0.49862	0.929;0.786	P;P	0.55222	0.771;0.665	D	0.99013	1.0815	9	0.87932	D	0	.	15.7127	0.77644	0.0:0.0:1.0:0.0	.	238;238	Q8NCI6-4;Q8NCI6	.;GLBL3_HUMAN	I	238	ENSP00000374537:M238I;ENSP00000396615:M238I	ENSP00000374537:M238I	M	+	3	0	GLB1L3	133663979	1.000000	0.71417	0.991000	0.47740	0.038000	0.13279	6.425000	0.73370	2.758000	0.94735	0.655000	0.94253	ATG	.	.		0.507	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	
USP5	8078	hgsc.bcm.edu	37	12	6973284	6973284	+	Silent	SNP	T	T	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr12:6973284T>G	ENST00000229268.8	+	17	2221	c.2169T>G	c.(2167-2169)ccT>ccG	p.P723P	USP5_ENST00000389231.5_Silent_p.P700P|TPI1_ENST00000229270.4_5'Flank	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	723	UBA 2. {ECO:0000255|PROSITE- ProRule:PRU00212}.|USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						CCGACCCCCCTCCTGAGGACT	0.617																																					p.P723P		Atlas-SNP	.											.	USP5	124	.	0			c.T2169G						.						77.0	83.0	81.0					12																	6973284		2203	4300	6503	SO:0001819	synonymous_variant	8078	exon17			CCCCCCTCCTGAG	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.2169T>G	chr12.hg19:g.6973284T>G		73.0	0.0		21.0	14.0	NM_001098536	D3DUS7|D3DUS8|Q96J22	Silent	SNP	ENST00000229268.8	hg19	CCDS41743.1																																																																																			.	.		0.617	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
ATF7IP	55729	hgsc.bcm.edu	37	12	14631250	14631251	+	Splice_Site	DNP	GA	GA	TC			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr12:14631250_14631251GA>TC	ENST00000540793.1	+	11	3096_3097	c.2941_2942GA>TC	c.(2941-2943)GAc>TCc	p.D981S	ATF7IP_ENST00000544627.1_Splice_Site_p.D989S|ATF7IP_ENST00000536444.1_Splice_Site_p.D980S|ATF7IP_ENST00000543189.1_Splice_Site_p.D980S|ATF7IP_ENST00000261168.4_Splice_Site_p.D981S			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	981					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						TTAACTAACAGACCCCAAAAAA	0.396																																					.|p.D981A		Atlas-SNP	.											.	ATF7IP	136	.	0			c.2942-1G>T|c.A2942C						.																																			SO:0001630	splice_region_variant	55729	exon12			CTAACAGACCCCA|TAACAGACCCCAA	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		Exception_encountered	chr12.hg19:g.14631250_14631251delinsTC		100.0|101.0	0.0		39.0	24.0	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Splice_Site|Missense_Mutation	SNP	ENST00000540793.1	hg19	CCDS8663.1																																																																																			.	.		0.396	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	Missense_Mutation
LRRK2	120892	hgsc.bcm.edu	37	12	40687370	40687370	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr12:40687370A>T	ENST00000298910.7	+	21	2771	c.2713A>T	c.(2713-2715)Aaa>Taa	p.K905*	LRRK2_ENST00000343742.2_Nonsense_Mutation_p.K905*	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	905					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATTTCTTGTGAAAAAGAAATC	0.328																																					p.K905X		Atlas-SNP	.											.	LRRK2	763	.	0			c.A2713T						.						69.0	69.0	69.0					12																	40687370		2201	4298	6499	SO:0001587	stop_gained	120892	exon21			CTTGTGAAAAAGA	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2713A>T	chr12.hg19:g.40687370A>T	ENSP00000298910:p.Lys905*	118.0	0.0		138.0	101.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	ENST00000298910.7	hg19	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	41	8.778675	0.98950	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	.	.	.	5.03	5.03	0.67393	.	0.291831	0.37393	N	0.002106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0591	0.71939	1.0:0.0:0.0:0.0	.	.	.	.	X	905	.	ENSP00000298910:K905X	K	+	1	0	LRRK2	38973637	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.860000	0.69546	2.000000	0.58554	0.528000	0.53228	AAA	.	.		0.328	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
PDZRN4	29951	hgsc.bcm.edu	37	12	41957413	41957413	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr12:41957413A>G	ENST00000402685.2	+	8	1437	c.1429A>G	c.(1429-1431)Aag>Gag	p.K477E	PDZRN4_ENST00000298919.7_Missense_Mutation_p.K217E|PDZRN4_ENST00000539469.2_Missense_Mutation_p.K219E	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	477	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CGATGAGTGTAAGAGAATCGT	0.408																																					p.K477E		Atlas-SNP	.											.	PDZRN4	346	.	0			c.A1429G						.						128.0	118.0	121.0					12																	41957413		2203	4300	6503	SO:0001583	missense	29951	exon8			GAGTGTAAGAGAA	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1429A>G	chr12.hg19:g.41957413A>G	ENSP00000384197:p.Lys477Glu	93.0	0.0		98.0	66.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.260997	0.39995	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.30182	1.54;1.54;1.54	5.19	4.03	0.46877	PDZ/DHR/GLGF (3);	0.297133	0.32401	N	0.006156	T	0.17916	0.0430	N	0.17379	0.485	0.36349	D	0.859995	P;B;B	0.44521	0.837;0.061;0.001	B;B;B	0.37387	0.248;0.096;0.015	T	0.13442	-1.0509	10	0.30854	T	0.27	-27.764	12.9161	0.58207	0.8642:0.1357:0.0:0.0	.	477;217;219	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	E	477;219;217	ENSP00000384197:K477E;ENSP00000439990:K219E;ENSP00000298919:K217E	ENSP00000298919:K217E	K	+	1	0	PDZRN4	40243680	1.000000	0.71417	0.633000	0.29310	0.966000	0.64601	3.411000	0.52672	1.042000	0.40150	0.533000	0.62120	AAG	.	.		0.408	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
KMT2D	8085	hgsc.bcm.edu	37	12	49416062	49416062	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr12:49416062C>A	ENST00000301067.7	-	52	16412		c.e52+1			NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D						chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCATCTCTCACCTGGCAGGGC	0.488																																					.		Atlas-SNP	.											.	MLL2	1173	.	0			c.16412+1G>T						.						61.0	63.0	63.0					12																	49416062		2090	4227	6317	SO:0001630	splice_region_variant	8085	exon53			CTCTCACCTGGCA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16412+1G>T	chr12.hg19:g.49416062C>A		66.0	0.0		87.0	18.0	NM_003482	O14687	Splice_Site	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764962	0.90020	.	.	ENSG00000167548	ENST00000301067;ENST00000526209	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7533	0.88441	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MLL2	47702329	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.706000	0.84615	2.565000	0.86533	0.650000	0.86243	.	.	.		0.488	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		Intron
RPH3A	22895	hgsc.bcm.edu	37	12	113304627	113304627	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr12:113304627C>G	ENST00000389385.4	+	7	923	c.426C>G	c.(424-426)atC>atG	p.I142M	RPH3A_ENST00000415485.3_Missense_Mutation_p.I142M|RPH3A_ENST00000551052.1_Missense_Mutation_p.I138M|RPH3A_ENST00000420983.2_Missense_Mutation_p.I142M|RPH3A_ENST00000543106.2_Missense_Mutation_p.I142M|RPH3A_ENST00000447659.2_Missense_Mutation_p.I93M|RPH3A_ENST00000548866.1_Missense_Mutation_p.I93M	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	142	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TCTGCAAAATCTGCATTGAGC	0.532																																					p.I142M		Atlas-SNP	.											.	RPH3A	98	.	0			c.C426G						.						123.0	95.0	105.0					12																	113304627		2203	4300	6503	SO:0001583	missense	22895	exon7			CAAAATCTGCATT	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.426C>G	chr12.hg19:g.113304627C>G	ENSP00000374036:p.Ile142Met	60.0	0.0		60.0	12.0	NM_001143854	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	hg19	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165785	0.57476	.	.	ENSG00000089169	ENST00000543106;ENST00000551593;ENST00000547728;ENST00000389385;ENST00000447659;ENST00000550901;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	4.69	3.78	0.43462	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000011	D	0.83737	0.5319	M	0.72353	2.195	0.53005	D	0.999967	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.996;0.995;0.995;0.998	D	0.83907	0.0293	10	0.87932	D	0	.	5.1009	0.14759	0.1889:0.6524:0.0:0.1587	.	93;142;142;138	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	M	142;142;142;142;93;75;138;142;93;142	ENSP00000440384:I142M;ENSP00000446780:I142M;ENSP00000449613:I142M;ENSP00000374036:I142M;ENSP00000413254:I93M;ENSP00000448100:I75M;ENSP00000448297:I138M;ENSP00000405357:I142M;ENSP00000450347:I93M;ENSP00000408889:I142M	ENSP00000374036:I142M	I	+	3	3	RPH3A	111789010	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.500000	0.45381	2.315000	0.78130	0.563000	0.77884	ATC	.	.		0.532	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
STARD13	90627	hgsc.bcm.edu	37	13	33681023	33681023	+	Silent	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr13:33681023G>C	ENST00000336934.5	-	13	3212	c.3096C>G	c.(3094-3096)ctC>ctG	p.L1032L	STARD13_ENST00000399365.3_Silent_p.L914L|STARD13_ENST00000255486.4_Silent_p.L1024L	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	1032	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GCTCCACGGAGAGGGACACCA	0.532																																					p.L1032L		Atlas-SNP	.											.	STARD13	100	.	0			c.C3096G						.						122.0	117.0	119.0					13																	33681023		2203	4300	6503	SO:0001819	synonymous_variant	90627	exon13			CACGGAGAGGGAC	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.3096C>G	chr13.hg19:g.33681023G>C		99.0	0.0		60.0	15.0	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Silent	SNP	ENST00000336934.5	hg19	CCDS9348.1																																																																																			.	.		0.532	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
WDFY2	115825	hgsc.bcm.edu	37	13	52301872	52301872	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr13:52301872C>A	ENST00000298125.5	+	6	724	c.544C>A	c.(544-546)Ctc>Atc	p.L182I		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	182							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		AGTAACAATCCTCAAACTGGA	0.413																																					p.L182I		Atlas-SNP	.											.	WDFY2	36	.	0			c.C544A						.						140.0	124.0	129.0					13																	52301872		2203	4300	6503	SO:0001583	missense	115825	exon6			ACAATCCTCAAAC	AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.544C>A	chr13.hg19:g.52301872C>A	ENSP00000298125:p.Leu182Ile	64.0	0.0		62.0	14.0	NM_052950	B1AL86|Q96CS1	Missense_Mutation	SNP	ENST00000298125.5	hg19	CCDS9429.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918388	0.92249	.	.	ENSG00000139668	ENST00000298125	T	0.65549	-0.16	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77011	0.4068	L	0.59912	1.85	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.70016	0.967;0.952	T	0.77781	-0.2459	10	0.66056	D	0.02	-20.9036	18.7245	0.91710	0.0:1.0:0.0:0.0	.	79;182	Q96LK4;Q96P53	.;WDFY2_HUMAN	I	182	ENSP00000298125:L182I	ENSP00000298125:L182I	L	+	1	0	WDFY2	51199873	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	7.440000	0.80464	2.652000	0.90054	0.650000	0.86243	CTC	.	.		0.413	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045985.3	NM_052950	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111927941	111927941	+	Silent	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr13:111927941C>A	ENST00000375741.2	+	13	1648	c.1398C>A	c.(1396-1398)atC>atA	p.I466I	ARHGEF7_ENST00000218789.5_Silent_p.I288I|ARHGEF7_ENST00000483189.1_3'UTR|ARHGEF7_ENST00000544132.1_Silent_p.I122I|ARHGEF7_ENST00000317133.5_Silent_p.I445I|ARHGEF7_ENST00000375736.4_Silent_p.I288I|ARHGEF7_ENST00000478679.1_Silent_p.I210I|ARHGEF7_ENST00000370623.3_Silent_p.I373I|ARHGEF7_ENST00000375737.5_Silent_p.I363I|ARHGEF7_ENST00000375723.1_Silent_p.I288I|ARHGEF7_ENST00000426073.2_Silent_p.I288I|ARHGEF7_ENST00000375739.2_Silent_p.I416I	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	466					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CGGAAGCCATCCGGAACTGGG	0.512																																					p.I466I		Atlas-SNP	.											.	ARHGEF7	157	.	0			c.C1398A						.						181.0	156.0	165.0					13																	111927941		2203	4300	6503	SO:0001819	synonymous_variant	8874	exon13			AGCCATCCGGAAC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1398C>A	chr13.hg19:g.111927941C>A		117.0	0.0		118.0	32.0	NM_001113511	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000375741.2	hg19	CCDS45068.1																																																																																			.	.		0.512	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
GPHN	10243	hgsc.bcm.edu	37	14	67346716	67346716	+	Silent	SNP	A	A	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr14:67346716A>T	ENST00000315266.5	+	5	1475	c.354A>T	c.(352-354)ggA>ggT	p.G118G	GPHN_ENST00000543237.1_Silent_p.G131G|GPHN_ENST00000478722.1_Silent_p.G118G|GPHN_ENST00000305960.9_Silent_p.G87G|GPHN_ENST00000459628.1_Silent_p.G100G|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	118	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		TGCTGATGGGATCACTTAATG	0.418			T	MLL	AL																																p.G118G		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.A354T						.						105.0	98.0	101.0					14																	67346716		2203	4300	6503	SO:0001819	synonymous_variant	10243	exon5			GATGGGATCACTT	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.354A>T	chr14.hg19:g.67346716A>T		118.0	0.0		42.0	29.0	NM_001024218	Q9H4E9|Q9P2G2	Silent	SNP	ENST00000315266.5	hg19	CCDS32103.1																																																																																			.	.		0.418	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
DMXL2	23312	hgsc.bcm.edu	37	15	51839582	51839582	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr15:51839582C>T	ENST00000251076.5	-	7	878	c.591G>A	c.(589-591)tgG>tgA	p.W197*	DMXL2_ENST00000449909.3_Nonsense_Mutation_p.W197*|DMXL2_ENST00000560421.1_5'UTR|DMXL2_ENST00000543779.2_Nonsense_Mutation_p.W197*	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	197						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.W197C(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TCATAGGATACCACACTTTCA	0.313																																					p.W197X		Atlas-SNP	.											DMXL2,NS,carcinoma,0,1	DMXL2	262	.	1	Substitution - Missense(1)	kidney(1)	c.G591A						.						77.0	76.0	76.0					15																	51839582		2195	4293	6488	SO:0001587	stop_gained	23312	exon7			AGGATACCACACT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.591G>A	chr15.hg19:g.51839582C>T	ENSP00000251076:p.Trp197*	72.0	0.0		67.0	14.0	NM_001174117	B2RTR3|B7ZMH3|F5GWF1|O94938	Nonsense_Mutation	SNP	ENST00000251076.5	hg19	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467836	0.84533	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3281	0.94270	0.0:1.0:0.0:0.0	.	.	.	.	X	197	.	ENSP00000251076:W197X	W	-	3	0	DMXL2	49626874	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.398000	0.79919	2.588000	0.87417	0.585000	0.79938	TGG	.	.		0.313	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
LACTB	114294	hgsc.bcm.edu	37	15	63419842	63419842	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr15:63419842T>G	ENST00000261893.4	+	4	978	c.906T>G	c.(904-906)atT>atG	p.I302M	RPS27L_ENST00000559763.1_Intron|LACTB_ENST00000413507.2_Missense_Mutation_p.I302M	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	302						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						AAAATTCAATTGAATCCCTAA	0.308																																					p.I302M	Melanoma(85;443 1381 6215 27308 35583)	Atlas-SNP	.											.	LACTB	29	.	0			c.T906G						.						31.0	37.0	35.0					15																	63419842		2187	4278	6465	SO:0001583	missense	114294	exon4			TTCAATTGAATCC	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.906T>G	chr15.hg19:g.63419842T>G	ENSP00000261893:p.Ile302Met	131.0	0.0		101.0	42.0	NM_171846	P83096	Missense_Mutation	SNP	ENST00000261893.4	hg19	CCDS10182.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.753315	0.31046	.	.	ENSG00000103642	ENST00000261893;ENST00000413507	T;T	0.42131	0.98;0.98	6.08	1.21	0.21127	Beta-lactamase/transpeptidase-like (2);Beta-lactamase-related (1);	0.046900	0.85682	D	0.000000	T	0.34571	0.0902	L	0.54323	1.7	0.80722	D	1	B	0.22800	0.075	B	0.30251	0.113	T	0.11203	-1.0597	10	0.49607	T	0.09	-12.5011	4.8517	0.13540	0.1275:0.2802:0.0:0.5922	.	302	P83111	LACTB_HUMAN	M	302	ENSP00000261893:I302M;ENSP00000392956:I302M	ENSP00000261893:I302M	I	+	3	3	LACTB	61206895	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	0.856000	0.27818	0.164000	0.19529	-0.353000	0.07706	ATT	.	.		0.308	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
MYO9A	4649	hgsc.bcm.edu	37	15	72338583	72338583	+	Silent	SNP	T	T	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr15:72338583T>G	ENST00000356056.5	-	2	794	c.322A>C	c.(322-324)Aga>Cga	p.R108R	MYO9A_ENST00000444904.1_Silent_p.R108R|MYO9A_ENST00000564571.1_Silent_p.R108R|RNU2-65P_ENST00000410162.1_RNA|MYO9A_ENST00000566885.1_Intron|MYO9A_ENST00000424560.1_Silent_p.R108R|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	108	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TTTTTCTCTCTCAGAAGGAAG	0.488																																					p.R108R		Atlas-SNP	.											.	MYO9A	203	.	0			c.A322C						.						92.0	92.0	92.0					15																	72338583		2199	4297	6496	SO:0001819	synonymous_variant	4649	exon2			TCTCTCTCAGAAG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.322A>C	chr15.hg19:g.72338583T>G		105.0	0.0		101.0	47.0	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	hg19	CCDS10239.1																																																																																			.	.		0.488	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
LMF1	64788	hgsc.bcm.edu	37	16	904604	904604	+	Missense_Mutation	SNP	G	G	T	rs201312320		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:904604G>T	ENST00000262301.11	-	11	1650	c.1632C>A	c.(1630-1632)ttC>ttA	p.F544L	LMF1_ENST00000543238.1_Missense_Mutation_p.F307L|LMF1_ENST00000568897.1_Missense_Mutation_p.F327L|LMF1_ENST00000399843.2_Missense_Mutation_p.F544L	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	544					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				TGAGCGGAGGGAAGTAGGCTC	0.652																																					p.F544L		Atlas-SNP	.											.	LMF1	42	.	0			c.C1632A						.						26.0	32.0	30.0					16																	904604		2031	4166	6197	SO:0001583	missense	64788	exon11			CGGAGGGAAGTAG	AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.1632C>A	chr16.hg19:g.904604G>T	ENSP00000262301:p.Phe544Leu	36.0	0.0		34.0	16.0	NM_022773	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Missense_Mutation	SNP	ENST00000262301.11	hg19	CCDS45373.1	.	.	.	.	.	.	.	.	.	.	G	2.875	-0.233042	0.05983	.	.	ENSG00000103227	ENST00000262301;ENST00000399843;ENST00000540070;ENST00000543238	T;T;T	0.20598	2.06;2.06;2.06	4.4	0.172	0.15031	.	0.000000	0.85682	U	0.000000	T	0.09291	0.0229	N	0.14661	0.345	0.80722	D	1	B	0.15141	0.012	B	0.22880	0.042	T	0.27226	-1.0080	10	0.11485	T	0.65	-4.5933	6.8417	0.23967	0.5242:0.0:0.4758:0.0	.	544	Q96S06	LMF1_HUMAN	L	544;544;327;307	ENSP00000262301:F544L;ENSP00000382737:F544L;ENSP00000437418:F307L	ENSP00000262301:F544L	F	-	3	2	LMF1	844605	1.000000	0.71417	0.966000	0.40874	0.016000	0.09150	1.947000	0.40293	0.024000	0.15214	-0.362000	0.07510	TTC	.	G|0.998;A|0.002		0.652	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773	
PPL	5493	hgsc.bcm.edu	37	16	4935181	4935181	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:4935181A>G	ENST00000345988.2	-	22	3564	c.3475T>C	c.(3475-3477)Tgg>Cgg	p.W1159R	PPL_ENST00000590782.2_Missense_Mutation_p.W1157R	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1159					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCCAAGGCCCATATCTTTCGG	0.622																																					p.W1159R		Atlas-SNP	.											.	PPL	168	.	0			c.T3475C						.						129.0	118.0	122.0					16																	4935181		2197	4300	6497	SO:0001583	missense	5493	exon22			AGGCCCATATCTT	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3475T>C	chr16.hg19:g.4935181A>G	ENSP00000340510:p.Trp1159Arg	117.0	0.0		68.0	25.0	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	hg19	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	A	0.039	-1.293411	0.01375	.	.	ENSG00000118898	ENST00000345988	T	0.45668	0.89	5.17	2.94	0.34122	.	0.639363	0.15096	N	0.280817	T	0.25531	0.0621	L	0.38531	1.155	0.28266	N	0.924612	B	0.02656	0.0	B	0.04013	0.001	T	0.17899	-1.0354	10	0.15499	T	0.54	.	2.5733	0.04800	0.514:0.0:0.2892:0.1969	.	1159	O60437	PEPL_HUMAN	R	1159	ENSP00000340510:W1159R	ENSP00000340510:W1159R	W	-	1	0	PPL	4875182	0.998000	0.40836	0.962000	0.40283	0.437000	0.31866	1.007000	0.29860	0.823000	0.34589	-0.375000	0.07067	TGG	.	.		0.622	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
C16orf89	146556	hgsc.bcm.edu	37	16	5108602	5108602	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:5108602G>C	ENST00000315997.5	-	4	720	c.519C>G	c.(517-519)agC>agG	p.S173R	C16orf89_ENST00000350219.4_Missense_Mutation_p.S211R|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Missense_Mutation_p.S211R|C16orf89_ENST00000472572.3_Missense_Mutation_p.S173R|C16orf89_ENST00000474471.3_Missense_Mutation_p.S173R	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	173						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						AGGGCTCGCTGCTGTCCGTCC	0.612																																					p.S173R		Atlas-SNP	.											.	C16orf89	64	.	0			c.C519G						.						34.0	43.0	40.0					16																	5108602		2104	4234	6338	SO:0001583	missense	146556	exon4			CTCGCTGCTGTCC		CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.519C>G	chr16.hg19:g.5108602G>C	ENSP00000324672:p.Ser173Arg	20.0	0.0		28.0	9.0	NM_001098514	B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	ENST00000315997.5	hg19	CCDS42116.2	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648958	0.47362	.	.	ENSG00000153446	ENST00000474471;ENST00000472572;ENST00000477550;ENST00000422873;ENST00000350219;ENST00000315997	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.14	3.17	0.36434	.	0.534254	0.20030	N	0.100730	T	0.35068	0.0919	M	0.63428	1.95	0.09310	N	1	P;P	0.51791	0.944;0.948	B;P	0.52267	0.416;0.694	T	0.11991	-1.0565	10	0.14252	T	0.57	-6.1235	7.1401	0.25552	0.1992:0.0:0.8008:0.0	.	173;211	Q6UX73;G3V0F0	CP089_HUMAN;.	R	173;173;173;211;211;173	ENSP00000417158:S173R;ENSP00000420566:S173R;ENSP00000390402:S211R;ENSP00000283478:S211R;ENSP00000324672:S173R	ENSP00000324672:S173R	S	-	3	2	C16orf89	5048603	0.003000	0.15002	0.030000	0.17652	0.071000	0.16799	0.830000	0.27462	1.164000	0.42652	0.455000	0.32223	AGC	.	.		0.612	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1	NM_152459	
PALB2	79728	hgsc.bcm.edu	37	16	23646316	23646316	+	Silent	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:23646316T>C	ENST00000261584.4	-	4	1703	c.1551A>G	c.(1549-1551)aaA>aaG	p.K517K		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	517	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TGCAGGCTGATTTTCTTTTTC	0.468			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.K517K		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2	108	.	0			c.A1551G						.						163.0	155.0	158.0					16																	23646316		2197	4300	6497	SO:0001819	synonymous_variant	79728	exon4			GGCTGATTTTCTT		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1551A>G	chr16.hg19:g.23646316T>C		153.0	0.0		133.0	58.0	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Silent	SNP	ENST00000261584.4	hg19	CCDS32406.1																																																																																			.	.		0.468	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
KDM8	79831	hgsc.bcm.edu	37	16	27225073	27225073	+	Splice_Site	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:27225073G>C	ENST00000286096.4	+	3	838		c.e3+1		KDM8_ENST00000568965.1_Intron|CTD-3203P2.1_ENST00000567108.1_RNA|KDM8_ENST00000380948.2_Intron|KDM8_ENST00000441782.2_Splice_Site	NM_024773.2	NP_079049.2	Q8N371	KDM8_HUMAN	lysine (K)-specific demethylase 8						G2/M transition of mitotic cell cycle (GO:0000086)|histone H3-K36 demethylation (GO:0070544)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (H3-K36 specific) (GO:0051864)|metal ion binding (GO:0046872)										AGAAGTGGAGGTGGGTGGTCG	0.592																																					.		Atlas-SNP	.											.	.	.	.	0			c.665+1G>C						.						55.0	53.0	54.0					16																	27225073		2197	4300	6497	SO:0001630	splice_region_variant	79831	exon3			GTGGAGGTGGGTG	AK023860	CCDS10627.1, CCDS45448.1	16p12.1	2012-03-28	2012-03-28	2012-03-28	ENSG00000155666	ENSG00000155666		"""Chromatin-modifying enzymes / K-demethylases"""	25840	protein-coding gene	gene with protein product		611917	"""jumonji domain containing 5"""	JMJD5		20457893	Standard	NM_024773		Approved	FLJ13798	uc010vcn.1	Q8N371	OTTHUMG00000131677	ENST00000286096.4:c.665+1G>C	chr16.hg19:g.27225073G>C		59.0	0.0		48.0	17.0	NM_024773	B4DLU9|Q6VAK5|Q9H8B1	Splice_Site	SNP	ENST00000286096.4	hg19	CCDS10627.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966961	0.74131	.	.	ENSG00000155666	ENST00000286096;ENST00000441782	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4553	0.90718	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	JMJD5	27132574	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.435000	0.90297	2.699000	0.92147	0.609000	0.83330	.	.	.		0.592	KDM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254580.3	NM_024773	Intron
NLRC5	84166	hgsc.bcm.edu	37	16	57054706	57054706	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:57054706C>A	ENST00000262510.6	+	3	307	c.82C>A	c.(82-84)Ctg>Atg	p.L28M	NLRC5_ENST00000308149.7_Missense_Mutation_p.L28M|NLRC5_ENST00000436936.1_Missense_Mutation_p.L28M|NLRC5_ENST00000539144.1_Missense_Mutation_p.L28M	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	28					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCCAGAATGGCTGAACGCCAA	0.567																																					p.L28M		Atlas-SNP	.											.	NLRC5	186	.	0			c.C82A						.						97.0	87.0	90.0					16																	57054706		2198	4300	6498	SO:0001583	missense	84166	exon2			GAATGGCTGAACG	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.82C>A	chr16.hg19:g.57054706C>A	ENSP00000262510:p.Leu28Met	73.0	0.0		55.0	14.0	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	hg19	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978607	0.34942	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000544641;ENST00000539144	T;T;T;T	0.81078	-1.25;-1.29;-1.45;-1.29	4.76	3.79	0.43588	.	.	.	.	.	T	0.72195	0.3430	L	0.43152	1.355	0.24245	N	0.99535	P	0.52061	0.95	B	0.38056	0.264	T	0.63932	-0.6525	9	0.87932	D	0	.	11.7296	0.51728	0.1768:0.8232:0.0:0.0	.	28	Q86WI3	NLRC5_HUMAN	M	28	ENSP00000262510:L28M;ENSP00000308886:L28M;ENSP00000389739:L28M;ENSP00000441727:L28M	ENSP00000262510:L28M	L	+	1	2	NLRC5	55612207	1.000000	0.71417	0.977000	0.42913	0.408000	0.30992	2.004000	0.40854	0.976000	0.38417	0.455000	0.32223	CTG	.	.		0.567	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
TPPP3	51673	hgsc.bcm.edu	37	16	67424967	67424967	+	Silent	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:67424967C>T	ENST00000564104.1	-	1	889	c.48G>A	c.(46-48)aaG>aaA	p.K16K	RNU1-123P_ENST00000458950.1_RNA|TPPP3_ENST00000562206.1_Silent_p.K16K|TPPP3_ENST00000393957.2_Silent_p.K16K|TPPP3_ENST00000290942.5_Silent_p.K16K			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	16					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		GGATGGCAAACTTGCGGAAGC	0.597																																					p.K16K		Atlas-SNP	.											.	TPPP3	13	.	0			c.G48A						.						124.0	101.0	109.0					16																	67424967		2198	4300	6498	SO:0001819	synonymous_variant	51673	exon3			GGCAAACTTGCGG	BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.48G>A	chr16.hg19:g.67424967C>T		68.0	0.0		57.0	13.0	NM_016140	Q49AH9|Q9Y326|Q9Y6H0	Silent	SNP	ENST00000564104.1	hg19	CCDS10835.1																																																																																			.	.		0.597	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421787.2	NM_015964	
GLG1	2734	hgsc.bcm.edu	37	16	74487222	74487222	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr16:74487222G>A	ENST00000422840.2	-	26	3382	c.3383C>T	c.(3382-3384)gCa>gTa	p.A1128V	GLG1_ENST00000205061.5_Missense_Mutation_p.A1128V|GLG1_ENST00000447066.2_Missense_Mutation_p.A1117V	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	1128					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						GAAGCCATCTGCTGGGGCCAC	0.468																																					p.A1128V		Atlas-SNP	.											.	GLG1	106	.	0			c.C3383T						.						85.0	73.0	77.0					16																	74487222		2198	4300	6498	SO:0001583	missense	2734	exon26			CCATCTGCTGGGG		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.3383C>T	chr16.hg19:g.74487222G>A	ENSP00000405984:p.Ala1128Val	108.0	0.0		94.0	39.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	hg19	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.437753	0.25900	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.59088	0.2168	L	0.47716	1.5	0.80722	D	1	B;B;P;D	0.55172	0.008;0.296;0.794;0.97	B;B;B;P	0.51833	0.004;0.027;0.31;0.681	T	0.55062	-0.8199	9	0.02654	T	1	-19.2368	19.4724	0.94967	0.0:0.0:1.0:0.0	.	258;1128;1128;1117	Q6ZMF1;Q92896;Q92896-2;B7Z8Y4	.;GSLG1_HUMAN;.;.	V	1128;1117;1128	.	ENSP00000205061:A1128V	A	-	2	0	GLG1	73044723	1.000000	0.71417	0.738000	0.30950	0.426000	0.31534	9.434000	0.97515	2.595000	0.87683	0.514000	0.50259	GCA	.	.		0.468	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
YWHAE	7531	hgsc.bcm.edu	37	17	1264424	1264424	+	Missense_Mutation	SNP	G	G	T	rs148760302		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr17:1264424G>T	ENST00000264335.8	-	4	807	c.540C>A	c.(538-540)ttC>ttA	p.F180L	YWHAE_ENST00000571732.1_Missense_Mutation_p.F158L|YWHAE_ENST00000573026.1_Intron|YWHAE_ENST00000575977.1_Intron	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon	180					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		TTTCGTAGTAGAATACGGAAA	0.473			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome																														p.F180L		Atlas-SNP	.		Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	.	YWHAE	50	.	0			c.C540A						.						93.0	88.0	90.0					17																	1264424		2203	4300	6503	SO:0001583	missense	7531	exon4			GTAGTAGAATACG	U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.540C>A	chr17.hg19:g.1264424G>T	ENSP00000264335:p.Phe180Leu	104.0	0.0		49.0	35.0	NM_006761	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Missense_Mutation	SNP	ENST00000264335.8	hg19	CCDS11001.1	.	.	.	.	.	.	.	.	.	.	G	31	5.062852	0.93898	.	.	ENSG00000108953	ENST00000264335;ENST00000414131	T	0.60424	0.19	5.39	4.43	0.53597	14-3-3 domain (4);	0.000000	0.85682	U	0.000000	T	0.79695	0.4490	M	0.92367	3.3	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	D	0.84132	0.0412	10	0.87932	D	0	-18.6295	12.2476	0.54578	0.0827:0.0:0.9173:0.0	.	180	P62258	1433E_HUMAN	L	180;158	ENSP00000264335:F180L	ENSP00000264335:F180L	F	-	3	2	YWHAE	1211174	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.713000	0.74686	1.288000	0.44600	0.650000	0.86243	TTC	.	G|1.000;A|0.000		0.473	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259354.3	NM_006761	
TP53	7157	hgsc.bcm.edu	37	17	7578525	7578525	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr17:7578525G>T	ENST00000269305.4	-	5	594	c.405C>A	c.(403-405)tgC>tgA	p.C135*	TP53_ENST00000455263.2_Nonsense_Mutation_p.C135*|TP53_ENST00000359597.4_Nonsense_Mutation_p.C135*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Nonsense_Mutation_p.C135*|TP53_ENST00000445888.2_Nonsense_Mutation_p.C135*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C135*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135W(24)|p.0?(8)|p.C135*(7)|p.C135C(5)|p.C135fs*9(3)|p.N131fs*27(2)|p.Q136fs*13(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*15(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C3W(1)|p.C42W(1)|p.C135_T140delCQLAKT(1)|p.Q136*(1)|p.C135_Q136insXXXXXX(1)|p.C135_Q136insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGCCAGTTGGCAAAACATCT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C135X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,0,1	TP53	33396	.	68	Substitution - Missense(27)|Deletion - Frameshift(9)|Substitution - Nonsense(8)|Whole gene deletion(8)|Substitution - coding silent(5)|Deletion - In frame(4)|Insertion - Frameshift(4)|Insertion - In frame(2)|Complex - deletion inframe(1)	urinary_tract(11)|lung(8)|breast(7)|central_nervous_system(6)|oesophagus(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|stomach(2)|skin(2)|prostate(2)|thyroid(1)|liver(1)|pancreas(1)	c.C405A						.						51.0	51.0	51.0					17																	7578525		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAGTTGGCAAAAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.405C>A	chr17.hg19:g.7578525G>T	ENSP00000269305:p.Cys135*	38.0	0.0		22.0	16.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678815	0.88542	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	3.5	0.40072	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.815	10.0222	0.42051	0.1647:0.0:0.8353:0.0	.	.	.	.	X	135;135;135;135;135;135;124;42;3;42;3;135	.	ENSP00000269305:C135X	C	-	3	2	TP53	7519250	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	0.645000	0.24782	0.798000	0.33994	0.655000	0.94253	TGC	.	.		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
GGNBP2	79893	hgsc.bcm.edu	37	17	34935776	34935776	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr17:34935776A>T	ENST00000304718.4	+	8	1263	c.947A>T	c.(946-948)aAg>aTg	p.K316M		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	316					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ATCTGGCAGAAGCTACGGGCA	0.438																																					p.K316M		Atlas-SNP	.											.	GGNBP2	72	.	0			c.A947T						.						187.0	187.0	187.0					17																	34935776		2203	4300	6503	SO:0001583	missense	79893	exon8			GGCAGAAGCTACG	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.947A>T	chr17.hg19:g.34935776A>T	ENSP00000307617:p.Lys316Met	114.0	0.0		197.0	39.0	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	hg19	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.558246	0.86231	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.76190	0.3953	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.987;0.98	T	0.78780	-0.2070	9	0.87932	D	0	-18.7483	15.7048	0.77569	1.0:0.0:0.0:0.0	.	316;316;316	A8K3S2;Q9H3C7;Q9H3C7-3	.;GGNB2_HUMAN;.	M	316	.	ENSP00000307617:K316M	K	+	2	0	GGNBP2	32009889	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	8.591000	0.90824	2.113000	0.64589	0.377000	0.23210	AAG	.	.		0.438	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
KRTAP4-2	85291	hgsc.bcm.edu	37	17	39334360	39334360	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr17:39334360G>C	ENST00000377726.2	-	1	100	c.57C>G	c.(55-57)aaC>aaG	p.N19K		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	19	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)				kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GACGGCAGCAGTTCTCTAGGC	0.627																																					p.N19K		Atlas-SNP	.											.	KRTAP4-2	93	.	0			c.C57G						.						65.0	64.0	64.0					17																	39334360		2202	4300	6502	SO:0001583	missense	85291	exon1			GCAGCAGTTCTCT	AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.57C>G	chr17.hg19:g.39334360G>C	ENSP00000366955:p.Asn19Lys	112.0	0.0		144.0	38.0	NM_033062	A0JP64	Missense_Mutation	SNP	ENST00000377726.2	hg19	CCDS11384.1	.	.	.	.	.	.	.	.	.	.	.	11.68	1.709384	0.30322	.	.	ENSG00000244537	ENST00000377726;ENST00000458321	T	0.01295	5.04	4.4	3.42	0.39159	.	5.946940	0.02210	U	0.063068	T	0.01387	0.0045	N	0.08118	0	0.22292	N	0.999225	B	0.11235	0.004	B	0.14578	0.011	T	0.41610	-0.9499	10	0.48119	T	0.1	.	8.6587	0.34079	0.1107:0.0:0.8893:0.0	.	19	Q9BYR5	KRA42_HUMAN	K	19;136	ENSP00000366955:N19K	ENSP00000366955:N19K	N	-	3	2	KRTAP4-2	36587886	0.986000	0.35501	0.951000	0.38953	0.645000	0.38454	1.810000	0.38932	0.952000	0.37798	0.508000	0.49915	AAC	.	.		0.627	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257305.1		
BECN1	8678	hgsc.bcm.edu	37	17	40962923	40962923	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr17:40962923A>G	ENST00000361523.4	-	12	1340	c.1208T>C	c.(1207-1209)aTt>aCt	p.I403T	BECN1_ENST00000590099.1_Missense_Mutation_p.I403T|BECN1_ENST00000438274.3_Silent_p.D279D|CNTD1_ENST00000315066.5_3'UTR	NM_003766.3	NP_003757.1	Q14457	BECN1_HUMAN	beclin 1, autophagy related	403			I -> T.		autophagic vacuole assembly (GO:0000045)|beta-amyloid metabolic process (GO:0050435)|cellular defense response (GO:0006968)|cellular response to aluminum ion (GO:0071275)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokinesis (GO:0000910)|defense response to virus (GO:0051607)|lysosome organization (GO:0007040)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|positive regulation of macroautophagy (GO:0016239)|regulation of catalytic activity (GO:0050790)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to vitamin E (GO:0033197)|viral process (GO:0016032)	dendrite (GO:0030425)|membrane (GO:0016020)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		TGTGTCTTCAATCTTGCCTTT	0.468																																					p.I403T		Atlas-SNP	.											.	BECN1	23	.	0			c.T1208C						.						75.0	68.0	70.0					17																	40962923		2203	4300	6503	SO:0001583	missense	8678	exon12			TCTTCAATCTTGC	AF077301	CCDS11441.1	17q21	2014-02-12	2008-01-14		ENSG00000126581	ENSG00000126581			1034	protein-coding gene	gene with protein product	"""ATG6 autophagy related 6 homolog (S. cerevisiae)"""	604378	"""beclin 1 (coiled-coil, moesin-like BCL2 interacting protein)"""			9765397	Standard	NM_003766		Approved	ATG6, VPS30	uc002ibn.2	Q14457		ENST00000361523.4:c.1208T>C	chr17.hg19:g.40962923A>G	ENSP00000355231:p.Ile403Thr	43.0	0.0		47.0	32.0	NM_003766	B2R6N7|O75595|Q9UNA8	Missense_Mutation	SNP	ENST00000361523.4	hg19	CCDS11441.1	.	.	.	.	.	.	.	.	.	.	A	18.36	3.607506	0.66558	.	.	ENSG00000126581	ENST00000361523;ENST00000543382	T	0.60920	0.15	5.88	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.78904	0.4357	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.82106	-0.0621	10	0.72032	D	0.01	.	11.9132	0.52751	0.9322:0.0:0.0678:0.0	.	403	Q14457	BECN1_HUMAN	T	403;316	ENSP00000355231:I403T	ENSP00000355231:I403T	I	-	2	0	BECN1	38216449	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.300000	0.96151	1.052000	0.40392	0.533000	0.62120	ATT	.	.		0.468	BECN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452405.1	NM_003766	
C17orf112	100506650	hgsc.bcm.edu	37	17	51063875	51063875	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr17:51063875G>T	ENST00000441889.1	+	2	278	c.119G>T	c.(118-120)gGa>gTa	p.G40V		NM_001243552.1	NP_001230481.1	F2Z3M2	CQ112_HUMAN	chromosome 17 open reading frame 112	40																	AATCAGCTGGGAAACATGCAG	0.418																																					p.G40V		Atlas-SNP	.											.	.	.	.	0			c.G119T						.																																			SO:0001583	missense	100506650	exon2			AGCTGGGAAACAT		CCDS56040.1	17q22	2012-10-23			ENSG00000227011	ENSG00000227011			42963	protein-coding gene	gene with protein product							Standard	NM_001243552		Approved		uc021uaf.1	F2Z3M2	OTTHUMG00000132355	ENST00000441889.1:c.119G>T	chr17.hg19:g.51063875G>T	ENSP00000411112:p.Gly40Val	189.0	0.0		250.0	60.0	NM_001243552		Missense_Mutation	SNP	ENST00000441889.1	hg19	CCDS56040.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301571	0.23736	.	.	ENSG00000227011	ENST00000441889	.	.	.	4.34	-1.8	0.07907	.	.	.	.	.	T	0.19685	0.0473	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.30592	-0.9973	6	0.87932	D	0	.	7.8834	0.29635	0.5969:0.0:0.4031:0.0	.	.	.	.	V	40	.	ENSP00000411112:G40V	G	+	2	0	AC102948.1	48418874	0.001000	0.12720	0.000000	0.03702	0.179000	0.23085	0.100000	0.15231	-0.398000	0.07679	-0.262000	0.10625	GGA	.	.		0.418	C17orf112-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000255477.1	NM_001243552	
PTPRM	5797	hgsc.bcm.edu	37	18	7906552	7906552	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr18:7906552A>C	ENST00000332175.8	+	4	1555	c.518A>C	c.(517-519)gAt>gCt	p.D173A	PTPRM_ENST00000580170.1_Missense_Mutation_p.D173A|PTPRM_ENST00000400060.4_Missense_Mutation_p.D173A|PTPRM_ENST00000400053.4_Missense_Mutation_p.D111A	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	173	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CTCGCTATCGATGAGGTGAAG	0.333																																					p.D173A		Atlas-SNP	.											.	PTPRM	185	.	0			c.A518C						.						178.0	176.0	177.0					18																	7906552		2203	4300	6503	SO:0001583	missense	5797	exon4			CTATCGATGAGGT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.518A>C	chr18.hg19:g.7906552A>C	ENSP00000331418:p.Asp173Ala	202.0	0.0		170.0	57.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.195315	0.58017	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053	T;T;T	0.09911	2.93;2.93;2.93	5.66	5.66	0.87406	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.104180	0.64402	D	0.000003	T	0.41743	0.1172	M	0.91612	3.225	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.993	T	0.52373	-0.8584	10	0.87932	D	0	.	14.4722	0.67523	1.0:0.0:0.0:0.0	.	173;173	A7MBN1;P28827	.;PTPRM_HUMAN	A	173;173;111	ENSP00000331418:D173A;ENSP00000382933:D173A;ENSP00000382927:D111A	ENSP00000331418:D173A	D	+	2	0	PTPRM	7896552	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.802000	0.62539	2.167000	0.68274	0.528000	0.53228	GAT	.	.		0.333	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
DSEL	92126	hgsc.bcm.edu	37	18	65178248	65178248	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr18:65178248T>A	ENST00000310045.7	-	2	5101	c.3628A>T	c.(3628-3630)Act>Tct	p.T1210S	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1200					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TCCATCAGAGTCCAGCAGATG	0.373																																					p.T1210S		Atlas-SNP	.											.	DSEL	196	.	0			c.A3628T						.						101.0	97.0	98.0					18																	65178248		2203	4300	6503	SO:0001583	missense	92126	exon2			TCAGAGTCCAGCA	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3628A>T	chr18.hg19:g.65178248T>A	ENSP00000310565:p.Thr1210Ser	140.0	0.0		104.0	36.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	hg19	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	T	4.517	0.095997	0.08681	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	D	0.81659	-1.52	5.63	3.21	0.36854	Sulfotransferase domain (1);	0.840505	0.10288	U	0.692741	T	0.60702	0.2289	N	0.16903	0.455	0.24345	N	0.994946	B	0.10296	0.003	B	0.10450	0.005	T	0.48468	-0.9033	10	0.08599	T	0.76	-6.1882	3.6372	0.08153	0.1293:0.0735:0.1563:0.6409	.	1200	Q8IZU8	DSEL_HUMAN	S	1210;1200	ENSP00000310565:T1210S	ENSP00000310565:T1210S	T	-	1	0	DSEL	63329228	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.629000	0.24538	1.002000	0.39104	0.533000	0.62120	ACT	.	.		0.373	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
BRD4	23476	hgsc.bcm.edu	37	19	15367957	15367957	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr19:15367957T>A	ENST00000263377.2	-	8	1590	c.1369A>T	c.(1369-1371)Atg>Ttg	p.M457L	BRD4_ENST00000602230.1_5'UTR|BRD4_ENST00000360016.5_Missense_Mutation_p.M457L|BRD4_ENST00000371835.4_Missense_Mutation_p.M457L	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	457					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			TCGTCCGGCATCTTGGCAAAG	0.647			T	C15orf55	lethal midline carcinoma of young people																																p.M457L		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.A1369T						.						29.0	27.0	28.0					19																	15367957		2203	4300	6503	SO:0001583	missense	23476	exon8			CCGGCATCTTGGC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1369A>T	chr19.hg19:g.15367957T>A	ENSP00000263377:p.Met457Leu	30.0	0.0		25.0	8.0	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	hg19	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.165936	0.78339	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.15952	2.94;2.38;2.38	5.36	5.36	0.76844	Bromodomain (3);	0.070874	0.64402	D	0.000013	T	0.36744	0.0978	M	0.88906	2.99	0.51233	D	0.999918	B;B;B	0.26081	0.007;0.093;0.141	B;B;B	0.39706	0.005;0.307;0.047	T	0.26155	-1.0111	10	0.44086	T	0.13	-17.2319	14.3739	0.66860	0.0:0.0:0.0:1.0	.	457;457;457	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	L	457	ENSP00000263377:M457L;ENSP00000360901:M457L;ENSP00000353112:M457L	ENSP00000263377:M457L	M	-	1	0	BRD4	15228957	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.040000	0.89188	2.042000	0.60477	0.533000	0.62120	ATG	.	.		0.647	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
LGALS4	3960	hgsc.bcm.edu	37	19	39297124	39297124	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr19:39297124C>T	ENST00000307751.4	-	4	928	c.451G>A	c.(451-453)Gga>Aga	p.G151R	LGALS4_ENST00000597803.1_5'UTR	NM_006149.3	NP_006140.1	P56470	LEG4_HUMAN	lectin, galactoside-binding, soluble, 4	151					cell adhesion (GO:0007155)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.G151R(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GGCTGGCCTCCGATGAAGTTG	0.498																																					p.G151R		Atlas-SNP	.											LGALS4,colon,carcinoma,0,2	LGALS4	39	.	1	Substitution - Missense(1)	endometrium(1)	c.G451A						.						74.0	81.0	79.0					19																	39297124		2203	4300	6503	SO:0001583	missense	3960	exon4			GGCCTCCGATGAA		CCDS12521.1	19q13.2	2014-03-19	2008-07-25		ENSG00000171747	ENSG00000171747		"""Lectins, galactoside-binding"""	6565	protein-coding gene	gene with protein product	"""galectin 4"""	602518				8063692	Standard	NM_006149		Approved	GAL4	uc002ojg.3	P56470	OTTHUMG00000182608	ENST00000307751.4:c.451G>A	chr19.hg19:g.39297124C>T	ENSP00000302100:p.Gly151Arg	88.0	0.0		76.0	8.0	NM_006149		Missense_Mutation	SNP	ENST00000307751.4	hg19	CCDS12521.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020850	0.93462	.	.	ENSG00000171747	ENST00000307751	T	0.12569	2.67	5.17	5.17	0.71159	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.056938	0.64402	D	0.000002	T	0.20007	0.0481	N	0.08118	0	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.979	T	0.27905	-1.0060	10	0.59425	D	0.04	-8.8748	16.1626	0.81731	0.0:1.0:0.0:0.0	.	151;151	B4DKK5;P56470	.;LEG4_HUMAN	R	151	ENSP00000302100:G151R	ENSP00000302100:G151R	G	-	1	0	LGALS4	43988964	0.995000	0.38212	0.647000	0.29507	0.541000	0.35023	4.638000	0.61353	2.420000	0.82092	0.462000	0.41574	GGA	.	.		0.498	LGALS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462641.1	NM_006149	
CEACAM5	1048	hgsc.bcm.edu	37	19	42224926	42224926	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr19:42224926C>T	ENST00000221992.6	+	8	1970	c.1856C>T	c.(1855-1857)tCt>tTt	p.S619F	CEACAM5_ENST00000398599.4_Missense_Mutation_p.S618F|CEACAM5_ENST00000405816.1_Missense_Mutation_p.S619F|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	619	Ig-like 7.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CACTCGGCCTCTAACCCATCC	0.532																																					p.S619F		Atlas-SNP	.											.	CEACAM5	84	.	0			c.C1856T						.						166.0	149.0	155.0					19																	42224926		2203	4300	6503	SO:0001583	missense	1048	exon8			CGGCCTCTAACCC	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1856C>T	chr19.hg19:g.42224926C>T	ENSP00000221992:p.Ser619Phe	189.0	0.0		161.0	71.0	NM_004363	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	hg19	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313133	0.40895	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.17370	2.28;2.28	2.17	2.17	0.27698	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49881	0.1583	H	0.95816	3.725	0.09310	N	1	D;D	0.63880	0.988;0.993	P;D	0.91635	0.903;0.999	T	0.32214	-0.9915	9	0.87932	D	0	.	7.8851	0.29646	0.0:1.0:0.0:0.0	.	619;619	P06731;Q53G30	CEAM5_HUMAN;.	F	619;619;337	ENSP00000221992:S619F;ENSP00000385072:S619F	ENSP00000221992:S619F	S	+	2	0	CEACAM5	46916766	0.964000	0.33143	0.126000	0.21872	0.016000	0.09150	2.935000	0.48963	1.507000	0.48752	0.467000	0.42956	TCT	.	.		0.532	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
ZNF226	7769	hgsc.bcm.edu	37	19	44681511	44681511	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr19:44681511A>G	ENST00000590089.1	+	7	2463	c.2096A>G	c.(2095-2097)tAt>tGt	p.Y699C	ZNF226_ENST00000454662.2_Missense_Mutation_p.Y699C|ZNF226_ENST00000337433.5_Missense_Mutation_p.Y699C|ZNF226_ENST00000588883.1_3'UTR			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	699					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				GAAAAACCATATAAATGTGGG	0.453																																					p.Y699C	Pancreas(115;581 1665 13228 19278 50070)	Atlas-SNP	.											.	.	.	.	0			c.A2096G						.						121.0	130.0	127.0					19																	44681511		2190	4295	6485	SO:0001583	missense	7769	exon6			AACCATATAAATG	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.2096A>G	chr19.hg19:g.44681511A>G	ENSP00000465121:p.Tyr699Cys	114.0	0.0		89.0	44.0	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	hg19	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071212	0.36566	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.25414	1.8;1.8	3.89	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44435	0.1293	M	0.67569	2.06	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.11966	-1.0566	9	0.72032	D	0.01	.	6.6146	0.22771	0.6083:0.0:0.0:0.3917	.	699	Q9NYT6	ZN226_HUMAN	C	699	ENSP00000336719:Y699C;ENSP00000393265:Y699C	ENSP00000336719:Y699C	Y	+	2	0	ZNF226	49373351	0.000000	0.05858	0.970000	0.41538	0.956000	0.61745	-0.025000	0.12413	1.775000	0.52247	0.533000	0.62120	TAT	.	.		0.453	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
PLCB1	23236	hgsc.bcm.edu	37	20	8698371	8698371	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr20:8698371G>T	ENST00000338037.6	+	14	1416	c.1389G>T	c.(1387-1389)ttG>ttT	p.L463F	PLCB1_ENST00000378641.3_Missense_Mutation_p.L463F|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.L463F	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	463	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						ATAAAATTTTGGTGAAAAATA	0.388																																					p.K463N		Atlas-SNP	.											.	PLCB1	394	.	0			c.A1389T						.						78.0	84.0	82.0					20																	8698371		2203	4300	6503	SO:0001583	missense	23236	exon14			AATTTTGGTGAAA	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1389G>T	chr20.hg19:g.8698371G>T	ENSP00000338185:p.Leu463Phe	71.0	0.0		47.0	17.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	hg19	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165200	0.78339	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.67523	-0.27;-0.27;-0.27	5.85	5.85	0.93711	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.061993	0.64402	D	0.000003	D	0.86293	0.5898	M	0.93939	3.475	0.53005	D	0.999968	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89170	0.3536	10	0.87932	D	0	.	15.6322	0.76920	0.0:0.1367:0.8633:0.0	.	463;463	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	F	463;463;463;383;383	ENSP00000367908:L463F;ENSP00000338185:L463F;ENSP00000367904:L463F	ENSP00000338185:L463F	L	+	3	2	PLCB1	8646371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.707000	0.47143	2.768000	0.95171	0.655000	0.94253	TTG	.	.		0.388	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
RBM39	9584	hgsc.bcm.edu	37	20	34312495	34312495	+	Silent	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr20:34312495T>C	ENST00000253363.6	-	8	707	c.684A>G	c.(682-684)tcA>tcG	p.S228S	RBM39_ENST00000361162.6_Silent_p.S228S|RBM39_ENST00000528062.3_Silent_p.S206S|RBM39_ENST00000407261.4_Silent_p.S71S			Q14498	RBM39_HUMAN	RNA binding motif protein 39	228	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					AAATTACCTGTGATGCCTGTA	0.428																																					p.S228S		Atlas-SNP	.											.	RBM39	68	.	0			c.A684G						.						102.0	94.0	97.0					20																	34312495		2203	4300	6503	SO:0001819	synonymous_variant	9584	exon8			TACCTGTGATGCC	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.684A>G	chr20.hg19:g.34312495T>C		94.0	0.0		119.0	71.0	NM_184234	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Silent	SNP	ENST00000253363.6	hg19	CCDS13266.1	.	.	.	.	.	.	.	.	.	.	T	10.18	1.279322	0.23307	.	.	ENSG00000131051	ENST00000448303	.	.	.	5.36	1.41	0.22369	.	.	.	.	.	T	0.56140	0.1965	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48958	-0.8988	4	.	.	.	.	8.6434	0.33991	0.1205:0.0:0.3746:0.5049	.	.	.	.	A	101	.	.	T	-	1	0	RBM39	33775909	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	0.424000	0.21330	0.377000	0.24735	0.456000	0.33151	ACA	.	.		0.428	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
GTSF1L	149699	hgsc.bcm.edu	37	20	42355239	42355239	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr20:42355239C>G	ENST00000373003.1	-	1	399	c.96G>C	c.(94-96)aaG>aaC	p.K32N	GTSF1L_ENST00000373005.2_Missense_Mutation_p.K32N	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	32							metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCTTGGGGTTCTTTCTCCTGC	0.498																																					p.K32N		Atlas-SNP	.											.	GTSF1L	14	.	0			c.G96C						.						136.0	127.0	130.0					20																	42355239		2203	4300	6503	SO:0001583	missense	149699	exon1			GGGGTTCTTTCTC	AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.96G>C	chr20.hg19:g.42355239C>G	ENSP00000362094:p.Lys32Asn	105.0	0.0		145.0	37.0	NM_001008901	Q5JWH5	Missense_Mutation	SNP	ENST00000373003.1	hg19	CCDS13323.1	.	.	.	.	.	.	.	.	.	.	C	7.988	0.752565	0.15778	.	.	ENSG00000124196	ENST00000373003;ENST00000373005	T;T	0.42900	0.96;0.96	3.68	1.75	0.24633	.	0.095669	0.42420	D	0.000717	T	0.35248	0.0925	N	0.16307	0.4	0.32859	D	0.507739	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.45160	-0.9280	10	0.02654	T	1	-11.6811	5.8651	0.18771	0.0:0.769:0.0:0.231	.	32;32	Q9H1H1;Q5JWH5	GTSFL_HUMAN;.	N	32	ENSP00000362094:K32N;ENSP00000362096:K32N	ENSP00000362094:K32N	K	-	3	2	GTSF1L	41788653	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	1.429000	0.34903	0.542000	0.28846	0.430000	0.28490	AAG	.	.		0.498	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079313.1	NM_176791	
NFATC2	4773	hgsc.bcm.edu	37	20	50048694	50048694	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr20:50048694C>T	ENST00000396009.3	-	9	2851	c.2632G>A	c.(2632-2634)Gga>Aga	p.G878R	NFATC2_ENST00000609507.1_Missense_Mutation_p.G659R|NFATC2_ENST00000609943.1_Missense_Mutation_p.G858R|NFATC2_ENST00000414705.1_Missense_Mutation_p.G858R|NFATC2_ENST00000371564.3_Missense_Mutation_p.G878R|NFATC2_ENST00000610033.1_Missense_Mutation_p.G659R	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	878					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					ACCGGGGGTCCGTTTTTGGCG	0.572																																					p.G878R		Atlas-SNP	.											.	NFATC2	112	.	0			c.G2632A						.						109.0	107.0	107.0					20																	50048694		2203	4300	6503	SO:0001583	missense	4773	exon9			GGGGTCCGTTTTT	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2632G>A	chr20.hg19:g.50048694C>T	ENSP00000379330:p.Gly878Arg	169.0	0.0		155.0	11.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	hg19	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482823	0.63962	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.14144	2.53;2.54;2.54	5.42	5.42	0.78866	.	0.645829	0.15921	N	0.238110	T	0.32315	0.0825	L	0.44542	1.39	0.35949	D	0.833755	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	P;D;P;P	0.91635	0.852;0.999;0.899;0.863	T	0.09422	-1.0675	10	0.31617	T	0.26	-7.2803	19.2321	0.93843	0.0:1.0:0.0:0.0	.	858;858;878;878	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	R	878;878;858	ENSP00000360619:G878R;ENSP00000379330:G878R;ENSP00000396471:G858R	ENSP00000360619:G878R	G	-	1	0	NFATC2	49482101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.283000	0.58977	2.533000	0.85409	0.591000	0.81541	GGA	.	.		0.572	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
STX16	8675	hgsc.bcm.edu	37	20	57251326	57251326	+	Silent	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr20:57251326C>T	ENST00000371141.4	+	9	1681	c.957C>T	c.(955-957)ctC>ctT	p.L319L	STX16_ENST00000361770.5_Silent_p.L302L|STX16-NPEPL1_ENST00000530122.1_Intron|STX16_ENST00000358029.4_Silent_p.L315L|STX16_ENST00000361830.3_Silent_p.L319L|STX16_ENST00000359617.4_Silent_p.L266L|STX16_ENST00000355957.5_Silent_p.L302L|STX16_ENST00000371132.4_Silent_p.L298L	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	319					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TTGTTGTCCTCGTTGGCGTGA	0.507																																					p.L319L		Atlas-SNP	.											.	STX16	36	.	0			c.C957T						.						253.0	225.0	235.0					20																	57251326		2203	4300	6503	SO:0001819	synonymous_variant	8675	exon9			TGTCCTCGTTGGC	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.957C>T	chr20.hg19:g.57251326C>T		195.0	0.0		202.0	54.0	NM_001001433	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Silent	SNP	ENST00000371141.4	hg19	CCDS13468.1																																																																																			.	.		0.507	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433	
HRH3	11255	hgsc.bcm.edu	37	20	60791849	60791849	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr20:60791849G>C	ENST00000340177.5	-	3	835	c.551C>G	c.(550-552)cCc>cGc	p.P184R	HRH3_ENST00000317393.6_Missense_Mutation_p.P184R	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	184					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	GTGGCCCTCGGGGATGGAGCT	0.602																																					p.P184R		Atlas-SNP	.											.	HRH3	25	.	0			c.C551G						.						67.0	58.0	61.0					20																	60791849		2203	4300	6503	SO:0001583	missense	11255	exon3			CCCTCGGGGATGG	AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.551C>G	chr20.hg19:g.60791849G>C	ENSP00000342560:p.Pro184Arg	68.0	0.0		65.0	16.0	NM_007232	Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	ENST00000340177.5	hg19	CCDS13493.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068747	0.76301	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.38722	1.12;1.12	4.53	3.57	0.40892	GPCR, rhodopsin-like superfamily (1);	0.053378	0.85682	D	0.000000	T	0.58004	0.2092	M	0.75085	2.285	0.51233	D	0.99991	D;B;B;B	0.55800	0.973;0.216;0.444;0.444	P;B;B;B	0.59546	0.859;0.345;0.345;0.327	T	0.58808	-0.7571	10	0.38643	T	0.18	-39.9244	12.7758	0.57445	0.0815:0.0:0.9185:0.0	.	184;184;184;184	Q9Y5N1-2;E7EWA7;Q8WXZ9;Q9Y5N1	.;.;.;HRH3_HUMAN	R	184	ENSP00000342560:P184R;ENSP00000321482:P184R	ENSP00000321482:P184R	P	-	2	0	HRH3	60225244	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.492000	0.81482	1.008000	0.39264	0.407000	0.27541	CCC	.	.		0.602	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079994.1	NM_007232	
BRWD1	54014	hgsc.bcm.edu	37	21	40627715	40627715	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr21:40627715T>C	ENST00000333229.2	-	19	2438	c.2111A>G	c.(2110-2112)aAt>aGt	p.N704S	BRWD1_ENST00000380800.3_Missense_Mutation_p.N704S|BRWD1_ENST00000342449.3_Missense_Mutation_p.N704S	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	704					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CAGACCAATATTTGGAGGGGA	0.433																																					p.N704S	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											.	BRWD1	325	.	0			c.A2111G						.						101.0	82.0	88.0					21																	40627715		2203	4300	6503	SO:0001583	missense	54014	exon19			CCAATATTTGGAG	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.2111A>G	chr21.hg19:g.40627715T>C	ENSP00000330753:p.Asn704Ser	85.0	0.0		30.0	7.0	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	hg19	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700352	0.48307	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.61392	0.11;0.17;0.25	5.7	5.7	0.88788	.	0.065155	0.64402	D	0.000007	T	0.60676	0.2287	L	0.52364	1.645	0.80722	D	1	D;B;P;P	0.57257	0.979;0.046;0.941;0.647	P;B;P;B	0.52881	0.679;0.041;0.712;0.146	T	0.61647	-0.7020	10	0.44086	T	0.13	-15.0161	10.3357	0.43847	0.0:0.0732:0.0:0.9268	.	415;415;704;704	Q5R2U6;Q5R2U8;Q9NSI6-2;Q9NSI6	.;.;.;BRWD1_HUMAN	S	704	ENSP00000330753:N704S;ENSP00000344333:N704S;ENSP00000370178:N704S	ENSP00000330753:N704S	N	-	2	0	BRWD1	39549585	1.000000	0.71417	0.999000	0.59377	0.934000	0.57294	3.822000	0.55708	2.175000	0.68902	0.477000	0.44152	AAT	.	.		0.433	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46021639	46021639	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr21:46021639C>T	ENST00000380102.2	+	1	1143	c.1118C>T	c.(1117-1119)tCc>tTc	p.S373F	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	373						keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						ACCCAGAAGTCCAGCTGCTGA	0.622																																					p.S368F		Atlas-SNP	.											.	KRTAP10-7	41	.	0			c.C1103T						.						29.0	34.0	32.0					21																	46021639		2140	4236	6376	SO:0001583	missense	386675	exon2			AGAAGTCCAGCTG	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.1118C>T	chr21.hg19:g.46021639C>T	ENSP00000369445:p.Ser373Phe	70.0	0.0		30.0	12.0	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	hg19		.	.	.	.	.	.	.	.	.	.	c	6.006	0.369505	0.11352	.	.	ENSG00000205441	ENST00000380102	T	0.00840	5.63	3.89	-0.216	0.13153	.	.	.	.	.	T	0.01287	0.0042	M	0.61703	1.905	0.09310	N	1	B	0.14805	0.011	B	0.12837	0.008	T	0.42783	-0.9431	9	0.72032	D	0.01	.	4.2656	0.10761	0.0:0.4324:0.1658:0.4018	.	368	P60409-2	.	F	373	ENSP00000369445:S373F	ENSP00000369445:S373F	S	+	2	0	KRTAP10-7	44846067	0.207000	0.23482	0.001000	0.08648	0.298000	0.27526	0.495000	0.22483	-0.315000	0.08703	-0.373000	0.07131	TCC	.	.		0.622	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
CABIN1	23523	hgsc.bcm.edu	37	22	24564464	24564464	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr22:24564464A>G	ENST00000398319.2	+	33	6117	c.5732A>G	c.(5731-5733)cAt>cGt	p.H1911R	CABIN1_ENST00000263119.5_Missense_Mutation_p.H1911R|CABIN1_ENST00000337989.7_Missense_Mutation_p.H336R|CABIN1_ENST00000485008.1_3'UTR|CABIN1_ENST00000405822.2_Missense_Mutation_p.H1832R	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1911					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGCCAGGTCCATCTTGGGGCT	0.597																																					p.H1911R		Atlas-SNP	.											.	CABIN1	153	.	0			c.A5732G						.						56.0	42.0	47.0					22																	24564464		2185	4283	6468	SO:0001583	missense	23523	exon33			AGGTCCATCTTGG	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.5732A>G	chr22.hg19:g.24564464A>G	ENSP00000381364:p.His1911Arg	96.0	0.0		23.0	19.0	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	hg19	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257453	0.80246	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	T;T;T;D	0.86030	0.12;-0.11;0.12;-2.06	5.28	5.28	0.74379	.	0.069207	0.64402	D	0.000005	T	0.75102	0.3804	N	0.24115	0.695	0.49798	D	0.999821	B;P;P	0.38078	0.335;0.617;0.483	B;B;B	0.33960	0.115;0.173;0.084	T	0.75590	-0.3265	10	0.33141	T	0.24	.	14.7596	0.69596	1.0:0.0:0.0:0.0	.	336;1832;1911	B5MEB3;G5E9F3;Q9Y6J0	.;.;CABIN_HUMAN	R	1911;1832;1911;336;336	ENSP00000263119:H1911R;ENSP00000384694:H1832R;ENSP00000381364:H1911R;ENSP00000336991:H336R	ENSP00000263119:H1911R	H	+	2	0	CABIN1	22894464	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.304000	0.89958	2.149000	0.67028	0.529000	0.55759	CAT	.	.		0.597	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
AP1B1	162	hgsc.bcm.edu	37	22	29724846	29724846	+	Silent	SNP	G	G	A	rs147684584		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr22:29724846G>A	ENST00000405198.1	-	22	2845	c.2814C>T	c.(2812-2814)caC>caT	p.H938H	AP1B1_ENST00000432560.2_Silent_p.H928H|AP1B1_ENST00000356015.2_Silent_p.H931H|AP1B1_ENST00000317368.7_Silent_p.H908H|AP1B1_ENST00000472057.1_5'Flank|AP1B1_ENST00000415447.1_Silent_p.H928H|AP1B1_ENST00000402502.1_Silent_p.H928H|AP1B1_ENST00000357586.2_Silent_p.H938H			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	938					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCTGGTACACGTGCTGGGACA	0.667													g|||	1	0.000199681	0.0	0.0	5008	,	,		14408	0.001		0.0	False		,,,				2504	0.0				p.H938H		Atlas-SNP	.											.	AP1B1	72	.	0			c.C2814T						.		,,	1,4405	2.1+/-5.4	0,1,2202	70.0	56.0	60.0		2814,2724,2784	-5.6	0.9	22	dbSNP_134	60	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	AP1B1	NM_001127.3,NM_001166019.1,NM_145730.2	,,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,,	938/950,908/920,928/940	29724846	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	162	exon23			GTACACGTGCTGG	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2814C>T	chr22.hg19:g.29724846G>A		52.0	0.0		35.0	16.0	NM_001127	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	ENST00000405198.1	hg19	CCDS13855.1																																																																																			.	G|1.000;A|0.000		0.667	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	
CELSR1	9620	hgsc.bcm.edu	37	22	46807621	46807621	+	Silent	SNP	C	C	T	rs577948297		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr22:46807621C>T	ENST00000262738.3	-	6	4646	c.4647G>A	c.(4645-4647)ccG>ccA	p.P1549P		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1549	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TTTCCCCGGACGGCCCATGGG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		19987	0.0		0.0	False		,,,				2504	0.001				p.P1549P		Atlas-SNP	.											.	CELSR1	242	.	0			c.G4647A						.						97.0	92.0	93.0					22																	46807621		2203	4300	6503	SO:0001819	synonymous_variant	9620	exon6			CCCGGACGGCCCA	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4647G>A	chr22.hg19:g.46807621C>T		57.0	0.0		39.0	13.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	hg19	CCDS14076.1																																																																																			.	.		0.587	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
NUDT10	170685	hgsc.bcm.edu	37	X	51075989	51075989	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chrX:51075989C>A	ENST00000376006.3	+	2	392	c.172C>A	c.(172-174)Ccg>Acg	p.P58T	NUDT10_ENST00000356450.2_Missense_Mutation_p.P58T	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	223					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					CGAGGAGGAGCCGGGCGGTGC	0.682																																					p.P58T	NSCLC(90;1817 2035 37909 38249)	Atlas-SNP	.											.	NUDT10	28	.	0			c.C172A						.						22.0	31.0	28.0					X																	51075989		2195	4276	6471	SO:0001583	missense	170685	exon2			GAGGAGCCGGGCG	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.172C>A	chrX.hg19:g.51075989C>A	ENSP00000365174:p.Pro58Thr	51.0	0.0		48.0	37.0	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000376006.3	hg19	CCDS35278.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.764907	0.69878	.	.	ENSG00000122824	ENST00000376006;ENST00000356450	T;T	0.51071	0.72;0.72	3.14	2.26	0.28386	NUDIX hydrolase domain (3);NUDIX hydrolase, conserved site (1);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.61098	0.2320	M	0.70842	2.15	0.40523	D	0.980859	D	0.89917	1.0	D	0.87578	0.998	T	0.68704	-0.5338	9	0.48119	T	0.1	-13.7387	7.3002	0.26415	0.0:0.8533:0.0:0.1467	.	58	Q8NFP7	NUD10_HUMAN	T	58	ENSP00000365174:P58T;ENSP00000348831:P58T	ENSP00000348831:P58T	P	+	1	0	NUDT10	51092729	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.246000	0.65411	1.602000	0.50124	0.429000	0.28392	CCG	.	.		0.682	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
NXF3	56000	hgsc.bcm.edu	37	X	102332620	102332620	+	Silent	SNP	G	G	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chrX:102332620G>C	ENST00000395065.3	-	18	1607	c.1506C>G	c.(1504-1506)acC>acG	p.T502T	NXF3_ENST00000425644.1_Silent_p.T174T	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	502					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						AGGCACTCTGGGTCCCTTGGT	0.562																																					p.T502T		Atlas-SNP	.											.	NXF3	81	.	0			c.C1506G						.						215.0	140.0	166.0					X																	102332620		2203	4300	6503	SO:0001819	synonymous_variant	56000	exon18			ACTCTGGGTCCCT	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.1506C>G	chrX.hg19:g.102332620G>C		62.0	0.0		38.0	30.0	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Silent	SNP	ENST00000395065.3	hg19	CCDS14503.1																																																																																			.	.		0.562	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
IRAK1	3654	hgsc.bcm.edu	37	X	153278076	153278076	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chrX:153278076T>C	ENST00000369980.3	-	13	2151	c.1984A>G	c.(1984-1986)Atc>Gtc	p.I662V	IRAK1_ENST00000393687.2_Missense_Mutation_p.I632V|IRAK1_ENST00000393682.1_Missense_Mutation_p.I643V|IRAK1_ENST00000369974.2_Missense_Mutation_p.I583V|IRAK1_ENST00000477274.1_Intron|IRAK1_ENST00000429936.2_Missense_Mutation_p.I658V	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	662					activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGGGTTGATGATAATCTGC	0.627													T|||	1	0.000264901	0.0008	0.0	3775	,	,		12908	0.0		0.0	False		,,,				2504	0.0				p.I662V		Atlas-SNP	.											.	IRAK1	107	.	0			c.A1984G						.						118.0	89.0	99.0					X																	153278076		2203	4300	6503	SO:0001583	missense	3654	exon13			GGTTGATGATAAT	L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.1984A>G	chrX.hg19:g.153278076T>C	ENSP00000358997:p.Ile662Val	68.0	0.0		59.0	16.0	NM_001569	D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	ENST00000369980.3	hg19	CCDS14740.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.929723	0.73327	.	.	ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000393687;ENST00000429936	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	5.96	5.96	0.96718	.	0.114545	0.38959	N	0.001520	T	0.39600	0.1084	L	0.32530	0.975	0.37090	D	0.899404	D;D;D	0.69078	0.994;0.995;0.997	P;D;D	0.80764	0.876;0.984;0.994	T	0.46005	-0.9222	10	0.62326	D	0.03	-19.8813	12.784	0.57493	0.0:0.0:0.0:1.0	.	583;662;632	P51617-4;P51617;P51617-2	.;IRAK1_HUMAN;.	V	662;583;643;632;658	ENSP00000358997:I662V;ENSP00000358991:I583V;ENSP00000377287:I643V;ENSP00000377291:I632V;ENSP00000392662:I658V	ENSP00000358991:I583V	I	-	1	0	IRAK1	152931270	1.000000	0.71417	0.983000	0.44433	0.724000	0.41520	4.861000	0.62969	2.008000	0.58898	0.481000	0.45027	ATC	.	.		0.627	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061143.3		
MT-ND4	4538	hgsc.bcm.edu	37	M	11531	11531	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chrM:11531G>A	ENST00000361381.2	+	1	772	c.772G>A	c.(772-774)Gcc>Acc	p.A258T	MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	258					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CAAAACACATAGCCTACCCCT	0.448																																					p.A258T		Atlas-SNP	.											.	.	.	.	0			c.G772A						.																																			SO:0001583	missense	0	exon1			CACATAGCCTACC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.772G>A	chrM.hg19:g.11531G>A	ENSP00000354961:p.Ala258Thr	111.0	0.0		15.0	12.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
NPAT	4863	hgsc.bcm.edu	37	11	108064705	108064714	+	Frame_Shift_Del	DEL	ACTCATTTAA	ACTCATTTAA	-			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	ACTCATTTAA	ACTCATTTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:108064705_108064714delACTCATTTAA	ENST00000278612.8	-	3	292_301	c.187_196delTTAAATGAGT	c.(187-198)ttaaatgagtatfs	p.LNEY63fs	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	63	Interaction with MIZF.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ATAGCTACATACTCATTTAAAATTGTTGTC	0.243																																					p.63_66del		Atlas-Indel,Pindel	.											.	NPAT	124	.	0			c.188_197del						.																																			SO:0001589	frameshift_variant	4863	exon3			.	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.187_196delTTAAATGAGT	chr11.hg19:g.108064705_108064714delACTCATTTAA	ENSP00000278612:p.Leu63fs	272.0	0.0		199.0	55.0	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Frame_Shift_Del	DEL	ENST00000278612.8	hg19	CCDS41710.1																																																																																			.	.		0.243	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
OR5T2	219464	hgsc.bcm.edu	37	11	56000436	56000441	+	In_Frame_Del	DEL	AGAGGT	AGAGGT	-	rs183120088|rs145960242	byFrequency	TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	AGAGGT	AGAGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:56000436_56000441delAGAGGT	ENST00000313264.4	-	1	296_301	c.221_226delACCTCT	c.(220-228)tacctcttc>ttc	p.YL74del		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					ATGAGAGTGAAGAGGTAGATTGCTAG	0.398																																					p.74_76del		Atlas-Indel,Pindel	.											.	OR5T2	107	.	0			c.222_227del						.																																			SO:0001651	inframe_deletion	219464	exon1			.	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.221_226delACCTCT	chr11.hg19:g.56000436_56000441delAGAGGT	ENSP00000323688:p.Tyr74_Leu75del	123.0	0.0		74.0	19.0	NM_001004746	B9EGX5|Q6IFC8	In_Frame_Del	DEL	ENST00000313264.4	hg19	CCDS31523.1																																																																																			.	.		0.398	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
C6	729	hgsc.bcm.edu	37	5	41181559	41181560	+	Frame_Shift_Ins	INS	-	-	C	rs372345940		TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr5:41181559_41181560insC	ENST00000263413.3	-	7	1092_1093	c.828_829insG	c.(826-831)gggagcfs	p.S277fs	C6_ENST00000475349.1_5'UTR|C6_ENST00000337836.5_Frame_Shift_Ins_p.S277fs	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	277	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTGAAAGAGCTCCCCCCCTGAC	0.376																																					p.S277fs		Atlas-INDEL	.											.,1	C6	197	.	0			c.829_830insG	GRCh37	CD982526	C6	D		.																																			SO:0001589	frameshift_variant	729	exon7			.	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.829dupG	chr5.hg19:g.41181566_41181566dupC	ENSP00000263413:p.Ser277fs	180.0	0.0		213.0	22.0	NM_000065		Frame_Shift_Ins	INS	ENST00000263413.3	hg19	CCDS3936.1																																																																																			.	.		0.376	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
APOB	338	hgsc.bcm.edu	37	2	21251239	21251240	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr2:21251239_21251240insA	ENST00000233242.1	-	13	1915_1916	c.1788_1789insT	c.(1786-1791)catattfs	p.I597fs	APOB_ENST00000399256.4_Frame_Shift_Ins_p.I597fs	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	597	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATATTGGCAATATGGGAAGCCA	0.416																																					p.I597fs		Atlas-INDEL	.											.	APOB	761	.	0			c.1789_1790insT						.																																			SO:0001589	frameshift_variant	338	exon13			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1789dupT	chr2.hg19:g.21251240_21251240dupA	ENSP00000233242:p.Ile597fs	157.0	0.0		120.0	49.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.416	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
IMMP1L	196294	hgsc.bcm.edu	37	11	31482231	31482232	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr11:31482231_31482232insA	ENST00000278200.1	-	4	330_331	c.135_136insT	c.(133-138)attcaafs	p.Q46fs	IMMP1L_ENST00000533642.1_Intron|IMMP1L_ENST00000528161.1_Intron|IMMP1L_ENST00000534812.1_Intron|IMMP1L_ENST00000532287.1_Frame_Shift_Ins_p.Q46fs|IMMP1L_ENST00000526776.1_Intron	NM_144981.1	NP_659418.1	Q96LU5	IMP1L_HUMAN	IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)	46					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	serine-type peptidase activity (GO:0008236)			breast(1)|cervix(1)|large_intestine(1)|lung(4)	7	Lung SC(675;0.225)					TCTGAATTTTGAATTGTAGGCT	0.277																																					p.Q46fs		Atlas-INDEL	.											.	IMMP1L	16	.	0			c.136_137insT						.																																			SO:0001589	frameshift_variant	196294	exon4			.		CCDS7874.1	11p13	2014-07-30			ENSG00000148950	ENSG00000148950			26317	protein-coding gene	gene with protein product		612323					Standard	NM_144981		Approved	FLJ25059	uc001msy.1	Q96LU5	OTTHUMG00000166226	ENST00000278200.1:c.136dupT	chr11.hg19:g.31482233_31482233dupA	ENSP00000278200:p.Gln46fs	390.0	0.0		286.0	110.0	NM_144981	D3DQZ7|Q96SH9	Frame_Shift_Ins	INS	ENST00000278200.1	hg19	CCDS7874.1																																																																																			.	.		0.277	IMMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388496.1	NM_144981	
CD109	135228	hgsc.bcm.edu	37	6	74492373	74492373	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr6:74492373delA	ENST00000287097.5	+	18	2112	c.2000delA	c.(1999-2001)gaafs	p.E667fs	CD109_ENST00000422508.2_Frame_Shift_Del_p.E590fs|CD109_ENST00000437994.2_Frame_Shift_Del_p.E667fs			Q6YHK3	CD109_HUMAN	CD109 molecule	667	Bait region (approximate). {ECO:0000250}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTTATGGAGGAAAATGAAGGA	0.373																																					p.E667fs		Atlas-Indel,Pindel	.											.	CD109	170	.	0			c.1999delG						.						179.0	167.0	171.0					6																	74492373		2203	4300	6503	SO:0001589	frameshift_variant	135228	exon18			.	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2000delA	chr6.hg19:g.74492373delA	ENSP00000287097:p.Glu667fs	123.0	0.0		82.0	30.0	NM_001159587	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Frame_Shift_Del	DEL	ENST00000287097.5	hg19	CCDS4982.1																																																																																			.	.		0.373	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
SENP6	26054	hgsc.bcm.edu	37	6	76376479	76376480	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr6:76376479_76376480insTT	ENST00000447266.2	+	10	1524_1525	c.1046_1047insTT	c.(1045-1050)gaaagcfs	p.ES349fs	SENP6_ENST00000327284.8_Frame_Shift_Ins_p.ES342fs|SENP6_ENST00000541192.1_5'Flank|SENP6_ENST00000370014.3_Frame_Shift_Ins_p.ES349fs|SENP6_ENST00000370010.2_Frame_Shift_Ins_p.ES342fs	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	349					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				AACAGAAGAGAAAGCATATCTC	0.356																																					p.E349fs		Atlas-INDEL	.											.	SENP6	189	.	0			c.1046_1047insTT						.																																			SO:0001589	frameshift_variant	26054	exon10			.		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	Exception_encountered	chr6.hg19:g.76376479_76376480insTT	ENSP00000402527:p.Glu349fs	70.0	0.0		44.0	18.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Frame_Shift_Ins	INS	ENST00000447266.2	hg19	CCDS47454.1																																																																																			.	.		0.356	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
SENP6	26054	hgsc.bcm.edu	37	6	76376480	76376481	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-DD-A3A7-01A-11D-A22F-10	TCGA-DD-A3A7-11A-11D-A22F-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29b92b51-7ba3-42a9-97d3-6a9b5e43f928	134e6bf3-534e-4a0e-94e0-37c93f47f72b	g.chr6:76376480_76376481delAA	ENST00000447266.2	+	10	1525_1526	c.1047_1048delAA	c.(1045-1050)gaaagcfs	p.S350fs	SENP6_ENST00000327284.8_Frame_Shift_Del_p.S343fs|SENP6_ENST00000541192.1_5'Flank|SENP6_ENST00000370014.3_Frame_Shift_Del_p.S350fs|SENP6_ENST00000370010.2_Frame_Shift_Del_p.S343fs	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	350					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				ACAGAAGAGAAAGCATATCTCC	0.361																																					p.349_349del		Pindel	.											.	SENP6	189	.	0			c.1046_1047del						.																																			SO:0001589	frameshift_variant	26054	exon10			.		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1047_1048delAA	chr6.hg19:g.76376480_76376481delAA	ENSP00000402527:p.Ser350fs	71.0	0.0		44.0	14.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Frame_Shift_Del	DEL	ENST00000447266.2	hg19	CCDS47454.1																																																																																			.	.		0.361	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
