#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DVL1	1855	hgsc.bcm.edu	37	1	1277480	1277480	+	Missense_Mutation	SNP	A	A	G	rs147424815		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:1277480A>G	ENST00000378888.5	-	4	703	c.419T>C	c.(418-420)aTg>aCg	p.M140T	DVL1_ENST00000378891.5_Missense_Mutation_p.M140T			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	140					axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GTGACTGACCATGGACTCCGT	0.687																																					p.M140T		Atlas-SNP	.											.	DVL1	36	.	0			c.T419C						.	A	THR/MET	0,4386		0,0,2193	26.0	24.0	25.0		419	3.6	1.0	1	dbSNP_134	25	1,8581		0,1,4290	no	missense	DVL1	NM_004421.2	81	0,1,6483	GG,GA,AA		0.0117,0.0,0.0077	benign	140/671	1277480	1,12967	2193	4291	6484	SO:0001583	missense	1855	exon4			CTGACCATGGACT	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.419T>C	chr1.hg19:g.1277480A>G	ENSP00000368166:p.Met140Thr	153.0	0.0		150.0	27.0	NM_004421	Q5TA33|Q5TA35	Missense_Mutation	SNP	ENST00000378888.5	hg19		.	.	.	.	.	.	.	.	.	.	A	10.31	1.314796	0.23908	0.0	1.17E-4	ENSG00000107404	ENST00000378891;ENST00000378888;ENST00000345100	T;T	0.04551	3.61;3.6	3.59	3.59	0.41128	.	0.193497	0.41712	D	0.000827	T	0.03564	0.0102	N	0.14661	0.345	0.41865	D	0.990246	B	0.22146	0.065	B	0.17098	0.017	T	0.47100	-0.9143	10	0.52906	T	0.07	.	11.5538	0.50735	1.0:0.0:0.0:0.0	.	140	O14640-2	.	T	140	ENSP00000368169:M140T;ENSP00000368166:M140T	ENSP00000340031:M140T	M	-	2	0	DVL1	1267343	0.946000	0.32159	0.987000	0.45799	0.607000	0.37147	8.619000	0.90938	1.629000	0.50426	0.155000	0.16302	ATG	.	A|1.000;G|0.000		0.687	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000008490.1	NM_004421	
CAMTA1	23261	hgsc.bcm.edu	37	1	7700465	7700465	+	Silent	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:7700465C>T	ENST00000303635.7	+	7	723	c.516C>T	c.(514-516)ccC>ccT	p.P172P	CAMTA1_ENST00000439411.2_Silent_p.P172P	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CACAGAACCCCGACATCGTCC	0.647			T	WWTR1	epitheliod hemangioendothelioma																																p.P172P		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.C516T						.						86.0	76.0	80.0					1																	7700465		2203	4300	6503	SO:0001819	synonymous_variant	23261	exon7			GAACCCCGACATC	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.516C>T	chr1.hg19:g.7700465C>T		137.0	0.0		130.0	27.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	hg19	CCDS30576.1																																																																																			.	.		0.647	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
MFAP2	4237	hgsc.bcm.edu	37	1	17301519	17301519	+	Splice_Site	SNP	C	C	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:17301519C>G	ENST00000375535.3	-	9	738		c.e9-1		MFAP2_ENST00000375534.3_Splice_Site|MFAP2_ENST00000438542.1_Splice_Site|MFAP2_ENST00000490075.1_Splice_Site			P55001	MFAP2_HUMAN	microfibrillar-associated protein 2						extracellular matrix organization (GO:0030198)|platelet formation (GO:0030220)	extracellular region (GO:0005576)|microfibril (GO:0001527)				kidney(1)|lung(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGAGGTCAGCTATTGGGGGC	0.617																																					.		Atlas-SNP	.											.	MFAP2	8	.	0			c.446-1G>C						.						8.0	8.0	8.0					1																	17301519		2090	4073	6163	SO:0001630	splice_region_variant	4237	exon10			GGTCAGCTATTGG	BC015039	CCDS174.1, CCDS44071.1	1p36.1-p35	2008-02-05			ENSG00000117122	ENSG00000117122			7033	protein-coding gene	gene with protein product		156790				7759096	Standard	NM_017459		Approved	MAGP, MAGP-1	uc001azw.3	P55001	OTTHUMG00000002290	ENST00000375535.3:c.449-1G>C	chr1.hg19:g.17301519C>G		125.0	0.0		114.0	19.0	NM_001135248	Q53X60|Q5JXY0	Splice_Site	SNP	ENST00000375535.3	hg19	CCDS174.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838766	0.51057	.	.	ENSG00000117122	ENST00000375535;ENST00000375534;ENST00000438542	.	.	.	3.87	3.87	0.44632	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7093	0.62659	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MFAP2	17174106	1.000000	0.71417	0.998000	0.56505	0.653000	0.38743	6.821000	0.75272	1.905000	0.55150	0.491000	0.48974	.	.	.		0.617	MFAP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006609.1	NM_002403	Intron
FGR	2268	hgsc.bcm.edu	37	1	27941376	27941376	+	Silent	SNP	C	C	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:27941376C>A	ENST00000374005.3	-	10	1368	c.1080G>T	c.(1078-1080)gtG>gtT	p.V360V	FGR_ENST00000399173.1_Silent_p.V360V|FGR_ENST00000545953.1_Silent_p.V294V|FGR_ENST00000374004.1_Silent_p.V360V	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	360	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CTGCCATGTCCACCAATTGGG	0.562																																					p.V360V		Atlas-SNP	.											.	FGR	39	.	0			c.G1080T						.						26.0	24.0	25.0					1																	27941376		2203	4298	6501	SO:0001819	synonymous_variant	2268	exon10			CATGTCCACCAAT	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.1080G>T	chr1.hg19:g.27941376C>A		204.0	0.0		147.0	19.0	NM_001042729	D3DPL7|Q9UIQ3	Silent	SNP	ENST00000374005.3	hg19	CCDS305.1																																																																																			.	.		0.562	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
IPP	3652	hgsc.bcm.edu	37	1	46165836	46165836	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:46165836C>A	ENST00000396478.3	-	9	1659	c.1557G>T	c.(1555-1557)atG>atT	p.M519I	IPP_ENST00000495072.1_5'UTR	NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	519						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TAGGCACTTTCATTGAGGCAA	0.408																																					p.M519I		Atlas-SNP	.											.	IPP	66	.	0			c.G1557T						.						117.0	120.0	119.0					1																	46165836		2203	4300	6503	SO:0001583	missense	3652	exon9			CACTTTCATTGAG	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1557G>T	chr1.hg19:g.46165836C>A	ENSP00000379739:p.Met519Ile	38.0	0.0		34.0	6.0	NM_001145349	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	hg19	CCDS30702.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020667	0.93462	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	D;D	0.84070	-1.8;-1.8	5.77	5.77	0.91146	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.91831	0.7415	M	0.81341	2.54	0.80722	D	1	D;D	0.69078	0.997;0.971	D;D	0.75020	0.985;0.93	D	0.92163	0.5737	10	0.87932	D	0	.	19.9946	0.97381	0.0:1.0:0.0:0.0	.	519;519	Q9Y573;A2A6V3	IPP_HUMAN;.	I	519	ENSP00000353024:M519I;ENSP00000379739:M519I	ENSP00000353024:M519I	M	-	3	0	IPP	45938423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.212000	0.77941	2.728000	0.93425	0.591000	0.81541	ATG	.	.		0.408	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
PTPN22	26191	hgsc.bcm.edu	37	1	114380848	114380848	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:114380848C>T	ENST00000359785.5	-	13	1309	c.1174G>A	c.(1174-1176)Gac>Aac	p.D392N	PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000538253.1_Missense_Mutation_p.D148N|PTPN22_ENST00000528414.1_Missense_Mutation_p.D337N|PTPN22_ENST00000525799.1_Missense_Mutation_p.D265N|PTPN22_ENST00000420377.2_Missense_Mutation_p.D392N	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	392					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGGTTGTGTCAGCATTTTTG	0.398																																					p.D392N		Atlas-SNP	.											.	PTPN22	90	.	0			c.G1174A						.						91.0	90.0	90.0					1																	114380848		2203	4300	6503	SO:0001583	missense	26191	exon13			TTGTGTCAGCATT	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1174G>A	chr1.hg19:g.114380848C>T	ENSP00000352833:p.Asp392Asn	53.0	0.0		52.0	8.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	hg19	CCDS863.1	.	.	.	.	.	.	.	.	.	.	C	8.609	0.888604	0.17540	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.32515	3.72;3.33;1.45;3.6;3.03	5.82	1.82	0.25136	.	0.575346	0.17597	N	0.168558	T	0.10937	0.0267	M	0.65975	2.015	0.09310	N	1	B;P;B;B;B;B	0.35050	0.122;0.482;0.007;0.013;0.012;0.007	B;B;B;B;B;B	0.27262	0.045;0.078;0.006;0.005;0.015;0.006	T	0.11494	-1.0585	10	0.48119	T	0.1	.	5.7786	0.18294	0.0:0.6253:0.1414:0.2334	.	148;265;392;337;392;392	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	N	392;337;148;392;265;392	ENSP00000352833:D392N;ENSP00000435176:D337N;ENSP00000439372:D148N;ENSP00000388229:D392N;ENSP00000432674:D265N	ENSP00000346621:D392N	D	-	1	0	PTPN22	114182371	0.000000	0.05858	0.017000	0.16124	0.088000	0.18126	0.196000	0.17176	0.354000	0.24105	0.655000	0.94253	GAC	.	.		0.398	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
OR10J5	127385	hgsc.bcm.edu	37	1	159504893	159504893	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:159504893C>G	ENST00000334857.2	-	1	949	c.905G>C	c.(904-906)aGa>aCa	p.R302T		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GCCCACAACTCTGCATAGGGC	0.418																																					p.R302T		Atlas-SNP	.											.	OR10J5	68	.	0			c.G905C						.						63.0	59.0	61.0					1																	159504893		2203	4300	6503	SO:0001583	missense	127385	exon1			ACAACTCTGCATA		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.905G>C	chr1.hg19:g.159504893C>G	ENSP00000334441:p.Arg302Thr	46.0	0.0		52.0	7.0	NM_001004469	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	hg19	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416895	0.42918	.	.	ENSG00000184155	ENST00000334857	T	0.40476	1.03	4.4	3.48	0.39840	.	.	.	.	.	T	0.51381	0.1671	M	0.84219	2.685	0.30806	N	0.739329	D	0.69078	0.997	D	0.64687	0.928	T	0.52586	-0.8556	9	0.87932	D	0	.	10.3544	0.43956	0.0:0.9025:0.0:0.0975	.	302	Q8NHC4	O10J5_HUMAN	T	302	ENSP00000334441:R302T	ENSP00000334441:R302T	R	-	2	0	OR10J5	157771517	0.429000	0.25530	0.201000	0.23476	0.694000	0.40290	1.296000	0.33389	1.180000	0.42898	0.591000	0.81541	AGA	.	.		0.418	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
FCRLB	127943	hgsc.bcm.edu	37	1	161697408	161697408	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:161697408G>A	ENST00000367948.2	+	8	1452	c.1237G>A	c.(1237-1239)Gct>Act	p.A413T	FCRLB_ENST00000367944.3_3'UTR|FCRLB_ENST00000392158.1_Missense_Mutation_p.A413T|FCRLB_ENST00000367945.1_3'UTR|FCRLB_ENST00000336830.5_3'UTR|FCRLB_ENST00000495397.1_3'UTR|FCRLB_ENST00000367946.3_3'UTR			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	413					negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CTCTCACTTTGCTGTGAGCCC	0.647																																					p.A413T		Atlas-SNP	.											.	FCRLB	35	.	0			c.G1237A						.						23.0	29.0	27.0					1																	161697408		2201	4300	6501	SO:0001583	missense	127943	exon6			CACTTTGCTGTGA	AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.1237G>A	chr1.hg19:g.161697408G>A	ENSP00000356925:p.Ala413Thr	115.0	0.0		123.0	8.0	NM_001002901	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Missense_Mutation	SNP	ENST00000367948.2	hg19	CCDS30927.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.515373	0.44763	.	.	ENSG00000162746	ENST00000367948;ENST00000392158	T;T	0.01599	4.74;4.74	4.45	2.52	0.30459	.	0.502419	0.16507	N	0.211401	T	0.00384	0.0012	N	0.17082	0.46	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.44375	-0.9332	10	0.19590	T	0.45	.	5.3593	0.16079	0.1152:0.2079:0.6769:0.0	.	413	Q6BAA4	FCRLB_HUMAN	T	413	ENSP00000356925:A413T;ENSP00000375999:A413T	ENSP00000356925:A413T	A	+	1	0	FCRLB	159964032	0.060000	0.20803	0.007000	0.13788	0.221000	0.24807	0.620000	0.24403	0.471000	0.27319	0.455000	0.32223	GCT	.	.		0.647	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1	NM_152378	
CACNA1E	777	hgsc.bcm.edu	37	1	181767462	181767462	+	Missense_Mutation	SNP	C	C	G	rs189356042		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:181767462C>G	ENST00000367573.2	+	48	6434	c.6434C>G	c.(6433-6435)tCt>tGt	p.S2145C	CACNA1E_ENST00000360108.3_Missense_Mutation_p.S2126C|CACNA1E_ENST00000367567.4_Missense_Mutation_p.S1709C|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S2102C|CACNA1E_ENST00000358338.5_Missense_Mutation_p.S2034C|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S2096C|CACNA1E_ENST00000526775.1_Missense_Mutation_p.S2083C	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2145					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCCATCCCCTCTGTCTCTGAC	0.572																																					p.S2145C		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C6434G						.						126.0	135.0	132.0					1																	181767462		2024	4177	6201	SO:0001583	missense	777	exon48			TCCCCTCTGTCTC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6434C>G	chr1.hg19:g.181767462C>G	ENSP00000356545:p.Ser2145Cys	33.0	0.0		36.0	9.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573979	0.86542	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98135	-4.62;-4.61;-4.29;-4.61;-4.74;-4.29;-4.29	5.59	5.59	0.84812	.	0.447086	0.24172	N	0.040899	D	0.98372	0.9459	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.995	D	0.99659	1.0993	10	0.87932	D	0	.	17.3853	0.87414	0.0:1.0:0.0:0.0	.	2083;2102	Q15878-2;Q15878-3	.;.	C	2102;2083;2096;2034;1709;2126;2145	ENSP00000356542:S2102C;ENSP00000434814:S2083C;ENSP00000350183:S2096C;ENSP00000351101:S2034C;ENSP00000356539:S1709C;ENSP00000353222:S2126C;ENSP00000356545:S2145C	ENSP00000350183:S2096C	S	+	2	0	CACNA1E	180034085	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	6.836000	0.75349	2.622000	0.88805	0.563000	0.77884	TCT	.	C|1.000;T|0.000		0.572	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
LYST	1130	hgsc.bcm.edu	37	1	235973623	235973623	+	Silent	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:235973623G>T	ENST00000389794.3	-	5	669	c.495C>A	c.(493-495)acC>acA	p.T165T	LYST_ENST00000536965.1_Silent_p.T165T|LYST_ENST00000389793.2_Silent_p.T165T			Q99698	LYST_HUMAN	lysosomal trafficking regulator	165					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTGAATCTGAGGTGGAGAGCT	0.393																																					p.T165T		Atlas-SNP	.											.	LYST	370	.	0			c.C495A						.						151.0	147.0	148.0					1																	235973623		2203	4300	6503	SO:0001819	synonymous_variant	1130	exon5			ATCTGAGGTGGAG	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.495C>A	chr1.hg19:g.235973623G>T		83.0	0.0		92.0	20.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	hg19	CCDS31062.1																																																																																			.	.		0.393	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
RYR2	6262	hgsc.bcm.edu	37	1	237778097	237778097	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:237778097A>C	ENST00000366574.2	+	37	5986	c.5669A>C	c.(5668-5670)aAg>aCg	p.K1890T	RYR2_ENST00000542537.1_Missense_Mutation_p.K1874T|RYR2_ENST00000360064.6_Missense_Mutation_p.K1888T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1890	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGCGGCCCAAGGAAGGCCTG	0.507																																					p.K1890T		Atlas-SNP	.											.	RYR2	1273	.	0			c.A5669C						.						41.0	44.0	43.0					1																	237778097		1967	4148	6115	SO:0001583	missense	6262	exon37			GGCCCAAGGAAGG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5669A>C	chr1.hg19:g.237778097A>C	ENSP00000355533:p.Lys1890Thr	185.0	0.0		156.0	31.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	7.093	0.572537	0.13623	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.72942	-0.7;-0.7;-0.7	5.33	5.33	0.75918	.	0.310145	0.24674	N	0.036523	T	0.51244	0.1663	N	0.14661	0.345	0.43326	D	0.995351	B	0.06786	0.001	B	0.04013	0.001	T	0.47142	-0.9140	10	0.15499	T	0.54	.	11.9117	0.52743	0.8546:0.1454:0.0:0.0	.	1890	Q92736	RYR2_HUMAN	T	1890;1888;1874	ENSP00000355533:K1890T;ENSP00000353174:K1888T;ENSP00000443798:K1874T	ENSP00000353174:K1888T	K	+	2	0	RYR2	235844720	0.994000	0.37717	0.880000	0.34516	0.949000	0.60115	3.016000	0.49607	2.012000	0.59069	0.528000	0.53228	AAG	.	.		0.507	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
GRHL1	29841	hgsc.bcm.edu	37	2	10095217	10095217	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:10095217A>G	ENST00000324907.9	+	2	330	c.194A>G	c.(193-195)tAt>tGt	p.Y65C	GRHL1_ENST00000324883.5_5'UTR|GRHL1_ENST00000405379.2_Missense_Mutation_p.Y65C	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	65	Transcription activation.				cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GGCCTGCTCTATGACTACTAC	0.498																																					p.Y65C		Atlas-SNP	.											.	GRHL1	95	.	0			c.A194G						.						47.0	52.0	50.0					2																	10095217		2053	4240	6293	SO:0001583	missense	29841	exon2			TGCTCTATGACTA	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.194A>G	chr2.hg19:g.10095217A>G	ENSP00000324693:p.Tyr65Cys	132.0	0.0		110.0	16.0	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	hg19	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852336	0.71719	.	.	ENSG00000134317	ENST00000405379;ENST00000324907	T;T	0.55760	0.5;0.5	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78979	-0.1990	10	0.66056	D	0.02	-6.483	16.1205	0.81351	1.0:0.0:0.0:0.0	.	65	Q9NZI5	GRHL1_HUMAN	C	65	ENSP00000384209:Y65C;ENSP00000324693:Y65C	ENSP00000324693:Y65C	Y	+	2	0	GRHL1	10012668	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	9.339000	0.96797	2.205000	0.71048	0.533000	0.62120	TAT	.	.		0.498	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
DQX1	165545	hgsc.bcm.edu	37	2	74745708	74745708	+	Silent	SNP	T	T	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:74745708T>A	ENST00000404568.3	-	12	2238	c.2019A>T	c.(2017-2019)ccA>ccT	p.P673P	DQX1_ENST00000393951.2_Silent_p.P673P	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	673						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TCAGGAAGTATGGAGGGGCCA	0.483																																					p.P673P		Atlas-SNP	.											.	DQX1	95	.	0			c.A2019T						.						100.0	91.0	94.0					2																	74745708		2203	4300	6503	SO:0001819	synonymous_variant	165545	exon12			GAAGTATGGAGGG	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.2019A>T	chr2.hg19:g.74745708T>A		147.0	0.0		139.0	24.0	NM_133637	Q6B017|Q8NAM8	Silent	SNP	ENST00000404568.3	hg19	CCDS1949.2																																																																																			.	.		0.483	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
LMAN2L	81562	hgsc.bcm.edu	37	2	97405772	97405772	+	Silent	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:97405772C>T	ENST00000264963.4	-	1	28	c.6G>A	c.(4-6)gcG>gcA	p.A2A	LMAN2L_ENST00000377079.4_Silent_p.A2A|LMAN2L_ENST00000426463.2_5'UTR|LMAN2L_ENST00000534882.1_5'UTR|LMAN2L_ENST00000537039.1_5'UTR	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	2					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						CCAGAGTCGCCGCCATCTTTC	0.602																																					p.A2A		Atlas-SNP	.											.	LMAN2L	27	.	0			c.G6A						.						48.0	54.0	52.0					2																	97405772		2203	4300	6503	SO:0001819	synonymous_variant	81562	exon1			AGTCGCCGCCATC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.6G>A	chr2.hg19:g.97405772C>T		22.0	0.0		37.0	9.0	NM_030805	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Silent	SNP	ENST00000264963.4	hg19	CCDS2023.1																																																																																			.	.		0.602	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
GLI2	2736	hgsc.bcm.edu	37	2	121554929	121554929	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:121554929G>T	ENST00000452319.1	+	2	93	c.33G>T	c.(31-33)gaG>gaT	p.E11D	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.E11D					GLI family zinc finger 2									p.E11E(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTGCCTCCGAGAAGCAAGAAG	0.597																																					p.E11D		Atlas-SNP	.											GLI2,NS,carcinoma,0,1	GLI2	187	.	1	Substitution - coding silent(1)	breast(1)	c.G33T						.						120.0	138.0	132.0					2																	121554929		2203	4300	6503	SO:0001583	missense	2736	exon1			CTCCGAGAAGCAA		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.33G>T	chr2.hg19:g.121554929G>T	ENSP00000390436:p.Glu11Asp	73.0	0.0		68.0	15.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	hg19	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.274804	0.23307	.	.	ENSG00000074047	ENST00000418323;ENST00000452319;ENST00000361492;ENST00000440937;ENST00000360874	T;T	0.16324	2.35;2.35	5.86	4.98	0.66077	.	0.000000	0.53938	D	0.000051	T	0.12561	0.0305	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.12013	0.003;0.002;0.0;0.005	B;B;B;B	0.11329	0.004;0.002;0.0;0.006	T	0.04509	-1.0946	10	0.87932	D	0	.	15.2895	0.73854	0.0:0.2779:0.7221:0.0	.	11;11;11;11	B4DT63;P10070;Q0VGA0;F5H4D9	.;GLI2_HUMAN;.;.	D	11;11;11;11;3	ENSP00000390436:E11D;ENSP00000354586:E11D	ENSP00000344473:E11D	E	+	3	2	GLI2	121271399	1.000000	0.71417	0.999000	0.59377	0.336000	0.28762	1.875000	0.39578	1.467000	0.48044	0.655000	0.94253	GAG	.	.		0.597	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
BAZ2B	29994	hgsc.bcm.edu	37	2	160242941	160242941	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:160242941T>A	ENST00000392783.2	-	22	3889	c.3394A>T	c.(3394-3396)Atg>Ttg	p.M1132L	BAZ2B_ENST00000355831.2_Missense_Mutation_p.M1098L|BAZ2B_ENST00000392782.1_Missense_Mutation_p.M1096L|AC008277.1_ENST00000420020.1_RNA|BAZ2B_ENST00000343439.5_Missense_Mutation_p.M1032L	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1132	DDT. {ECO:0000255|PROSITE- ProRule:PRU00063}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ACTTCACCCATGCTGTCCCCT	0.383																																					p.M1132L		Atlas-SNP	.											.	BAZ2B	196	.	0			c.A3394T						.						96.0	88.0	90.0					2																	160242941		1890	4135	6025	SO:0001583	missense	29994	exon22			CACCCATGCTGTC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.3394A>T	chr2.hg19:g.160242941T>A	ENSP00000376534:p.Met1132Leu	98.0	0.0		61.0	10.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.08|17.08	3.298867|3.298867	0.60195|0.60195	.|.	.|.	ENSG00000123636|ENSG00000123636	ENST00000294905|ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	.|T;T;T;T	.|0.57436	.|0.46;0.46;0.46;0.4	6.08|6.08	6.08|6.08	0.98989|0.98989	.|DDT domain superfamily (1);DDT domain, subgroup (1);DDT domain (1);	.|0.000000	.|0.44902	.|U	.|0.000420	T|T	0.40862|0.40862	0.1134|0.1134	N|N	0.08118|0.08118	0|0	0.47094|0.47094	D|D	0.999317|0.999317	.|B;P	.|0.45176	.|0.367;0.852	.|B;P	.|0.46389	.|0.106;0.515	T|T	0.35251|0.35251	-0.9796|-0.9796	5|9	.|.	.|.	.|.	-12.1071|-12.1071	16.6512|16.6512	0.85203|0.85203	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1096;1132	.|Q9UIF8-5;Q9UIF8	.|.;BAZ2B_HUMAN	L|L	192|1096;1132;1098;1032	.|ENSP00000376533:M1096L;ENSP00000376534:M1132L;ENSP00000348087:M1098L;ENSP00000339670:M1032L	.|.	H|M	-|-	2|1	0|0	BAZ2B|BAZ2B	159951187|159951187	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.081000|5.081000	0.64444|0.64444	2.333000|2.333000	0.79357|0.79357	0.482000|0.482000	0.46254|0.46254	CAT|ATG	.	.		0.383	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
HOXD9	3235	hgsc.bcm.edu	37	2	176988265	176988265	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:176988265G>C	ENST00000249499.6	+	1	1178	c.769G>C	c.(769-771)Gag>Cag	p.E257Q	HOXD-AS2_ENST00000440016.2_RNA	NM_014213.3	NP_055028.3	P28356	HXD9_HUMAN	homeobox D9	257					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal system morphogenesis (GO:0048704)|hindlimb morphogenesis (GO:0035137)|mammary gland development (GO:0030879)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		TTCGCTGAAGGAGGAGGAGAA	0.612																																					p.E257Q	GBM(47;924 952 7959 9248 12176)	Atlas-SNP	.											.	HOXD9	49	.	0			c.G769C						.						14.0	14.0	14.0					2																	176988265		2195	4271	6466	SO:0001583	missense	3235	exon1			CTGAAGGAGGAGG		CCDS2267.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128709	ENSG00000128709		"""Homeoboxes / ANTP class : HOXL subclass"""	5140	protein-coding gene	gene with protein product		142982	"""homeo box D9"""	HOX4C, HOX4		1973146, 1358459	Standard	NM_014213		Approved		uc010zex.2	P28356	OTTHUMG00000132516	ENST00000249499.6:c.769G>C	chr2.hg19:g.176988265G>C	ENSP00000249499:p.Glu257Gln	91.0	0.0		70.0	12.0	NM_014213	Q86ST1	Missense_Mutation	SNP	ENST00000249499.6	hg19	CCDS2267.2	.	.	.	.	.	.	.	.	.	.	G	16.56	3.157721	0.57368	.	.	ENSG00000128709	ENST00000249499	D	0.94046	-3.34	4.91	2.95	0.34219	.	5.085380	0.00541	N	0.000224	D	0.91637	0.7357	L	0.43152	1.355	0.32337	N	0.560278	D	0.54601	0.967	B	0.44044	0.439	D	0.84295	0.0502	10	0.35671	T	0.21	.	9.8521	0.41064	0.0773:0.1403:0.7824:0.0	.	257	P28356	HXD9_HUMAN	Q	257	ENSP00000249499:E257Q	ENSP00000249499:E257Q	E	+	1	0	HOXD9	176696511	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.728000	0.74769	1.176000	0.42840	0.555000	0.69702	GAG	.	.		0.612	HOXD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255698.4		
FSIP2	401024	hgsc.bcm.edu	37	2	186673299	186673299	+	Silent	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:186673299C>T	ENST00000424728.1	+	17	19266	c.19266C>T	c.(19264-19266)gtC>gtT	p.V6422V	FSIP2_ENST00000343098.5_Silent_p.V6511V			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6422										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						ATCAGGTTGTCGATTCCGTTT	0.328																																					p.V6511V		Atlas-SNP	.											.	FSIP2	251	.	0			c.C19533T						.						65.0	59.0	61.0					2																	186673299		1811	4072	5883	SO:0001819	synonymous_variant	401024	exon17			GGTTGTCGATTCC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19266C>T	chr2.hg19:g.186673299C>T		127.0	0.0		98.0	16.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	ENST00000424728.1	hg19																																																																																				.	.		0.328	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
ITGAV	3685	hgsc.bcm.edu	37	2	187465066	187465066	+	Intron	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:187465066T>C	ENST00000261023.3	+	2	459				ITGAV_ENST00000433736.2_Missense_Mutation_p.L2P|ITGAV_ENST00000374907.3_Intron	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V						angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	ACACAAATGCTCCTAGGCACC	0.463																																					p.L2P	Melanoma(58;108 1995 6081)	Atlas-SNP	.											.	ITGAV	124	.	0			c.T5C						.						189.0	160.0	169.0					2																	187465066		692	1591	2283	SO:0001627	intron_variant	3685	exon1			AAATGCTCCTAGG		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.186-1682T>C	chr2.hg19:g.187465066T>C		71.0	0.0		49.0	7.0	NM_001144999	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	hg19	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	T	2.665	-0.278942	0.05642	.	.	ENSG00000138448	ENST00000433736	T	0.69175	-0.38	2.58	1.34	0.21922	.	.	.	.	.	T	0.41834	0.1176	N	0.08118	0	0.09310	N	1	B	0.21309	0.054	B	0.15052	0.012	T	0.33266	-0.9875	9	0.87932	D	0	.	4.6264	0.12481	0.0:0.1604:0.0:0.8396	.	2	E7EWZ6	.	P	2	ENSP00000404291:L2P	ENSP00000404291:L2P	L	+	2	0	ITGAV	187173311	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.046000	0.14035	0.365000	0.24400	0.528000	0.53228	CTC	.	.		0.463	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
COL4A4	1286	hgsc.bcm.edu	37	2	227906897	227906897	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr2:227906897C>A	ENST00000396625.3	-	37	3679	c.3472G>T	c.(3472-3474)Gat>Tat	p.D1158Y	COL4A4_ENST00000329662.7_Missense_Mutation_p.D1158Y	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1158	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ATCCCTGGATCCCCCTGGAGG	0.542																																					p.D1158Y		Atlas-SNP	.											.	COL4A4	215	.	0			c.G3472T						.						142.0	138.0	139.0					2																	227906897		1865	4101	5966	SO:0001583	missense	1286	exon37			CTGGATCCCCCTG		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.3472G>T	chr2.hg19:g.227906897C>A	ENSP00000379866:p.Asp1158Tyr	56.0	0.0		45.0	7.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	hg19	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	C	0.913	-0.718288	0.03182	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.93547	-2.63;-3.24	6.17	1.24	0.21308	.	.	.	.	.	D	0.87529	0.6200	L	0.39020	1.185	0.09310	N	0.999999	B	0.15930	0.015	B	0.19946	0.027	T	0.75602	-0.3261	9	0.41790	T	0.15	.	4.9584	0.14054	0.2304:0.3074:0.3921:0.0702	.	1158	P53420	CO4A4_HUMAN	Y	1158	ENSP00000379866:D1158Y;ENSP00000328553:D1158Y	ENSP00000328553:D1158Y	D	-	1	0	COL4A4	227615141	0.000000	0.05858	0.003000	0.11579	0.906000	0.53458	-0.023000	0.12456	-0.053000	0.13289	0.655000	0.94253	GAT	.	.		0.542	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
FBLN2	2199	hgsc.bcm.edu	37	3	13612210	13612210	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr3:13612210C>T	ENST00000295760.7	+	2	424	c.355C>T	c.(355-357)Ccc>Tcc	p.P119S	FBLN2_ENST00000492059.1_Missense_Mutation_p.P119S|FBLN2_ENST00000535798.1_Missense_Mutation_p.P145S|FBLN2_ENST00000404922.3_Missense_Mutation_p.P119S	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	119	N.|Subdomain NA (Cys-rich).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GGAGCTGCCGCCCAACTGCAT	0.652																																					p.P119S		Atlas-SNP	.											.	FBLN2	137	.	0			c.C355T						.						8.0	10.0	10.0					3																	13612210		2118	4205	6323	SO:0001583	missense	2199	exon2			CTGCCGCCCAACT	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.355C>T	chr3.hg19:g.13612210C>T	ENSP00000295760:p.Pro119Ser	75.0	0.0		108.0	21.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	hg19	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361558	0.41801	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000465610;ENST00000492059	T;T;T;T;T	0.80738	-1.41;-1.34;-1.31;1.46;-1.34	5.16	5.16	0.70880	.	0.229124	0.36409	N	0.002604	D	0.85225	0.5648	L	0.32530	0.975	0.34760	D	0.732614	P;D;D	0.89917	0.91;1.0;0.976	P;D;P	0.87578	0.743;0.998;0.741	D	0.88175	0.2867	10	0.44086	T	0.13	.	18.7103	0.91653	0.0:1.0:0.0:0.0	.	119;119;145	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	S	145;119;119;119;119	ENSP00000445705:P145S;ENSP00000384169:P119S;ENSP00000295760:P119S;ENSP00000420164:P119S;ENSP00000420042:P119S	ENSP00000295760:P119S	P	+	1	0	FBLN2	13587210	0.923000	0.31300	0.927000	0.36925	0.710000	0.40934	2.352000	0.44080	2.429000	0.82318	0.558000	0.71614	CCC	.	.		0.652	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
LTF	4057	hgsc.bcm.edu	37	3	46492064	46492064	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr3:46492064C>A	ENST00000231751.4	-	7	1098	c.803G>T	c.(802-804)cGg>cTg	p.R268L	LTF_ENST00000426532.2_Missense_Mutation_p.R224L|LTF_ENST00000417439.1_Missense_Mutation_p.R268L	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	268	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		AGAAGGGACCCGGGCCAGATG	0.562																																					p.R268L		Atlas-SNP	.											.	LTF	98	.	0			c.G803T						.						105.0	93.0	97.0					3																	46492064		2203	4296	6499	SO:0001583	missense	4057	exon7			GGGACCCGGGCCA		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.803G>T	chr3.hg19:g.46492064C>A	ENSP00000231751:p.Arg268Leu	178.0	0.0		150.0	25.0	NM_002343	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	hg19	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267941	0.23136	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	4.79	0.439	0.16567	.	0.239958	0.48767	D	0.000161	T	0.43986	0.1272	L	0.55743	1.74	0.40246	D	0.978013	B;D;B	0.59357	0.1;0.985;0.1	B;P;B	0.59424	0.086;0.857;0.086	T	0.25745	-1.0123	10	0.44086	T	0.13	-10.4148	8.2006	0.31421	0.0:0.4907:0.0:0.5093	.	268;255;268	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	L	268;224;268;255	ENSP00000231751:R268L;ENSP00000405719:R224L;ENSP00000405546:R268L;ENSP00000397427:R255L	ENSP00000231751:R268L	R	-	2	0	LTF	46467068	0.064000	0.20934	0.008000	0.14137	0.223000	0.24884	0.419000	0.21247	-0.047000	0.13423	0.655000	0.94253	CGG	.	.		0.562	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343	
C3orf67	200844	hgsc.bcm.edu	37	3	58849427	58849427	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr3:58849427G>A	ENST00000482387.1	-	8	1171	c.1075C>T	c.(1075-1077)Cca>Tca	p.P359S	RP11-147N17.1_ENST00000492031.1_RNA|RP11-147N17.1_ENST00000463703.1_RNA|C3orf67_ENST00000472469.1_Missense_Mutation_p.P266S|RP11-147N17.1_ENST00000482372.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.P359S			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	359										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GCTGATCGTGGTCTTGATGAA	0.468																																					p.P359S		Atlas-SNP	.											.	C3orf67	45	.	0			c.C1075T						.						148.0	142.0	144.0					3																	58849427		2203	4300	6503	SO:0001583	missense	200844	exon12			ATCGTGGTCTTGA	AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.1075C>T	chr3.hg19:g.58849427G>A	ENSP00000417122:p.Pro359Ser	94.0	0.0		77.0	13.0	NM_198463	B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.3	4.275456	0.80580	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000394474;ENST00000472469	T;T;T	0.37058	1.64;1.35;1.22	5.39	5.39	0.77823	.	0.068735	0.64402	D	0.000018	T	0.62109	0.2401	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.64402	-0.6416	10	0.66056	D	0.02	-15.996	17.7005	0.88293	0.0:0.0:1.0:0.0	.	266;359;359	C9J3M8;Q6ZVT6-2;Q6ZVT6	.;.;CC067_HUMAN	S	359;359;64;266	ENSP00000295966:P359S;ENSP00000417122:P359S;ENSP00000417271:P266S	ENSP00000295966:P359S	P	-	1	0	C3orf67	58824467	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.688000	0.74557	2.678000	0.91216	0.655000	0.94253	CCA	.	.		0.468	C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463	
OR5H14	403273	hgsc.bcm.edu	37	3	97868812	97868812	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr3:97868812A>T	ENST00000437310.1	+	1	643	c.583A>T	c.(583-585)Aac>Tac	p.N195Y	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TTCCTCTATTAACTTTCTAAT	0.284																																					p.N195Y		Atlas-SNP	.											.	OR5H14	56	.	0			c.A583T						.						64.0	68.0	67.0					3																	97868812		2200	4295	6495	SO:0001583	missense	403273	exon1			TCTATTAACTTTC		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.583A>T	chr3.hg19:g.97868812A>T	ENSP00000401706:p.Asn195Tyr	62.0	0.0		52.0	15.0	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	hg19	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.665736	0.47677	.	.	ENSG00000236032	ENST00000437310	T	0.00224	8.51	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.128437	0.35378	N	0.003241	T	0.00440	0.0014	M	0.75777	2.31	0.27419	N	0.954332	D	0.89917	1.0	D	0.83275	0.996	T	0.37820	-0.9689	10	0.87932	D	0	.	6.7194	0.23323	1.0:0.0:0.0:0.0	.	195	A6NHG9	O5H14_HUMAN	Y	195	ENSP00000401706:N195Y	ENSP00000401706:N195Y	N	+	1	0	OR5H14	99351502	0.000000	0.05858	0.133000	0.22050	0.049000	0.14656	0.830000	0.27462	1.132000	0.42129	0.164000	0.16699	AAC	.	.		0.284	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
AFAP1	60312	hgsc.bcm.edu	37	4	7787959	7787959	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr4:7787959C>T	ENST00000360265.4	-	11	1726	c.1492G>A	c.(1492-1494)Gca>Aca	p.A498T	AFAP1_ENST00000382543.3_Missense_Mutation_p.A498T|AFAP1_ENST00000420658.1_Missense_Mutation_p.A498T|AFAP1_ENST00000513842.1_5'UTR|AFAP1_ENST00000358461.2_Missense_Mutation_p.A498T			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	498						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TAATGAAGTGCCGTCCCGCTG	0.498																																					p.A498T		Atlas-SNP	.											.	AFAP1	93	.	0			c.G1492A						.						117.0	113.0	115.0					4																	7787959		2203	4300	6503	SO:0001583	missense	60312	exon12			GAAGTGCCGTCCC	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1492G>A	chr4.hg19:g.7787959C>T	ENSP00000353402:p.Ala498Thr	137.0	0.0		98.0	19.0	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	hg19	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847265	0.91277	.	.	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.16743	2.32;2.34;2.32;2.34	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	M	0.70595	2.14	0.80722	D	1	D;B	0.89917	1.0;0.226	D;B	0.87578	0.998;0.132	T	0.18524	-1.0334	10	0.10902	T	0.67	-44.1013	18.916	0.92506	0.0:1.0:0.0:0.0	.	498;498	E9PDT7;Q8N556	.;AFAP1_HUMAN	T	498	ENSP00000353402:A498T;ENSP00000410689:A498T;ENSP00000351245:A498T;ENSP00000371983:A498T	ENSP00000351245:A498T	A	-	1	0	AFAP1	7838859	1.000000	0.71417	0.748000	0.31131	0.689000	0.40095	5.266000	0.65525	2.462000	0.83206	0.650000	0.86243	GCA	.	.		0.498	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
TRPC3	7222	hgsc.bcm.edu	37	4	122853884	122853884	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr4:122853884C>T	ENST00000379645.3	-	2	602	c.529G>A	c.(529-531)Gac>Aac	p.D177N	TRPC3_ENST00000513531.1_Missense_Mutation_p.D104N|TRPC3_ENST00000264811.5_Missense_Mutation_p.D104N	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	92					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AGCAGGGCGTCGCCAATGCGC	0.647																																					p.D177N		Atlas-SNP	.											.	TRPC3	201	.	0			c.G529A						.						66.0	57.0	60.0					4																	122853884		2203	4300	6503	SO:0001583	missense	7222	exon2			GGGCGTCGCCAAT	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.529G>A	chr4.hg19:g.122853884C>T	ENSP00000368966:p.Asp177Asn	152.0	0.0		132.0	28.0	NM_001130698	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	hg19	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	C	34	5.311162	0.95629	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.63580	-0.05;-0.05;-0.05	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	L	0.45137	1.4	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.97110	0.881;1.0	T	0.74172	-0.3751	10	0.54805	T	0.06	0.0055	20.3932	0.98965	0.0:1.0:0.0:0.0	.	104;177	E9PCJ9;Q5G1L5	.;.	N	104;177;104	ENSP00000264811:D104N;ENSP00000368966:D177N;ENSP00000426899:D104N	ENSP00000264811:D104N	D	-	1	0	TRPC3	123073334	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.755000	0.85180	2.824000	0.97209	0.655000	0.94253	GAC	.	.		0.647	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
FAM160A1	729830	hgsc.bcm.edu	37	4	152507926	152507926	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr4:152507926T>C	ENST00000505231.1	+	4	1025	c.866T>C	c.(865-867)cTg>cCg	p.L289P	FAM160A1_ENST00000435205.1_Missense_Mutation_p.L289P			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	289										endometrium(2)|kidney(1)	3						ATGAACTCCCTGGAGTTTTGC	0.448																																					p.L289P		Atlas-SNP	.											.	FAM160A1	60	.	0			c.T866C						.						123.0	105.0	110.0					4																	152507926		692	1591	2283	SO:0001583	missense	729830	exon6			ACTCCCTGGAGTT		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.866T>C	chr4.hg19:g.152507926T>C	ENSP00000421580:p.Leu289Pro	103.0	0.0		82.0	11.0	NM_001109977	Q6ZUS2	Missense_Mutation	SNP	ENST00000505231.1	hg19	CCDS47146.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.706472	0.89018	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.47528	0.84;0.84	5.76	5.76	0.90799	.	.	.	.	.	T	0.73442	0.3587	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78871	-0.2033	9	0.87932	D	0	-2.1241	16.1253	0.81392	0.0:0.0:0.0:1.0	.	289	Q05DH4	F16A1_HUMAN	P	289	ENSP00000413196:L289P;ENSP00000421580:L289P	ENSP00000413196:L289P	L	+	2	0	FAM160A1	152727376	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	8.040000	0.89188	2.205000	0.71048	0.477000	0.44152	CTG	.	.		0.448	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1	NM_001109977	
SPEF2	79925	hgsc.bcm.edu	37	5	35704679	35704679	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr5:35704679G>A	ENST00000356031.3	+	17	2576	c.2422G>A	c.(2422-2424)Gct>Act	p.A808T	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Missense_Mutation_p.A803T|SPEF2_ENST00000440995.2_Missense_Mutation_p.A803T	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	808					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTATAAAACTGCTCACGAAGA	0.313																																					p.A808T		Atlas-SNP	.											.	SPEF2	324	.	0			c.G2422A						.						112.0	103.0	106.0					5																	35704679		1824	4075	5899	SO:0001583	missense	79925	exon17			AAAACTGCTCACG	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2422G>A	chr5.hg19:g.35704679G>A	ENSP00000348314:p.Ala808Thr	63.0	0.0		40.0	7.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	hg19	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379416	0.24944	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.31510	3.4;3.25;3.39;1.49	5.76	-11.0	0.00169	.	1.975980	0.01835	N	0.034961	T	0.17662	0.0424	L	0.43152	1.355	0.09310	N	1	B;B;B	0.18610	0.017;0.029;0.017	B;B;B	0.16289	0.006;0.015;0.006	T	0.10636	-1.0621	10	0.19147	T	0.46	.	3.0789	0.06255	0.1595:0.0925:0.3132:0.4347	.	803;803;808	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	T	808;803;803;314	ENSP00000348314:A808T;ENSP00000421593:A803T;ENSP00000412125:A803T;ENSP00000421744:A314T	ENSP00000348314:A808T	A	+	1	0	SPEF2	35740436	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.874000	0.00718	-1.549000	0.01710	-0.293000	0.09583	GCT	.	.		0.313	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
PCDHA3	56145	hgsc.bcm.edu	37	5	140182464	140182464	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr5:140182464A>G	ENST00000522353.2	+	1	1682	c.1682A>G	c.(1681-1683)aAc>aGc	p.N561S	PCDHA3_ENST00000532566.2_Missense_Mutation_p.N561S|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	561	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGAACGACAACGCGCCGGCA	0.682																																					p.N561S		Atlas-SNP	.											.	PCDHA3	396	.	0			c.A1682G						.						91.0	91.0	91.0					5																	140182464		2203	4298	6501	SO:0001583	missense	56145	exon1			ACGACAACGCGCC	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1682A>G	chr5.hg19:g.140182464A>G	ENSP00000429808:p.Asn561Ser	41.0	0.0		133.0	14.0	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	hg19	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	a	16.41	3.114673	0.56505	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.52754	0.65;0.65	4.5	4.5	0.54988	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.45126	U	0.000383	T	0.74129	0.3676	M	0.91459	3.21	0.34191	D	0.672095	D;D	0.89917	0.999;1.0	D;D	0.85130	0.997;0.983	D	0.86083	0.1545	10	0.87932	D	0	.	14.1425	0.65329	1.0:0.0:0.0:0.0	.	561;561	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	S	561	ENSP00000429808:N561S;ENSP00000434086:N561S	ENSP00000429808:N561S	N	+	2	0	PCDHA3	140162648	1.000000	0.71417	1.000000	0.80357	0.367000	0.29736	6.679000	0.74513	1.814000	0.52955	0.254000	0.18369	AAC	.	.		0.682	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
FYN	2534	hgsc.bcm.edu	37	6	112035597	112035597	+	Silent	SNP	A	A	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr6:112035597A>G	ENST00000354650.3	-	5	903	c.297T>C	c.(295-297)gaT>gaC	p.D99D	FYN_ENST00000538466.1_Silent_p.D99D|FYN_ENST00000229471.4_Silent_p.D99D|FYN_ENST00000368667.2_Silent_p.D99D|FYN_ENST00000368678.4_Silent_p.D99D|FYN_ENST00000229470.5_Splice_Site|FYN_ENST00000356013.2_Silent_p.D99D|FYN_ENST00000368682.3_Silent_p.D99D	NM_002037.5	NP_002028.1	P06241	FYN_HUMAN	FYN proto-oncogene, Src family tyrosine kinase	99	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activated T cell proliferation (GO:0050798)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular response to peptide hormone stimulus (GO:0071375)|dendrite morphogenesis (GO:0048813)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|feeding behavior (GO:0007631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|leukocyte migration (GO:0050900)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein localization to nucleus (GO:1900182)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|glycoprotein binding (GO:0001948)|growth factor receptor binding (GO:0070851)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(17)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	30		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	AACTCAGGTCATCTTCTGTCC	0.423																																					p.D99D		Atlas-SNP	.											.	FYN	108	.	0			c.T297C						.						95.0	91.0	93.0					6																	112035597		2203	4300	6503	SO:0001819	synonymous_variant	2534	exon2			CAGGTCATCTTCT	AK056699	CCDS5094.1, CCDS5095.1, CCDS5096.1	6q21	2014-06-25	2014-06-25		ENSG00000010810	ENSG00000010810		"""SH2 domain containing"""	4037	protein-coding gene	gene with protein product		137025	"""FYN oncogene related to SRC, FGR, YES"""			3526330	Standard	NM_002037		Approved	SYN, SLK, MGC45350	uc003pvh.3	P06241	OTTHUMG00000016305	ENST00000354650.3:c.297T>C	chr6.hg19:g.112035597A>G		60.0	0.0		40.0	5.0	NM_153047	B5BU57|E1P557|H0UI48|Q16248|Q5R3A6|Q5R3A7|Q8N5D7	Silent	SNP	ENST00000354650.3	hg19	CCDS5094.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.517835	0.64634	.	.	ENSG00000010810	ENST00000229470	.	.	.	5.77	4.6	0.57074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.477	0.55821	0.8744:0.0:0.0:0.1256	.	.	.	.	.	-1	.	.	.	-	.	.	FYN	112142290	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.351000	0.66022	1.089000	0.41292	0.533000	0.62120	.	.	.		0.423	FYN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043655.1		
TUBE1	51175	hgsc.bcm.edu	37	6	112408489	112408489	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr6:112408489T>A	ENST00000368662.5	-	2	124	c.46A>T	c.(46-48)Atc>Ttc	p.I16F	FAM229B_ENST00000368656.2_5'Flank|FAM229B_ENST00000604268.1_5'Flank|TUBE1_ENST00000604814.1_5'Flank	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	16					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	CAGCAGCCGATCTGGTTTCCG	0.642											OREG0017625	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I16F		Atlas-SNP	.											.	TUBE1	49	.	0			c.A46T						.						14.0	13.0	14.0					6																	112408489		2119	4132	6251	SO:0001583	missense	51175	exon2			AGCCGATCTGGTT	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.46A>T	chr6.hg19:g.112408489T>A	ENSP00000357651:p.Ile16Phe	336.0	0.0	1442	280.0	31.0	NM_016262	Q5H8W8|Q8NEG3	Missense_Mutation	SNP	ENST00000368662.5	hg19	CCDS5100.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.556665	0.86231	.	.	ENSG00000074935	ENST00000368662;ENST00000368657	T	0.73469	-0.75	5.48	5.48	0.80851	Tubulin/FtsZ, GTPase domain (3);	0.218932	0.47852	D	0.000215	D	0.88533	0.6462	H	0.97564	4.03	0.58432	D	0.999998	D	0.59767	0.986	D	0.70227	0.968	D	0.91661	0.5342	10	0.87932	D	0	.	11.0503	0.47882	0.0:0.0748:0.0:0.9252	.	16	Q9UJT0	TBE_HUMAN	F	16	ENSP00000357651:I16F	ENSP00000357646:I16F	I	-	1	0	TUBE1	112515182	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.829000	0.39121	2.219000	0.72066	0.472000	0.43445	ATC	.	.		0.642	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041867.1	NM_016262	
LAMA4	3910	hgsc.bcm.edu	37	6	112435307	112435307	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr6:112435307C>G	ENST00000230538.7	-	38	5695	c.5298G>C	c.(5296-5298)agG>agC	p.R1766S	LAMA4_ENST00000522006.1_Missense_Mutation_p.R1759S|LAMA4_ENST00000389463.4_Missense_Mutation_p.R1759S|LAMA4_ENST00000424408.2_Missense_Mutation_p.R1759S	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1766	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ACACAGGCTCCCTGTGATCAA	0.398																																					p.R1766S		Atlas-SNP	.											.	LAMA4	227	.	0			c.G5298C						.						109.0	104.0	106.0					6																	112435307		2203	4300	6503	SO:0001583	missense	3910	exon38			AGGCTCCCTGTGA		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.5298G>C	chr6.hg19:g.112435307C>G	ENSP00000230538:p.Arg1766Ser	55.0	0.0		54.0	8.0	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	hg19	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465153	0.43839	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.6	3.76	0.43208	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.135590	0.64402	N	0.000003	T	0.46718	0.1407	N	0.25647	0.755	0.80722	D	1	B;B	0.24426	0.103;0.084	B;B	0.25614	0.062;0.037	T	0.47381	-0.9122	10	0.29301	T	0.29	.	7.4671	0.27328	0.0:0.7175:0.1416:0.1409	.	1766;1759	Q16363;Q16363-2	LAMA4_HUMAN;.	S	1766;1759;1759;1759	ENSP00000230538:R1766S;ENSP00000429488:R1759S;ENSP00000374114:R1759S;ENSP00000416470:R1759S	ENSP00000230538:R1766S	R	-	3	2	LAMA4	112542000	0.980000	0.34600	1.000000	0.80357	0.996000	0.88848	0.152000	0.16302	1.468000	0.48064	0.655000	0.94253	AGG	.	.		0.398	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
AMZ1	155185	hgsc.bcm.edu	37	7	2740124	2740124	+	Silent	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:2740124G>A	ENST00000312371.4	+	2	407	c.39G>A	c.(37-39)ggG>ggA	p.G13G	AMZ1_ENST00000407112.1_Silent_p.G13G	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	13							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		TCAGCTTCGGGCCCCGGGCCT	0.692																																					p.G13G		Atlas-SNP	.											.	AMZ1	41	.	0			c.G39A						.						61.0	67.0	65.0					7																	2740124		2203	4300	6503	SO:0001819	synonymous_variant	155185	exon2			CTTCGGGCCCCGG	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.39G>A	chr7.hg19:g.2740124G>A		55.0	0.0		62.0	13.0	NM_133463	B3KRS0|Q8TF51	Silent	SNP	ENST00000312371.4	hg19	CCDS34589.1																																																																																			.	.		0.692	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
SDK1	221935	hgsc.bcm.edu	37	7	4285345	4285345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:4285345T>C	ENST00000404826.2	+	44	6428	c.6289T>C	c.(6289-6291)Tca>Cca	p.S2097P	SDK1_ENST00000389531.3_Missense_Mutation_p.S2077P|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2097					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCTGCACTACTCAGACGAGGA	0.607																																					p.S2097P		Atlas-SNP	.											.	SDK1	361	.	0			c.T6289C						.						71.0	63.0	66.0					7																	4285345		2203	4300	6503	SO:0001583	missense	221935	exon44			CACTACTCAGACG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6289T>C	chr7.hg19:g.4285345T>C	ENSP00000385899:p.Ser2097Pro	157.0	0.0		140.0	17.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.905832	0.92107	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.73681	-0.76;-0.77	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000004	D	0.86581	0.5967	M	0.83012	2.62	0.53688	D	0.999977	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.994;0.998;0.99;0.997	D	0.88628	0.3167	10	0.87932	D	0	.	13.8091	0.63252	0.0:0.0:0.0:1.0	.	2077;157;584;2097	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	P	2097;345;2077	ENSP00000385899:S2097P;ENSP00000374182:S2077P	ENSP00000374182:S2077P	S	+	1	0	SDK1	4251871	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.480000	0.81109	1.992000	0.58205	0.533000	0.62120	TCA	.	.		0.607	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
HOXA3	3200	hgsc.bcm.edu	37	7	27148273	27148273	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:27148273T>C	ENST00000396352.4	-	3	792	c.593A>G	c.(592-594)tAc>tGc	p.Y198C	HOXA3_ENST00000317201.2_Missense_Mutation_p.Y198C|HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	198					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CGCGCTCGTGTAGGCCGTGCG	0.667																																					p.Y198C	Esophageal Squamous(136;1368 1743 5685 7935 50360)	Atlas-SNP	.											.	HOXA3	62	.	0			c.A593G						.						49.0	50.0	50.0					7																	27148273		2203	4300	6503	SO:0001583	missense	3200	exon3			CTCGTGTAGGCCG		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.593A>G	chr7.hg19:g.27148273T>C	ENSP00000379640:p.Tyr198Cys	39.0	0.0		55.0	8.0	NM_030661	A4D181	Missense_Mutation	SNP	ENST00000396352.4	hg19	CCDS5404.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.987286	0.53934	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000396350	D;D	0.96365	-3.99;-3.99	5.03	5.03	0.67393	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.113080	0.64402	D	0.000007	D	0.98466	0.9489	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99694	1.1002	10	0.87932	D	0	.	14.9447	0.71020	0.0:0.0:0.0:1.0	.	198	O43365	HXA3_HUMAN	C	198;198;40	ENSP00000379640:Y198C;ENSP00000324884:Y198C	ENSP00000324884:Y198C	Y	-	2	0	HOXA3	27114798	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.011000	0.70760	2.118000	0.64928	0.533000	0.62120	TAC	.	.		0.667	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2		
CCDC129	223075	hgsc.bcm.edu	37	7	31683502	31683502	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:31683502C>A	ENST00000407970.3	+	11	2556	c.2518C>A	c.(2518-2520)Cag>Aag	p.Q840K	CCDC129_ENST00000451887.2_Missense_Mutation_p.Q866K|CCDC129_ENST00000319386.3_Missense_Mutation_p.Q692K|CCDC129_ENST00000409210.1_Missense_Mutation_p.Q748K	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	840										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AACTGGTCACCAGGAAGCCCA	0.547																																					p.Q866K		Atlas-SNP	.											.	CCDC129	127	.	0			c.C2596A						.						79.0	74.0	76.0					7																	31683502		2203	4300	6503	SO:0001583	missense	223075	exon11			GGTCACCAGGAAG	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2518C>A	chr7.hg19:g.31683502C>A	ENSP00000384416:p.Gln840Lys	57.0	0.0		75.0	11.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	hg19	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	C	0.046	-1.265142	0.01433	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.56	1.72	0.24424	.	1.779550	0.03023	N	0.151011	T	0.18800	0.0451	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.12013	0.005;0.002;0.002;0.002	B;B;B;B	0.13407	0.006;0.003;0.003;0.009	T	0.16630	-1.0396	10	0.07030	T	0.85	2.9476	4.5407	0.12056	0.1534:0.6:0.0:0.2466	.	866;850;840;692	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	K	692;840;866;850;748	ENSP00000313062:Q692K;ENSP00000384416:Q840K;ENSP00000395835:Q866K;ENSP00000387214:Q748K	ENSP00000313062:Q692K	Q	+	1	0	CCDC129	31650027	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.013000	0.29937	0.102000	0.17638	-0.742000	0.03525	CAG	.	.		0.547	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
GIGYF1	64599	hgsc.bcm.edu	37	7	100284048	100284048	+	Missense_Mutation	SNP	G	G	T	rs542492951		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:100284048G>T	ENST00000275732.5	-	8	1912	c.703C>A	c.(703-705)Ccc>Acc	p.P235T	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	235					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GCAGAGCGGGGACCACCATCT	0.632																																					p.P235T		Atlas-SNP	.											.	GIGYF1	113	.	0			c.C703A						.						40.0	39.0	39.0					7																	100284048		2181	4252	6433	SO:0001583	missense	64599	exon8			AGCGGGGACCACC	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.703C>A	chr7.hg19:g.100284048G>T	ENSP00000275732:p.Pro235Thr	50.0	0.0		60.0	5.0	NM_022574	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	hg19	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.108888	0.77096	.	.	ENSG00000146830	ENST00000275732	D	0.84730	-1.89	5.15	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.82130	0.4970	L	0.54323	1.7	0.80722	D	1	P	0.48589	0.912	P	0.45310	0.476	T	0.78558	-0.2158	10	0.20519	T	0.43	-18.0463	11.3205	0.49419	0.0876:0.0:0.9124:0.0	.	235	O75420	PERQ1_HUMAN	T	235	ENSP00000275732:P235T	ENSP00000275732:P235T	P	-	1	0	GIGYF1	100121984	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	9.604000	0.98317	1.401000	0.46761	0.563000	0.77884	CCC	.	.		0.632	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
MUC12	10071	hgsc.bcm.edu	37	7	100646199	100646199	+	Missense_Mutation	SNP	T	T	C	rs181671450	byFrequency	TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:100646199T>C	ENST00000379442.3	+	5	12784	c.12784T>C	c.(12784-12786)Ttt>Ctt	p.F4262L	MUC12_ENST00000536621.1_Missense_Mutation_p.F4119L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4262	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AACAACACACTTTTCTGCCAG	0.552													T|||	1164	0.232428	0.2829	0.1571	5008	,	,		41858	0.2063		0.2624	False		,,,				2504	0.2137				p.F4119L		Atlas-SNP	.											MUC12,NS,carcinoma,0,1	MUC12	140	.	0			c.T12355C						.						8.0	10.0	9.0					7																	100646199		491	1071	1562	SO:0001583	missense	10071	exon2			ACACACTTTTCTG	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12784T>C	chr7.hg19:g.100646199T>C	ENSP00000368755:p.Phe4262Leu	2.0	1.0		13.0	6.0	NM_001164462	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	ENST00000379442.3	hg19		.	.	.	.	.	.	.	.	.	.	T	4.831	0.154453	0.09236	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11712	2.75;2.75	0.53	0.53	0.17102	.	.	.	.	.	T	0.04679	0.0127	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.41645	-0.9497	6	0.20519	T	0.43	.	5.2833	0.15688	0.0:1.0E-4:0.0:0.9999	.	.	.	.	L	4262;4119	ENSP00000368755:F4262L;ENSP00000441929:F4119L	ENSP00000368755:F4262L	F	+	1	0	MUC12	100432919	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.028000	0.12350	0.435000	0.26365	0.164000	0.16699	TTT	.	C|1.000;|0.000		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347234.1	XM_379904	
EPHA1	2041	hgsc.bcm.edu	37	7	143096483	143096483	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:143096483T>A	ENST00000275815.3	-	5	945	c.859A>T	c.(859-861)Atg>Ttg	p.M287L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	287	Cys-rich.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TCCATGTCCATCCGGTAGGAG	0.592																																					p.M287L		Atlas-SNP	.											.	EPHA1	193	.	0			c.A859T						.						42.0	36.0	38.0					7																	143096483		2203	4300	6503	SO:0001583	missense	2041	exon5			TGTCCATCCGGTA	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.859A>T	chr7.hg19:g.143096483T>A	ENSP00000275815:p.Met287Leu	144.0	0.0		144.0	44.0	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	hg19	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	T	8.001	0.755414	0.15846	.	.	ENSG00000146904	ENST00000275815	D	0.97186	-4.28	5.22	-0.761	0.11038	Growth factor, receptor (1);	1.983880	0.02089	N	0.052968	D	0.91290	0.7254	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.84449	0.0587	10	0.87932	D	0	.	4.208	0.10498	0.1061:0.5117:0.1488:0.2334	.	287	P21709	EPHA1_HUMAN	L	287	ENSP00000275815:M287L	ENSP00000275815:M287L	M	-	1	0	EPHA1	142806605	0.000000	0.05858	0.005000	0.12908	0.045000	0.14185	0.073000	0.14640	-0.024000	0.13941	0.533000	0.62120	ATG	.	.		0.592	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
OR2A2	442361	hgsc.bcm.edu	37	7	143807041	143807041	+	Nonsense_Mutation	SNP	T	T	A	rs201869620		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr7:143807041T>A	ENST00000408979.2	+	1	435	c.366T>A	c.(364-366)taT>taA	p.Y122*		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					ATGATAGGTATGTGGCCATCT	0.483																																					p.Y122X		Atlas-SNP	.											.	OR2A2	48	.	0			c.T366A						.						184.0	171.0	175.0					7																	143807041		2109	4264	6373	SO:0001587	stop_gained	442361	exon1			TAGGTATGTGGCC		CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.366T>A	chr7.hg19:g.143807041T>A	ENSP00000386209:p.Tyr122*	143.0	0.0		159.0	21.0	NM_001005480	B2RN85|Q8NGT6	Nonsense_Mutation	SNP	ENST00000408979.2	hg19	CCDS43671.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588865	0.46110	.	.	ENSG00000221989	ENST00000408979	.	.	.	3.61	-5.37	0.02681	.	0.597987	0.12654	U	0.450208	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5284	11.4922	0.50387	0.0:0.5836:0.0:0.4164	.	.	.	.	X	122	.	ENSP00000386209:Y122X	Y	+	3	2	OR2A2	143437974	0.001000	0.12720	0.083000	0.20561	0.466000	0.32739	-1.711000	0.01886	-1.305000	0.02327	-0.315000	0.08773	TAT	.	T|0.999;C|0.001		0.483	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349978.1		
BLK	640	hgsc.bcm.edu	37	8	11420535	11420535	+	Missense_Mutation	SNP	G	G	A	rs376140772		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr8:11420535G>A	ENST00000259089.4	+	12	1820	c.1228G>A	c.(1228-1230)Ggg>Agg	p.G410R	BLK_ENST00000529894.1_Missense_Mutation_p.G339R	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	410	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CATCCACTTCGGGGTCTTCAC	0.607																																					p.G410R		Atlas-SNP	.											.	BLK	78	.	0			c.G1228A						.	G	ARG/GLY	0,4406		0,0,2203	98.0	77.0	84.0		1228	4.2	0.9	8		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	BLK	NM_001715.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	410/506	11420535	1,13005	2203	4300	6503	SO:0001583	missense	640	exon12			CACTTCGGGGTCT	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.1228G>A	chr8.hg19:g.11420535G>A	ENSP00000259089:p.Gly410Arg	152.0	0.0		172.0	32.0	NM_001715	Q16291|Q96IN1	Missense_Mutation	SNP	ENST00000259089.4	hg19	CCDS5982.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441544	0.83993	0.0	1.16E-4	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894;ENST00000526097	D;D	0.82526	-1.62;-1.62	4.22	4.22	0.49857	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43919	D	0.000508	D	0.84275	0.5436	N	0.16708	0.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87386	0.2360	10	0.87932	D	0	.	16.1153	0.81302	0.0:0.0:1.0:0.0	.	246;410	E9PM44;P51451	.;BLK_HUMAN	R	410;410;339;246	ENSP00000259089:G410R;ENSP00000433663:G339R	ENSP00000259089:G410R	G	+	1	0	BLK	11457944	1.000000	0.71417	0.914000	0.36105	0.654000	0.38779	9.312000	0.96287	2.325000	0.78763	0.455000	0.32223	GGG	.	.		0.607	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1		
SLC39A14	23516	hgsc.bcm.edu	37	8	22273745	22273745	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr8:22273745A>G	ENST00000381237.1	+	7	1218	c.1099A>G	c.(1099-1101)Atc>Gtc	p.I367V	SLC39A14_ENST00000240095.6_Missense_Mutation_p.I367V|SLC39A14_ENST00000359741.5_Missense_Mutation_p.I367V|SLC39A14_ENST00000289952.5_Missense_Mutation_p.I367V	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	367					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		TTTCCAAGGCATCAGCACCTC	0.587																																					p.I367V		Atlas-SNP	.											.	SLC39A14	59	.	0			c.A1099G						.						112.0	100.0	104.0					8																	22273745		2203	4300	6503	SO:0001583	missense	23516	exon7			CAAGGCATCAGCA	D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.1099A>G	chr8.hg19:g.22273745A>G	ENSP00000370635:p.Ile367Val	140.0	0.0		147.0	23.0	NM_001135153	A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	ENST00000381237.1	hg19	CCDS47823.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.624006	0.46840	.	.	ENSG00000104635	ENST00000359741;ENST00000240095;ENST00000381237;ENST00000289952;ENST00000517370	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.99	5.99	0.97316	.	0.151633	0.64402	D	0.000012	T	0.38878	0.1057	L	0.28192	0.835	0.44295	D	0.997163	B;B;B	0.31893	0.081;0.198;0.345	B;B;B	0.33392	0.051;0.074;0.163	T	0.29427	-1.0012	10	0.29301	T	0.29	-41.9697	9.8955	0.41316	0.9236:0.0:0.0764:0.0	.	367;367;367	Q15043-2;Q15043;B6EU88	.;S39AE_HUMAN;.	V	367;367;367;367;190	ENSP00000352779:I367V;ENSP00000240095:I367V;ENSP00000370635:I367V;ENSP00000289952:I367V;ENSP00000427981:I190V	ENSP00000240095:I367V	I	+	1	0	SLC39A14	22329690	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.627000	0.54252	2.291000	0.77112	0.533000	0.62120	ATC	.	.		0.587	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215039.2	XM_046677	
FNTA	2339	hgsc.bcm.edu	37	8	42911627	42911627	+	Silent	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr8:42911627C>T	ENST00000302279.3	+	1	332	c.138C>T	c.(136-138)gcC>gcT	p.A46A	FNTA_ENST00000529687.1_5'Flank|FNTA_ENST00000524546.1_3'UTR|RP11-598P20.5_ENST00000534420.1_Intron|FNTA_ENST00000342116.4_Silent_p.A46A	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	46					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			CTGGGGAAGCCGTGGCGTCCC	0.741																																					p.A46A		Atlas-SNP	.											.	FNTA	34	.	0			c.C138T						.						12.0	12.0	12.0					8																	42911627		2173	4256	6429	SO:0001819	synonymous_variant	2339	exon1			GGAAGCCGTGGCG	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.138C>T	chr8.hg19:g.42911627C>T		33.0	0.0		52.0	14.0	NM_002027	A6NJW0|Q53XJ9|Q9UDC1	Silent	SNP	ENST00000302279.3	hg19	CCDS6140.1																																																																																			.	.		0.741	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383178.1	NM_002027	
ZFHX4	79776	hgsc.bcm.edu	37	8	77767616	77767616	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr8:77767616A>C	ENST00000521891.2	+	10	8907	c.8459A>C	c.(8458-8460)aAc>aCc	p.N2820T	ZFHX4_ENST00000050961.6_Missense_Mutation_p.N2775T|ZFHX4_ENST00000518282.1_Missense_Mutation_p.N2794T|ZFHX4_ENST00000455469.2_Missense_Mutation_p.N2775T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2775					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GACGAGGGAAACACTGAAATG	0.483										HNSCC(33;0.089)																											p.N2820T		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A8459C						.						56.0	56.0	56.0					8																	77767616		1959	4154	6113	SO:0001583	missense	79776	exon10			AGGGAAACACTGA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8459A>C	chr8.hg19:g.77767616A>C	ENSP00000430497:p.Asn2820Thr	82.0	0.0		43.0	11.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	0.220	-1.029708	0.02045	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.61859	0.07;0.16;0.13;0.11	5.13	1.29	0.21616	.	0.801294	0.10398	U	0.679569	T	0.60547	0.2277	L	0.55990	1.75	0.09310	N	1	B;B;B	0.23591	0.053;0.088;0.063	B;B;B	0.38683	0.144;0.279;0.128	T	0.59337	-0.7473	10	0.46703	T	0.11	.	12.8967	0.58104	0.5955:0.4045:0.0:0.0	.	2775;2775;2820	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	T	2820;2804;2775;2775;2794	ENSP00000430497:N2820T;ENSP00000399605:N2775T;ENSP00000050961:N2775T;ENSP00000430848:N2794T	ENSP00000050961:N2775T	N	+	2	0	ZFHX4	77930171	1.000000	0.71417	0.000000	0.03702	0.015000	0.08874	5.986000	0.70563	0.067000	0.16545	-0.488000	0.04728	AAC	.	.		0.483	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
REXO1L1P	254958	hgsc.bcm.edu	37	8	86573858	86573858	+	Silent	SNP	G	G	A	rs145542023		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr8:86573858G>A	ENST00000379010.2	-	1	1868	c.1869C>T	c.(1867-1869)gcC>gcT	p.A623A		NM_172239.4	NP_758439.4														endometrium(1)|lung(4)	5						CCAGGTAGTCGGCCGCGAGAT	0.637																																					p.A623A		Atlas-SNP	.											REXO1L1_ENST00000379010,NS,carcinoma,0,2	REXO1L1	28	.	0			c.C1869T						.						2.0	2.0	2.0					8																	86573858		897	2027	2924	SO:0001819	synonymous_variant	254958	exon1			GTAGTCGGCCGCG																												ENST00000379010.2:c.1869C>T	chr8.hg19:g.86573858G>A		11.0	1.0		50.0	9.0	NM_172239		Silent	SNP	ENST00000379010.2	hg19																																																																																				.	.		0.637	REXO1L1-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000381106.1		
LRRC69	100130742	hgsc.bcm.edu	37	8	92114903	92114903	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr8:92114903T>C	ENST00000448384.2	+	1	14	c.14T>C	c.(13-15)tTg>tCg	p.L5S	LRRC69_ENST00000343709.3_Missense_Mutation_p.L5S	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	5										endometrium(1)	1						ACTGAGAGATTGTTAATAAAA	0.358																																					p.L5S		Atlas-SNP	.											.	LRRC69	24	.	0			c.T14C						.						144.0	118.0	126.0					8																	92114903		692	1591	2283	SO:0001583	missense	100130742	exon1			AGAGATTGTTAAT	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.14T>C	chr8.hg19:g.92114903T>C	ENSP00000400803:p.Leu5Ser	48.0	0.0		58.0	9.0	NM_001129890		Missense_Mutation	SNP	ENST00000448384.2	hg19		.	.	.	.	.	.	.	.	.	.	T	11.79	1.742365	0.30865	.	.	ENSG00000214954	ENST00000518304;ENST00000343709;ENST00000448384	T;T	0.57595	0.77;0.39	5.11	5.11	0.69529	.	0.171355	0.27253	U	0.020207	T	0.66436	0.2789	M	0.67953	2.075	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.984;0.99	T	0.58109	-0.7694	10	0.21540	T	0.41	-6.2469	11.4722	0.50275	0.0:0.0:0.0:1.0	.	5;5	Q6ZNQ3;Q6ZNQ3-2	LRC69_HUMAN;.	S	5	ENSP00000343221:L5S;ENSP00000400803:L5S	ENSP00000343221:L5S	L	+	2	0	LRRC69	92184079	0.997000	0.39634	0.082000	0.20525	0.708000	0.40852	3.387000	0.52501	2.281000	0.76405	0.533000	0.62120	TTG	.	.		0.358	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000415207.1	NM_001129890	
CISD1	55847	hgsc.bcm.edu	37	10	60037077	60037077	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr10:60037077A>T	ENST00000333926.5	+	2	448	c.232A>T	c.(232-234)Aaa>Taa	p.K78*	CISD1_ENST00000488388.2_3'UTR	NM_018464.4	NP_060934.1	Q9NZ45	CISD1_HUMAN	CDGSH iron sulfur domain 1	78					regulation of cellular respiration (GO:0043457)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)			breast(1)	1						TTGGAGGTCCAAAAAGGTGAG	0.363																																					p.K78X		Atlas-SNP	.											.	CISD1	7	.	0			c.A232T						.						56.0	50.0	52.0					10																	60037077		2203	4300	6503	SO:0001587	stop_gained	55847	exon2			AGGTCCAAAAAGG	AY960578	CCDS7251.1	10q21.3	2011-01-05	2007-08-10	2007-08-10	ENSG00000122873	ENSG00000122873		"""CDGSH iron sulfur domain containing"""	30880	protein-coding gene	gene with protein product		611932	"""chromosome 10 open reading frame 70"", ""zinc finger, CDGSH-type domain 1"""	C10orf70, ZCD1		17376863, 17584744	Standard	NM_018464		Approved	MDS029, mitoNEET	uc001jkc.5	Q9NZ45	OTTHUMG00000018266	ENST00000333926.5:c.232A>T	chr10.hg19:g.60037077A>T	ENSP00000363041:p.Lys78*	217.0	0.0		181.0	28.0	NM_018464	Q1X902	Nonsense_Mutation	SNP	ENST00000333926.5	hg19	CCDS7251.1	.	.	.	.	.	.	.	.	.	.	A	38	7.116879	0.98074	.	.	ENSG00000122873	ENST00000333926	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.8936	14.3757	0.66874	1.0:0.0:0.0:0.0	.	.	.	.	X	78	.	ENSP00000363041:K78X	K	+	1	0	CISD1	59707083	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.958000	0.87877	2.279000	0.76181	0.533000	0.62120	AAA	.	.		0.363	CISD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048137.1	NM_018464	
TNKS2	80351	hgsc.bcm.edu	37	10	93558647	93558647	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr10:93558647G>T	ENST00000371627.4	+	1	578		c.e1+1		TNKS2-AS1_ENST00000432246.1_RNA|TNKS2-AS1_ENST00000432938.1_RNA	NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2						multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				TTCGCCGCAGGTAACCGGGGC	0.677																																					.		Atlas-SNP	.											.	TNKS2	103	.	0			c.199+1G>T						.						10.0	12.0	11.0					10																	93558647		2107	4161	6268	SO:0001630	splice_region_variant	80351	exon1			CCGCAGGTAACCG	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.199+1G>T	chr10.hg19:g.93558647G>T		67.0	0.0		75.0	12.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Splice_Site	SNP	ENST00000371627.4	hg19	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223708	0.95139	.	.	ENSG00000107854	ENST00000371627	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7371	0.88396	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNKS2	93548627	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.952000	0.93031	2.513000	0.84729	0.561000	0.74099	.	.	.		0.677	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	Intron
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643105	1643105	+	Silent	SNP	G	G	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr11:1643105G>C	ENST00000399682.1	-	1	263	c.219C>G	c.(217-219)tcC>tcG	p.S73S		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.S73S(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGCCCCCACAGGAGCCACAGC	0.667																																					p.S73S		Atlas-SNP	.											KRTAP5-4,NS,carcinoma,0,1	KRTAP5-4	78	.	1	Substitution - coding silent(1)	lung(1)	c.C219G						.						7.0	15.0	12.0					11																	1643105		657	1539	2196	SO:0001819	synonymous_variant	387267	exon1			CCCACAGGAGCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.219C>G	chr11.hg19:g.1643105G>C		96.0	1.0		121.0	7.0	NM_001012709		Silent	SNP	ENST00000399682.1	hg19																																																																																				.	.		0.667	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
OR51D1	390038	hgsc.bcm.edu	37	11	4661048	4661048	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr11:4661048A>G	ENST00000357605.2	+	1	104	c.28A>G	c.(28-30)Atc>Gtc	p.I10V		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTGGTCCCTATCATAGCCAC	0.483																																					p.I10V		Atlas-SNP	.											.	OR51D1	49	.	0			c.A28G						.						145.0	139.0	141.0					11																	4661048		2201	4298	6499	SO:0001583	missense	390038	exon1			GTCCCTATCATAG	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.28A>G	chr11.hg19:g.4661048A>G	ENSP00000350222:p.Ile10Val	79.0	0.0		50.0	8.0	NM_001004751	B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	hg19	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.513722	0.00975	.	.	ENSG00000197428	ENST00000357605	T	0.00003	9.84	4.59	-2.29	0.06805	.	1.292380	0.05750	N	0.602973	T	0.00039	0.0001	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.01188	-1.1424	10	0.08837	T	0.75	.	4.4669	0.11694	0.3978:0.3084:0.2937:0.0	.	10	Q8NGF3	O51D1_HUMAN	V	10	ENSP00000350222:I10V	ENSP00000350222:I10V	I	+	1	0	OR51D1	4617624	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.645000	0.05409	-0.281000	0.09141	-1.229000	0.01577	ATC	.	.		0.483	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
OR51T1	401665	hgsc.bcm.edu	37	11	4903313	4903313	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr11:4903313T>A	ENST00000322049.1	+	1	184	c.184T>A	c.(184-186)Tat>Aat	p.Y62N	MMP26_ENST00000380390.1_Intron|OR51T1_ENST00000380378.1_Missense_Mutation_p.Y89N|MMP26_ENST00000477339.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAAACCCATGTATTATTTCCT	0.478																																					p.Y89N		Atlas-SNP	.											.	OR51T1	92	.	0			c.T265A						.						192.0	174.0	180.0					11																	4903313		2201	4298	6499	SO:0001583	missense	401665	exon1			CCCATGTATTATT	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.184T>A	chr11.hg19:g.4903313T>A	ENSP00000322679:p.Tyr62Asn	97.0	0.0		79.0	16.0	NM_001004759	Q6IFH9	Missense_Mutation	SNP	ENST00000322049.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.61	3.170651	0.57584	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.15603	2.41;2.41	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36628	N	0.002493	T	0.59851	0.2224	H	0.99182	4.46	0.53688	D	0.999975	D	0.89917	1.0	D	0.97110	1.0	T	0.76618	-0.2893	10	0.87932	D	0	.	12.5837	0.56406	0.0:0.0:0.0:1.0	.	62	Q8NGJ9	O51T1_HUMAN	N	89;62	ENSP00000369738:Y89N;ENSP00000322679:Y62N	ENSP00000322679:Y62N	Y	+	1	0	OR51T1	4859889	1.000000	0.71417	1.000000	0.80357	0.422000	0.31414	6.059000	0.71133	1.838000	0.53458	0.397000	0.26171	TAT	.	.		0.478	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759	
NAALADL1	10004	hgsc.bcm.edu	37	11	64820704	64820704	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr11:64820704G>A	ENST00000358658.3	-	8	1211	c.1184C>T	c.(1183-1185)aCc>aTc	p.T395I	NAALADL1_ENST00000355721.3_Missense_Mutation_p.T354I|NAALADL1_ENST00000340252.4_Missense_Mutation_p.T446I|NAALADL1_ENST00000355369.2_Missense_Mutation_p.T395I|NAALADL1_ENST00000356632.3_Missense_Mutation_p.T360I|NAALADL1_ENST00000339885.2_Missense_Mutation_p.T395I	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	395	NAALADase.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						CTTCAGCAGGGTCCCCAGGAC	0.677																																					p.T395I		Atlas-SNP	.											.	NAALADL1	58	.	0			c.C1184T						.						15.0	13.0	14.0					11																	64820704		2146	4210	6356	SO:0001583	missense	10004	exon8			AGCAGGGTCCCCA	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.1184C>T	chr11.hg19:g.64820704G>A	ENSP00000351484:p.Thr395Ile	191.0	0.0		206.0	31.0	NM_005468	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Missense_Mutation	SNP	ENST00000358658.3	hg19	CCDS31604.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.348152	0.61183	.	.	ENSG00000168060	ENST00000358658;ENST00000355369;ENST00000339885;ENST00000453486;ENST00000340252;ENST00000355721;ENST00000356632	T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04	4.38	4.38	0.52667	Peptidase M28 (1);	1.058390	0.07396	N	0.889930	T	0.54935	0.1889	M	0.69823	2.125	0.36556	D	0.872157	P	0.39311	0.667	P	0.45232	0.474	T	0.58160	-0.7685	10	0.59425	D	0.04	-41.2916	14.4677	0.67494	0.0:0.0:1.0:0.0	.	395	Q9UQQ1	NALDL_HUMAN	I	395;395;395;395;446;354;360	ENSP00000351484:T395I;ENSP00000347530:T395I;ENSP00000340111:T395I;ENSP00000344244:T446I;ENSP00000347955:T354I;ENSP00000349045:T360I	ENSP00000340111:T395I	T	-	2	0	NAALADL1	64577280	0.978000	0.34361	1.000000	0.80357	0.976000	0.68499	1.144000	0.31565	2.265000	0.75225	0.655000	0.94253	ACC	.	.		0.677	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123489506	123489506	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr11:123489506A>T	ENST00000529750.1	+	18	2334	c.2007A>T	c.(2005-2007)gaA>gaT	p.E669D	GRAMD1B_ENST00000450171.2_Missense_Mutation_p.E356D|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.E669D|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.E676D	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	669						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GGCTCCAAGAAAGGTAATCCT	0.557																																					p.E669D		Atlas-SNP	.											.	GRAMD1B	122	.	0			c.A2007T						.						44.0	46.0	46.0					11																	123489506		2053	4196	6249	SO:0001583	missense	57476	exon18			CCAAGAAAGGTAA	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.2007A>T	chr11.hg19:g.123489506A>T	ENSP00000436500:p.Glu669Asp	102.0	0.0		98.0	16.0	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	hg19	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.675970	0.29783	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000450171	T;T;T;T;T	0.48522	1.84;1.84;1.84;1.84;0.81	4.83	-0.351	0.12602	.	0.242826	0.40469	N	0.001083	T	0.26774	0.0655	N	0.21194	0.64	0.58432	D	0.999999	B;B;B;B	0.14805	0.002;0.011;0.0;0.001	B;B;B;B	0.16722	0.005;0.016;0.002;0.002	T	0.03221	-1.1059	10	0.32370	T	0.25	.	5.7251	0.18008	0.3925:0.3943:0.2132:0.0	.	625;356;669;676	B7Z4N9;Q3KR37-3;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	D	676;676;669;669;629;356	ENSP00000402457:E676D;ENSP00000325628:E669D;ENSP00000436500:E669D;ENSP00000432987:E629D;ENSP00000388458:E356D	ENSP00000325628:E669D	E	+	3	2	GRAMD1B	122994716	0.995000	0.38212	1.000000	0.80357	0.942000	0.58702	0.342000	0.19926	0.285000	0.22329	0.374000	0.22700	GAA	.	.		0.557	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
SPATS2	65244	hgsc.bcm.edu	37	12	49919817	49919817	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr12:49919817A>G	ENST00000553127.1	+	15	1930	c.1417A>G	c.(1417-1419)Atg>Gtg	p.M473V	SPATS2_ENST00000552918.1_Missense_Mutation_p.M473V|SPATS2_ENST00000321898.6_Missense_Mutation_p.M473V			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	473						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						GCATGACAGTATGGGTCGTTA	0.512																																					p.M473V		Atlas-SNP	.											.	SPATS2	43	.	0			c.A1417G						.						149.0	120.0	130.0					12																	49919817		2203	4300	6503	SO:0001583	missense	65244	exon14			GACAGTATGGGTC	AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.1417A>G	chr12.hg19:g.49919817A>G	ENSP00000448228:p.Met473Val	309.0	0.0		231.0	49.0	NM_023071	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	ENST00000553127.1	hg19	CCDS31794.1	.	.	.	.	.	.	.	.	.	.	A	5.619	0.298877	0.10622	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	4.8	-0.7	0.11273	.	1.755980	0.02754	N	0.117782	T	0.17109	0.0411	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19192	-1.0313	9	0.12430	T	0.62	5.7897	8.9139	0.35570	0.5259:0.0:0.4741:0.0	.	473	Q86XZ4	SPAS2_HUMAN	V	473	.	ENSP00000326841:M473V	M	+	1	0	SPATS2	48206084	0.002000	0.14202	0.245000	0.24217	0.744000	0.42396	-0.164000	0.09983	-0.008000	0.14320	-0.483000	0.04790	ATG	.	.		0.512	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404023.1	NM_023071	
ASIC1	41	hgsc.bcm.edu	37	12	50473752	50473752	+	Silent	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr12:50473752C>T	ENST00000447966.2	+	8	1348	c.1119C>T	c.(1117-1119)ggC>ggT	p.G373G	ASIC1_ENST00000228468.4_Silent_p.G373G|ASIC1_ENST00000552438.1_Silent_p.G407G	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	373					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	CCCGCTATGGCAAAGAGCTGT	0.532																																					p.G407G		Atlas-SNP	.											.	.	.	.	0			c.C1221T						.						167.0	141.0	149.0					12																	50473752		2203	4300	6503	SO:0001819	synonymous_variant	41	exon6			CTATGGCAAAGAG	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.1119C>T	chr12.hg19:g.50473752C>T		325.0	0.0		324.0	53.0	NM_001256830	A3KN86|E5KBL7|P78349|Q96CV2	Silent	SNP	ENST00000447966.2	hg19	CCDS44876.1	.	.	.	.	.	.	.	.	.	.	C	9.786	1.176565	0.21704	.	.	ENSG00000110881	ENST00000453327	.	.	.	4.74	3.79	0.43588	.	.	.	.	.	T	0.69079	0.3071	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67352	-0.5692	4	.	.	.	-18.821	14.5079	0.67764	0.0:0.7524:0.2476:0.0	.	.	.	.	V	241	.	.	A	+	2	0	ACCN2	48760019	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.092000	0.30927	2.653000	0.90120	0.561000	0.74099	GCA	.	.		0.532	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039	
RAB3IP	117177	hgsc.bcm.edu	37	12	70206599	70206599	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr12:70206599G>A	ENST00000247833.7	+	9	1548	c.1172G>A	c.(1171-1173)aGa>aAa	p.R391K	RAB3IP_ENST00000325555.9_Missense_Mutation_p.R185K|AC025263.3_ENST00000550437.1_Missense_Mutation_p.R32K|RAB3IP_ENST00000553099.1_Missense_Mutation_p.R185K|RAB3IP_ENST00000483530.2_Intron|RAB3IP_ENST00000550847.1_Missense_Mutation_p.R98K|RAB3IP_ENST00000362025.5_Intron|RAB3IP_ENST00000551641.1_Missense_Mutation_p.R185K|RAB3IP_ENST00000550536.1_Missense_Mutation_p.R407K					RAB3A interacting protein											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			TGTAAACACAGAATTAAATTA	0.333																																					p.R407K		Atlas-SNP	.											.	RAB3IP	48	.	0			c.G1220A						.						82.0	88.0	86.0					12																	70206599		2203	4300	6503	SO:0001583	missense	117177	exon9			AACACAGAATTAA		CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000247833.7:c.1172G>A	chr12.hg19:g.70206599G>A	ENSP00000247833:p.Arg391Lys	116.0	0.0		75.0	13.0	NM_175623		Missense_Mutation	SNP	ENST00000247833.7	hg19	CCDS8995.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.082839|5.082839	0.94050|0.94050	.|.	.|.	ENSG00000127328|ENSG00000127328	ENST00000526994|ENST00000247833;ENST00000325555;ENST00000550536;ENST00000551641;ENST00000553099;ENST00000550847	.|T;T;T;T;T;T	.|0.51071	.|0.72;0.72;0.72;0.72;0.72;0.72	6.01|6.01	5.1|5.1	0.69264|0.69264	.|.	.|0.042490	.|0.85682	.|D	.|0.000000	T|T	0.54447|0.54447	0.1859|0.1859	M|M	0.88310|0.88310	2.945|2.945	0.58432|0.58432	D|D	0.999999|0.999999	.|P	.|0.38195	.|0.622	.|B	.|0.30179	.|0.112	T|T	0.65994|0.65994	-0.6033|-0.6033	5|10	.|0.87932	.|D	.|0	.|.	17.1091|17.1091	0.86670|0.86670	0.0:0.1267:0.8733:0.0|0.0:0.1267:0.8733:0.0	.|.	.|407	.|Q96QF0	.|RAB3I_HUMAN	K|K	123|391;185;407;185;185;98	.|ENSP00000247833:R391K;ENSP00000323349:R185K;ENSP00000447300:R407K;ENSP00000448773:R185K;ENSP00000448027:R185K;ENSP00000448102:R98K	.|ENSP00000447336:R32K	E|R	+|+	1|2	0|0	RAB3IP|RAB3IP	68492866|68492866	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.476000|9.476000	0.97823|0.97823	1.515000|1.515000	0.48885|0.48885	0.650000|0.650000	0.86243|0.86243	GAA|AGA	.	.		0.333	RAB3IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280671.2	NM_022456	
GLT8D2	83468	hgsc.bcm.edu	37	12	104388181	104388181	+	Silent	SNP	G	G	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr12:104388181G>C	ENST00000360814.4	-	9	1104	c.699C>G	c.(697-699)gcC>gcG	p.A233A	GLT8D2_ENST00000546436.1_Silent_p.A233A|GLT8D2_ENST00000548660.1_Silent_p.A233A	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	233						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						CTGTCATGTTGGCAACAATCA	0.473																																					p.A233A		Atlas-SNP	.											.	GLT8D2	40	.	0			c.C699G						.						138.0	116.0	123.0					12																	104388181		2203	4300	6503	SO:0001819	synonymous_variant	83468	exon9			CATGTTGGCAACA	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.699C>G	chr12.hg19:g.104388181G>C		132.0	0.0		130.0	18.0	NM_031302	Q96KA2	Silent	SNP	ENST00000360814.4	hg19	CCDS9096.1																																																																																			.	.		0.473	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1	NM_031302	
BTBD11	121551	hgsc.bcm.edu	37	12	108012091	108012091	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr12:108012091G>T	ENST00000280758.5	+	10	2916	c.2388G>T	c.(2386-2388)agG>agT	p.R796S	RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000357167.4_Missense_Mutation_p.R333S|BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000490090.2_Missense_Mutation_p.R796S	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	796						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GGGCCCTGAGGGAGGCCATGT	0.627																																					p.R796S		Atlas-SNP	.											.	BTBD11	122	.	0			c.G2388T						.						64.0	53.0	57.0					12																	108012091		2203	4300	6503	SO:0001583	missense	121551	exon10			CCTGAGGGAGGCC	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2388G>T	chr12.hg19:g.108012091G>T	ENSP00000280758:p.Arg796Ser	86.0	0.0		83.0	12.0	NM_001018072	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	hg19	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683482	0.68157	.	.	ENSG00000151136	ENST00000280758;ENST00000490090;ENST00000357167	T;T;T	0.39056	1.2;1.24;1.1	5.07	3.21	0.36854	.	0.204155	0.51477	D	0.000088	T	0.39809	0.1092	L	0.51422	1.61	0.80722	D	1	B;P;P	0.49090	0.018;0.919;0.914	B;B;P	0.46026	0.016;0.324;0.501	T	0.34354	-0.9832	10	0.72032	D	0.01	.	8.6922	0.34273	0.2323:0.0:0.7677:0.0	.	333;796;796	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	S	796;796;333	ENSP00000280758:R796S;ENSP00000447319:R796S;ENSP00000349690:R333S	ENSP00000280758:R796S	R	+	3	2	BTBD11	106536221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.920000	0.40025	1.257000	0.44085	0.563000	0.77884	AGG	.	.		0.627	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
DAAM1	23002	hgsc.bcm.edu	37	14	59821978	59821978	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr14:59821978C>G	ENST00000395125.1	+	20	2505	c.2482C>G	c.(2482-2484)Caa>Gaa	p.Q828E	DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000360909.3_Missense_Mutation_p.Q818E|DAAM1_ENST00000351081.1_Missense_Mutation_p.Q828E	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	828	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GAATAAAGGTCAAAGAGGGAA	0.413																																					p.Q828E		Atlas-SNP	.											.	DAAM1	95	.	0			c.C2482G						.						156.0	146.0	149.0					14																	59821978		2203	4300	6503	SO:0001583	missense	23002	exon20			AAAGGTCAAAGAG	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.2482C>G	chr14.hg19:g.59821978C>G	ENSP00000378557:p.Gln828Glu	109.0	0.0		63.0	12.0	NM_014992	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	hg19	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320873	0.81469	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	T;T;T	0.16743	2.32;2.32;2.32	5.81	5.81	0.92471	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.45054	0.1323	M	0.79475	2.455	0.80722	D	1	D;D	0.67145	0.975;0.996	P;D	0.64687	0.658;0.928	T	0.22417	-1.0217	10	0.54805	T	0.06	.	20.4375	0.99097	0.0:1.0:0.0:0.0	.	818;828	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	E	818;828;797;828	ENSP00000354162:Q818E;ENSP00000247170:Q828E;ENSP00000378557:Q828E	ENSP00000247170:Q828E	Q	+	1	0	DAAM1	58891731	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.776000	0.85560	2.906000	0.99361	0.655000	0.94253	CAA	.	.		0.413	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
DHRS7	51635	hgsc.bcm.edu	37	14	60631900	60631900	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr14:60631900C>T	ENST00000216500.5	-	2	583	c.128G>A	c.(127-129)cGc>cAc	p.R43H	DHRS7_ENST00000536410.2_Intron|PCNXL4_ENST00000553898.1_Intron|DHRS7_ENST00000557185.1_Missense_Mutation_p.R43H|PCNXL4_ENST00000406949.1_Intron			Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7	43						membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(108;0.121)		CTCACCTGGGCGTCGTCCCTG	0.697																																					p.R43H		Atlas-SNP	.											.	DHRS7	31	.	0			c.G128A						.						18.0	19.0	19.0					14																	60631900		2199	4294	6493	SO:0001583	missense	51635	exon1			CCTGGGCGTCGTC	AF151844	CCDS9743.1	14q23.1	2011-09-20			ENSG00000100612	ENSG00000100612		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	21524	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 4"", ""short chain dehydrogenase/reductase family 34C, member 1"""	612833				10800688, 10810093, 19027726	Standard	NM_016029		Approved	retDSR4, SDR34C1	uc001xes.3	Q9Y394	OTTHUMG00000140331	ENST00000216500.5:c.128G>A	chr14.hg19:g.60631900C>T	ENSP00000216500:p.Arg43His	219.0	0.0		220.0	27.0	NM_016029	B2R896|Q9UKU2	Missense_Mutation	SNP	ENST00000216500.5	hg19	CCDS9743.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.3|28.3	4.903943|4.903943	0.92035|0.92035	.|.	.|.	ENSG00000100612|ENSG00000100612	ENST00000554101;ENST00000557137|ENST00000216500;ENST00000360557;ENST00000557185;ENST00000557326	.|D;D	.|0.85013	.|-1.93;-1.93	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|0.244896	.|0.38959	.|N	.|0.001510	D|D	0.85474|0.85474	0.5705|0.5705	L|L	0.47716|0.47716	1.5|1.5	0.34921|0.34921	D|D	0.748429|0.748429	.|D;D	.|0.71674	.|0.998;0.992	.|P;P	.|0.58013	.|0.831;0.574	D|D	0.87741|0.87741	0.2585|0.2585	5|10	.|0.48119	.|T	.|0.1	.|.	7.0958|7.0958	0.25309|0.25309	0.0:0.7347:0.1751:0.0902|0.0:0.7347:0.1751:0.0902	.|.	.|43;43	.|F8W9Q4;Q9Y394	.|.;DHRS7_HUMAN	T|H	38;43|43	.|ENSP00000216500:R43H;ENSP00000451882:R43H	.|ENSP00000216500:R43H	A|R	-|-	1|2	0|0	DHRS7|DHRS7	59701653|59701653	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	1.748000|1.748000	0.38308|0.38308	2.602000|2.602000	0.87976|0.87976	0.557000|0.557000	0.71058|0.71058	GCC|CGC	.	.		0.697	DHRS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276947.2	NM_016029	
NLRC5	84166	hgsc.bcm.edu	37	16	57060281	57060281	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr16:57060281T>A	ENST00000262510.6	+	6	1651	c.1426T>A	c.(1426-1428)Tat>Aat	p.Y476N	NLRC5_ENST00000308149.7_Missense_Mutation_p.Y476N|NLRC5_ENST00000436936.1_Missense_Mutation_p.Y476N|NLRC5_ENST00000539144.1_Missense_Mutation_p.Y476N	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	476	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GGTTATCTTCTATGCAAAAGA	0.617																																					p.Y476N		Atlas-SNP	.											.	NLRC5	186	.	0			c.T1426A						.						38.0	35.0	36.0					16																	57060281		2198	4300	6498	SO:0001583	missense	84166	exon5			ATCTTCTATGCAA	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1426T>A	chr16.hg19:g.57060281T>A	ENSP00000262510:p.Tyr476Asn	94.0	0.0		66.0	15.0	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	hg19	CCDS10773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.67|12.67	2.006408|2.006408	0.35415|0.35415	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000538805|ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144	.|D;D;D;D	.|0.88201	.|-2.35;-2.35;-2.35;-2.35	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.533360	.|0.14204	.|N	.|0.334531	D|D	0.87301|0.87301	0.6143|0.6143	L|L	0.46157|0.46157	1.445|1.445	0.33805|0.33805	D|D	0.627167|0.627167	.|P;D;B;B	.|0.54964	.|0.799;0.969;0.222;0.19	.|B;P;B;B	.|0.46253	.|0.386;0.509;0.037;0.028	D|D	0.87584|0.87584	0.2486|0.2486	5|10	.|0.22706	.|T	.|0.39	.|.	14.5996|14.5996	0.68432|0.68432	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|476;476;476;476	.|Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.|.;.;.;NLRC5_HUMAN	Q|N	228|476	.|ENSP00000262510:Y476N;ENSP00000308886:Y476N;ENSP00000389739:Y476N;ENSP00000441727:Y476N	.|ENSP00000262510:Y476N	L|Y	+|+	2|1	0|0	NLRC5|NLRC5	55617782|55617782	1.000000|1.000000	0.71417|0.71417	0.870000|0.870000	0.34147|0.34147	0.281000|0.281000	0.26958|0.26958	3.025000|3.025000	0.49681|0.49681	2.047000|2.047000	0.60756|0.60756	0.459000|0.459000	0.35465|0.35465	CTA|TAT	.	.		0.617	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
SLC2A4	6517	hgsc.bcm.edu	37	17	7187403	7187403	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr17:7187403G>T	ENST00000317370.8	+	5	827	c.559G>T	c.(559-561)Gcc>Tcc	p.A187S	SLC2A4_ENST00000571308.1_Missense_Mutation_p.A187S|RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000424875.2_Missense_Mutation_p.A177S	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	187					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						CATTCTGATCGCCCAGGTGAC	0.612																																					p.A187S		Atlas-SNP	.											.	SLC2A4	44	.	0			c.G559T						.						35.0	33.0	34.0					17																	7187403		2200	4298	6498	SO:0001583	missense	6517	exon5			CTGATCGCCCAGG	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.559G>T	chr17.hg19:g.7187403G>T	ENSP00000320935:p.Ala187Ser	86.0	0.0		58.0	10.0	NM_001042	Q05BQ3|Q14CX2	Missense_Mutation	SNP	ENST00000317370.8	hg19	CCDS11097.1	.	.	.	.	.	.	.	.	.	.	G	6.982	0.551300	0.13374	.	.	ENSG00000181856	ENST00000317370;ENST00000424875	T;T	0.81415	-1.49;-1.49	5.66	5.66	0.87406	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.060310	0.64402	N	0.000004	T	0.77143	0.4087	L	0.58583	1.82	0.80722	D	1	P;P	0.45672	0.741;0.864	B;B	0.41466	0.358;0.244	T	0.74411	-0.3674	10	0.09590	T	0.72	.	17.2301	0.86982	0.0:0.0:1.0:0.0	.	187;177	P14672;F5H081	GTR4_HUMAN;.	S	187;177	ENSP00000320935:A187S;ENSP00000396887:A177S	ENSP00000320935:A187S	A	+	1	0	SLC2A4	7128127	0.840000	0.29493	0.966000	0.40874	0.608000	0.37181	4.227000	0.58612	2.665000	0.90641	0.655000	0.94253	GCC	.	.		0.612	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3		
TP53	7157	hgsc.bcm.edu	37	17	7576633	7576633	+	Intron	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr17:7576633T>C	ENST00000269305.4	-	9	1183				TP53_ENST00000445888.2_Intron|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.N340D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*49(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTTAACAATTTTCTTTTTGA	0.368		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N340D	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53	33396	.	10	Whole gene deletion(8)|Unknown(1)|Insertion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|stomach(1)|breast(1)	c.A1018G						.						69.0	61.0	63.0					17																	7576633		1567	3581	5148	SO:0001627	intron_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AACAATTTTCTTT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+219A>G	chr17.hg19:g.7576633T>C		109.0	0.0		42.0	16.0	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	18.91	3.723503	0.68959	.	.	ENSG00000141510	ENST00000420246	D	0.99311	-5.73	2.36	1.2	0.21068	.	.	.	.	.	D	0.97343	0.9131	.	.	.	0.19300	N	0.999976	B	0.30889	0.299	B	0.38616	0.277	D	0.95034	0.8172	7	.	.	.	.	4.4007	0.11385	0.2965:0.0:0.0:0.7035	.	340	P04637-2	.	D	340	ENSP00000391127:N340D	.	N	-	1	0	TP53	7517358	0.162000	0.22906	0.336000	0.25522	0.965000	0.64279	0.105000	0.15333	0.301000	0.22738	0.459000	0.35465	AAT	.	.		0.368	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
GREB1L	80000	hgsc.bcm.edu	37	18	19079942	19079942	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr18:19079942G>A	ENST00000580732.2	+	22	4025	c.3644G>A	c.(3643-3645)gGa>gAa	p.G1215E	GREB1L_ENST00000269218.6_Missense_Mutation_p.G1106E|GREB1L_ENST00000424526.1_Missense_Mutation_p.G1215E|GREB1L_ENST00000400483.4_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1215						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CCATGGCCGGGACAGCCCATC	0.647																																					p.G1215E		Atlas-SNP	.											.	GREB1L	69	.	0			c.G3644A						.						15.0	22.0	20.0					18																	19079942		691	1591	2282	SO:0001583	missense	80000	exon22			GGCCGGGACAGCC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.3644G>A	chr18.hg19:g.19079942G>A	ENSP00000464162:p.Gly1215Glu	60.0	0.0		54.0	11.0	NM_001142966	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	hg19	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	0.706	-0.788968	0.02884	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.06142	3.34;3.35	4.32	2.5	0.30297	.	0.827080	0.10609	N	0.654649	T	0.05318	0.0141	L	0.46157	1.445	0.20074	N	0.999931	B;B;B	0.26845	0.161;0.069;0.078	B;B;B	0.24394	0.053;0.037;0.053	T	0.45131	-0.9282	10	0.05959	T	0.93	-9.3883	6.0271	0.19660	0.1635:0.2964:0.5401:0.0	.	1106;1215;589	Q9C091-3;Q9C091;B4DDS9	.;GRB1L_HUMAN;.	E	1215;1106	ENSP00000412060:G1215E;ENSP00000269218:G1106E	ENSP00000269218:G1106E	G	+	2	0	GREB1L	17333940	0.583000	0.26757	0.001000	0.08648	0.018000	0.09664	1.505000	0.35736	0.441000	0.26529	0.561000	0.74099	GGA	.	.		0.647	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
NCLN	56926	hgsc.bcm.edu	37	19	3206308	3206308	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr19:3206308C>T	ENST00000246117.4	+	12	1815	c.1384C>T	c.(1384-1386)Cag>Tag	p.Q462*	NCLN_ENST00000590671.1_Nonsense_Mutation_p.Q388*	NM_020170.3	NP_064555.2	Q969V3	NCLN_HUMAN	nicalin	462					regulation of signal transduction (GO:0009966)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|lung(3)|skin(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCACCAACCAGCCGCGGGC	0.662																																					p.Q462X		Atlas-SNP	.											.	NCLN	27	.	0			c.C1384T						.						26.0	20.0	22.0					19																	3206308		1963	3775	5738	SO:0001587	stop_gained	56926	exon12			ACCAACCAGCCGC	BC025926	CCDS32869.1	19p13.3	2010-08-13	2010-08-13			ENSG00000125912			26923	protein-coding gene	gene with protein product	"""nicastrin-like protein"""	609156	"""nicalin homolog (zebrafish)"""			11230166	Standard	NM_020170		Approved	NICALIN, NET59	uc002lxi.3	Q969V3		ENST00000246117.4:c.1384C>T	chr19.hg19:g.3206308C>T	ENSP00000246117:p.Gln462*	105.0	0.0		109.0	27.0	NM_020170	D6W613|O75252|Q6FI60|Q6ZMB7|Q8TAT7|Q96H48|Q96IS7|Q9BQH9|Q9BTX4|Q9NPP2	Nonsense_Mutation	SNP	ENST00000246117.4	hg19	CCDS32869.1	.	.	.	.	.	.	.	.	.	.	C	38	7.255656	0.98168	.	.	ENSG00000125912	ENST00000246117	.	.	.	4.05	4.05	0.47172	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-12.412	14.7949	0.69870	0.0:1.0:0.0:0.0	.	.	.	.	X	462	.	ENSP00000246117:Q462X	Q	+	1	0	NCLN	3157308	1.000000	0.71417	0.979000	0.43373	0.859000	0.49053	7.090000	0.76916	1.802000	0.52723	0.549000	0.68633	CAG	.	.		0.662	NCLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452545.1	NM_020170	
C19orf10	56005	hgsc.bcm.edu	37	19	4664897	4664897	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr19:4664897G>T	ENST00000262947.3	-	3	313	c.278C>A	c.(277-279)aCc>aAc	p.T93N	C19orf10_ENST00000599630.1_Missense_Mutation_p.T93N	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	93					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		CCTCCAGATGGTGCAGGTGAA	0.637																																					p.T93N		Atlas-SNP	.											.	C19orf10	9	.	0			c.C278A						.						119.0	75.0	90.0					19																	4664897		2200	4298	6498	SO:0001583	missense	56005	exon3			CAGATGGTGCAGG	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.278C>A	chr19.hg19:g.4664897G>T	ENSP00000262947:p.Thr93Asn	143.0	0.0		94.0	13.0	NM_019107	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	hg19	CCDS12133.1	.	.	.	.	.	.	.	.	.	.	g	13.36	2.215345	0.39102	.	.	ENSG00000074842	ENST00000262947	T	0.46819	0.86	4.54	3.25	0.37280	.	0.133303	0.51477	D	0.000094	T	0.39358	0.1075	L	0.34521	1.04	0.20764	N	0.999851	P	0.43826	0.818	P	0.44732	0.459	T	0.27123	-1.0083	10	0.49607	T	0.09	-16.6686	10.3755	0.44079	0.1152:0.0:0.8848:0.0	.	93	Q969H8	CS010_HUMAN	N	93	ENSP00000262947:T93N	ENSP00000262947:T93N	T	-	2	0	C19orf10	4615897	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.515000	0.60489	2.118000	0.64928	0.550000	0.68814	ACC	.	.		0.637	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
JAK3	3718	hgsc.bcm.edu	37	19	17943612	17943612	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr19:17943612G>A	ENST00000527670.1	-	17	2506	c.2477C>T	c.(2476-2478)tCa>tTa	p.S826L	JAK3_ENST00000458235.1_Missense_Mutation_p.S826L|JAK3_ENST00000534444.1_Missense_Mutation_p.S826L			P52333	JAK3_HUMAN	Janus kinase 3	826	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GCCCAGCTGTGAGATGTACTT	0.627		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.S826L		Atlas-SNP	.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3	341	.	0			c.C2477T						.						185.0	154.0	164.0					19																	17943612		2203	4300	6503	SO:0001583	missense	3718	exon18			AGCTGTGAGATGT	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2477C>T	chr19.hg19:g.17943612G>A	ENSP00000432511:p.Ser826Leu	263.0	0.0		198.0	35.0	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	hg19	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752414	0.89753	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	T;T;D	0.89552	-0.02;-0.02;-2.53	5.11	5.11	0.69529	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92126	0.7504	L	0.48935	1.535	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.71414	0.936;0.973	D	0.92798	0.6254	10	0.66056	D	0.02	-15.1052	15.9996	0.80285	0.0:0.0:1.0:0.0	.	826;826	P52333-2;P52333	.;JAK3_HUMAN	L	826	ENSP00000391676:S826L;ENSP00000432511:S826L;ENSP00000436421:S826L	ENSP00000391676:S826L	S	-	2	0	JAK3	17804612	0.999000	0.42202	0.989000	0.46669	0.987000	0.75469	2.893000	0.48633	2.385000	0.81259	0.478000	0.44815	TCA	.	.		0.627	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
RYR1	6261	hgsc.bcm.edu	37	19	39071081	39071081	+	Silent	SNP	C	C	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr19:39071081C>T	ENST00000359596.3	+	101	14583	c.14583C>T	c.(14581-14583)cgC>cgT	p.R4861R	RYR1_ENST00000355481.4_Silent_p.R4856R|RYR1_ENST00000360985.3_Silent_p.R4856R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4861			R -> C (in CCD). {ECO:0000269|PubMed:12565913, ECO:0000269|PubMed:17226826}.|R -> H (in CCD and MHS1; release of calcium from intracellular stores in the absence of any pharmacological activator of RYR). {ECO:0000269|PubMed:11709545, ECO:0000269|PubMed:11741831, ECO:0000269|PubMed:12565913, ECO:0000269|PubMed:14670767, ECO:0000269|PubMed:14985404, ECO:0000269|PubMed:17226826, ECO:0000269|PubMed:23558838, ECO:0000269|PubMed:24561095}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACTTCTTCCGCAAGTTCTACA	0.582																																					p.R4861R		Atlas-SNP	.											.	RYR1	708	.	0			c.C14583T						.						205.0	161.0	175.0					19																	39071081		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon101			CTTCCGCAAGTTC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14583C>T	chr19.hg19:g.39071081C>T		246.0	0.0		264.0	46.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	hg19	CCDS33011.1																																																																																			.	.		0.582	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
CD37	951	hgsc.bcm.edu	37	19	49841271	49841271	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr19:49841271C>G	ENST00000323906.4	+	5	573	c.432C>G	c.(430-432)gaC>gaG	p.D144E	CD37_ENST00000426897.2_Missense_Mutation_p.D76E|CD37_ENST00000535669.2_Missense_Mutation_p.D144E|CD37_ENST00000598095.1_Missense_Mutation_p.D76E|CD37_ENST00000596426.1_3'UTR|CTC-301O7.4_ENST00000358234.4_lincRNA	NM_001774.2	NP_001765.1	P11049	CD37_HUMAN	CD37 molecule	144					defense response to protozoan (GO:0042832)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|positive regulation of immunoglobulin production (GO:0002639)|regulation of defense response to virus (GO:0050688)|regulation of humoral immune response (GO:0002920)	extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	11		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		AGAGCTGGGACTATGTGCAGT	0.637																																					p.D144E		Atlas-SNP	.											.	CD37	33	.	0			c.C432G						.						98.0	89.0	92.0					19																	49841271		2203	4300	6503	SO:0001583	missense	951	exon5			CTGGGACTATGTG		CCDS12760.1, CCDS46139.1	19p13-q13.4	2013-02-14	2006-03-28			ENSG00000104894		"""CD molecules"", ""Tetraspanins"""	1666	protein-coding gene	gene with protein product		151523	"""CD37 antigen"""			8436422	Standard	XM_005259435		Approved	TSPAN26	uc002pnd.3	P11049		ENST00000323906.4:c.432C>G	chr19.hg19:g.49841271C>G	ENSP00000325708:p.Asp144Glu	180.0	0.0		194.0	62.0	NM_001774	B4DVC1|Q3KPF9	Missense_Mutation	SNP	ENST00000323906.4	hg19	CCDS12760.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818360	0.50633	.	.	ENSG00000104894	ENST00000323906;ENST00000426897;ENST00000535669	D;D;D	0.81908	-1.55;-1.55;-1.55	3.69	2.3	0.28687	Tetraspanin, EC2 domain (1);	0.000000	0.56097	D	0.000029	D	0.89065	0.6609	M	0.85859	2.78	0.40891	D	0.984078	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.999;0.998;0.998;0.997	D	0.86897	0.2052	10	0.87932	D	0	.	4.127	0.10131	0.0:0.6288:0.0:0.3712	.	76;144;144;144	B4DVC1;B7ZAN3;B4DW15;P11049	.;.;.;CD37_HUMAN	E	144;76;144	ENSP00000325708:D144E;ENSP00000413151:D76E;ENSP00000441037:D144E	ENSP00000325708:D144E	D	+	3	2	CD37	54533083	0.765000	0.28485	1.000000	0.80357	0.345000	0.29048	-0.105000	0.10907	0.686000	0.31488	0.313000	0.20887	GAC	.	.		0.637	CD37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465532.1		
A1BG	1	hgsc.bcm.edu	37	19	58862780	58862780	+	Missense_Mutation	SNP	G	G	A	rs542119157		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr19:58862780G>A	ENST00000263100.3	-	5	948	c.887C>T	c.(886-888)cCg>cTg	p.P296L	A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000595302.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	296	Ig-like V-type 3.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CAGCTCGACCGGCGCGCTGTC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		14169	0.0		0.0	False		,,,				2504	0.001				p.P296L		Atlas-SNP	.											A1BG,NS,carcinoma,0,1	A1BG	40	.	0			c.C887T						.						54.0	59.0	57.0					19																	58862780		2202	4300	6502	SO:0001583	missense	1	exon5			TCGACCGGCGCGC		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.887C>T	chr19.hg19:g.58862780G>A	ENSP00000263100:p.Pro296Leu	68.0	0.0		96.0	27.0	NM_130786	A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	ENST00000263100.3	hg19	CCDS12976.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431997	0.62844	.	.	ENSG00000121410	ENST00000263100;ENST00000453054	T	0.13538	2.58	3.42	3.42	0.39159	Immunoglobulin-like fold (1);	0.000000	0.45361	D	0.000380	T	0.36880	0.0983	M	0.82823	2.61	0.50467	D	0.999871	D	0.89917	1.0	D	0.76071	0.987	T	0.26849	-1.0091	10	0.87932	D	0	.	10.6418	0.45596	0.0:0.0:1.0:0.0	.	296	P04217	A1BG_HUMAN	L	296;174	ENSP00000263100:P296L	ENSP00000263100:P296L	P	-	2	0	A1BG	63554592	0.000000	0.05858	0.755000	0.31263	0.003000	0.03518	0.558000	0.23469	2.217000	0.71921	0.462000	0.41574	CCG	.	.		0.657	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	NM_130786	
SEC23B	10483	hgsc.bcm.edu	37	20	18505223	18505223	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr20:18505223G>C	ENST00000336714.3	+	5	945	c.513G>C	c.(511-513)agG>agC	p.R171S	SEC23B_ENST00000377475.3_Missense_Mutation_p.R171S|SEC23B_ENST00000377465.1_Missense_Mutation_p.R171S|SEC23B_ENST00000262544.2_Missense_Mutation_p.R171S	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	171					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						CATTTGGAAGGATGGTGCAGG	0.478																																					p.R171S		Atlas-SNP	.											.	SEC23B	70	.	0			c.G513C						.						145.0	127.0	133.0					20																	18505223		2203	4300	6503	SO:0001583	missense	10483	exon5			TGGAAGGATGGTG	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.513G>C	chr20.hg19:g.18505223G>C	ENSP00000338844:p.Arg171Ser	153.0	0.0		99.0	17.0	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	hg19	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046011	0.55110	.	.	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95	4.91	-0.753	0.11068	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	L	0.35593	1.075	0.80722	D	1	B;B	0.15930	0.015;0.004	B;B	0.17098	0.017;0.017	T	0.42916	-0.9423	10	0.30078	T	0.28	-19.7662	9.812	0.40828	0.5316:0.0:0.4684:0.0	.	153;171	B4DJW8;Q15437	.;SC23B_HUMAN	S	171	ENSP00000403971:R171S;ENSP00000338844:R171S;ENSP00000262544:R171S;ENSP00000366695:R171S;ENSP00000366685:R171S	ENSP00000262544:R171S	R	+	3	2	SEC23B	18453223	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.130000	0.42064	0.020000	0.15106	0.591000	0.81541	AGG	.	.		0.478	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
PYGB	5834	hgsc.bcm.edu	37	20	25261588	25261588	+	Missense_Mutation	SNP	G	G	A	rs201813153		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr20:25261588G>A	ENST00000216962.4	+	11	1353	c.1243G>A	c.(1243-1245)Gtg>Atg	p.V415M		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	415					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						GCACCAGCACGTGGCCGCGCT	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18121	0.0		0.0	False		,,,				2504	0.0				p.V415M		Atlas-SNP	.											.	PYGB	84	.	0			c.G1243A						.						114.0	102.0	106.0					20																	25261588		2203	4300	6503	SO:0001583	missense	5834	exon11			CAGCACGTGGCCG		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1243G>A	chr20.hg19:g.25261588G>A	ENSP00000216962:p.Val415Met	173.0	0.0		169.0	24.0	NM_002862	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	hg19	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141304	0.37825	.	.	ENSG00000100994	ENST00000216962	D	0.95035	-3.59	4.02	3.06	0.35304	.	0.251138	0.39341	N	0.001398	D	0.95130	0.8422	M	0.81942	2.565	0.44462	D	0.997395	D	0.60575	0.988	P	0.53401	0.725	D	0.94246	0.7489	10	0.87932	D	0	-26.065	8.2363	0.31627	0.1881:0.0:0.8119:0.0	.	415	P11216	PYGB_HUMAN	M	415	ENSP00000216962:V415M	ENSP00000216962:V415M	V	+	1	0	PYGB	25209588	0.998000	0.40836	0.834000	0.33040	0.026000	0.11368	3.100000	0.50275	1.027000	0.39758	0.462000	0.41574	GTG	.	.		0.642	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	
CPNE1	8904	hgsc.bcm.edu	37	20	34220601	34220601	+	Silent	SNP	C	C	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr20:34220601C>A	ENST00000317619.3	-	5	541	c.147G>T	c.(145-147)cgG>cgT	p.R49R	CPNE1_ENST00000397445.1_Silent_p.R49R|CPNE1_ENST00000397446.1_Silent_p.R49R|CPNE1_ENST00000397443.1_Silent_p.R49R|RP1-309K20.6_ENST00000541176.2_3'UTR|CPNE1_ENST00000352393.4_Silent_p.R49R|CPNE1_ENST00000397442.1_Silent_p.R49R|CPNE1_ENST00000317677.5_Silent_p.R54R			Q99829	CPNE1_HUMAN	copine I	49	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			AGTTCCGCACCCGTTCAGTCC	0.532																																					p.R54R		Atlas-SNP	.											.	CPNE1	44	.	0			c.G162T						.						128.0	126.0	127.0					20																	34220601		2203	4300	6503	SO:0001819	synonymous_variant	8904	exon3			CCGCACCCGTTCA	U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.147G>T	chr20.hg19:g.34220601C>A		186.0	0.0		125.0	10.0	NM_003915	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Silent	SNP	ENST00000317619.3	hg19	CCDS13260.1																																																																																			.	.		0.532	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078909.3	NM_152930	
ATP9A	10079	hgsc.bcm.edu	37	20	50287714	50287714	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr20:50287714G>A	ENST00000338821.5	-	12	1384	c.1120C>T	c.(1120-1122)Cgc>Tgc	p.R374C	ATP9A_ENST00000311637.5_Missense_Mutation_p.R238C|ATP9A_ENST00000402822.1_Missense_Mutation_p.R253C	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	374					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GTGCTGGAGCGAACCACGGTC	0.552																																					p.R374C		Atlas-SNP	.											.	ATP9A	135	.	0			c.C1120T						.						94.0	79.0	84.0					20																	50287714		2203	4300	6503	SO:0001583	missense	10079	exon12			TGGAGCGAACCAC	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1120C>T	chr20.hg19:g.50287714G>A	ENSP00000342481:p.Arg374Cys	123.0	0.0		100.0	7.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	hg19	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867084	0.51588	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.91577	-2.87;-2.87;-2.87	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.97244	0.9099	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.978	D	0.98312	1.0524	10	0.87932	D	0	-15.1513	13.6168	0.62112	0.0:0.0:0.8447:0.1553	.	253;374	O75110-2;O75110	.;ATP9A_HUMAN	C	238;374;253	ENSP00000309086:R238C;ENSP00000342481:R374C;ENSP00000385875:R253C	ENSP00000309086:R238C	R	-	1	0	ATP9A	49721121	1.000000	0.71417	0.999000	0.59377	0.230000	0.25150	4.694000	0.61760	2.397000	0.81536	0.313000	0.20887	CGC	.	.		0.552	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
PHACTR3	116154	hgsc.bcm.edu	37	20	58322830	58322830	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr20:58322830G>T	ENST00000371015.1	+	3	765	c.298G>T	c.(298-300)Gcc>Tcc	p.A100S	PHACTR3_ENST00000395639.4_Missense_Mutation_p.A59S|PHACTR3_ENST00000359926.3_Missense_Mutation_p.A97S|PHACTR3_ENST00000395636.2_Missense_Mutation_p.A59S|PHACTR3_ENST00000541461.1_Missense_Mutation_p.A59S|PHACTR3_ENST00000355648.4_Missense_Mutation_p.A59S|PHACTR3_ENST00000361300.4_Missense_Mutation_p.A59S	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	100						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GAAGAAGATGGCCGGCAGGCA	0.607																																					p.A100S		Atlas-SNP	.											.	PHACTR3	104	.	0			c.G298T						.						146.0	133.0	138.0					20																	58322830		2203	4300	6503	SO:0001583	missense	116154	exon3			AAGATGGCCGGCA	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.298G>T	chr20.hg19:g.58322830G>T	ENSP00000360054:p.Ala100Ser	183.0	0.0		103.0	15.0	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	hg19	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	G	1.196	-0.633917	0.03584	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.19532	2.87;2.91;2.14;2.78;2.78;2.78;2.14	4.26	2.28	0.28536	.	0.351081	0.33199	N	0.005169	T	0.06508	0.0167	N	0.04705	-0.18	0.30950	N	0.724849	B;B;B	0.15141	0.012;0.001;0.001	B;B;B	0.14578	0.011;0.003;0.002	T	0.35968	-0.9767	10	0.02654	T	1	-5.5525	3.4531	0.07506	0.3106:0.0:0.5107:0.1787	.	59;100;97	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	S	97;100;59;59;59;59;59	ENSP00000353002:A97S;ENSP00000360054:A100S;ENSP00000379001:A59S;ENSP00000442483:A59S;ENSP00000347866:A59S;ENSP00000378998:A59S;ENSP00000354555:A59S	ENSP00000347866:A59S	A	+	1	0	PHACTR3	57756225	1.000000	0.71417	0.954000	0.39281	0.933000	0.57130	1.266000	0.33039	0.359000	0.24239	0.563000	0.77884	GCC	.	.		0.607	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
CHRNA4	1137	hgsc.bcm.edu	37	20	61978125	61978125	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr20:61978125G>A	ENST00000370263.4	-	6	2070	c.1849C>T	c.(1849-1851)Ctc>Ttc	p.L617F	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	617					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GGCAGGAAGAGGCCCACCGTC	0.657																																					p.L617F		Atlas-SNP	.											.	CHRNA4	98	.	0			c.C1849T						.						98.0	61.0	73.0					20																	61978125		2202	4299	6501	SO:0001583	missense	1137	exon6			GGAAGAGGCCCAC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1849C>T	chr20.hg19:g.61978125G>A	ENSP00000359285:p.Leu617Phe	130.0	0.0		130.0	23.0	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	hg19	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	G	33	5.227201	0.95173	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.87809	-2.3	4.43	4.43	0.53597	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.179987	0.49916	D	0.000123	D	0.92867	0.7731	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	D	0.93943	0.7225	10	0.87932	D	0	.	17.3789	0.87399	0.0:0.0:1.0:0.0	.	546;617	Q4VAQ5;P43681	.;ACHA4_HUMAN	F	523;617;546	ENSP00000359285:L617F	ENSP00000359280:L523F	L	-	1	0	CHRNA4	61448569	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.546000	0.98097	2.177000	0.69029	0.511000	0.50034	CTC	.	.		0.657	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
RSPH1	89765	hgsc.bcm.edu	37	21	43896039	43896039	+	Silent	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr21:43896039G>A	ENST00000291536.3	-	8	1013	c.846C>T	c.(844-846)gaC>gaT	p.D282D	RSPH1_ENST00000398352.3_Silent_p.D244D	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	282					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						ACTCCTCCTGGTCATACTCCC	0.627																																					p.D282D	Esophageal Squamous(23;63 706 6286 10288 12913)	Atlas-SNP	.											.	RSPH1	36	.	0			c.C846T						.						186.0	143.0	157.0					21																	43896039		2203	4300	6503	SO:0001819	synonymous_variant	89765	exon8			CTCCTGGTCATAC	AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.846C>T	chr21.hg19:g.43896039G>A		114.0	0.0		104.0	24.0	NM_080860	A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	ENST00000291536.3	hg19	CCDS13688.1																																																																																			.	.		0.627	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195379.1		
THAP7	80764	hgsc.bcm.edu	37	22	21354333	21354333	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr22:21354333G>A	ENST00000215742.4	-	4	940	c.766C>T	c.(766-768)Cgc>Tgc	p.R256C	THAP7-AS1_ENST00000429962.1_RNA|THAP7_ENST00000399133.2_Missense_Mutation_p.R256C|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000436079.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	256					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGCAGCTGGCGCTGGGCCTTG	0.662																																					p.R256C		Atlas-SNP	.											.	THAP7	15	.	0			c.C766T						.						21.0	23.0	22.0					22																	21354333		2194	4292	6486	SO:0001583	missense	80764	exon4			GCTGGCGCTGGGC	BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.766C>T	chr22.hg19:g.21354333G>A	ENSP00000215742:p.Arg256Cys	92.0	0.0		122.0	23.0	NM_030573	B2RD97|D3DX40	Missense_Mutation	SNP	ENST00000215742.4	hg19	CCDS13787.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901273	0.72754	.	.	ENSG00000184436	ENST00000215742;ENST00000399133	D;D	0.97256	-4.31;-4.31	4.96	3.95	0.45737	.	0.198258	0.33534	N	0.004811	D	0.91978	0.7459	N	0.24115	0.695	0.58432	D	0.999998	B	0.19331	0.035	B	0.06405	0.002	D	0.88075	0.2803	10	0.87932	D	0	-18.3688	6.1901	0.20520	0.0935:0.0:0.7229:0.1836	.	256	Q9BT49	THAP7_HUMAN	C	256	ENSP00000215742:R256C;ENSP00000382084:R256C	ENSP00000215742:R256C	R	-	1	0	THAP7	19684333	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.031000	0.41117	1.303000	0.44873	0.655000	0.94253	CGC	.	.		0.662	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320405.1	NM_030573	
TTC28	23331	hgsc.bcm.edu	37	22	28494971	28494971	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr22:28494971T>C	ENST00000397906.2	-	10	3620	c.3479A>G	c.(3478-3480)tAc>tGc	p.Y1160C		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1160					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GGAGAGTTTGTAGTCCGTGCT	0.527																																					p.Y1160C		Atlas-SNP	.											.	TTC28	84	.	0			c.A3479G						.						189.0	160.0	169.0					22																	28494971		692	1591	2283	SO:0001583	missense	23331	exon10			AGTTTGTAGTCCG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3479A>G	chr22.hg19:g.28494971T>C	ENSP00000381003:p.Tyr1160Cys	204.0	0.0		245.0	25.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	hg19	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.501545	0.44455	.	.	ENSG00000100154	ENST00000397906	D	0.89415	-2.51	5.92	4.9	0.64082	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.88771	0.6527	M	0.74881	2.28	0.58432	D	0.999995	B	0.22080	0.064	B	0.30716	0.119	D	0.85048	0.0927	10	0.46703	T	0.11	-21.2307	11.18	0.48623	0.0:0.0714:0.0:0.9286	.	1160	Q96AY4	TTC28_HUMAN	C	1160	ENSP00000381003:Y1160C	ENSP00000381003:Y1160C	Y	-	2	0	TTC28	26824971	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.700000	0.61803	1.082000	0.41137	0.533000	0.62120	TAC	.	.		0.527	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
COL4A6	1288	hgsc.bcm.edu	37	X	107681209	107681209	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chrX:107681209A>T	ENST00000372216.4	-	2	129	c.29T>A	c.(28-30)cTg>cAg	p.L10Q	COL4A6_ENST00000545689.1_Missense_Mutation_p.L9Q|COL4A6_ENST00000334504.7_Missense_Mutation_p.L9Q|COL4A6_ENST00000538570.1_Missense_Mutation_p.L9Q|COL4A5_ENST00000328300.6_5'Flank|COL4A6_ENST00000461897.1_5'UTR|COL4A6_ENST00000394872.2_Missense_Mutation_p.L9Q|COL4A5_ENST00000361603.2_5'Flank	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	10					cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CAACGTAACCAGGAGCAGCCA	0.597									Alport syndrome with Diffuse Leiomyomatosis																												p.L10Q	Melanoma(87;1895 1945 2589 7165)	Atlas-SNP	.											.	COL4A6	270	.	0			c.T29A						.						63.0	52.0	56.0					X																	107681209		2203	4300	6503	SO:0001583	missense	1288	exon2	Familial Cancer Database		GTAACCAGGAGCA	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.29T>A	chrX.hg19:g.107681209A>T	ENSP00000361290:p.Leu10Gln	268.0	0.0		226.0	64.0	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	hg19	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879269	0.33162	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.92249	-3.0;-2.97;-2.98;-2.93;-2.93	5.18	5.18	0.71444	.	0.000000	0.30252	N	0.010047	D	0.91246	0.7241	N	0.19112	0.55	0.32529	N	0.535172	D;D;D;D	0.69078	0.997;0.997;0.994;0.997	D;D;P;D	0.66351	0.943;0.943;0.879;0.943	D	0.92142	0.5721	10	0.56958	D	0.05	.	10.7064	0.45958	1.0:0.0:0.0:0.0	.	9;9;10;9	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	Q	10;9;9;9;9;9	ENSP00000361290:L10Q;ENSP00000334733:L9Q;ENSP00000378340:L9Q;ENSP00000443707:L9Q;ENSP00000445236:L9Q	ENSP00000334733:L9Q	L	-	2	0	COL4A6	107567865	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	3.848000	0.55903	1.992000	0.58205	0.486000	0.48141	CTG	.	.		0.597	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
MT-ND2	4536	hgsc.bcm.edu	37	M	5374	5374	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chrM:5374T>C	ENST00000361453.3	+	1	905	c.905T>C	c.(904-906)aTc>aCc	p.I302T	MT-TS1_ENST00000387416.2_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	302					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CTCCACCTCAATCACACTACT	0.443																																					p.I302T		Atlas-SNP	.											.	.	.	.	0			c.T905C						.																																			SO:0001583	missense	0	exon1			CCTCAATCACACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.905T>C	chrM.hg19:g.5374T>C	ENSP00000355046:p.Ile302Thr	5.0	0.0		601.0	94.0	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.		0.443	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
TSC2	7249	hgsc.bcm.edu	37	16	2136306	2136311	+	In_Frame_Del	DEL	TGTACC	TGTACC	-	rs397514889|rs45517368|rs137854039|rs45511204		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	TGTACC	TGTACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr16:2136306_2136311delTGTACC	ENST00000219476.3	+	37	5405_5410	c.4775_4780delTGTACC	c.(4774-4782)gtgtacctg>gtg	p.YL1593del	TSC2_ENST00000353929.4_In_Frame_Del_p.YL1550del|TSC2_ENST00000401874.2_In_Frame_Del_p.YL1526del|TSC2_ENST00000439673.2_In_Frame_Del_p.YL1490del|TSC2_ENST00000350773.4_In_Frame_Del_p.YL1570del|TSC2_ENST00000568454.1_In_Frame_Del_p.YL1537del|TSC2_ENST00000382538.6_In_Frame_Del_p.YL1478del	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1593	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCGGACAAGGTGTACCTGGGAGGCCT	0.631			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.1592_1593del		Atlas-Indel,Pindel	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.4774_4779del	GRCh37	CM054165|CM971528	TSC2	M	rs45511204|rs45517368	.																																			SO:0001651	inframe_deletion	7249	exon37	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	.	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4775_4780delTGTACC	chr16.hg19:g.2136306_2136311delTGTACC	ENSP00000219476:p.Tyr1593_Leu1594del	239.0	0.0		156.0	20.0	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	In_Frame_Del	DEL	ENST00000219476.3	hg19	CCDS10458.1																																																																																			.	.		0.631	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
H1F0	3005	hgsc.bcm.edu	37	22	38201683	38201684	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr22:38201683_38201684insT	ENST00000340857.2	+	1	570_571	c.132_133insT	c.(133-135)tccfs	p.S45fs	GCAT_ENST00000323205.6_5'Flank|GCAT_ENST00000248924.6_5'Flank	NM_005318.3	NP_005309.1	P07305	H10_HUMAN	H1 histone family, member 0	45	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|nucleosome assembly (GO:0006334)	actin cytoskeleton (GO:0015629)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|prostate(2)|urinary_tract(1)	7	Melanoma(58;0.045)					ACCGCGCTGGCTCCTCGCGCCA	0.574																																					p.G44fs	NSCLC(191;1872 2984 30230 41544)|Esophageal Squamous(4;11 371 39444 52196)	Atlas-INDEL	.											.	H1F0	12	.	0			c.132_133insT						.																																			SO:0001589	frameshift_variant	3005	exon1			.	X03473	CCDS13956.1	22q13.1	2011-01-27			ENSG00000189060	ENSG00000189060		"""Histones / Replication-independent"""	4714	protein-coding gene	gene with protein product	"""H1.0, H1(0), H1-0"""	142708		H1FV		3084796	Standard	NM_005318		Approved	H10	uc003aty.3	P07305	OTTHUMG00000150659	ENST00000340857.2:c.133dupT	chr22.hg19:g.38201684_38201684dupT	ENSP00000344504:p.Ser45fs	176.0	0.0		111.0	11.0	NM_005318	B2R6I0|B4DRD6|Q6FG88|Q8N6R3	Frame_Shift_Ins	INS	ENST00000340857.2	hg19	CCDS13956.1																																																																																			.	.		0.574	H1F0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319453.1	NM_005318	
FAM227B	196951	hgsc.bcm.edu	37	15	49620847	49620850	+	Frame_Shift_Del	DEL	TCTC	TCTC	-			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	TCTC	TCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr15:49620847_49620850delTCTC	ENST00000299338.6	-	16	1745_1748	c.1442_1445delGAGA	c.(1441-1446)agagaafs	p.RE481fs	GALK2_ENST00000327171.3_3'UTR	NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	481																	tgCCACACATTCTCTCTCAATTTC	0.348																																					p.481_482del		Atlas-INDEL	.											.	.	.	.	0			c.1443_1446del						.																																			SO:0001589	frameshift_variant	196951	exon16			.		CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.1442_1445delGAGA	chr15.hg19:g.49620851_49620854delTCTC	ENSP00000299338:p.Arg481fs	74.0	0.0		66.0	10.0	NM_152647	Q86WS2	Frame_Shift_Del	DEL	ENST00000299338.6	hg19	CCDS32237.1																																																																																			.	.		0.348	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647	
TRIM67	440730	hgsc.bcm.edu	37	1	231344856	231344857	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr1:231344856_231344857insA	ENST00000366653.5	+	8	1983_1984	c.1983_1984insA	c.(1984-1986)aacfs	p.N662fs	TRIM67_ENST00000444294.3_Frame_Shift_Ins_p.N660fs|TRIM67_ENST00000366652.2_Frame_Shift_Ins_p.N662fs|TRIM67_ENST00000449018.3_Frame_Shift_Ins_p.N600fs			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	662	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ACCGGTACGACAACCACCCAGA	0.629																																					p.D661fs		Atlas-Indel,Pindel	.											.	TRIM67	160	.	0			c.1983_1984insA						.																																			SO:0001589	frameshift_variant	440730	exon8			.	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1985dupA	chr1.hg19:g.231344858_231344858dupA	ENSP00000355613:p.Asn662fs	246.0	0.0		275.0	85.0	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Frame_Shift_Ins	INS	ENST00000366653.5	hg19	CCDS44333.1																																																																																			.	.		0.629	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
TUBE1	51175	hgsc.bcm.edu	37	6	112408473	112408484	+	In_Frame_Del	DEL	CAGAAGCAGCAG	CAGAAGCAGCAG	-	rs146077743		TCGA-DD-A4NQ-01A-21D-A28X-10	TCGA-DD-A4NQ-10A-01D-A28X-10	CAGAAGCAGCAG	CAGAAGCAGCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c2df6b36-605d-46f7-8c66-d9625766c023	7985bd29-3002-4677-91fc-3754d1e3f0a4	g.chr6:112408473_112408484delCAGAAGCAGCAG	ENST00000368662.5	-	2	129_140	c.51_62delCTGCTGCTTCTG	c.(49-63)ggctgctgcttctgg>ggg	p.CCFW18del	FAM229B_ENST00000368656.2_5'Flank|FAM229B_ENST00000604268.1_5'Flank|TUBE1_ENST00000604814.1_5'Flank	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	18					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	TGCCAGGTCCCAGAAGCAGCAGCCGATCTGGT	0.642											OREG0017625	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.18_21del		Atlas-Indel,Pindel	.											.	TUBE1	49	.	0			c.52_63del						.																																			SO:0001651	inframe_deletion	51175	exon2			.	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.51_62delCTGCTGCTTCTG	chr6.hg19:g.112408473_112408484delCAGAAGCAGCAG	ENSP00000357651:p.Cys18_Trp21del	305.0	0.0	1442	258.0	22.0	NM_016262	Q5H8W8|Q8NEG3	In_Frame_Del	DEL	ENST00000368662.5	hg19	CCDS5100.1																																																																																			.	.		0.642	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041867.1	NM_016262	
