#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CELA3B	23436	hgsc.bcm.edu	37	1	22310306	22310306	+	Missense_Mutation	SNP	G	G	T	rs201377315		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:22310306G>T	ENST00000337107.6	+	5	501	c.482G>T	c.(481-483)gGc>gTc	p.G161V		NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	161	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						TACATCACCGGCTGGGGCCGT	0.617																																					p.G161V		Atlas-SNP	.											.	CELA3B	24	.	0			c.G482T						.						94.0	77.0	82.0					1																	22310306		2203	4300	6503	SO:0001583	missense	23436	exon5			TCACCGGCTGGGG	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.482G>T	chr1.hg19:g.22310306G>T	ENSP00000338369:p.Gly161Val	426.0	0.0		427.0	140.0	NM_007352	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Missense_Mutation	SNP	ENST00000337107.6	hg19	CCDS219.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332360	0.81801	.	.	ENSG00000219073	ENST00000337107;ENST00000400277	T;T	0.72615	-0.67;-0.67	4.56	4.56	0.56223	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.056662	0.64402	N	0.000001	D	0.90985	0.7165	H	0.99600	4.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94736	0.7914	10	0.87932	D	0	-57.6144	15.161	0.72785	0.0:0.0:1.0:0.0	.	161	P08861	CEL3B_HUMAN	V	161;64	ENSP00000338369:G161V;ENSP00000383135:G64V	ENSP00000338369:G161V	G	+	2	0	CELA3B	22182893	1.000000	0.71417	0.993000	0.49108	0.928000	0.56348	9.429000	0.97481	2.246000	0.74042	0.555000	0.69702	GGC	.	.		0.617	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
ZMYM4	9202	hgsc.bcm.edu	37	1	35852656	35852656	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:35852656A>G	ENST00000314607.6	+	12	1969	c.1889A>G	c.(1888-1890)cAg>cGg	p.Q630R	ZMYM4_ENST00000373297.2_Missense_Mutation_p.Q541R	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	630					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CCCTTGTCTCAGGGCCAAGTA	0.423																																					p.Q630R		Atlas-SNP	.											.	ZMYM4	143	.	0			c.A1889G						.						65.0	58.0	61.0					1																	35852656		2203	4300	6503	SO:0001583	missense	9202	exon12			TGTCTCAGGGCCA	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1889A>G	chr1.hg19:g.35852656A>G	ENSP00000322915:p.Gln630Arg	78.0	0.0		59.0	21.0	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	hg19	CCDS389.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.906433	0.52333	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.25250	1.81;1.89	5.81	5.81	0.92471	.	0.119831	0.56097	D	0.000025	T	0.29620	0.0739	M	0.73962	2.25	0.46654	D	0.999148	B	0.28880	0.226	B	0.19148	0.024	T	0.07065	-1.0792	10	0.21014	T	0.42	-7.431	16.1637	0.81739	1.0:0.0:0.0:0.0	.	630	Q5VZL5	ZMYM4_HUMAN	R	630;541	ENSP00000322915:Q630R;ENSP00000362394:Q541R	ENSP00000322915:Q630R	Q	+	2	0	ZMYM4	35625243	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.660000	0.74417	2.216000	0.71823	0.533000	0.62120	CAG	.	.		0.423	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
GPR61	83873	hgsc.bcm.edu	37	1	110086824	110086824	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:110086824T>C	ENST00000527748.1	+	2	1863	c.1180T>C	c.(1180-1182)Tcc>Ccc	p.S394P	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	394						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		TCCTTCTGAGTCCTGGGTTTC	0.602																																					p.S394P		Atlas-SNP	.											.	GPR61	60	.	0			c.T1180C						.						37.0	41.0	39.0					1																	110086824		2203	4299	6502	SO:0001583	missense	83873	exon2			TCTGAGTCCTGGG	AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.1180T>C	chr1.hg19:g.110086824T>C	ENSP00000432456:p.Ser394Pro	66.0	0.0		92.0	26.0	NM_031936	A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	ENST00000527748.1	hg19	CCDS801.1	.	.	.	.	.	.	.	.	.	.	T	7.885	0.731059	0.15507	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.70045	-0.45	5.2	2.84	0.33178	.	0.211592	0.41194	D	0.000924	T	0.13543	0.0328	N	0.01874	-0.695	0.31276	N	0.691132	B	0.02656	0.0	B	0.01281	0.0	T	0.05225	-1.0898	10	0.38643	T	0.18	-10.8095	0.1371	0.00080	0.2679:0.1814:0.1705:0.3801	.	394	Q9BZJ8	GPR61_HUMAN	P	394;522	ENSP00000432456:S394P	ENSP00000286603:S522P	S	+	1	0	GPR61	109888347	0.994000	0.37717	0.999000	0.59377	0.924000	0.55760	0.355000	0.20163	0.990000	0.38787	0.533000	0.62120	TCC	.	.		0.602	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1		
LAMC2	3918	hgsc.bcm.edu	37	1	183184629	183184629	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:183184629T>A	ENST00000264144.4	+	3	375	c.310T>A	c.(310-312)Tgt>Agt	p.C104S	LAMC2_ENST00000493293.1_Missense_Mutation_p.C104S	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	104	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						ACGGTGCAGCTGTAAACCAGG	0.522																																					p.C104S		Atlas-SNP	.											.	LAMC2	113	.	0			c.T310A						.						113.0	100.0	105.0					1																	183184629		2203	4300	6503	SO:0001583	missense	3918	exon3			TGCAGCTGTAAAC	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.310T>A	chr1.hg19:g.183184629T>A	ENSP00000264144:p.Cys104Ser	97.0	0.0		62.0	34.0	NM_005562	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	hg19	CCDS1352.1	.	.	.	.	.	.	.	.	.	.	T	33	5.287600	0.95517	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	D;D	0.94280	-3.39;-3.39	4.97	4.97	0.65823	EGF-like, laminin (4);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.98197	0.9404	H	0.99777	4.77	0.80722	D	1	D;P	0.58970	0.984;0.702	P;P	0.61275	0.886;0.544	D	0.99078	1.0836	10	0.59425	D	0.04	.	14.6551	0.68828	0.0:0.0:0.0:1.0	.	104;104	Q13753;Q13753-2	LAMC2_HUMAN;.	S	104	ENSP00000432063:C104S;ENSP00000264144:C104S	ENSP00000264144:C104S	C	+	1	0	LAMC2	181451252	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.173000	0.77612	1.881000	0.54492	0.533000	0.62120	TGT	.	.		0.522	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562	
FAM129A	116496	hgsc.bcm.edu	37	1	184787922	184787922	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:184787922C>A	ENST00000367511.3	-	9	1216	c.1023G>T	c.(1021-1023)gaG>gaT	p.E341D	FAM129A_ENST00000487074.1_5'UTR|RNU7-13P_ENST00000516413.1_RNA	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	341					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						GCTGCACACTCTCCAAGCAGC	0.532																																					p.E341D		Atlas-SNP	.											.	FAM129A	98	.	0			c.G1023T						.						131.0	134.0	133.0					1																	184787922		2203	4300	6503	SO:0001583	missense	116496	exon9			CACACTCTCCAAG	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.1023G>T	chr1.hg19:g.184787922C>A	ENSP00000356481:p.Glu341Asp	104.0	0.0		69.0	35.0	NM_052966	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	hg19	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	C	9.395	1.076604	0.20227	.	.	ENSG00000135842	ENST00000367511	T	0.13196	2.61	5.05	3.13	0.36017	.	0.050867	0.85682	N	0.000000	T	0.14527	0.0351	M	0.64997	1.995	0.40464	D	0.980277	B	0.24043	0.096	B	0.27796	0.083	T	0.04427	-1.0952	10	0.45353	T	0.12	-21.3025	6.6188	0.22792	0.0:0.6535:0.1377:0.2088	.	341	Q9BZQ8	NIBAN_HUMAN	D	341	ENSP00000356481:E341D	ENSP00000356481:E341D	E	-	3	2	FAM129A	183054545	0.627000	0.27129	0.988000	0.46212	0.041000	0.13682	-0.125000	0.10579	0.600000	0.29862	0.557000	0.71058	GAG	.	.		0.532	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
NEK2	4751	hgsc.bcm.edu	37	1	211840446	211840446	+	Splice_Site	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:211840446A>T	ENST00000366999.4	-	7	1250		c.e7+1		NEK2_ENST00000462283.1_Splice_Site|NEK2_ENST00000366998.3_Silent_p.G371G|NEK2_ENST00000540251.1_Splice_Site	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2						blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		TGATTCTCATACCTGGATTAC	0.438																																					p.G371G		Atlas-SNP	.											.	NEK2	49	.	0			c.T1113A						.						82.0	80.0	81.0					1																	211840446		2203	4300	6503	SO:0001630	splice_region_variant	4751	exon7			TCTCATACCTGGA	U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.1111+1T>A	chr1.hg19:g.211840446A>T		214.0	0.0		241.0	67.0	NM_001204183	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Silent	SNP	ENST00000366999.4	hg19	CCDS1500.1	.	.	.	.	.	.	.	.	.	.	A	18.97	3.735886	0.69189	.	.	ENSG00000117650	ENST00000366999;ENST00000540251	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8954	0.70642	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEK2	209907069	1.000000	0.71417	0.999000	0.59377	0.841000	0.47740	5.321000	0.65846	2.054000	0.61138	0.528000	0.53228	.	.	.		0.438	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	Intron
OR2L8	391190	hgsc.bcm.edu	37	1	248112914	248112914	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr1:248112914C>T	ENST00000357191.3	+	1	755	c.755C>T	c.(754-756)gCa>gTa	p.A252V	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCTACTATGCACCTTTTGTC	0.478																																					p.A252V		Atlas-SNP	.											OR2L8,right_upper_lobe,carcinoma,0,1	OR2L8	92	.	0			c.C755T						.						143.0	103.0	116.0					1																	248112914		2203	4298	6501	SO:0001583	missense	391190	exon1			ACTATGCACCTTT	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.755C>T	chr1.hg19:g.248112914C>T	ENSP00000349719:p.Ala252Val	204.0	0.0		170.0	46.0	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	hg19	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	0.161	-1.081091	0.01888	.	.	ENSG00000196936	ENST00000357191	T	0.35421	1.31	1.8	-0.381	0.12485	GPCR, rhodopsin-like superfamily (1);	0.590255	0.12675	N	0.448469	T	0.12050	0.0293	N	0.01505	-0.83	0.09310	N	1	B	0.12013	0.005	B	0.19666	0.026	T	0.20538	-1.0272	10	0.51188	T	0.08	.	3.7754	0.08657	0.0:0.3475:0.3505:0.302	.	252	Q8NGY9	OR2L8_HUMAN	V	252	ENSP00000349719:A252V	ENSP00000349719:A252V	A	+	2	0	OR2L8	246179537	0.000000	0.05858	0.211000	0.23655	0.010000	0.07245	-0.477000	0.06583	-0.281000	0.09141	-0.443000	0.05667	GCA	.	.		0.478	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
CPSF3	51692	hgsc.bcm.edu	37	2	9574031	9574031	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:9574031A>G	ENST00000238112.3	+	6	757	c.551A>G	c.(550-552)gAa>gGa	p.E184G	CPSF3_ENST00000460593.1_Missense_Mutation_p.E147G	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	184					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TCAAGACAAGAAGATAGGCAC	0.308																																					p.E184G	Colon(194;1259 2048 3845 5218 19985)	Atlas-SNP	.											.	CPSF3	63	.	0			c.A551G						.						90.0	98.0	95.0					2																	9574031		2203	4299	6502	SO:0001583	missense	51692	exon6			GACAAGAAGATAG	AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.551A>G	chr2.hg19:g.9574031A>G	ENSP00000238112:p.Glu184Gly	343.0	0.0		357.0	107.0	NM_016207	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	ENST00000238112.3	hg19	CCDS1664.1	.	.	.	.	.	.	.	.	.	.	A	32	5.114925	0.94339	.	.	ENSG00000119203	ENST00000238112;ENST00000427001;ENST00000460593	T;T	0.42131	0.98;0.98	5.72	5.72	0.89469	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	T	0.59595	0.2205	L	0.58925	1.835	0.80722	D	1	D;P	0.69078	0.997;0.846	D;D	0.64776	0.916;0.929	T	0.60203	-0.7309	10	0.51188	T	0.08	-11.5964	15.9926	0.80217	1.0:0.0:0.0:0.0	.	184;184	E7ER23;Q9UKF6	.;CPSF3_HUMAN	G	184;184;147	ENSP00000238112:E184G;ENSP00000418957:E147G	ENSP00000238112:E184G	E	+	2	0	CPSF3	9491482	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.307000	0.96226	2.179000	0.69175	0.482000	0.46254	GAA	.	.		0.308	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206843.1	NM_016207	
MGAT5	4249	hgsc.bcm.edu	37	2	135206375	135206375	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:135206375A>T	ENST00000409645.1	+	17	2435	c.2183A>T	c.(2182-2184)gAc>gTc	p.D728V	MGAT5_ENST00000281923.2_Missense_Mutation_p.D728V			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	728					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CCCTGCCGGGACTTCATCAAG	0.607																																					p.D728V		Atlas-SNP	.											.	MGAT5	84	.	0			c.A2183T						.						49.0	52.0	51.0					2																	135206375		2203	4300	6503	SO:0001583	missense	4249	exon16			GCCGGGACTTCAT	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.2183A>T	chr2.hg19:g.135206375A>T	ENSP00000386377:p.Asp728Val	130.0	0.0		126.0	33.0	NM_002410	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	hg19	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.647197	0.87958	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.79293	0.4421	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.82524	-0.0414	9	0.87932	D	0	-22.0629	15.088	0.72170	1.0:0.0:0.0:0.0	.	728	Q09328	MGT5A_HUMAN	V	728	.	ENSP00000281923:D728V	D	+	2	0	MGAT5	134922845	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.183000	0.94887	2.041000	0.60428	0.533000	0.62120	GAC	.	.		0.607	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
COL3A1	1281	hgsc.bcm.edu	37	2	189856233	189856233	+	Silent	SNP	C	C	T	rs138569287		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:189856233C>T	ENST00000304636.3	+	12	1043	c.873C>T	c.(871-873)ggC>ggT	p.G291G	COL3A1_ENST00000317840.5_Silent_p.G291G	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	291	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GTCTTCCAGGCGAAAATGGAG	0.299																																					p.G291G		Atlas-SNP	.											COL3A1,NS,carcinoma,0,1	COL3A1	292	.	0			c.C873T						.	C		0,4406		0,0,2203	62.0	66.0	65.0		873	2.0	1.0	2	dbSNP_134	65	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	COL3A1	NM_000090.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		291/1467	189856233	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1281	exon12			TCCAGGCGAAAAT	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.873C>T	chr2.hg19:g.189856233C>T		270.0	0.0		256.0	74.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Silent	SNP	ENST00000304636.3	hg19	CCDS2297.1																																																																																			.	C|1.000;T|0.000		0.299	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
SGOL2	151246	hgsc.bcm.edu	37	2	201399894	201399894	+	Splice_Site	SNP	G	G	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:201399894G>C	ENST00000357799.4	+	3	407	c.309G>C	c.(307-309)ttG>ttC	p.L103F	SGOL2_ENST00000469840.1_3'UTR|SGOL2_ENST00000409203.3_Splice_Site_p.L103F	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	103					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						TAAATAACTTGGTATGTAAGC	0.269																																					p.L103F		Atlas-SNP	.											.	SGOL2	126	.	0			c.G309C						.						72.0	66.0	68.0					2																	201399894		1791	4056	5847	SO:0001630	splice_region_variant	151246	exon3			TAACTTGGTATGT	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.309+1G>C	chr2.hg19:g.201399894G>C		364.0	0.0		335.0	71.0	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	hg19	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753534	0.69648	.	.	ENSG00000163535	ENST00000357799;ENST00000409203	T;T	0.24151	1.87;1.87	5.46	5.46	0.80206	.	0.000000	0.42420	D	0.000708	T	0.51007	0.1649	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;1.0;1.0;0.998	T	0.51332	-0.8719	10	0.72032	D	0.01	-4.64	17.0919	0.86624	0.0:0.0:1.0:0.0	.	103;103;103;103	B7Z7S9;Q562F6-2;Q562F6;Q562F6-3	.;.;SGOL2_HUMAN;.	F	103	ENSP00000350447:L103F;ENSP00000386249:L103F	ENSP00000350447:L103F	L	+	3	2	SGOL2	201108139	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	6.310000	0.72830	2.572000	0.86782	0.467000	0.42956	TTG	.	.		0.269	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	Missense_Mutation
PLCD4	84812	hgsc.bcm.edu	37	2	219499332	219499332	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:219499332A>C	ENST00000450993.2	+	13	2214	c.1875A>C	c.(1873-1875)aaA>aaC	p.K625N	PLCD4_ENST00000432688.1_Missense_Mutation_p.K657N|RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000417849.1_Missense_Mutation_p.K625N	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	625	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GCCCTTTCAAAGCCCAGACTC	0.507																																					p.K625N		Atlas-SNP	.											.	PLCD4	51	.	0			c.A1875C						.						182.0	170.0	174.0					2																	219499332		1895	4105	6000	SO:0001583	missense	84812	exon13			TTTCAAAGCCCAG	AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1875A>C	chr2.hg19:g.219499332A>C	ENSP00000388631:p.Lys625Asn	152.0	0.0		146.0	50.0	NM_032726	Q53FS8	Missense_Mutation	SNP	ENST00000450993.2	hg19	CCDS46516.1	.	.	.	.	.	.	.	.	.	.	A	9.967	1.224451	0.22457	.	.	ENSG00000115556	ENST00000450993;ENST00000251959;ENST00000417849;ENST00000432688	T;T;T	0.18502	2.24;2.24;2.21	5.19	-0.201	0.13212	C2 membrane targeting protein (1);PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);C2 calcium/lipid-binding domain, CaLB (1);	0.394774	0.28865	N	0.013891	T	0.08313	0.0207	N	0.13168	0.305	0.26698	N	0.971216	B	0.14012	0.009	B	0.12837	0.008	T	0.30534	-0.9975	10	0.27785	T	0.31	.	8.6332	0.33933	0.5598:0.0:0.4402:0.0	.	625	Q9BRC7	PLCD4_HUMAN	N	625;625;625;657	ENSP00000388631:K625N;ENSP00000396942:K625N;ENSP00000396185:K657N	ENSP00000251959:K625N	K	+	3	2	PLCD4	219207576	0.998000	0.40836	0.909000	0.35828	0.900000	0.52787	0.909000	0.28558	0.060000	0.16281	-0.230000	0.12252	AAA	.	.		0.507	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1		
HDLBP	3069	hgsc.bcm.edu	37	2	242194526	242194526	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:242194526G>C	ENST00000391975.1	-	9	1355	c.1128C>G	c.(1126-1128)caC>caG	p.H376Q	HDLBP_ENST00000427183.2_Missense_Mutation_p.H343Q|HDLBP_ENST00000310931.4_Missense_Mutation_p.H376Q|HDLBP_ENST00000391976.2_Missense_Mutation_p.H376Q	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	376	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TGATGAAACGGTGAAGCCAGG	0.493																																					p.H376Q		Atlas-SNP	.											.	HDLBP	118	.	0			c.C1128G						.						186.0	200.0	195.0					2																	242194526		2203	4300	6503	SO:0001583	missense	3069	exon9			GAAACGGTGAAGC		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1128C>G	chr2.hg19:g.242194526G>C	ENSP00000375836:p.His376Gln	75.0	0.0		73.0	21.0	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	hg19	CCDS2547.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	19.16|19.16|19.16	3.774071|3.774071|3.774071	0.69992|0.69992|0.69992	.|.|.	.|.|.	ENSG00000115677|ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183|ENST00000373292|ENST00000453141	T;T;T;T|.|.	0.33654|.|.	1.4;1.4;1.4;1.4|.|.	5.93|5.93|5.93	3.17|3.17|3.17	0.36434|0.36434|0.36434	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.73946|0.73946|0.73946	0.3652|0.3652|0.3652	M|M|M	0.86651|0.86651|0.86651	2.83|2.83|2.83	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0|.|.	D;D;D|.|.	0.97110|.|.	1.0;0.996;1.0|.|.	T|T|T	0.72070|0.72070|0.72070	-0.4401|-0.4401|-0.4401	10|5|5	0.66056|.|.	D|.|.	0.02|.|.	-42.5724|-42.5724|-42.5724	7.7771|7.7771|7.7771	0.29043|0.29043|0.29043	0.4322:0.0:0.5678:0.0|0.4322:0.0:0.5678:0.0|0.4322:0.0:0.5678:0.0	.|.|.	376;343;376|.|.	B2R5V9;E7EM71;Q00341|.|.	.;.;VIGLN_HUMAN|.|.	Q|A|S	376;376;376;343|185|254	ENSP00000375836:H376Q;ENSP00000375837:H376Q;ENSP00000312042:H376Q;ENSP00000399139:H343Q|.|.	ENSP00000312042:H376Q|.|.	H|P|T	-|-|-	3|1|2	2|0|0	HDLBP|HDLBP|HDLBP	241843199|241843199|241843199	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.994000|0.994000|0.994000	0.49952|0.49952|0.49952	0.920000|0.920000|0.920000	0.55202|0.55202|0.55202	0.936000|0.936000|0.936000	0.28938|0.28938|0.28938	0.413000|0.413000|0.413000	0.25759|0.25759|0.25759	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	CAC|CCG|ACC	.	.		0.493	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
CTNNB1	1499	hgsc.bcm.edu	37	3	41274910	41274910	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr3:41274910A>T	ENST00000349496.5	+	8	1440	c.1160A>T	c.(1159-1161)aAt>aTt	p.N387I	CTNNB1_ENST00000396183.3_Missense_Mutation_p.N387I|CTNNB1_ENST00000396185.3_Missense_Mutation_p.N387I|CTNNB1_ENST00000405570.1_Missense_Mutation_p.N387I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.N380I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	387					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTCTCAGGAATCTTTCAGAT	0.393		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.N387I	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	4904	.	0			c.A1160T						.						102.0	93.0	96.0					3																	41274910		2203	4300	6503	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TCAGGAATCTTTC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1160A>T	chr3.hg19:g.41274910A>T	ENSP00000344456:p.Asn387Ile	126.0	0.0		152.0	45.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632816	0.87660	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93767	0.7071	10	0.87932	D	0	-10.1444	15.9983	0.80268	1.0:0.0:0.0:0.0	.	315;387	B4DSW9;P35222	.;CTNB1_HUMAN	I	387;387;387;380;387	ENSP00000385604:N387I;ENSP00000379486:N387I;ENSP00000344456:N387I;ENSP00000411226:N380I;ENSP00000379488:N387I	ENSP00000344456:N387I	N	+	2	0	CTNNB1	41249914	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.339000	0.96797	2.171000	0.68590	0.533000	0.62120	AAT	.	.		0.393	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CCDC13	152206	hgsc.bcm.edu	37	3	42781149	42781149	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr3:42781149C>T	ENST00000310232.6	-	9	1224	c.1141G>A	c.(1141-1143)Gac>Aac	p.D381N	CCDC13-AS1_ENST00000446950.1_RNA|CCDC13-AS1_ENST00000418161.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	381										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						ATGAGCTCGTCATCATGCCGG	0.602																																					p.D381N		Atlas-SNP	.											.	CCDC13	71	.	0			c.G1141A						.						158.0	135.0	143.0					3																	42781149		2203	4300	6503	SO:0001583	missense	152206	exon9			GCTCGTCATCATG	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1141G>A	chr3.hg19:g.42781149C>T	ENSP00000309836:p.Asp381Asn	117.0	0.0		105.0	40.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055293	0.75960	.	.	ENSG00000244607	ENST00000310232	T	0.35973	1.28	5.27	5.27	0.74061	.	0.050358	0.85682	D	0.000000	T	0.33177	0.0854	L	0.38692	1.165	0.42629	D	0.993375	P	0.45474	0.859	P	0.46253	0.509	T	0.03443	-1.1036	10	0.29301	T	0.29	.	11.2031	0.48754	0.0:0.9139:0.0:0.0861	.	381	Q8IYE1	CCD13_HUMAN	N	381	ENSP00000309836:D381N	ENSP00000309836:D381N	D	-	1	0	CCDC13	42756153	0.998000	0.40836	0.999000	0.59377	0.952000	0.60782	3.962000	0.56766	2.472000	0.83506	0.561000	0.74099	GAC	.	.		0.602	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
RRP9	9136	hgsc.bcm.edu	37	3	51969471	51969471	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr3:51969471C>T	ENST00000232888.6	-	10	931	c.858G>A	c.(856-858)gtG>gtA	p.V286V		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	286					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CCAGTGCAGCCACAGCGTCCT	0.627																																					p.V286V		Atlas-SNP	.											.	RRP9	40	.	0			c.G858A						.						68.0	57.0	60.0					3																	51969471		2203	4300	6503	SO:0001819	synonymous_variant	9136	exon10			TGCAGCCACAGCG	AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.858G>A	chr3.hg19:g.51969471C>T		78.0	0.0		83.0	32.0	NM_004704	B2R996|Q8IZ30	Silent	SNP	ENST00000232888.6	hg19	CCDS2837.1																																																																																			.	.		0.627	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704	
PDHB	5162	hgsc.bcm.edu	37	3	58419520	58419520	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr3:58419520C>T	ENST00000302746.6	-	1	59	c.17G>A	c.(16-18)gGc>gAc	p.G6D	PDHB_ENST00000485460.1_Missense_Mutation_p.G6D|PDHB_ENST00000474765.1_Missense_Mutation_p.G6D	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	6					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	CCGCACCAAGCCAGACACCGC	0.697																																					p.G6D		Atlas-SNP	.											.	PDHB	19	.	0			c.G17A						.						23.0	24.0	24.0					3																	58419520		2189	4283	6472	SO:0001583	missense	5162	exon1			ACCAAGCCAGACA		CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.17G>A	chr3.hg19:g.58419520C>T	ENSP00000307241:p.Gly6Asp	104.0	0.0		140.0	29.0	NM_000925	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Missense_Mutation	SNP	ENST00000302746.6	hg19	CCDS2890.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.238260	0.39598	.	.	ENSG00000168291	ENST00000302746;ENST00000383714;ENST00000485460;ENST00000474765	D;D;D;D	0.97976	-4.07;-4.06;-4.64;-3.99	5.37	2.57	0.30868	.	0.508615	0.22001	N	0.066013	D	0.91630	0.7355	N	0.08118	0	0.09310	N	1	B;B;B;B	0.29085	0.01;0.232;0.062;0.01	B;B;B;B	0.30029	0.007;0.11;0.094;0.007	D	0.83412	0.0028	10	0.18710	T	0.47	-1.4522	10.2168	0.43173	0.1429:0.5812:0.2758:0.0	.	6;6;6;6	B4DDD7;C9J634;P11177-2;P11177	.;.;.;ODPB_HUMAN	D	6	ENSP00000307241:G6D;ENSP00000373220:G6D;ENSP00000417267:G6D;ENSP00000418448:G6D	ENSP00000307241:G6D	G	-	2	0	PDHB	58394560	0.000000	0.05858	0.001000	0.08648	0.690000	0.40134	-0.644000	0.05415	0.375000	0.24679	0.561000	0.74099	GGC	.	.		0.697	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353558.1		
PPP2R3A	5523	hgsc.bcm.edu	37	3	135825091	135825091	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr3:135825091T>A	ENST00000264977.3	+	13	3873	c.3256T>A	c.(3256-3258)Tgg>Agg	p.W1086R	PPP2R3A_ENST00000334546.2_Missense_Mutation_p.W465R|PPP2R3A_ENST00000490467.1_Missense_Mutation_p.W350R|PPP2R3A_ENST00000469270.1_3'UTR	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	1086					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCCCTCAGACTGGGACCGGTT	0.458																																					p.W1086R		Atlas-SNP	.											.	PPP2R3A	114	.	0			c.T3256A						.						71.0	72.0	72.0					3																	135825091		2203	4300	6503	SO:0001583	missense	5523	exon13			TCAGACTGGGACC	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.3256T>A	chr3.hg19:g.135825091T>A	ENSP00000264977:p.Trp1086Arg	82.0	0.0		107.0	25.0	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	hg19	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.766989	0.90020	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546	T;T;T	0.39229	1.09;1.09;1.09	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.71476	0.3344	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78011	-0.2371	10	0.87932	D	0	.	15.7305	0.77800	0.0:0.0:0.0:1.0	.	465;1086	Q06190-2;Q06190	.;P2R3A_HUMAN	R	1086;350;465	ENSP00000264977:W1086R;ENSP00000419344:W350R;ENSP00000334748:W465R	ENSP00000264977:W1086R	W	+	1	0	PPP2R3A	137307781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.499000	0.81566	2.299000	0.77371	0.528000	0.53228	TGG	.	.		0.458	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
SLIT2	9353	hgsc.bcm.edu	37	4	20525746	20525746	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:20525746C>T	ENST00000504154.1	+	14	1636	c.1384C>T	c.(1384-1386)Cgc>Tgc	p.R462C	SLIT2_ENST00000503823.1_Missense_Mutation_p.R462C|SLIT2_ENST00000273739.5_Missense_Mutation_p.R466C|SLIT2_ENST00000503837.1_Missense_Mutation_p.R466C	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	462	LRRCT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CAGCCCCCGCCGCCTGGCAAA	0.483																																					p.R462C		Atlas-SNP	.											SLIT2,NS,lymphoid_neoplasm,0,1	SLIT2	290	.	0			c.C1384T						.						109.0	123.0	118.0					4																	20525746		2203	4300	6503	SO:0001583	missense	9353	exon14			CCCCGCCGCCTGG	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1384C>T	chr4.hg19:g.20525746C>T	ENSP00000422591:p.Arg462Cys	118.0	0.0		92.0	31.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	hg19	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	32	5.172718	0.94807	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;T;T	0.81579	-1.5;-1.51;-1.43;-1.48	5.93	5.93	0.95920	Cysteine-rich flanking region, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.91119	0.7204	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.977;1.0	D	0.91338	0.5095	10	0.87932	D	0	.	20.3368	0.98748	0.0:1.0:0.0:0.0	.	462;462	O94813-3;O94813	.;SLIT2_HUMAN	C	462;462;466;466;466	ENSP00000427548:R462C;ENSP00000422591:R462C;ENSP00000273739:R466C;ENSP00000422261:R466C	ENSP00000273739:R466C	R	+	1	0	SLIT2	20134844	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.770000	0.85390	2.805000	0.96524	0.655000	0.94253	CGC	.	.		0.483	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SCD5	79966	hgsc.bcm.edu	37	4	83626515	83626515	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:83626515C>T	ENST00000319540.4	-	2	603	c.284G>A	c.(283-285)cGc>cAc	p.R95H	SCD5_ENST00000273908.4_Missense_Mutation_p.R95H|SCD5_ENST00000282709.4_Missense_Mutation_p.R95H	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	95					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				GCTCCACAAGCGATGGGCACC	0.582																																					p.R95H		Atlas-SNP	.											.	SCD5	58	.	0			c.G284A						.						66.0	60.0	62.0					4																	83626515		2203	4300	6503	SO:0001583	missense	79966	exon2			CACAAGCGATGGG	AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.284G>A	chr4.hg19:g.83626515C>T	ENSP00000316329:p.Arg95His	203.0	0.0		168.0	47.0	NM_024906	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	ENST00000319540.4	hg19	CCDS34024.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813311	0.90707	.	.	ENSG00000145284	ENST00000319540;ENST00000273908;ENST00000282709	T;T	0.00949	5.51;5.51	5.12	4.27	0.50696	Fatty acid desaturase, type 1 (1);	0.097978	0.64402	N	0.000003	T	0.13543	0.0328	H	0.99746	4.745	0.51482	D	0.999926	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.35847	-0.9772	10	0.87932	D	0	-6.1917	14.1484	0.65364	0.0:0.9258:0.0:0.0742	.	95;95;95	Q9BSN4;Q86SK9-2;Q86SK9	.;.;SCD5_HUMAN	H	95	ENSP00000316329:R95H;ENSP00000273908:R95H	ENSP00000273908:R95H	R	-	2	0	SCD5	83845539	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.706000	0.68362	1.496000	0.48567	0.491000	0.48974	CGC	.	.		0.582	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
MMRN1	22915	hgsc.bcm.edu	37	4	90856220	90856220	+	Silent	SNP	T	T	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:90856220T>C	ENST00000394980.1	+	7	1708	c.1389T>C	c.(1387-1389)atT>atC	p.I463I	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000508372.1_Silent_p.I205I|MMRN1_ENST00000264790.2_Silent_p.I463I			Q13201	MMRN1_HUMAN	multimerin 1	463					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GGAATCACATTGTGAATGTAA	0.388																																					p.I463I		Atlas-SNP	.											.	MMRN1	174	.	0			c.T1389C						.						69.0	69.0	69.0					4																	90856220		2202	4299	6501	SO:0001819	synonymous_variant	22915	exon6			TCACATTGTGAAT	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1389T>C	chr4.hg19:g.90856220T>C		264.0	0.0		269.0	97.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	hg19	CCDS3635.1																																																																																			.	.		0.388	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
PCDH10	57575	hgsc.bcm.edu	37	4	134072769	134072769	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:134072769G>C	ENST00000264360.5	+	1	2300	c.1474G>C	c.(1474-1476)Gag>Cag	p.E492Q	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	492	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CGACCGGGATGAGGGCGCCAA	0.587																																					p.E492Q		Atlas-SNP	.											.	PCDH10	290	.	0			c.G1474C						.						60.0	61.0	61.0					4																	134072769		2203	4300	6503	SO:0001583	missense	57575	exon1			CGGGATGAGGGCG	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1474G>C	chr4.hg19:g.134072769G>C	ENSP00000264360:p.Glu492Gln	63.0	0.0		71.0	4.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	hg19	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	4.768	0.142716	0.09083	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.52057	0.68	4.51	4.51	0.55191	Cadherin (4);Cadherin-like (1);	0.000000	0.43579	D	0.000556	T	0.40719	0.1128	L	0.49455	1.56	0.34300	D	0.684218	B;B	0.06786	0.001;0.001	B;B	0.13407	0.004;0.009	T	0.48281	-0.9049	10	0.22109	T	0.4	.	12.6201	0.56597	0.0:0.1681:0.8319:0.0	.	492;492	Q9P2E7;Q96SF0	PCD10_HUMAN;.	Q	492	ENSP00000264360:E492Q	ENSP00000264360:E492Q	E	+	1	0	PCDH10	134292219	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	3.160000	0.50739	2.329000	0.79093	0.655000	0.94253	GAG	.	.		0.587	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
POU4F2	5458	hgsc.bcm.edu	37	4	147561765	147561765	+	Silent	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:147561765G>A	ENST00000281321.3	+	2	1283	c.1035G>A	c.(1033-1035)aaG>aaA	p.K345K	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	345					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					GCGCGGAGAAGAAGCGCAAGC	0.612																																					p.K345K		Atlas-SNP	.											.	POU4F2	83	.	0			c.G1035A						.						87.0	91.0	90.0					4																	147561765		2203	4300	6503	SO:0001819	synonymous_variant	5458	exon2			GGAGAAGAAGCGC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.1035G>A	chr4.hg19:g.147561765G>A		80.0	0.0		74.0	27.0	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	hg19	CCDS34074.1																																																																																			.	.		0.612	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
ADAM29	11086	hgsc.bcm.edu	37	4	175897952	175897952	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:175897952C>T	ENST00000359240.3	+	5	1946	c.1276C>T	c.(1276-1278)Ctg>Ttg	p.L426L	ADAM29_ENST00000445694.1_Silent_p.L426L|ADAM29_ENST00000404450.4_Silent_p.L426L|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Silent_p.L426L	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	426	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TCCCTGCTGTCTGTCAAATTG	0.448																																					p.L426L	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											.	ADAM29	262	.	0			c.C1276T						.						215.0	203.0	207.0					4																	175897952		2203	4300	6503	SO:0001819	synonymous_variant	11086	exon4			TGCTGTCTGTCAA	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1276C>T	chr4.hg19:g.175897952C>T		120.0	0.0		101.0	38.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	hg19	CCDS3823.1																																																																																			.	.		0.448	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
IRX1	79192	hgsc.bcm.edu	37	5	3600047	3600047	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:3600047G>A	ENST00000302006.3	+	2	1037	c.985G>A	c.(985-987)Gcg>Acg	p.A329T	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	329					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CCCCGACGGTGCGCCCAAGGC	0.776																																					p.A329T		Atlas-SNP	.											.	IRX1	106	.	0			c.G985A						.						3.0	4.0	3.0					5																	3600047		1708	3452	5160	SO:0001583	missense	79192	exon2			GACGGTGCGCCCA	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.985G>A	chr5.hg19:g.3600047G>A	ENSP00000305244:p.Ala329Thr	54.0	0.0		74.0	28.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	hg19	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	G	5.109	0.205786	0.09704	.	.	ENSG00000170549	ENST00000302006	T	0.59224	0.28	4.52	2.71	0.32032	.	0.390344	0.21896	N	0.067504	T	0.41119	0.1145	L	0.35414	1.06	0.42008	D	0.990924	B	0.09022	0.002	B	0.06405	0.002	T	0.16188	-1.0411	10	0.14656	T	0.56	.	9.8869	0.41266	0.1674:0.0:0.8326:0.0	.	329	P78414	IRX1_HUMAN	T	329	ENSP00000305244:A329T	ENSP00000305244:A329T	A	+	1	0	IRX1	3653047	0.975000	0.34042	0.982000	0.44146	0.012000	0.07955	2.352000	0.44080	0.863000	0.35553	-0.251000	0.11542	GCG	.	.		0.776	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
NIPBL	25836	hgsc.bcm.edu	37	5	37008169	37008169	+	Silent	SNP	T	T	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:37008169T>C	ENST00000282516.8	+	19	4798	c.4299T>C	c.(4297-4299)tgT>tgC	p.C1433C	NIPBL_ENST00000448238.2_Silent_p.C1433C	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1433					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TACAGTTGTGTGCCATTAAGT	0.299																																					p.C1433C		Atlas-SNP	.											.	NIPBL	513	.	0			c.T4299C						.						100.0	95.0	97.0					5																	37008169		2202	4297	6499	SO:0001819	synonymous_variant	25836	exon19			GTTGTGTGCCATT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4299T>C	chr5.hg19:g.37008169T>C		248.0	0.0		241.0	77.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.		0.299	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
MAP1B	4131	hgsc.bcm.edu	37	5	71493190	71493190	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:71493190C>T	ENST00000296755.7	+	5	4306	c.4008C>T	c.(4006-4008)taC>taT	p.Y1336Y		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1336					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ACACACCTTACTATCAATCTC	0.458																																					p.Y1336Y	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.C4008T						.						67.0	65.0	66.0					5																	71493190		2203	4300	6503	SO:0001819	synonymous_variant	4131	exon5			ACCTTACTATCAA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4008C>T	chr5.hg19:g.71493190C>T		107.0	0.0		109.0	36.0	NM_005909	A2BDK5	Silent	SNP	ENST00000296755.7	hg19	CCDS4012.1																																																																																			.	.		0.458	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
CMYA5	202333	hgsc.bcm.edu	37	5	79026634	79026634	+	Silent	SNP	C	C	T	rs539952978		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:79026634C>T	ENST00000446378.2	+	2	2077	c.2046C>T	c.(2044-2046)gaC>gaT	p.D682D		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	682					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TATCAGGAGACGAGGCCTCAG	0.453													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21643	0.0		0.0	False		,,,				2504	0.0				p.D682D		Atlas-SNP	.											.	CMYA5	643	.	0			c.C2046T						.						54.0	50.0	51.0					5																	79026634		1922	4126	6048	SO:0001819	synonymous_variant	202333	exon2			AGGAGACGAGGCC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.2046C>T	chr5.hg19:g.79026634C>T		106.0	0.0		148.0	6.0	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	hg19	CCDS47238.1																																																																																			.	.		0.453	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
ACOT12	134526	hgsc.bcm.edu	37	5	80626218	80626218	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:80626218A>C	ENST00000307624.3	-	15	1691	c.1663T>G	c.(1663-1665)Ttt>Gtt	p.F555V	ACOT12_ENST00000508234.1_5'UTR	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	555					acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		GACCTTTAAAATGTGCTTACA	0.398																																					p.F555V		Atlas-SNP	.											.	ACOT12	57	.	0			c.T1663G						.						68.0	70.0	69.0					5																	80626218		2203	4300	6503	SO:0001583	missense	134526	exon15			TTTAAAATGTGCT	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.1663T>G	chr5.hg19:g.80626218A>C	ENSP00000303246:p.Phe555Val	109.0	0.0		139.0	76.0	NM_130767	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	hg19	CCDS4055.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.859962	0.32884	.	.	ENSG00000172497	ENST00000307624	T	0.13420	2.59	5.2	0.0617	0.14341	.	1.015390	0.07891	N	0.971204	T	0.08582	0.0213	N	0.22421	0.69	0.09310	N	1	B	0.15930	0.015	B	0.12156	0.007	T	0.38908	-0.9639	10	0.54805	T	0.06	-4.3237	3.2289	0.06741	0.5451:0.0:0.283:0.1719	.	555	Q8WYK0	ACO12_HUMAN	V	555	ENSP00000303246:F555V	ENSP00000303246:F555V	F	-	1	0	ACOT12	80661974	0.186000	0.23225	0.001000	0.08648	0.243000	0.25628	0.853000	0.27777	0.060000	0.16281	0.459000	0.35465	TTT	.	.		0.398	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767	
GPR98	84059	hgsc.bcm.edu	37	5	89924641	89924641	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:89924641C>A	ENST00000405460.2	+	8	1597	c.1501C>A	c.(1501-1503)Cca>Aca	p.P501T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	501					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGTGAGCGAGCCAGCGGAGGT	0.403																																					p.P501T		Atlas-SNP	.											.	GPR98	605	.	0			c.C1501A						.						65.0	68.0	67.0					5																	89924641		1985	4152	6137	SO:0001583	missense	84059	exon8			AGCGAGCCAGCGG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1501C>A	chr5.hg19:g.89924641C>A	ENSP00000384582:p.Pro501Thr	88.0	0.0		145.0	42.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.656972|4.656972	0.88154|0.88154	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000504142|ENST00000405460;ENST00000296619;ENST00000399043	.|T	.|0.42513	.|0.97	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68403|0.68403	0.2997|0.2997	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.69942|0.69942	-0.5008|-0.5008	5|10	.|0.66056	.|D	.|0.02	.|.	20.0216|20.0216	0.97506|0.97506	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|501	.|Q8WXG9	.|GPR98_HUMAN	D|T	89|501	.|ENSP00000384582:P501T	.|ENSP00000296619:P501T	A|P	+|+	2|1	0|0	GPR98|GPR98	89960397|89960397	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.810000|0.810000	0.45777|0.45777	7.590000|7.590000	0.82653|0.82653	2.735000|2.735000	0.93741|0.93741	0.650000|0.650000	0.86243|0.86243	GCC|CCA	.	.		0.403	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
PAM	5066	hgsc.bcm.edu	37	5	102360991	102360991	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:102360991T>A	ENST00000438793.3	+	23	3112	c.2642T>A	c.(2641-2643)cTg>cAg	p.L881Q	PAM_ENST00000346918.2_Intron|PAM_ENST00000379787.4_Missense_Mutation_p.L261Q|PAM_ENST00000348126.2_Missense_Mutation_p.L774Q|PAM_ENST00000274392.9_Missense_Mutation_p.L783Q|PAM_ENST00000304400.7_Missense_Mutation_p.L881Q|PAM_ENST00000455264.2_Intron	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	881					central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GTTGTCCTGCTGGCCATTGCC	0.473																																					p.L881Q		Atlas-SNP	.											.	PAM	180	.	0			c.T2642A						.						100.0	112.0	108.0					5																	102360991		2203	4300	6503	SO:0001583	missense	5066	exon23			TCCTGCTGGCCAT	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2642T>A	chr5.hg19:g.102360991T>A	ENSP00000396493:p.Leu881Gln	193.0	0.0		235.0	63.0	NM_001177306	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	hg19	CCDS54885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.4|24.4	4.531147|4.531147	0.85706|0.85706	.|.	.|.	ENSG00000145730|ENSG00000145730	ENST00000438793;ENST00000348126;ENST00000379787;ENST00000304400;ENST00000274392|ENST00000504691	T;T;T;T;T|.	0.67171|.	0.65;0.5;0.22;0.65;-0.25|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.363007|.	0.27311|.	N|.	0.019957|.	T|T	0.54791|0.54791	0.1880|0.1880	L|L	0.27053|0.27053	0.805|0.805	0.41240|0.41240	D|D	0.986637|0.986637	D;D;D;D;D|.	0.76494|.	0.998;0.999;0.997;0.986;0.998|.	D;D;D;P;D|.	0.70487|.	0.957;0.962;0.944;0.9;0.969|.	T|T	0.52426|0.52426	-0.8577|-0.8577	10|5	0.87932|.	D|.	0|.	.|.	16.0021|16.0021	0.80301|0.80301	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	783;261;881;881;774|.	F8WE90;A6NMH0;P19021;P19021-5;P19021-2|.	.;.;AMD_HUMAN;.;.|.	Q|R	881;774;261;881;783|176	ENSP00000396493:L881Q;ENSP00000314638:L774Q;ENSP00000369113:L261Q;ENSP00000306100:L881Q;ENSP00000274392:L783Q|.	ENSP00000274392:L783Q|.	L|W	+|+	2|1	0|0	PAM|PAM	102388890|102388890	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.343000|6.343000	0.72986|0.72986	2.184000|2.184000	0.69523|0.69523	0.529000|0.529000	0.55759|0.55759	CTG|TGG	.	.		0.473	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PCDHB10	56126	hgsc.bcm.edu	37	5	140574371	140574371	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:140574371A>T	ENST00000239446.4	+	1	2430	c.2246A>T	c.(2245-2247)cAg>cTg	p.Q749L		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	749					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCCTGTCCCAGAGCTACCAG	0.622																																					p.Q749L		Atlas-SNP	.											.	PCDHB10	177	.	0			c.A2246T						.						76.0	85.0	82.0					5																	140574371		2203	4300	6503	SO:0001583	missense	56126	exon1			TGTCCCAGAGCTA	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2246A>T	chr5.hg19:g.140574371A>T	ENSP00000239446:p.Gln749Leu	104.0	0.0		126.0	25.0	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	hg19	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	a	11.70	1.717153	0.30413	.	.	ENSG00000120324	ENST00000239446	T	0.53423	0.62	3.28	3.28	0.37604	.	.	.	.	.	T	0.53786	0.1818	M	0.85859	2.78	0.09310	N	1	P	0.42248	0.774	P	0.46026	0.501	T	0.56733	-0.7930	9	0.87932	D	0	.	2.8435	0.05536	0.6568:0.0:0.1218:0.2214	.	749	Q9UN67	PCDBA_HUMAN	L	749	ENSP00000239446:Q749L	ENSP00000239446:Q749L	Q	+	2	0	PCDHB10	140554555	0.000000	0.05858	0.981000	0.43875	0.324000	0.28378	0.251000	0.18257	1.508000	0.48769	0.248000	0.18094	CAG	.	.		0.622	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140811741	140811741	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:140811741T>A	ENST00000252085.3	+	1	1557	c.1415T>A	c.(1414-1416)gTc>gAc	p.V472D	PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	472	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTCCCTCGTCTCTGTGACC	0.572																																					p.V472D		Atlas-SNP	.											.	PCDHGA12	271	.	0			c.T1415A						.						71.0	74.0	73.0					5																	140811741		2203	4300	6503	SO:0001583	missense	26025	exon1			CCCTCGTCTCTGT	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1415T>A	chr5.hg19:g.140811741T>A	ENSP00000252085:p.Val472Asp	178.0	0.0		230.0	106.0	NM_032094	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	hg19	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	t	3.949	-0.012647	0.07727	.	.	ENSG00000253159	ENST00000252085	T	0.01705	4.68	5.23	2.73	0.32206	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.02929	0.0087	L	0.55990	1.75	0.09310	N	1	B;P	0.35456	0.274;0.502	B;B	0.41412	0.173;0.356	T	0.41770	-0.9490	9	0.62326	D	0.03	.	3.7857	0.08700	0.1288:0.0742:0.1342:0.6627	.	472;472	O60330-2;O60330	.;PCDGC_HUMAN	D	472	ENSP00000252085:V472D	ENSP00000252085:V472D	V	+	2	0	PCDHGA12	140791925	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	-0.210000	0.09345	0.842000	0.35045	0.459000	0.35465	GTC	.	.		0.572	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
FAT2	2196	hgsc.bcm.edu	37	5	150886868	150886868	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:150886868C>A	ENST00000261800.5	-	22	12376	c.12364G>T	c.(12364-12366)Gcc>Tcc	p.A4122S	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4122					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K4121>?(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAACAGAGGCCTTGCTGGGT	0.577																																					p.A4122S		Atlas-SNP	.											.,1	FAT2	465	.	1	Complex(1)	large_intestine(1)	c.G12364T						.						146.0	150.0	148.0					5																	150886868		2203	4300	6503	SO:0001583	missense	2196	exon22			CAGAGGCCTTGCT	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12364G>T	chr5.hg19:g.150886868C>A	ENSP00000261800:p.Ala4122Ser	151.0	0.0		185.0	32.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.864|1.864	-0.461973|-0.461973	0.04508|0.04508	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	T|.	0.68025|.	-0.3|.	4.63|4.63	-2.42|-2.42	0.06542|0.06542	.|.	0.531499|.	0.18493|.	N|.	0.139585|.	T|T	0.19087|0.19087	0.0458|0.0458	N|N	0.16368|0.16368	0.405|0.405	0.19945|0.19945	N|N	0.999944|0.999944	B;B|.	0.10296|.	0.0;0.003|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.31138|0.31138	-0.9954|-0.9954	10|5	0.02654|.	T|.	1|.	.|.	6.362|6.362	0.21433|0.21433	0.0:0.446:0.2988:0.2552|0.0:0.446:0.2988:0.2552	.|.	4122;1227|.	Q9NYQ8;E9PDJ8|.	FAT2_HUMAN;.|.	S|V	4122|894	ENSP00000261800:A4122S|.	ENSP00000261800:A4122S|.	A|G	-|-	1|2	0|0	FAT2|FAT2	150867061|150867061	0.330000|0.330000	0.24705|0.24705	0.989000|0.989000	0.46669|0.46669	0.165000|0.165000	0.22458|0.22458	-0.228000|-0.228000	0.09114|0.09114	-0.235000|-0.235000	0.09767|0.09767	-1.077000|-1.077000	0.02231|0.02231	GCC|GGC	.	.		0.577	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
LARP1	23367	hgsc.bcm.edu	37	5	154173763	154173763	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr5:154173763C>G	ENST00000336314.4	+	7	966	c.942C>G	c.(940-942)agC>agG	p.S314R		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	391					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ACAATGTCAGCAGCACCGAGC	0.483																																					p.S314R		Atlas-SNP	.											.	LARP1	187	.	0			c.C942G						.						154.0	130.0	138.0					5																	154173763		2203	4300	6503	SO:0001583	missense	23367	exon7			TGTCAGCAGCACC	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.942C>G	chr5.hg19:g.154173763C>G	ENSP00000336721:p.Ser314Arg	297.0	0.0		390.0	102.0	NM_015315	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	hg19	CCDS4328.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.547969|4.547969	0.86022|0.86022	.|.	.|.	ENSG00000155506|ENSG00000155506	ENST00000518194|ENST00000336314;ENST00000518297;ENST00000524248;ENST00000523163	.|T;T;T;T	.|0.46451	.|0.87;0.87;0.87;0.87	5.8|5.8	4.03|4.03	0.46877|0.46877	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58623|0.58623	0.2135|0.2135	M|M	0.68952|0.68952	2.095|2.095	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.65815	.|0.995;0.991	.|P;D	.|0.66979	.|0.858;0.948	T|T	0.56312|0.56312	-0.8000|-0.8000	5|10	.|0.38643	.|T	.|0.18	-17.3828|-17.3828	12.2596|12.2596	0.54642|0.54642	0.0:0.8635:0.0:0.1365|0.0:0.8635:0.0:0.1365	.|.	.|391;314	.|Q6PKG0;Q6PKG0-3	.|LARP1_HUMAN;.	E|R	127|314;391;186;99	.|ENSP00000336721:S314R;ENSP00000428589:S391R;ENSP00000429904:S186R;ENSP00000430438:S99R	.|ENSP00000336721:S314R	Q|S	+|+	1|3	0|2	LARP1|LARP1	154153956|154153956	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.991000|3.991000	0.56973|0.56973	0.794000|0.794000	0.33899|0.33899	0.655000|0.655000	0.94253|0.94253	CAG|AGC	.	.		0.483	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
WDR46	9277	hgsc.bcm.edu	37	6	33254618	33254618	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr6:33254618A>T	ENST00000374617.4	-	10	1425	c.1069T>A	c.(1069-1071)Tgt>Agt	p.C357S	PFDN6_ENST00000395131.1_5'Flank|WDR46_ENST00000477718.1_5'Flank|PFDN6_ENST00000374606.5_5'Flank|PFDN6_ENST00000463584.1_5'Flank|PFDN6_ENST00000374607.1_5'Flank|PFDN6_ENST00000374610.2_5'Flank	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	357							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						CCACGATGACAGAGAATCTTT	0.507																																					p.C357S		Atlas-SNP	.											.	WDR46	43	.	0			c.T1069A						.						177.0	166.0	170.0					6																	33254618		2203	4300	6503	SO:0001583	missense	9277	exon10			GATGACAGAGAAT	Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.1069T>A	chr6.hg19:g.33254618A>T	ENSP00000363746:p.Cys357Ser	121.0	0.0		114.0	41.0	NM_005452	A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	ENST00000374617.4	hg19	CCDS4772.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.295007	0.81025	.	.	ENSG00000227057	ENST00000374617;ENST00000444176	T;T	0.59083	0.29;0.29	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51075	0.1653	N	0.25144	0.715	0.80722	D	1	D;P	0.89917	1.0;0.875	D;P	0.75484	0.986;0.56	T	0.53823	-0.8384	10	0.34782	T	0.22	-10.4346	12.5989	0.56487	1.0:0.0:0.0:0.0	.	303;357	B4DP15;O15213	.;WDR46_HUMAN	S	357;284	ENSP00000363746:C357S;ENSP00000405568:C284S	ENSP00000363746:C357S	C	-	1	0	WDR46	33362596	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.025000	0.76449	2.067000	0.61834	0.448000	0.29417	TGT	.	.		0.507	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076382.2	NM_005452	
CEP162	22832	hgsc.bcm.edu	37	6	84910598	84910598	+	Silent	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr6:84910598A>T	ENST00000403245.3	-	9	858	c.744T>A	c.(742-744)tcT>tcA	p.S248S	KIAA1009_ENST00000257766.4_Silent_p.S172S	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		CCTCTGCAACAGAGTCTAATG	0.338																																					p.S248S		Atlas-SNP	.											.	KIAA1009	119	.	0			c.T744A						.						138.0	133.0	135.0					6																	84910598		2203	4300	6503	SO:0001819	synonymous_variant	22832	exon9			TGCAACAGAGTCT																												ENST00000403245.3:c.744T>A	chr6.hg19:g.84910598A>T		106.0	0.0		113.0	41.0	NM_014895		Silent	SNP	ENST00000403245.3	hg19	CCDS34494.2																																																																																			.	.		0.338	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
SEC63	11231	hgsc.bcm.edu	37	6	108214765	108214765	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr6:108214765A>T	ENST00000369002.4	-	16	1774	c.1595T>A	c.(1594-1596)tTa>tAa	p.L532*		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	532	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.L532*(2)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTTTTTTTTAAAGGTTTCTT	0.368																																					p.L532X		Atlas-SNP	.											SEC63,NS,carcinoma,0,2	SEC63	79	.	2	Substitution - Nonsense(2)	lung(1)|kidney(1)	c.T1595A						.						114.0	119.0	117.0					6																	108214765		2202	4300	6502	SO:0001587	stop_gained	11231	exon16			TTTTTTAAAGGTT	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.1595T>A	chr6.hg19:g.108214765A>T	ENSP00000357998:p.Leu532*	82.0	1.0		82.0	4.0	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Nonsense_Mutation	SNP	ENST00000369002.4	hg19	CCDS5061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	37|37	6.342620|6.342620	0.97489|0.97489	.|.	.|.	ENSG00000025796|ENSG00000025796	ENST00000423697|ENST00000369002;ENST00000437345	.|.	.|.	.|.	5.38|5.38	3.01|3.01	0.34805|0.34805	.|.	.|0.323197	.|0.31989	.|N	.|0.006744	T|.	0.17450|.	0.0419|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.07673|.	-1.0760|.	4|.	0.10636|0.14656	T|T	0.68|0.56	-2.4355|-2.4355	7.8269|7.8269	0.29320|0.29320	0.7741:0.0:0.2259:0.0|0.7741:0.0:0.2259:0.0	.|.	.|.	.|.	.|.	L|X	391|532;183	.|.	ENSP00000394572:F391L|ENSP00000357998:L532X	F|L	-|-	3|2	2|0	SEC63|SEC63	108321458|108321458	0.977000|0.977000	0.34250|0.34250	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	2.787000|2.787000	0.47798|0.47798	0.991000|0.991000	0.38814|0.38814	0.460000|0.460000	0.39030|0.39030	TTT|TTA	.	.		0.368	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
SGK1	6446	hgsc.bcm.edu	37	6	134494621	134494621	+	Silent	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr6:134494621G>A	ENST00000237305.7	-	4	400	c.312C>T	c.(310-312)atC>atT	p.I104I	SGK1_ENST00000475719.2_Silent_p.I104I|SGK1_ENST00000528577.1_Silent_p.I132I|SGK1_ENST00000367858.5_Silent_p.I199I|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000413996.3_Silent_p.I118I|SGK1_ENST00000367857.5_Silent_p.I94I	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	104	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TGCCCTTTCCGATCACTTTCA	0.393																																					p.I199I		Atlas-SNP	.											.	SGK1	387	.	0			c.C597T						.						64.0	69.0	67.0					6																	134494621		2203	4300	6503	SO:0001819	synonymous_variant	6446	exon6			CTTTCCGATCACT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.312C>T	chr6.hg19:g.134494621G>A		158.0	0.0		157.0	36.0	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Silent	SNP	ENST00000237305.7	hg19	CCDS5170.1																																																																																			.	.		0.393	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
KATNA1	11104	hgsc.bcm.edu	37	6	149916182	149916182	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr6:149916182C>G	ENST00000335647.5	-	10	1510	c.1466G>C	c.(1465-1467)gGa>gCa	p.G489A	KATNA1_ENST00000335643.8_3'UTR|RP1-12G14.7_ENST00000419134.1_RNA|KATNA1_ENST00000367411.2_Missense_Mutation_p.G489A|SNORA2_ENST00000365473.1_RNA|KATNA1_ENST00000494504.1_5'Flank					katanin p60 (ATPase containing) subunit A 1											endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		TTAGCATGATCCAAACTCAAA	0.333																																					p.G489A		Atlas-SNP	.											.	KATNA1	34	.	0			c.G1466C						.						99.0	95.0	96.0					6																	149916182		2203	4300	6503	SO:0001583	missense	11104	exon11			CATGATCCAAACT	AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.1466G>C	chr6.hg19:g.149916182C>G	ENSP00000335106:p.Gly489Ala	110.0	0.0		66.0	17.0	NM_007044		Missense_Mutation	SNP	ENST00000335647.5	hg19	CCDS5217.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.980479	0.92982	.	.	ENSG00000186625	ENST00000335647;ENST00000367411	D;D	0.99158	-5.5;-5.5	5.87	5.87	0.94306	Vps4 oligomerisation, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99612	0.9859	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98225	1.0480	9	.	.	.	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	489	O75449	KTNA1_HUMAN	A	489	ENSP00000335106:G489A;ENSP00000356381:G489A	.	G	-	2	0	KATNA1	149957875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	GGA	.	.		0.333	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044	
PARK2	5071	hgsc.bcm.edu	37	6	162206857	162206857	+	Missense_Mutation	SNP	T	T	C	rs373750972		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr6:162206857T>C	ENST00000366898.1	-	7	920	c.818A>G	c.(817-819)aAt>aGt	p.N273S	PARK2_ENST00000366897.1_Missense_Mutation_p.N245S|PARK2_ENST00000366894.1_Missense_Mutation_p.N82S|PARK2_ENST00000366896.1_Missense_Mutation_p.N124S|PARK2_ENST00000338468.3_Missense_Mutation_p.N82S|PARK2_ENST00000366892.1_Missense_Mutation_p.N273S	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	273	SYT11 binding 2.				adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CTGCCGATCATTGAGTCTTGT	0.478																																					p.N273S		Atlas-SNP	.											.	PARK2	96	.	0			c.A818G	GRCh37	CM080475	PARK2	M		.	T	SER/ASN,SER/ASN,SER/ASN	0,4406		0,0,2203	106.0	90.0	96.0		818,734,371	5.8	0.9	6		96	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PARK2	NM_004562.2,NM_013987.2,NM_013988.2	46,46,46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	273/466,245/438,124/317	162206857	1,13005	2203	4300	6503	SO:0001583	missense	5071	exon7			CGATCATTGAGTC		CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.818A>G	chr6.hg19:g.162206857T>C	ENSP00000355865:p.Asn273Ser	156.0	0.0		156.0	46.0	NM_004562	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	ENST00000366898.1	hg19	CCDS5281.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273185	0.80580	0.0	1.16E-4	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366894;ENST00000338468;ENST00000392134;ENST00000366892;ENST00000366895	D;D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57;-2.57	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.91085	0.7194	M	0.78637	2.42	0.38863	D	0.956527	D;D;D;D;P	0.69078	0.989;0.997;0.993;0.993;0.911	P;D;P;P;P	0.70716	0.9;0.97;0.858;0.858;0.505	D	0.89755	0.3943	10	0.12103	T	0.63	.	14.2774	0.66189	0.0:0.0:0.0:1.0	.	273;124;245;273;82	O60260-5;Q5VVX3;Q5VVX4;O60260;Q8NI42	.;.;.;PRKN2_HUMAN;.	S	273;245;124;82;82;82;273;194	ENSP00000355865:N273S;ENSP00000355863:N245S;ENSP00000355862:N124S;ENSP00000355860:N82S;ENSP00000343589:N82S;ENSP00000355858:N273S	ENSP00000343589:N82S	N	-	2	0	PARK2	162126847	1.000000	0.71417	0.923000	0.36655	0.939000	0.58152	6.736000	0.74811	2.193000	0.70182	0.528000	0.53228	AAT	.	.		0.478	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
EGFR	1956	hgsc.bcm.edu	37	7	55225380	55225380	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr7:55225380C>G	ENST00000275493.2	+	11	1409	c.1232C>G	c.(1231-1233)cCt>cGt	p.P411R	EGFR_ENST00000344576.2_Missense_Mutation_p.P411R|EGFR_ENST00000455089.1_Missense_Mutation_p.P366R|EGFR_ENST00000454757.2_Missense_Mutation_p.P358R|EGFR_ENST00000442591.1_Missense_Mutation_p.P411R|EGFR_ENST00000342916.3_Missense_Mutation_p.P411R	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	411					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CAGGCTTGGCCTGAAAACAGG	0.463		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.P411R		Atlas-SNP	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR	20426	.	0			c.C1232G						.						99.0	85.0	89.0					7																	55225380		2203	4300	6503	SO:0001583	missense	1956	exon11	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	CTTGGCCTGAAAA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1232C>G	chr7.hg19:g.55225380C>G	ENSP00000275493:p.Pro411Arg	147.0	0.0		120.0	43.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	hg19	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040735	0.93685	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	5.93	5.93	0.95920	EGF receptor, L domain (1);	0.000000	0.85682	D	0.000000	T	0.70439	0.3224	M	0.84511	2.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;1.0	T	0.73833	-0.3858	10	0.87932	D	0	.	18.9076	0.92469	0.0:1.0:0.0:0.0	.	366;411;411;411	Q504U8;P00533;P00533-3;P00533-4	.;EGFR_HUMAN;.;.	R	366;411;281;411;411;411;358;205	ENSP00000415559:P366R;ENSP00000342376:P411R;ENSP00000345973:P411R;ENSP00000275493:P411R;ENSP00000410031:P411R;ENSP00000395243:P358R	ENSP00000275493:P411R	P	+	2	0	EGFR	55192874	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	7.472000	0.80996	2.815000	0.96918	0.561000	0.74099	CCT	.	.		0.463	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
XPO7	23039	hgsc.bcm.edu	37	8	21842213	21842213	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:21842213A>T	ENST00000252512.9	+	12	1434	c.1334A>T	c.(1333-1335)cAg>cTg	p.Q445L	XPO7_ENST00000433566.4_Missense_Mutation_p.Q446L|XPO7_ENST00000434536.1_Missense_Mutation_p.Q454L	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	445					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CAGTTGGACCAGCTGTCCACC	0.547																																					p.Q445L		Atlas-SNP	.											.	XPO7	79	.	0			c.A1334T						.						46.0	48.0	47.0					8																	21842213		1988	4155	6143	SO:0001583	missense	23039	exon12			TGGACCAGCTGTC	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1334A>T	chr8.hg19:g.21842213A>T	ENSP00000252512:p.Gln445Leu	107.0	0.0		75.0	39.0	NM_015024	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	hg19	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.948887	0.92660	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.61627	0.09;0.09;0.09	5.4	5.4	0.78164	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79575	0.4469	M	0.91406	3.205	0.80722	D	1	D;B;B	0.89917	1.0;0.125;0.125	D;B;B	0.80764	0.994;0.119;0.082	T	0.80754	-0.1241	10	0.25751	T	0.34	-9.9419	15.0967	0.72242	1.0:0.0:0.0:0.0	.	446;454;445	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	L	454;445;446	ENSP00000404853:Q454L;ENSP00000252512:Q445L;ENSP00000410249:Q446L	ENSP00000252512:Q445L	Q	+	2	0	XPO7	21898159	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.339000	0.96797	2.051000	0.60960	0.383000	0.25322	CAG	.	.		0.547	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024	
ASPH	444	hgsc.bcm.edu	37	8	62593583	62593583	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:62593583A>G	ENST00000379454.4	-	3	453	c.266T>C	c.(265-267)aTc>aCc	p.I89T	ASPH_ENST00000517661.1_Missense_Mutation_p.I75T|ASPH_ENST00000389204.4_Missense_Mutation_p.I75T|ASPH_ENST00000522603.1_Missense_Mutation_p.I60T|ASPH_ENST00000445642.3_Missense_Mutation_p.I75T|ASPH_ENST00000517903.1_Missense_Mutation_p.I75T|ASPH_ENST00000379449.6_Missense_Mutation_p.I104T|ASPH_ENST00000517856.1_Missense_Mutation_p.I89T|ASPH_ENST00000522835.1_Missense_Mutation_p.I75T|ASPH_ENST00000541428.1_Missense_Mutation_p.I60T|ASPH_ENST00000518068.1_Missense_Mutation_p.I89T|ASPH_ENST00000517847.2_Missense_Mutation_p.I75T|ASPH_ENST00000356457.5_Missense_Mutation_p.I89T	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	89					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	AGCATCATAGATTCCTAGTTT	0.313																																					p.I104T		Atlas-SNP	.											.	ASPH	87	.	0			c.T311C						.						124.0	127.0	126.0					8																	62593583		2203	4295	6498	SO:0001583	missense	444	exon4			TCATAGATTCCTA	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.266T>C	chr8.hg19:g.62593583A>G	ENSP00000368767:p.Ile89Thr	324.0	0.0		316.0	94.0	NM_001164756	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	hg19	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.792445	0.50102	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000522349;ENST00000356457;ENST00000519234;ENST00000518068;ENST00000517903;ENST00000445642;ENST00000517847;ENST00000522835;ENST00000518306;ENST00000517856;ENST00000389204;ENST00000522603;ENST00000379449;ENST00000517661	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36	5.77	5.77	0.91146	Aspartyl beta-hydroxylase/Triadin domain (1);	0.616994	0.15683	N	0.249813	T	0.52175	0.1718	L	0.34521	1.04	0.35207	D	0.774787	B;B;P;B;B;B;B;B;P;B;B;B;B;B	0.45768	0.002;0.004;0.802;0.002;0.029;0.006;0.026;0.056;0.866;0.031;0.107;0.007;0.013;0.057	B;B;P;B;B;B;B;B;P;B;B;B;B;B	0.46796	0.005;0.017;0.527;0.026;0.039;0.039;0.037;0.141;0.507;0.028;0.069;0.014;0.026;0.062	T	0.64859	-0.6308	10	0.72032	D	0.01	-1.4402	16.068	0.80903	1.0:0.0:0.0:0.0	.	60;75;89;75;75;75;60;104;104;89;89;89;75;89	Q12797-4;Q12797-3;B8Y0L3;B4DIC9;B7ZM95;B7ZM96;F5H667;E5RG56;Q6NXR7;F8W7A9;Q8TB28;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;.;.;.;.;.;.;ASPH_HUMAN	T	89;60;89;60;89;104;89;75;75;75;75;60;89;75;60;104;75	ENSP00000437864:I60T;ENSP00000368767:I89T;ENSP00000429718:I60T;ENSP00000348841:I89T;ENSP00000427823:I104T;ENSP00000429286:I89T;ENSP00000430245:I75T;ENSP00000394013:I75T;ENSP00000429954:I75T;ENSP00000429160:I75T;ENSP00000427877:I60T;ENSP00000429743:I89T;ENSP00000373856:I75T;ENSP00000436188:I60T;ENSP00000368762:I104T;ENSP00000428060:I75T	ENSP00000348841:I89T	I	-	2	0	ASPH	62756137	1.000000	0.71417	0.856000	0.33681	0.968000	0.65278	6.965000	0.76067	2.326000	0.78906	0.533000	0.62120	ATC	.	.		0.313	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
LY96	23643	hgsc.bcm.edu	37	8	74917085	74917085	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:74917085G>T	ENST00000284818.2	+	2	258	c.167G>T	c.(166-168)aGa>aTa	p.R56I	LY96_ENST00000518893.1_Intron	NM_015364.4	NP_056179	Q9Y6Y9	LY96_HUMAN	lymphocyte antigen 96	56			R -> G (in dbSNP:rs6472812). {ECO:0000269|PubMed:10359581, ECO:0000269|PubMed:10891475, ECO:0000269|PubMed:11435474, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:18810425}.		cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endosome membrane (GO:0010008)|extracellular region (GO:0005576)|lipopolysaccharide receptor complex (GO:0046696)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|lipopolysaccharide receptor activity (GO:0001875)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			GAATTGAAAAGATCCAAAGGA	0.269																																					p.R56I	GBM(131;1357 1748 34893 50149 52212)	Atlas-SNP	.											.	LY96	17	.	0			c.G167T						.						49.0	53.0	51.0					8																	74917085		2200	4284	6484	SO:0001583	missense	23643	exon2			TGAAAAGATCCAA	AB018549	CCDS6216.1, CCDS56540.1	8q13.3	2004-01-22			ENSG00000154589	ENSG00000154589			17156	protein-coding gene	gene with protein product		605243				10359581, 11466383	Standard	NM_015364		Approved	MD-2	uc003yad.3	Q9Y6Y9	OTTHUMG00000164504	ENST00000284818.2:c.167G>T	chr8.hg19:g.74917085G>T	ENSP00000284818:p.Arg56Ile	355.0	1.0		389.0	124.0	NM_015364	B3Y6A5|E5RJJ7	Missense_Mutation	SNP	ENST00000284818.2	hg19	CCDS6216.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498429	0.26861	.	.	ENSG00000154589	ENST00000284818	T	0.44482	0.92	5.2	1.87	0.25490	MD-2-related lipid-recognition (2);Immunoglobulin E-set (1);	0.587686	0.16363	N	0.217688	T	0.19485	0.0468	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14254	-1.0479	10	0.66056	D	0.02	.	3.7764	0.08661	0.2529:0.1995:0.5477:0.0	.	56	Q9Y6Y9	LY96_HUMAN	I	56	ENSP00000284818:R56I	ENSP00000284818:R56I	R	+	2	0	LY96	75079639	0.046000	0.20272	0.019000	0.16419	0.003000	0.03518	1.150000	0.31639	0.583000	0.29574	0.650000	0.86243	AGA	.	.		0.269	LY96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379032.2	NM_015364	
OSR2	116039	hgsc.bcm.edu	37	8	99961205	99961205	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:99961205C>T	ENST00000297565.4	+	2	521	c.25C>T	c.(25-27)Ccc>Tcc	p.P9S	OSR2_ENST00000522510.1_Missense_Mutation_p.P9S|OSR2_ENST00000523368.1_Missense_Mutation_p.P9S|OSR2_ENST00000457907.2_Missense_Mutation_p.P130S|OSR2_ENST00000435298.2_Missense_Mutation_p.P9S	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	9					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			TCTGCCAGCGCCCATCCCGCT	0.662																																					p.P9S		Atlas-SNP	.											.	OSR2	56	.	0			c.C25T						.						45.0	50.0	48.0					8																	99961205		2038	4182	6220	SO:0001583	missense	116039	exon2			CCAGCGCCCATCC	AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.25C>T	chr8.hg19:g.99961205C>T	ENSP00000297565:p.Pro9Ser	72.0	0.0		102.0	21.0	NM_053001	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	ENST00000297565.4	hg19	CCDS47901.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749979	0.89753	.	.	ENSG00000164920	ENST00000523368;ENST00000297565;ENST00000435298;ENST00000522510;ENST00000457907;ENST00000520951;ENST00000518199	T;T;T;T;T;T;T	0.19250	2.16;2.39;2.42;2.39;2.77;2.91;2.41	4.04	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.33147	0.0853	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.91635	0.997;0.937;0.96;0.999	T	0.06023	-1.0850	9	.	.	.	-20.3963	17.4991	0.87727	0.0:1.0:0.0:0.0	.	130;9;9;9	B4E3B7;E5RH04;Q8N2R0;Q8N2R0-2	.;.;OSR2_HUMAN;.	S	9;9;9;9;130;62;9	ENSP00000430041:P9S;ENSP00000297565:P9S;ENSP00000402862:P9S;ENSP00000430780:P9S;ENSP00000414657:P130S;ENSP00000430074:P62S;ENSP00000429910:P9S	.	P	+	1	0	OSR2	100030381	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.585000	0.82584	2.529000	0.85273	0.655000	0.94253	CCC	.	.		0.662	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001	
KLF10	7071	hgsc.bcm.edu	37	8	103663550	103663550	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:103663550T>C	ENST00000285407.6	-	3	1310	c.1010A>G	c.(1009-1011)aAt>aGt	p.N337S	KLF10_ENST00000395884.3_Missense_Mutation_p.N326S	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	337					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			TCTGGTGCCATTCGGGCTCAC	0.542																																					p.N337S	Esophageal Squamous(16;495 519 2144 16528 44005)	Atlas-SNP	.											.	KLF10	44	.	0			c.A1010G						.						82.0	92.0	89.0					8																	103663550		2203	4300	6503	SO:0001583	missense	7071	exon3			GTGCCATTCGGGC	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.1010A>G	chr8.hg19:g.103663550T>C	ENSP00000285407:p.Asn337Ser	157.0	0.0		233.0	38.0	NM_005655	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	ENST00000285407.6	hg19	CCDS6294.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.285864	0.23478	.	.	ENSG00000155090	ENST00000285407;ENST00000395884	T;T	0.12569	2.67;2.73	5.5	4.3	0.51218	.	0.328865	0.32970	N	0.005439	T	0.07413	0.0187	N	0.17082	0.46	0.30433	N	0.777012	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.28364	-1.0046	10	0.10636	T	0.68	.	9.1312	0.36846	0.0:0.1432:0.0:0.8568	.	337;326	Q13118;O75411	KLF10_HUMAN;.	S	337;326	ENSP00000285407:N337S;ENSP00000379222:N326S	ENSP00000285407:N337S	N	-	2	0	KLF10	103732726	1.000000	0.71417	0.708000	0.30435	0.992000	0.81027	3.229000	0.51278	0.974000	0.38366	0.533000	0.62120	AAT	.	.		0.542	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1		
TRPS1	7227	hgsc.bcm.edu	37	8	116632123	116632123	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:116632123T>G	ENST00000220888.5	-	2	322	c.163A>C	c.(163-165)Aat>Cat	p.N55H	TRPS1_ENST00000519674.1_Missense_Mutation_p.N55H|TRPS1_ENST00000395715.3_Missense_Mutation_p.N68H|TRPS1_ENST00000520276.1_Missense_Mutation_p.N59H|TRPS1_ENST00000519076.1_Missense_Mutation_p.N55H			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	55					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TCCTTATGATTTAGTTCTGCA	0.413									Langer-Giedion syndrome																												p.N68H		Atlas-SNP	.											.	TRPS1	516	.	0			c.A202C						.						118.0	106.0	110.0					8																	116632123		1922	4148	6070	SO:0001583	missense	7227	exon3	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	TATGATTTAGTTC	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.163A>C	chr8.hg19:g.116632123T>G	ENSP00000220888:p.Asn55His	117.0	0.0		212.0	130.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	T	13.92	2.379699	0.42207	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674;ENST00000395713;ENST00000519815	D;D;D;D;T	0.98717	-5.09;-5.06;-5.03;-5.06;0.74	5.55	5.55	0.83447	.	0.076780	0.53938	D	0.000047	D	0.95774	0.8625	N	0.12182	0.205	0.36102	D	0.844201	P;P;P	0.40794	0.729;0.61;0.729	B;B;B	0.41236	0.351;0.191;0.351	D	0.99421	1.0933	10	0.87932	D	0	-15.9627	14.2778	0.66191	0.0:0.0:0.0:1.0	.	59;55;68	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	H	68;55;55;59;55;68;68	ENSP00000379065:N68H;ENSP00000220888:N55H;ENSP00000428910:N55H;ENSP00000428680:N59H;ENSP00000429174:N55H	ENSP00000220888:N55H	N	-	1	0	TRPS1	116701298	0.993000	0.37304	0.996000	0.52242	0.870000	0.49936	2.300000	0.43620	2.104000	0.64026	0.528000	0.53228	AAT	.	.		0.413	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
CYP11B2	1585	hgsc.bcm.edu	37	8	143996179	143996179	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr8:143996179C>A	ENST00000323110.2	-	4	743	c.741G>T	c.(739-741)tgG>tgT	p.W247C		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	247					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TGGGGCTGATCCAGCGAGACA	0.602									Familial Hyperaldosteronism type I																												p.W247C		Atlas-SNP	.											.	CYP11B2	107	.	0			c.G741T						.						56.0	50.0	52.0					8																	143996179		2202	4300	6502	SO:0001583	missense	1585	exon4	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GCTGATCCAGCGA	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.741G>T	chr8.hg19:g.143996179C>A	ENSP00000325822:p.Trp247Cys	341.0	0.0		457.0	103.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	hg19	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	13.16	2.153309	0.38021	.	.	ENSG00000179142	ENST00000323110	T	0.68624	-0.34	3.79	2.88	0.33553	.	0.163582	0.26397	N	0.024616	T	0.77212	0.4097	M	0.80183	2.485	0.23956	N	0.996352	D	0.55800	0.973	P	0.61275	0.886	T	0.66192	-0.5985	10	0.54805	T	0.06	.	9.3243	0.37984	0.0:0.8878:0.0:0.1122	.	247	P19099	C11B2_HUMAN	C	247	ENSP00000325822:W247C	ENSP00000325822:W247C	W	-	3	0	CYP11B2	143993181	0.014000	0.17966	0.683000	0.30040	0.852000	0.48524	0.681000	0.25320	1.946000	0.56461	0.561000	0.74099	TGG	.	.		0.602	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
DOCK8	81704	hgsc.bcm.edu	37	9	396809	396809	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr9:396809C>G	ENST00000453981.1	+	25	3107	c.2995C>G	c.(2995-2997)Cat>Gat	p.H999D	DOCK8_ENST00000382331.1_Missense_Mutation_p.H301D|DOCK8_ENST00000382329.1_Missense_Mutation_p.H466D|DOCK8_ENST00000432829.2_Missense_Mutation_p.H931D|DOCK8_ENST00000469391.1_Missense_Mutation_p.H899D			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	999					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CCAGCACGTACATAACATGGA	0.473																																					p.H999D		Atlas-SNP	.											.	DOCK8	401	.	0			c.C2995G						.						192.0	179.0	183.0					9																	396809		2203	4300	6503	SO:0001583	missense	81704	exon25			CACGTACATAACA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2995C>G	chr9.hg19:g.396809C>G	ENSP00000408464:p.His999Asp	111.0	0.0		100.0	40.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270212	0.40194	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.7	5.7	0.88788	.	0.194435	0.56097	D	0.000037	T	0.20495	0.0493	L	0.41236	1.265	0.46437	D	0.999043	B;B;B;B	0.12013	0.005;0.0;0.0;0.0	B;B;B;B	0.13407	0.009;0.002;0.001;0.001	T	0.01819	-1.1267	10	0.35671	T	0.21	.	16.1232	0.81375	0.0:0.8666:0.1334:0.0	.	301;899;466;999	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	D	999;967;931;899;301;466	ENSP00000408464:H999D;ENSP00000394888:H931D;ENSP00000419438:H899D;ENSP00000371768:H301D;ENSP00000371766:H466D	ENSP00000287364:H967D	H	+	1	0	DOCK8	386809	0.587000	0.26791	0.921000	0.36526	0.992000	0.81027	1.804000	0.38873	2.683000	0.91414	0.655000	0.94253	CAT	.	.		0.473	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
NACC2	138151	hgsc.bcm.edu	37	9	138903604	138903604	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr9:138903604C>A	ENST00000371753.1	-	5	1580	c.1522G>T	c.(1522-1524)Gct>Tct	p.A508S	NACC2_ENST00000277554.2_Missense_Mutation_p.A508S			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	508					cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						GTTCTCAGAGCCACGATGGTG	0.706																																					p.A508S		Atlas-SNP	.											.	NACC2	16	.	0			c.G1522T						.						8.0	8.0	8.0					9																	138903604		2158	4230	6388	SO:0001583	missense	138151	exon6			TCAGAGCCACGAT	BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1522G>T	chr9.hg19:g.138903604C>A	ENSP00000360818:p.Ala508Ser	31.0	0.0		36.0	13.0	NM_144653		Missense_Mutation	SNP	ENST00000371753.1	hg19	CCDS6993.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406841	0.25378	.	.	ENSG00000148411	ENST00000371753;ENST00000277554	T;T	0.69040	-0.37;-0.37	5.39	4.47	0.54385	.	0.399526	0.23302	N	0.049666	T	0.48484	0.1502	N	0.12182	0.205	0.35333	D	0.785763	B	0.17038	0.02	B	0.12156	0.007	T	0.54516	-0.8282	10	0.51188	T	0.08	.	12.1324	0.53950	0.3118:0.6882:0.0:0.0	.	508	Q96BF6	NACC2_HUMAN	S	508	ENSP00000360818:A508S;ENSP00000277554:A508S	ENSP00000277554:A508S	A	-	1	0	NACC2	138043425	0.570000	0.26651	0.968000	0.41197	0.046000	0.14306	1.646000	0.37249	1.204000	0.43247	0.491000	0.48974	GCT	.	.		0.706	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055040.1	NM_144653	
OR13A1	79290	hgsc.bcm.edu	37	10	45799015	45799015	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr10:45799015C>T	ENST00000553795.1	-	4	1164	c.856G>A	c.(856-858)Gca>Aca	p.A286T	OR13A1_ENST00000374401.2_Missense_Mutation_p.A286T|OR13A1_ENST00000536058.1_Missense_Mutation_p.A286T	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						CTCTTCCCTGCGCTGTAGCCA	0.547																																					p.A286T		Atlas-SNP	.											.	OR13A1	49	.	0			c.G856A						.						68.0	63.0	65.0					10																	45799015		2203	4300	6503	SO:0001583	missense	79290	exon4			TCCCTGCGCTGTA	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.856G>A	chr10.hg19:g.45799015C>T	ENSP00000451950:p.Ala286Thr	87.0	0.0		90.0	8.0	NM_001004297	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	hg19	CCDS31188.1	.	.	.	.	.	.	.	.	.	.	c	5.954	0.359924	0.11296	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.00107	8.72;8.72;8.72	5.68	0.323	0.15893	GPCR, rhodopsin-like superfamily (1);	0.940197	0.08767	N	0.896846	T	0.00073	0.0002	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.01561	-1.1324	10	0.15952	T	0.53	-14.7853	3.0987	0.06318	0.359:0.2975:0.2628:0.0807	.	286	Q8NGR1	O13A1_HUMAN	T	286	ENSP00000451950:A286T;ENSP00000438657:A286T;ENSP00000363522:A286T	ENSP00000311379:A286T	A	-	1	0	OR13A1	45119021	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.120000	0.10660	0.315000	0.23110	-0.143000	0.13931	GCA	.	.		0.547	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297	
DDX50	79009	hgsc.bcm.edu	37	10	70661161	70661161	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr10:70661161G>T	ENST00000373585.3	+	1	128	c.21G>T	c.(19-21)tgG>tgT	p.W7C		NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	7						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						AACTCCTCTGGGGGGACATTA	0.642																																					p.W7C		Atlas-SNP	.											.	DDX50	65	.	0			c.G21T						.						22.0	20.0	20.0					10																	70661161		2191	4282	6473	SO:0001583	missense	79009	exon1			CCTCTGGGGGGAC	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.21G>T	chr10.hg19:g.70661161G>T	ENSP00000362687:p.Trp7Cys	204.0	0.0		196.0	73.0	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	hg19	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212179	0.58452	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.19394	2.15	5.62	4.66	0.58398	.	0.693466	0.14873	N	0.293442	T	0.17408	0.0418	N	0.08118	0	0.52501	D	0.99995	D;D	0.64830	0.994;0.994	P;P	0.51415	0.669;0.669	T	0.02417	-1.1162	10	0.44086	T	0.13	-4.7945	12.0065	0.53261	0.0:0.1739:0.8261:0.0	.	7;7	Q9BQ39;B4DED6	DDX50_HUMAN;.	C	7	ENSP00000362687:W7C	ENSP00000362687:W7C	W	+	3	0	DDX50	70331167	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	2.584000	0.46102	2.818000	0.97014	0.655000	0.94253	TGG	.	.		0.642	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
JAKMIP3	282973	hgsc.bcm.edu	37	10	133946888	133946888	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr10:133946888G>T	ENST00000298622.4	+	3	844	c.706G>T	c.(706-708)Gct>Tct	p.A236S		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	236						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGCCGGGCATGCTCAGAGACT	0.547																																					p.A236S		Atlas-SNP	.											.	JAKMIP3	69	.	0			c.G706T						.						39.0	43.0	42.0					10																	133946888		1965	4143	6108	SO:0001583	missense	282973	exon3			GGGCATGCTCAGA	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.706G>T	chr10.hg19:g.133946888G>T	ENSP00000298622:p.Ala236Ser	90.0	0.0		73.0	19.0	NM_001105521	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	hg19	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030658	0.54790	.	.	ENSG00000188385	ENST00000298622	T	0.09723	2.95	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.12390	0.0301	L	0.48642	1.525	0.25781	N	0.984725	P	0.48294	0.908	B	0.43916	0.436	T	0.26950	-1.0088	10	0.08599	T	0.76	-10.3014	17.3619	0.87353	0.0:0.0:1.0:0.0	.	236	Q5VZ66	JKIP3_HUMAN	S	236	ENSP00000298622:A236S	ENSP00000298622:A236S	A	+	1	0	JAKMIP3	133796878	0.536000	0.26378	0.998000	0.56505	0.995000	0.86356	1.088000	0.30877	2.328000	0.79073	0.563000	0.77884	GCT	.	.		0.547	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
ST5	6764	hgsc.bcm.edu	37	11	8732433	8732433	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr11:8732433C>G	ENST00000534127.1	-	14	2696	c.2311G>C	c.(2311-2313)Gaa>Caa	p.E771Q	ST5_ENST00000530991.1_Missense_Mutation_p.E243Q|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000530438.1_Missense_Mutation_p.E351Q|ST5_ENST00000534278.1_5'Flank|ST5_ENST00000357665.1_Missense_Mutation_p.E771Q|ST5_ENST00000313726.6_Missense_Mutation_p.E771Q|ST5_ENST00000526099.1_Missense_Mutation_p.E284Q|ST5_ENST00000526757.1_Missense_Mutation_p.E351Q	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	771	UDENN.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CTGCCATCTTCCCCAGTCAGC	0.572																																					p.E771Q		Atlas-SNP	.											.	ST5	85	.	0			c.G2311C						.						61.0	56.0	58.0					11																	8732433		2201	4296	6497	SO:0001583	missense	6764	exon14			CATCTTCCCCAGT	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.2311G>C	chr11.hg19:g.8732433C>G	ENSP00000433528:p.Glu771Gln	59.0	0.0		53.0	14.0	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	hg19	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	C	34	5.293435	0.95546	.	.	ENSG00000166444	ENST00000526757;ENST00000534127;ENST00000313726;ENST00000530991;ENST00000357665;ENST00000526099;ENST00000530438;ENST00000533020	T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.85	5.85	0.93711	uDENN (3);	0.000000	0.85682	D	0.000000	T	0.66858	0.2832	L	0.52905	1.665	0.80722	D	1	D;D;D	0.71674	0.996;0.991;0.998	D;D;D	0.73708	0.974;0.945;0.981	T	0.66984	-0.5785	10	0.87932	D	0	-13.027	20.1577	0.98120	0.0:1.0:0.0:0.0	.	284;351;771	B4DDL8;P78524-2;P78524	.;.;ST5_HUMAN	Q	351;771;771;243;771;284;351;243	ENSP00000435097:E351Q;ENSP00000433528:E771Q;ENSP00000319678:E771Q;ENSP00000432887:E243Q;ENSP00000350294:E771Q;ENSP00000436808:E284Q;ENSP00000436802:E351Q;ENSP00000433588:E243Q	ENSP00000319678:E771Q	E	-	1	0	ST5	8689009	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.761000	0.68801	2.767000	0.95098	0.655000	0.94253	GAA	.	.		0.572	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
PATL1	219988	hgsc.bcm.edu	37	11	59416963	59416963	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr11:59416963A>C	ENST00000300146.9	-	14	1789	c.1705T>G	c.(1705-1707)Tta>Gta	p.L569V		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	569	Involved in nuclear spleckles localization.|Region C.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						TTCCCCCTTAAGTTGTCATAC	0.423																																					p.L569V		Atlas-SNP	.											.	PATL1	92	.	0			c.T1705G						.						142.0	124.0	130.0					11																	59416963		1934	4140	6074	SO:0001583	missense	219988	exon14			CCCTTAAGTTGTC	AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.1705T>G	chr11.hg19:g.59416963A>C	ENSP00000300146:p.Leu569Val	222.0	0.0		203.0	67.0	NM_152716	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Missense_Mutation	SNP	ENST00000300146.9	hg19	CCDS44613.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155249	0.78114	.	.	ENSG00000166889	ENST00000300146;ENST00000428532	T	0.68765	-0.35	5.93	0.652	0.17823	.	0.000000	0.85682	D	0.000000	T	0.74951	0.3784	L	0.61218	1.895	0.51767	D	0.999932	D;D	0.67145	0.996;0.99	D;D	0.75484	0.986;0.978	T	0.73585	-0.3936	10	0.87932	D	0	-6.8567	9.1043	0.36687	0.4746:0.0:0.5254:0.0	.	539;569	Q86TB9-4;Q86TB9	.;PATL1_HUMAN	V	569;539	ENSP00000300146:L569V	ENSP00000300146:L569V	L	-	1	2	PATL1	59173539	1.000000	0.71417	0.959000	0.39883	0.975000	0.68041	1.577000	0.36515	0.175000	0.19841	0.533000	0.62120	TTA	.	.		0.423	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394559.1	NM_152716	
ASUN	55726	hgsc.bcm.edu	37	12	27066960	27066960	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:27066960T>G	ENST00000261191.7	-	13	2057	c.1521A>C	c.(1519-1521)aaA>aaC	p.K507N	ASUN_ENST00000539625.1_Missense_Mutation_p.K406N	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	507					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GAGGATCATTTTTTCTTTCCA	0.318																																					p.K507N		Atlas-SNP	.											.	.	.	.	0			c.A1521C						.						91.0	94.0	93.0					12																	27066960		2203	4293	6496	SO:0001583	missense	55726	exon13			ATCATTTTTTCTT	AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1521A>C	chr12.hg19:g.27066960T>G	ENSP00000261191:p.Lys507Asn	265.0	0.0		274.0	74.0	NM_018164	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	ENST00000261191.7	hg19	CCDS8708.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.942273|3.942273	0.73672|0.73672	.|.	.|.	ENSG00000064102|ENSG00000064102	ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745;ENST00000261190|ENST00000542392	T;T;T|T	0.48836|0.47869	0.8;0.8;0.8|0.83	5.37|5.37	0.0833|0.0833	0.14432|0.14432	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.55097|0.55097	0.1899|0.1899	M|M	0.66939|0.66939	2.045|2.045	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.61697|.	0.99;0.979|.	P;P|.	0.62491|.	0.903;0.871|.	T|T	0.57653|0.57653	-0.7774|-0.7774	10|8	0.72032|0.66056	D|D	0.01|0.02	-28.1458|-28.1458	10.9855|10.9855	0.47520|0.47520	0.0:0.4819:0.0:0.518|0.0:0.4819:0.0:0.518	.|.	507;406|.	Q9NVM9;B4DNK1|.	M89BB_HUMAN;.|.	N|Q	154;507;406;94;4|221	ENSP00000445645:K154N;ENSP00000261191:K507N;ENSP00000443724:K406N|ENSP00000448215:K221Q	ENSP00000261190:K4N|ENSP00000448215:K221Q	K|K	-|-	3|1	2|0	C12orf11|C12orf11	26958227|26958227	0.999000|0.999000	0.42202|0.42202	0.994000|0.994000	0.49952|0.49952	0.998000|0.998000	0.95712|0.95712	0.610000|0.610000	0.24253|0.24253	0.044000|0.044000	0.15775|0.15775	0.482000|0.482000	0.46254|0.46254	AAA|AAA	.	.		0.318	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164	
ANO6	196527	hgsc.bcm.edu	37	12	45803160	45803160	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:45803160G>A	ENST00000320560.8	+	16	2103	c.1901G>A	c.(1900-1902)gGg>gAg	p.G634E	ANO6_ENST00000423947.3_Missense_Mutation_p.G655E|ANO6_ENST00000435642.1_Missense_Mutation_p.G634E|ANO6_ENST00000425752.2_Missense_Mutation_p.G634E|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000441606.2_Missense_Mutation_p.G616E	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	634					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AATCTAATTGGGCGATTTCAC	0.373																																					p.G655E		Atlas-SNP	.											.	ANO6	163	.	0			c.G1964A						.						102.0	104.0	103.0					12																	45803160		2203	4300	6503	SO:0001583	missense	196527	exon17			TAATTGGGCGATT	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.1901G>A	chr12.hg19:g.45803160G>A	ENSP00000320087:p.Gly634Glu	83.0	0.0		77.0	23.0	NM_001204803	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	hg19	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157851	0.38119	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07	4.7	4.7	0.59300	.	0.419347	0.25900	N	0.027570	T	0.56046	0.1959	L	0.45051	1.395	0.41976	D	0.990772	B;B;P;B	0.36027	0.302;0.048;0.533;0.292	B;B;B;B	0.41374	0.219;0.158;0.355;0.166	T	0.58255	-0.7668	10	0.42905	T	0.14	.	16.7235	0.85416	0.0:0.0:1.0:0.0	.	616;655;634;634	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	E	634;655;634;634;616	ENSP00000391417:G634E;ENSP00000409126:G655E;ENSP00000413840:G634E;ENSP00000320087:G634E;ENSP00000413137:G616E	ENSP00000320087:G634E	G	+	2	0	ANO6	44089427	1.000000	0.71417	0.936000	0.37596	0.895000	0.52256	4.287000	0.59001	2.538000	0.85594	0.655000	0.94253	GGG	.	.		0.373	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743	
MAP3K12	7786	hgsc.bcm.edu	37	12	53875041	53875041	+	Silent	SNP	T	T	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:53875041T>A	ENST00000267079.2	-	15	2730	c.2505A>T	c.(2503-2505)tcA>tcT	p.S835S	MAP3K12_ENST00000547035.1_Silent_p.S868S|MAP3K12_ENST00000547488.1_Silent_p.S868S	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	835					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						TGTCACAGTCTGAGTCCTCAG	0.502																																					p.S868S		Atlas-SNP	.											.	MAP3K12	160	.	0			c.A2604T						.						67.0	59.0	62.0					12																	53875041		2203	4300	6503	SO:0001819	synonymous_variant	7786	exon14			ACAGTCTGAGTCC	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.2505A>T	chr12.hg19:g.53875041T>A		91.0	0.0		117.0	54.0	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Silent	SNP	ENST00000267079.2	hg19	CCDS8860.1																																																																																			.	.		0.502	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
R3HDM2	22864	hgsc.bcm.edu	37	12	57660557	57660557	+	Silent	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:57660557A>T	ENST00000347140.3	-	19	2436	c.2046T>A	c.(2044-2046)tcT>tcA	p.S682S	R3HDM2_ENST00000403821.2_Silent_p.S716S|R3HDM2_ENST00000546843.1_5'UTR|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Silent_p.S696S|R3HDM2_ENST00000441731.2_Silent_p.S377S|R3HDM2_ENST00000358907.2_Silent_p.S682S|R3HDM2_ENST00000413953.2_Silent_p.S409S			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	682	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AGGGAGAGGGAGACTGAGGCA	0.542																																					p.S682S		Atlas-SNP	.											.	R3HDM2	125	.	0			c.T2046A						.						99.0	77.0	85.0					12																	57660557		2203	4300	6503	SO:0001819	synonymous_variant	22864	exon17			AGAGGGAGACTGA	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2046T>A	chr12.hg19:g.57660557A>T		53.0	0.0		52.0	15.0	NM_014925	Q2M1T9|Q3ZCT5	Silent	SNP	ENST00000347140.3	hg19	CCDS8937.2																																																																																			.	.		0.542	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
CNOT2	4848	hgsc.bcm.edu	37	12	70732260	70732260	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:70732260A>G	ENST00000418359.3	+	11	1389	c.938A>G	c.(937-939)gAt>gGt	p.D313G	CNOT2_ENST00000551483.1_5'UTR|CNOT2_ENST00000229195.3_Missense_Mutation_p.D313G	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	313					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TCAAGTACAGATGGACCCAAA	0.338																																					p.D313G		Atlas-SNP	.											.	CNOT2	53	.	0			c.A938G						.						83.0	84.0	84.0					12																	70732260		2203	4300	6503	SO:0001583	missense	4848	exon11			GTACAGATGGACC	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.938A>G	chr12.hg19:g.70732260A>G	ENSP00000412091:p.Asp313Gly	161.0	0.0		194.0	57.0	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	hg19	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.893083	0.33442	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550160;ENST00000552915;ENST00000548159;ENST00000551043;ENST00000550155	T;T;T;T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	N	0.16743	0.435	0.80722	D	1	B;B	0.22211	0.066;0.031	B;B	0.20577	0.03;0.009	T	0.51545	-0.8692	10	0.19147	T	0.46	-7.0665	15.5405	0.76039	1.0:0.0:0.0:0.0	.	313;313	Q9NZN8-4;Q9NZN8	.;CNOT2_HUMAN	G	313;313;313;176;252;304;313;123	ENSP00000450318:D313G;ENSP00000229195:D313G;ENSP00000412091:D313G;ENSP00000448490:D176G;ENSP00000447497:D252G;ENSP00000449659:D304G;ENSP00000449260:D313G;ENSP00000448499:D123G	ENSP00000229195:D313G	D	+	2	0	CNOT2	69018527	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.070000	0.61991	0.482000	0.46254	GAT	.	.		0.338	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
NOS1	4842	hgsc.bcm.edu	37	12	117698357	117698357	+	Silent	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:117698357C>G	ENST00000338101.4	-	13	2284	c.2280G>C	c.(2278-2280)gcG>gcC	p.A760A	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Silent_p.A760A			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		AGAGGATGGTCGCTTTCACCC	0.522																																					p.A760A	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.G2280C						.						100.0	100.0	100.0					12																	117698357		2000	4179	6179	SO:0001819	synonymous_variant	4842	exon14			GATGGTCGCTTTC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2280G>C	chr12.hg19:g.117698357C>G		110.0	0.0		99.0	31.0	NM_000620		Silent	SNP	ENST00000338101.4	hg19	CCDS55890.1																																																																																			.	.		0.522	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
CENPJ	55835	hgsc.bcm.edu	37	13	25467000	25467000	+	Silent	SNP	T	T	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr13:25467000T>C	ENST00000381884.4	-	10	3182	c.2997A>G	c.(2995-2997)ttA>ttG	p.L999L	CENPJ_ENST00000545981.1_Silent_p.L999L	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	999					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTTGCTGTTTTAAAGTCTCTC	0.333																																					p.L999L		Atlas-SNP	.											.	CENPJ	116	.	0			c.A2997G						.						97.0	94.0	95.0					13																	25467000		2203	4300	6503	SO:0001819	synonymous_variant	55835	exon10			CTGTTTTAAAGTC	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2997A>G	chr13.hg19:g.25467000T>C		144.0	0.0		161.0	54.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Silent	SNP	ENST00000381884.4	hg19	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	T	8.724	0.915074	0.17907	.	.	ENSG00000151849	ENST00000418179	.	.	.	5.22	3.09	0.35607	.	.	.	.	.	T	0.55049	0.1896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46541	-0.9184	4	.	.	.	.	6.6852	0.23142	0.0:0.4675:0.0:0.5325	.	.	.	.	E	81	.	.	K	-	1	0	CENPJ	24365000	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.919000	0.40015	0.486000	0.27676	0.454000	0.30748	AAA	.	.		0.333	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
MTMR6	9107	hgsc.bcm.edu	37	13	25826056	25826056	+	Silent	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr13:25826056A>T	ENST00000381801.5	-	12	2174	c.1413T>A	c.(1411-1413)ccT>ccA	p.P471P	MTMR6_ENST00000540661.1_Silent_p.P471P	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	471	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		AACTGTAGAGAGGATTTAAGT	0.338																																					p.P471P		Atlas-SNP	.											.	MTMR6	75	.	0			c.T1413A						.						115.0	130.0	125.0					13																	25826056		2203	4297	6500	SO:0001819	synonymous_variant	9107	exon12			GTAGAGAGGATTT	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1413T>A	chr13.hg19:g.25826056A>T		83.0	0.0		104.0	33.0	NM_004685	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Silent	SNP	ENST00000381801.5	hg19	CCDS9313.1																																																																																			.	.		0.338	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685	
PCK2	5106	hgsc.bcm.edu	37	14	24567763	24567763	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr14:24567763C>T	ENST00000216780.4	+	4	808	c.540C>T	c.(538-540)gaC>gaT	p.D180D	PCK2_ENST00000396973.4_Silent_p.D180D|PCK2_ENST00000561286.1_Silent_p.D46D|NRL_ENST00000561028.1_Intron|PCK2_ENST00000558096.1_Silent_p.D46D|PCK2_ENST00000545054.2_Silent_p.D46D|PCK2_ENST00000559250.1_Silent_p.D192D	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	180					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		AGCTCACTGACTCAGCCTATG	0.597																																					p.D180D		Atlas-SNP	.											.	PCK2	66	.	0			c.C540T						.						79.0	64.0	69.0					14																	24567763		2203	4300	6503	SO:0001819	synonymous_variant	5106	exon4			CACTGACTCAGCC	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.540C>T	chr14.hg19:g.24567763C>T		82.0	0.0		99.0	29.0	NM_001018073	O43253|Q86U01|Q9BV62	Silent	SNP	ENST00000216780.4	hg19	CCDS9609.1																																																																																			.	.		0.597	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3	NM_001018073	
SLC25A29	123096	hgsc.bcm.edu	37	14	100758804	100758804	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr14:100758804C>T	ENST00000359232.3	-	4	1028	c.728G>A	c.(727-729)gGc>gAc	p.G243D	AL157871.2_ENST00000553954.1_RNA|SLC25A29_ENST00000539621.1_Missense_Mutation_p.G177D|SLC25A29_ENST00000554912.1_Missense_Mutation_p.G177D|SLC25A29_ENST00000392908.3_3'UTR|SLC25A29_ENST00000556505.1_Missense_Mutation_p.G177D|RP11-638I2.6_ENST00000556458.1_lincRNA|SLC25A29_ENST00000555927.1_Missense_Mutation_p.G177D	NM_001039355.1	NP_001034444.1	Q8N8R3	MCATL_HUMAN	solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29	243						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	acyl carnitine transmembrane transporter activity (GO:0015227)			NS(1)|endometrium(1)|ovary(1)	3		Melanoma(154;0.152)			L-Carnitine(DB00583)	GACGCGCCAGCCCTCGGCGCG	0.726																																					p.G243D		Atlas-SNP	.											.	SLC25A29	14	.	0			c.G728A						.						10.0	13.0	12.0					14																	100758804		2135	4174	6309	SO:0001583	missense	123096	exon4			CGCCAGCCCTCGG	AK095532	CCDS32156.1	14q32.2	2013-05-22	2012-03-29	2004-01-21	ENSG00000197119	ENSG00000197119		"""Solute carriers"""	20116	protein-coding gene	gene with protein product		615064	"""chromosome 14 open reading frame 69"", ""solute carrier family 25, member 29"""	C14orf69			Standard	XM_005267343		Approved	FLJ38975	uc010twx.2	Q8N8R3	OTTHUMG00000171569	ENST00000359232.3:c.728G>A	chr14.hg19:g.100758804C>T	ENSP00000352167:p.Gly243Asp	13.0	0.0		30.0	9.0	NM_001039355	A3KMR5|Q541V0	Missense_Mutation	SNP	ENST00000359232.3	hg19	CCDS32156.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624315	0.87560	.	.	ENSG00000197119	ENST00000359232;ENST00000554912;ENST00000539621;ENST00000556505;ENST00000555927	D;D;D;D;D	0.97665	-4.48;-4.48;-4.48;-4.48;-4.48	5.62	5.62	0.85841	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.99287	0.9751	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98498	1.0613	10	0.87932	D	0	-32.0149	19.6706	0.95910	0.0:1.0:0.0:0.0	.	243	Q8N8R3	MCATL_HUMAN	D	243;177;177;177;177	ENSP00000352167:G243D;ENSP00000450913:G177D;ENSP00000442985:G177D;ENSP00000452446:G177D;ENSP00000452078:G177D	ENSP00000352167:G243D	G	-	2	0	SLC25A29	99828557	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	7.418000	0.80167	2.645000	0.89757	0.655000	0.94253	GGC	.	.		0.726	SLC25A29-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072449.3		
PAK6	56924	hgsc.bcm.edu	37	15	40564637	40564637	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr15:40564637C>T	ENST00000542403.2	+	4	1182	c.1071C>T	c.(1069-1071)gcC>gcT	p.A357A	PAK6_ENST00000560346.1_Silent_p.A357A|PAK6_ENST00000455577.2_Silent_p.A357A|PAK6_ENST00000453867.1_Silent_p.A357A|PAK6_ENST00000441369.1_Silent_p.A357A|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000260404.4_Silent_p.A357A	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	357	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		CCTGGCACGCCCAGATCAGCA	0.667																																					p.A357A		Atlas-SNP	.											.	PAK6	49	.	0			c.C1071T						.						51.0	50.0	50.0					15																	40564637		2203	4300	6503	SO:0001819	synonymous_variant	56924	exon5			GCACGCCCAGATC	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1071C>T	chr15.hg19:g.40564637C>T		59.0	0.0		62.0	4.0	NM_001128629	A8K2G2|B3KYB0|G5E9R2	Silent	SNP	ENST00000542403.2	hg19	CCDS10054.1																																																																																			.	.		0.667	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1		
SLCO3A1	28232	hgsc.bcm.edu	37	15	92459624	92459624	+	Silent	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr15:92459624G>T	ENST00000318445.6	+	2	796	c.582G>T	c.(580-582)gtG>gtT	p.V194V	SLCO3A1_ENST00000424469.2_Silent_p.V194V	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	194					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CTACCCCTGTGCAGCCCCTGG	0.617																																					p.V194V		Atlas-SNP	.											.	SLCO3A1	84	.	0			c.G582T						.						22.0	23.0	23.0					15																	92459624		2198	4298	6496	SO:0001819	synonymous_variant	28232	exon2			CCCTGTGCAGCCC	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.582G>T	chr15.hg19:g.92459624G>T		65.0	0.0		72.0	26.0	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Silent	SNP	ENST00000318445.6	hg19	CCDS10371.1																																																																																			.	.		0.617	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
IGF1R	3480	hgsc.bcm.edu	37	15	99459327	99459327	+	Missense_Mutation	SNP	G	G	A	rs143193096		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr15:99459327G>A	ENST00000268035.6	+	9	2574	c.1963G>A	c.(1963-1965)Ggc>Agc	p.G655S	IGF1R_ENST00000558762.1_Missense_Mutation_p.G655S	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	655	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCCTCAGGACGGCTACCTTTA	0.557																																					p.G655S		Atlas-SNP	.											.	IGF1R	147	.	0			c.G1963A						.	G	SER/GLY	0,4394		0,0,2197	67.0	63.0	64.0		1963	-1.1	1.0	15	dbSNP_134	64	1,8593	1.2+/-3.3	0,1,4296	yes	missense	IGF1R	NM_000875.3	56	0,1,6493	AA,AG,GG		0.0116,0.0,0.0077	benign	655/1368	99459327	1,12987	2197	4297	6494	SO:0001583	missense	3480	exon9			CAGGACGGCTACC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.1963G>A	chr15.hg19:g.99459327G>A	ENSP00000268035:p.Gly655Ser	183.0	0.0		170.0	53.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	7.286	0.610031	0.14066	0.0	1.16E-4	ENSG00000140443	ENST00000268035	T	0.67865	-0.29	4.83	-1.14	0.09741	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.360209	0.25964	N	0.027165	T	0.28566	0.0707	N	0.01529	-0.815	0.36790	D	0.8848	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.43228	-0.9404	10	0.02654	T	1	.	9.5461	0.39282	0.6952:0.0:0.3048:0.0	.	655;655	C9J5X1;P08069	.;IGF1R_HUMAN	S	655	ENSP00000268035:G655S	ENSP00000268035:G655S	G	+	1	0	IGF1R	97276850	0.993000	0.37304	0.980000	0.43619	0.994000	0.84299	0.406000	0.21032	-0.366000	0.08064	-0.218000	0.12543	GGC	.	G|1.000;A|0.000		0.557	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
TNRC6A	27327	hgsc.bcm.edu	37	16	24816121	24816121	+	Silent	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr16:24816121C>A	ENST00000395799.3	+	13	4062	c.3933C>A	c.(3931-3933)gcC>gcA	p.A1311A	TNRC6A_ENST00000315183.7_Intron|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1311	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CTAACCAGGCCCTTGGCTCCA	0.433																																					p.A1311A		Atlas-SNP	.											.	TNRC6A	171	.	0			c.C3933A						.						131.0	123.0	126.0					16																	24816121		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon13			CCAGGCCCTTGGC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3933C>A	chr16.hg19:g.24816121C>A		160.0	0.0		189.0	55.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.		0.433	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
CDH11	1009	hgsc.bcm.edu	37	16	64984770	64984770	+	Silent	SNP	G	G	A	rs563299959		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr16:64984770G>A	ENST00000268603.4	-	12	2409	c.1794C>T	c.(1792-1794)aaC>aaT	p.N598N	CDH11_ENST00000394156.3_Silent_p.N598N|CDH11_ENST00000566827.1_Silent_p.N472N	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	598	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N598N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GCAGTGCCCCGTTCACGTCGC	0.607			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		14798	0.0		0.0	False		,,,				2504	0.0				p.N598N		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	CDH11_ENST00000394156,NS,carcinoma,0,3	CDH11	260	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1794T						.						114.0	87.0	96.0					16																	64984770		2203	4300	6503	SO:0001819	synonymous_variant	1009	exon12			TGCCCCGTTCACG	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1794C>T	chr16.hg19:g.64984770G>A		74.0	0.0		62.0	22.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	hg19	CCDS10803.1																																																																																			.	.		0.607	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
WWP2	11060	hgsc.bcm.edu	37	16	69973254	69973254	+	Silent	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr16:69973254A>G	ENST00000359154.2	+	23	2552	c.2451A>G	c.(2449-2451)ggA>ggG	p.G817G	WWP2_ENST00000542271.1_Silent_p.G701G|WWP2_ENST00000568684.1_Silent_p.G378G|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000356003.2_Silent_p.G817G|WWP2_ENST00000448661.1_Silent_p.G817G	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	817	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTAGCAACGGACCACAGAAGT	0.587																																					p.G817G		Atlas-SNP	.											.	WWP2	88	.	0			c.A2451G						.						94.0	85.0	88.0					16																	69973254		2198	4300	6498	SO:0001819	synonymous_variant	11060	exon23			CAACGGACCACAG	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.2451A>G	chr16.hg19:g.69973254A>G		97.0	0.0		81.0	28.0	NM_001270454	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Silent	SNP	ENST00000359154.2	hg19	CCDS10885.1																																																																																			.	.		0.587	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
VAT1L	57687	hgsc.bcm.edu	37	16	77859321	77859321	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr16:77859321G>A	ENST00000302536.2	+	3	695	c.542G>A	c.(541-543)gGg>gAg	p.G181E		NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	181							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						CTCCGGGAAGGGATGTCTGTG	0.527																																					p.G181E		Atlas-SNP	.											.	VAT1L	68	.	0			c.G542A						.						63.0	50.0	55.0					16																	77859321		2198	4300	6498	SO:0001583	missense	57687	exon3			GGGAAGGGATGTC	AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.542G>A	chr16.hg19:g.77859321G>A	ENSP00000303129:p.Gly181Glu	146.0	0.0		108.0	34.0	NM_020927	Q8IYW8	Missense_Mutation	SNP	ENST00000302536.2	hg19	CCDS32492.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936895	0.92458	.	.	ENSG00000171724	ENST00000302536	T	0.46451	0.87	6.03	6.03	0.97812	GroES-like (1);Quinone oxidoreductase/zeta-crystallin, conserved site (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.70842	0.3270	M	0.87617	2.895	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	T	0.73754	-0.3883	10	0.66056	D	0.02	-4.1112	20.1519	0.98089	0.0:0.0:1.0:0.0	.	181	Q9HCJ6	VAT1L_HUMAN	E	181	ENSP00000303129:G181E	ENSP00000303129:G181E	G	+	2	0	VAT1L	76416822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.861000	0.98227	0.655000	0.94253	GGG	.	.		0.527	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434010.1	NM_020927	
KLHDC4	54758	hgsc.bcm.edu	37	16	87788816	87788816	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr16:87788816C>A	ENST00000270583.5	-	4	411	c.353G>T	c.(352-354)aGg>aTg	p.R118M	KLHDC4_ENST00000353170.5_Missense_Mutation_p.R61M|KLHDC4_ENST00000347925.5_Missense_Mutation_p.R118M	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	118										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		AGCACAGCGCCTCGGAGGTGG	0.517																																					p.R118M		Atlas-SNP	.											.	KLHDC4	45	.	0			c.G353T						.						195.0	177.0	183.0					16																	87788816		2198	4300	6498	SO:0001583	missense	54758	exon4			CAGCGCCTCGGAG	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.353G>T	chr16.hg19:g.87788816C>A	ENSP00000270583:p.Arg118Met	181.0	0.0		161.0	55.0	NM_001184856	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Missense_Mutation	SNP	ENST00000270583.5	hg19	CCDS10963.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532243	0.64972	.	.	ENSG00000104731	ENST00000270583;ENST00000347925;ENST00000353170	T;T;T	0.66815	0.96;0.96;-0.23	5.22	5.22	0.72569	Kelch-type beta propeller (1);	0.048998	0.85682	D	0.000000	D	0.83078	0.5176	M	0.83012	2.62	0.51012	D	0.999905	D;D;D	0.89917	0.999;1.0;0.99	D;D;D	0.71414	0.973;0.957;0.957	D	0.85892	0.1429	10	0.87932	D	0	-13.0181	17.7584	0.88456	0.0:1.0:0.0:0.0	.	61;118;118	Q8TBB5-2;Q8TBB5-3;Q8TBB5	.;.;KLDC4_HUMAN	M	118;118;61	ENSP00000270583:R118M;ENSP00000325717:R118M;ENSP00000262530:R61M	ENSP00000270583:R118M	R	-	2	0	KLHDC4	86346317	1.000000	0.71417	0.956000	0.39512	0.638000	0.38207	5.094000	0.64523	2.432000	0.82394	0.561000	0.74099	AGG	.	.		0.517	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
PELP1	27043	hgsc.bcm.edu	37	17	4575508	4575508	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:4575508C>T	ENST00000574876.1	-	16	2795	c.2778G>A	c.(2776-2778)gaG>gaA	p.E926E	PELP1_ENST00000572293.1_Silent_p.E976E|PELP1_ENST00000269230.7_Silent_p.E836E|PELP1_ENST00000301396.4_Silent_p.E1070E|PELP1_ENST00000436683.2_Silent_p.E779E			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	926	Glu-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						cttcttcctcctcttcttcct	0.438																																					p.E926E		Atlas-SNP	.											.	PELP1	102	.	0			c.G2778A						.						43.0	43.0	43.0					17																	4575508		2049	4139	6188	SO:0001819	synonymous_variant	27043	exon16			TTCCTCCTCTTCT		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2778G>A	chr17.hg19:g.4575508C>T		90.0	0.0		68.0	4.0	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	hg19	CCDS58503.1																																																																																			.	.		0.438	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
ZNF18	7566	hgsc.bcm.edu	37	17	11881942	11881942	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:11881942A>C	ENST00000322748.3	-	9	1586	c.982T>G	c.(982-984)Ttc>Gtc	p.F328V	RP11-1096G20.5_ENST00000580270.1_RNA|ZNF18_ENST00000454073.3_Missense_Mutation_p.F327V|ZNF18_ENST00000580306.2_Missense_Mutation_p.F328V	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	328					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		TCAGTGAAGAAGCCCCTCAAG	0.522																																					p.F328V		Atlas-SNP	.											ZNF18,caecum,carcinoma,0,1	ZNF18	42	.	0			c.T982G						.						133.0	141.0	139.0					17																	11881942		2203	4300	6503	SO:0001583	missense	7566	exon9			TGAAGAAGCCCCT	X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.982T>G	chr17.hg19:g.11881942A>C	ENSP00000315664:p.Phe328Val	73.0	0.0		79.0	22.0	NM_144680	Q5QHQ3|Q8IYC4|Q8NAH6	Missense_Mutation	SNP	ENST00000322748.3	hg19	CCDS32568.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.458195	0.43634	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	T;T	0.05925	3.37;3.37	4.97	1.28	0.21552	.	0.482695	0.19494	N	0.112902	T	0.02380	0.0073	N	0.14661	0.345	0.09310	N	1	B;B	0.19200	0.034;0.02	B;B	0.22601	0.04;0.018	T	0.43163	-0.9408	10	0.05525	T	0.97	-1.8901	0.4195	0.00453	0.2646:0.2168:0.3053:0.2132	.	327;328	P17022-2;P17022	.;ZNF18_HUMAN	V	328	ENSP00000391376:F328V;ENSP00000315664:F328V	ENSP00000315664:F328V	F	-	1	0	ZNF18	11822667	0.022000	0.18835	0.504000	0.27639	0.872000	0.50106	0.718000	0.25866	0.508000	0.28173	0.455000	0.32223	TTC	.	.		0.522	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441450.2	XM_085596	
MYO15A	51168	hgsc.bcm.edu	37	17	18025025	18025025	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:18025025G>T	ENST00000205890.5	+	2	3249	c.2911G>T	c.(2911-2913)Gtg>Ttg	p.V971L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	971					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCTGGGCCCTGTGCCATCCCC	0.662																																					p.V971L		Atlas-SNP	.											.	MYO15A	268	.	0			c.G2911T						.						15.0	17.0	17.0					17																	18025025		1915	4114	6029	SO:0001583	missense	51168	exon2			GGCCCTGTGCCAT	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.2911G>T	chr17.hg19:g.18025025G>T	ENSP00000205890:p.Val971Leu	147.0	0.0		143.0	54.0	NM_016239	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	hg19	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	g	5.999	0.368237	0.11352	.	.	ENSG00000091536	ENST00000205890	D	0.86497	-2.13	4.48	0.98	0.19750	.	.	.	.	.	T	0.71117	0.3302	N	0.08118	0	0.21256	N	0.999746	B	0.02656	0.0	B	0.04013	0.001	T	0.58381	-0.7646	9	0.37606	T	0.19	.	6.0525	0.19792	0.111:0.3672:0.5218:0.0	.	971	Q9UKN7	MYO15_HUMAN	L	971	ENSP00000205890:V971L	ENSP00000205890:V971L	V	+	1	0	MYO15A	17965750	0.000000	0.05858	0.508000	0.27688	0.164000	0.22412	0.131000	0.15870	0.280000	0.22209	0.455000	0.32223	GTG	.	.		0.662	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
SLFN11	91607	hgsc.bcm.edu	37	17	33679758	33679758	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:33679758C>A	ENST00000394566.1	-	7	2595	c.2323G>T	c.(2323-2325)Gga>Tga	p.G775*	SLFN11_ENST00000308377.4_Nonsense_Mutation_p.G775*	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	775					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGTAAGGTTCCCTGAACACCC	0.448																																					p.G775X		Atlas-SNP	.											.	SLFN11	112	.	0			c.G2323T						.						65.0	62.0	63.0					17																	33679758		2203	4300	6503	SO:0001587	stop_gained	91607	exon5			AGGTTCCCTGAAC	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2323G>T	chr17.hg19:g.33679758C>A	ENSP00000378067:p.Gly775*	121.0	0.0		108.0	26.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Nonsense_Mutation	SNP	ENST00000394566.1	hg19	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	c	38	7.128658	0.98081	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	.	.	.	3.85	3.85	0.44370	.	0.275722	0.26016	N	0.026843	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.4779	0.50308	0.0:1.0:0.0:0.0	.	.	.	.	X	775	.	ENSP00000312402:G775X	G	-	1	0	SLFN11	30703871	0.306000	0.24490	0.005000	0.12908	0.018000	0.09664	2.947000	0.49058	2.144000	0.66660	0.655000	0.94253	GGA	.	.		0.448	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
CCL3	6348	hgsc.bcm.edu	37	17	34416065	34416065	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:34416065C>T	ENST00000225245.5	-	3	314	c.232G>A	c.(232-234)Gag>Aag	p.E78K	AC069363.1_ENST00000592728.1_RNA|AC069363.1_ENST00000441575.1_RNA|AC069363.1_ENST00000590992.1_RNA	NM_002983.2	NP_002974.1	P10147	CCL3_HUMAN	chemokine (C-C motif) ligand 3	78			E -> D (in dbSNP:rs34171309).		astrocyte cell migration (GO:0043615)|behavior (GO:0007610)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|eosinophil degranulation (GO:0043308)|exocytosis (GO:0006887)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|monocyte chemotaxis (GO:0002548)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoclast differentiation (GO:0045671)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive chemotaxis (GO:0050918)|positive regulation of calcium ion import (GO:0090280)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell migration (GO:0030335)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of tumor necrosis factor production (GO:0032760)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|response to toxic substance (GO:0009636)|signaling (GO:0023052)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)	calcium-dependent protein kinase C activity (GO:0004698)|CCR1 chemokine receptor binding (GO:0031726)|CCR5 chemokine receptor binding (GO:0031730)|chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|protein kinase activity (GO:0004672)			breast(2)|lung(3)|urinary_tract(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACCCACTCCTCACTGGGGTCA	0.617																																					p.E78K		Atlas-SNP	.											.	CCL3	8	.	0			c.G232A						.						126.0	124.0	125.0					17																	34416065		2203	4300	6503	SO:0001583	missense	6348	exon3			ACTCCTCACTGGG	M23178	CCDS11307.1	17q12	2014-05-06	2002-08-22	2002-08-23	ENSG00000006075	ENSG00000277632		"""Chemokine ligands"", ""Endogenous ligands"""	10627	protein-coding gene	gene with protein product		182283	"""small inducible cytokine A3 (homologous to mouse Mip-1a)"""	SCYA3			Standard	NM_002983		Approved	G0S19-1, LD78ALPHA, MIP-1-alpha	uc002hkv.3	P10147	OTTHUMG00000188413	ENST00000225245.5:c.232G>A	chr17.hg19:g.34416065C>T	ENSP00000225245:p.Glu78Lys	488.0	0.0		449.0	124.0	NM_002983		Missense_Mutation	SNP	ENST00000225245.5	hg19	CCDS11307.1	.	.	.	.	.	.	.	.	.	.	.	1.245	-0.620244	0.03636	.	.	ENSG00000006075	ENST00000225245	T	0.04809	3.55	5.82	1.52	0.23074	Chemokine interleukin-8-like domain (3);	0.150495	0.42548	D	0.000683	T	0.02533	0.0077	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.18263	0.021	T	0.48958	-0.8988	9	0.10902	T	0.67	.	7.5381	0.27723	0.0:0.5903:0.2578:0.1519	.	78	P10147	CCL3_HUMAN	K	78	ENSP00000225245:E78K	ENSP00000225245:E78K	E	-	1	0	CCL3	31440178	0.002000	0.14202	0.240000	0.24138	0.046000	0.14306	0.330000	0.19715	0.096000	0.17463	-1.869000	0.00555	GAG	.	.		0.617	CCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256581.1	NM_002983	
GNGT2	2793	hgsc.bcm.edu	37	17	47284155	47284155	+	Silent	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:47284155A>G	ENST00000511277.1	-	4	353	c.174T>C	c.(172-174)aaT>aaC	p.N58N	GNGT2_ENST00000503070.1_Silent_p.N58N|GNGT2_ENST00000300406.2_Silent_p.N58N|GNGT2_ENST00000507680.1_Silent_p.N58N|GNGT2_ENST00000515635.1_Silent_p.N58N|GNGT2_ENST00000511673.1_Silent_p.N58N	NM_001198756.1	NP_001185685.1	O14610	GBGT2_HUMAN	guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2	58					G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|phototransduction (GO:0007602)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			endometrium(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CCTTGAAGGGATTCTTGTCCT	0.532																																					p.N58N		Atlas-SNP	.											.	GNGT2	12	.	0			c.T174C						.						170.0	146.0	154.0					17																	47284155		2203	4300	6503	SO:0001819	synonymous_variant	2793	exon4			GAAGGGATTCTTG		CCDS11545.1	17q21	2003-12-17				ENSG00000167083			4412	protein-coding gene	gene with protein product		139391				9286705	Standard	NM_031498		Approved	GNG9	uc021tzq.1	O14610		ENST00000511277.1:c.174T>C	chr17.hg19:g.47284155A>G		167.0	0.0		166.0	59.0	NM_031498	B2R746|D3DTW5	Silent	SNP	ENST00000511277.1	hg19	CCDS11545.1																																																																																			.	.		0.532	GNGT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364482.1	NM_031498	
COG1	9382	hgsc.bcm.edu	37	17	71199899	71199899	+	Silent	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:71199899C>T	ENST00000299886.4	+	9	2429	c.2349C>T	c.(2347-2349)gcC>gcT	p.A783A		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	783					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			TAGTAGCTGCCTATGAGAAAC	0.393																																					p.A783A		Atlas-SNP	.											.	COG1	46	.	0			c.C2349T						.						121.0	121.0	121.0					17																	71199899		2203	4300	6503	SO:0001819	synonymous_variant	9382	exon9			AGCTGCCTATGAG		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.2349C>T	chr17.hg19:g.71199899C>T		157.0	0.0		173.0	59.0	NM_018714	Q9NPV9|Q9P2G6	Silent	SNP	ENST00000299886.4	hg19	CCDS11692.1																																																																																			.	.		0.393	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
C17orf99	100141515	hgsc.bcm.edu	37	17	76160409	76160409	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr17:76160409A>G	ENST00000340363.5	+	4	659	c.604A>G	c.(604-606)Aat>Gat	p.N202D	C17orf99_ENST00000451352.3_3'UTR	NM_001163075.1	NP_001156547.1	Q6UX52	CQ099_HUMAN	chromosome 17 open reading frame 99	202						extracellular region (GO:0005576)											AAACAACGCCAATGTCCAGCA	0.632																																					p.N202D		Atlas-SNP	.											.	.	.	.	0			c.A604G						.						56.0	55.0	55.0					17																	76160409		692	1591	2283	SO:0001583	missense	100141515	exon4			AACGCCAATGTCC	AY358510	CCDS54171.1	17q25.3	2012-10-23			ENSG00000187997	ENSG00000187997			34490	protein-coding gene	gene with protein product							Standard	NM_001163075		Approved	GLPG464, UNQ464	uc002jus.4	Q6UX52	OTTHUMG00000153871	ENST00000340363.5:c.604A>G	chr17.hg19:g.76160409A>G	ENSP00000343493:p.Asn202Asp	215.0	0.0		187.0	61.0	NM_001163075		Missense_Mutation	SNP	ENST00000340363.5	hg19	CCDS54171.1	.	.	.	.	.	.	.	.	.	.	A	7.717	0.696417	0.15106	.	.	ENSG00000187997	ENST00000340363;ENST00000451352	T	0.14766	2.48	4.28	-3.72	0.04411	.	1.427250	0.05239	N	0.511881	T	0.09113	0.0225	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.40869	-0.9540	10	0.54805	T	0.06	-2.551	11.8077	0.52165	0.3278:0.0:0.6722:0.0	.	189;202	E7ESU9;Q6UX52	.;CQ099_HUMAN	D	202;189	ENSP00000343493:N202D	ENSP00000343493:N202D	N	+	1	0	C17orf99	73672004	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.226000	0.09139	-0.777000	0.04572	0.378000	0.23410	AAT	.	.		0.632	C17orf99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332775.1	NM_001163075	
MEX3C	51320	hgsc.bcm.edu	37	18	48702858	48702858	+	5'Flank	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr18:48702858C>G	ENST00000591040.1	-	0	799							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		GCAATAACCTCATTCTCAAAG	0.463																																					p.E615Q		Atlas-SNP	.											.	MEX3C	77	.	0			c.G1843C						.						247.0	216.0	226.0					18																	48702858		2203	4300	6503	SO:0001631	upstream_gene_variant	51320	exon2			TAACCTCATTCTC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693		chr18.hg19:g.48702858C>G	Exception_encountered	162.0	0.0		185.0	70.0	NM_016626	A1L022|Q9NZE3	Missense_Mutation	SNP	ENST00000591040.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.79	2.938177	0.52972	.	.	ENSG00000176624	ENST00000406189	T	0.67523	-0.27	6.03	6.03	0.97812	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.099528	0.64402	D	0.000003	T	0.64505	0.2604	L	0.45137	1.4	0.45822	D	0.998696	P	0.34934	0.476	B	0.36378	0.223	T	0.65479	-0.6158	10	0.66056	D	0.02	-4.9696	19.3283	0.94273	0.0:1.0:0.0:0.0	.	615	Q5U5Q3	MEX3C_HUMAN	Q	615	ENSP00000385610:E615Q	ENSP00000385610:E615Q	E	-	1	0	MEX3C	46956856	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.365000	0.52335	2.861000	0.98227	0.655000	0.94253	GAG	.	.		0.463	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
OR10H1	26539	hgsc.bcm.edu	37	19	15918464	15918464	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr19:15918464G>T	ENST00000334920.2	-	1	472	c.384C>A	c.(382-384)caC>caA	p.H128Q		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						AGCGCAGGGGGTGGCAGATGG	0.647																																					p.H128Q		Atlas-SNP	.											.	OR10H1	59	.	0			c.C384A						.						61.0	50.0	54.0					19																	15918464		2203	4299	6502	SO:0001583	missense	26539	exon1			CAGGGGGTGGCAG	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.384C>A	chr19.hg19:g.15918464G>T	ENSP00000335596:p.His128Gln	133.0	0.0		170.0	63.0	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	hg19	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	.	11.16	1.556771	0.27827	.	.	ENSG00000186723	ENST00000334920	T	0.01335	5.0	4.71	-4.45	0.03546	GPCR, rhodopsin-like superfamily (1);	0.255144	0.27811	N	0.017755	T	0.01592	0.0051	L	0.41906	1.305	0.26712	N	0.970953	B	0.33748	0.423	B	0.41894	0.369	T	0.39502	-0.9611	10	0.49607	T	0.09	.	6.752	0.23491	0.4597:0.1201:0.4202:0.0	.	128	Q9Y4A9	O10H1_HUMAN	Q	128	ENSP00000335596:H128Q	ENSP00000335596:H128Q	H	-	3	2	OR10H1	15779464	0.964000	0.33143	0.667000	0.29798	0.133000	0.20885	0.033000	0.13754	-0.430000	0.07318	-0.835000	0.03068	CAC	.	.		0.647	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
MAP1S	55201	hgsc.bcm.edu	37	19	17835870	17835870	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr19:17835870C>G	ENST00000324096.4	+	4	467	c.316C>G	c.(316-318)Ctg>Gtg	p.L106V	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.L80V|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	106	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CCGGAACCTTCTGTTGGACCC	0.597																																					p.L106V		Atlas-SNP	.											.	MAP1S	74	.	0			c.C316G						.						111.0	109.0	110.0					19																	17835870		2203	4300	6503	SO:0001583	missense	55201	exon4			AACCTTCTGTTGG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.316C>G	chr19.hg19:g.17835870C>G	ENSP00000325313:p.Leu106Val	176.0	0.0		160.0	55.0	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	hg19	CCDS32954.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436395	0.43224	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.02525	4.26;4.26	4.44	3.4	0.38934	.	0.000000	0.41605	D	0.000860	T	0.03695	0.0105	L	0.46157	1.445	0.30221	N	0.79681	B;B;P	0.35745	0.394;0.394;0.518	B;B;B	0.39465	0.3;0.3;0.147	T	0.19647	-1.0299	10	0.24483	T	0.36	-20.9382	8.362	0.32363	0.0:0.8876:0.0:0.1124	.	80;106;106	B4DH53;A8K940;Q66K74	.;.;MAP1S_HUMAN	V	106;80	ENSP00000325313:L106V;ENSP00000439243:L80V	ENSP00000325313:L106V	L	+	1	2	MAP1S	17696870	0.555000	0.26530	0.994000	0.49952	0.983000	0.72400	0.995000	0.29706	0.854000	0.35336	0.491000	0.48974	CTG	.	.		0.597	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ANKRD27	84079	hgsc.bcm.edu	37	19	33110252	33110252	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr19:33110252A>G	ENST00000306065.4	-	20	2079	c.1921T>C	c.(1921-1923)Tcc>Ccc	p.S641P		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	641					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					TGGCTGATGGAGTCCACGGAG	0.607																																					p.S641P		Atlas-SNP	.											.	ANKRD27	86	.	0			c.T1921C						.						79.0	74.0	76.0					19																	33110252		2203	4300	6503	SO:0001583	missense	84079	exon20			TGATGGAGTCCAC	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1921T>C	chr19.hg19:g.33110252A>G	ENSP00000304292:p.Ser641Pro	55.0	0.0		59.0	16.0	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	hg19	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.284941	0.40394	.	.	ENSG00000105186	ENST00000306065	T	0.64618	-0.11	5.57	5.57	0.84162	Ankyrin repeat-containing domain (2);	0.117017	0.38959	N	0.001520	T	0.57651	0.2068	M	0.61703	1.905	0.80722	D	1	P	0.45283	0.855	B	0.41571	0.36	T	0.59069	-0.7523	10	0.34782	T	0.22	-25.8552	9.0767	0.36527	0.7944:0.0:0.0:0.2056	.	641	Q96NW4	ANR27_HUMAN	P	641	ENSP00000304292:S641P	ENSP00000304292:S641P	S	-	1	0	ANKRD27	37802092	0.999000	0.42202	0.944000	0.38274	0.553000	0.35397	3.088000	0.50175	2.113000	0.64589	0.533000	0.62120	TCC	.	.		0.607	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
WDR87	83889	hgsc.bcm.edu	37	19	38380424	38380424	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr19:38380424G>T	ENST00000303868.5	-	6	3994	c.3770C>A	c.(3769-3771)tCc>tAc	p.S1257Y	WDR87_ENST00000447313.2_Missense_Mutation_p.S1296Y	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1257										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TTTTGTTTGGGAACCAGATAT	0.517																																					p.S1257Y		Atlas-SNP	.											.	WDR87	191	.	0			c.C3770A						.						193.0	155.0	167.0					19																	38380424		692	1591	2283	SO:0001583	missense	83889	exon6			GTTTGGGAACCAG	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3770C>A	chr19.hg19:g.38380424G>T	ENSP00000368025:p.Ser1257Tyr	105.0	0.0		117.0	43.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.497199	0.26861	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.28895	1.6;1.59	4.84	4.84	0.62591	.	0.374358	0.19553	N	0.111501	T	0.44582	0.1300	L	0.32530	0.975	0.36493	D	0.868511	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.53844	-0.8381	10	0.87932	D	0	-13.0749	13.4587	0.61214	0.0:0.0:1.0:0.0	.	1257;1296	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	Y	1296;1257	ENSP00000405012:S1296Y;ENSP00000368025:S1257Y	ENSP00000368025:S1257Y	S	-	2	0	WDR87	43072264	0.999000	0.42202	0.965000	0.40720	0.074000	0.17049	3.002000	0.49496	2.214000	0.71695	0.544000	0.68410	TCC	.	.		0.517	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
VASP	7408	hgsc.bcm.edu	37	19	46032587	46032587	+	IGR	SNP	G	G	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr19:46032587G>T	ENST00000245932.6	+	0	2305				OPA3_ENST00000323060.3_Missense_Mutation_p.F90L	NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein						actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		AGGCGGTGATGAAGATGATGC	0.642																																					p.F90L		Atlas-SNP	.											.	OPA3	19	.	0			c.C270A						.						57.0	59.0	58.0					19																	46032587		2202	4300	6502	SO:0001628	intergenic_variant	80207	exon2			GGTGATGAAGATG		CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552			chr19.hg19:g.46032587G>T		113.0	0.0		74.0	18.0	NM_001017989	B2RBT9|Q6PIZ1|Q93035	Missense_Mutation	SNP	ENST00000245932.6	hg19	CCDS33051.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007076	0.35415	.	.	ENSG00000125741	ENST00000323060	D	0.84944	-1.92	3.67	0.0369	0.14194	.	0.000000	0.85682	D	0.000000	D	0.88934	0.6572	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.84925	0.0856	9	0.45353	T	0.12	-18.7637	6.7584	0.23526	0.376:0.0:0.624:0.0	.	90	Q9H6K4-2	.	L	90	ENSP00000319817:F90L	ENSP00000319817:F90L	F	-	3	2	OPA3	50724427	0.689000	0.27690	0.151000	0.22473	0.055000	0.15305	0.874000	0.28065	-0.019000	0.14055	-0.367000	0.07326	TTC	.	.		0.642	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459589.1		
ZNF552	79818	hgsc.bcm.edu	37	19	58319697	58319697	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr19:58319697A>G	ENST00000391701.1	-	3	1104	c.935T>C	c.(934-936)aTt>aCt	p.I312T	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000599802.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CTGGTGTGCAATGAGGTGGTA	0.443																																					p.I312T		Atlas-SNP	.											.	ZNF552	32	.	0			c.T935C						.						89.0	81.0	83.0					19																	58319697		2203	4300	6503	SO:0001583	missense	79818	exon3			TGTGCAATGAGGT	AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.935T>C	chr19.hg19:g.58319697A>G	ENSP00000375582:p.Ile312Thr	91.0	0.0		94.0	31.0	NM_024762	B3KUE9|Q6P5A6	Missense_Mutation	SNP	ENST00000391701.1	hg19	CCDS12963.1	.	.	.	.	.	.	.	.	.	.	A	9.960	1.222614	0.22457	.	.	ENSG00000178935	ENST00000391701	T	0.07114	3.22	1.73	0.668	0.17912	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03053	0.0090	N	0.02985	-0.445	0.09310	N	1	B;B	0.25850	0.005;0.136	B;B	0.32149	0.025;0.141	T	0.46470	-0.9189	9	0.23302	T	0.38	.	1.4669	0.02408	0.4715:0.0:0.2132:0.3153	.	308;312	B7Z1H1;Q9H707	.;ZN552_HUMAN	T	312	ENSP00000375582:I312T	ENSP00000375582:I312T	I	-	2	0	ZNF552	63011509	0.000000	0.05858	0.001000	0.08648	0.675000	0.39556	-0.664000	0.05292	0.777000	0.33496	0.164000	0.16699	ATT	.	.		0.443	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466829.1	NM_024762	
SYCP2	10388	hgsc.bcm.edu	37	20	58449053	58449053	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr20:58449053G>A	ENST00000357552.3	-	35	3638	c.3413C>T	c.(3412-3414)tCa>tTa	p.S1138L	SYCP2_ENST00000371001.2_Missense_Mutation_p.S1138L			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1138					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TGGATAAGGTGATATAGATTT	0.308																																					p.S1138L		Atlas-SNP	.											.	SYCP2	204	.	0			c.C3413T						.						131.0	120.0	123.0					20																	58449053		2202	4300	6502	SO:0001583	missense	10388	exon34			TAAGGTGATATAG	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3413C>T	chr20.hg19:g.58449053G>A	ENSP00000350162:p.Ser1138Leu	161.0	0.0		127.0	36.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083176	0.55861	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.20069	2.1;2.1	4.88	3.85	0.44370	.	0.391238	0.22093	N	0.064722	T	0.35799	0.0944	L	0.56769	1.78	0.37687	D	0.92369	D	0.61697	0.99	P	0.59487	0.858	T	0.32481	-0.9905	10	0.72032	D	0.01	-3.7685	11.3204	0.49419	0.0:0.0:0.8185:0.1815	.	1138	Q9BX26	SYCP2_HUMAN	L	1138	ENSP00000360040:S1138L;ENSP00000350162:S1138L	ENSP00000350162:S1138L	S	-	2	0	SYCP2	57882448	0.999000	0.42202	0.856000	0.33681	0.490000	0.33462	2.841000	0.48223	2.433000	0.82419	0.563000	0.77884	TCA	.	.		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
RBBP8NL	140893	hgsc.bcm.edu	37	20	60989559	60989559	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr20:60989559G>A	ENST00000252998.1	-	10	1004	c.848C>T	c.(847-849)tCc>tTc	p.S283F		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	283						extracellular space (GO:0005615)											CACCTTCGGGGAGAGCTTCGG	0.692																																					p.S283F		Atlas-SNP	.											.	.	.	.	0			c.C848T						.						4.0	5.0	5.0					20																	60989559		2042	4076	6118	SO:0001583	missense	140893	exon10			TTCGGGGAGAGCT	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.848C>T	chr20.hg19:g.60989559G>A	ENSP00000252998:p.Ser283Phe	75.0	0.0		77.0	22.0	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	hg19	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119713	0.37436	.	.	ENSG00000130701	ENST00000252998	T	0.20738	2.05	5.11	4.15	0.48705	.	0.654623	0.14363	N	0.324301	T	0.30823	0.0777	L	0.48642	1.525	0.09310	N	1	D	0.56968	0.978	P	0.52267	0.694	T	0.09164	-1.0687	10	0.66056	D	0.02	-7.4802	13.581	0.61903	0.0:0.1563:0.8436:0.0	.	283	Q8NC74	CT151_HUMAN	F	283	ENSP00000252998:S283F	ENSP00000252998:S283F	S	-	2	0	C20orf151	60422954	0.003000	0.15002	0.073000	0.20177	0.006000	0.05464	1.224000	0.32539	1.140000	0.42260	0.491000	0.48974	TCC	.	.		0.692	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
TPTE	7179	hgsc.bcm.edu	37	21	10906954	10906954	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr21:10906954A>T	ENST00000361285.4	-	24	1936	c.1607T>A	c.(1606-1608)cTt>cAt	p.L536H	TPTE_ENST00000298232.7_Missense_Mutation_p.L518H|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.L498H	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	536	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTCGCCAAAAAGTATCTCCAC	0.378																																					p.L536H		Atlas-SNP	.											.	TPTE	513	.	0			c.T1607A						.						142.0	126.0	131.0					21																	10906954		2203	4300	6503	SO:0001583	missense	7179	exon24			CCAAAAAGTATCT	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1607T>A	chr21.hg19:g.10906954A>T	ENSP00000355208:p.Leu536His	344.0	0.0		350.0	44.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	hg19	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	1.633	-0.518468	0.04171	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.86230	-2.09;-2.09;-2.09	2.39	-0.354	0.12591	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	1.700170	0.03457	U	0.211538	T	0.76248	0.3961	N	0.17082	0.46	0.09310	N	1	B;B;B	0.29671	0.005;0.005;0.254	B;B;B	0.31686	0.018;0.023;0.134	T	0.62666	-0.6806	10	0.15952	T	0.53	-2.2927	5.9394	0.19184	0.4243:0.0:0.0:0.5757	.	498;518;536	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	H	518;536;498	ENSP00000298232:L518H;ENSP00000355208:L536H;ENSP00000344441:L498H	ENSP00000298232:L518H	L	-	2	0	TPTE	9928825	0.061000	0.20836	0.004000	0.12327	0.023000	0.10783	0.084000	0.14891	-0.076000	0.12775	0.155000	0.16302	CTT	.	.		0.378	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
BAGE2	85319	hgsc.bcm.edu	37	21	11049587	11049587	+	RNA	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr21:11049587G>A	ENST00000470054.1	-	0	521							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGTCTCCCGGGCTGTCGCACA	0.393																																					p.A105V		Atlas-SNP	.											.	.	.	.	0			c.C314T						.						66.0	54.0	58.0					21																	11049587		692	1591	2283			85318	exon4			TCCCGGGCTGTCG	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		chr21.hg19:g.11049587G>A		473.0	0.0		564.0	31.0	NM_182481	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	hg19																																																																																				.	.		0.393	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
NLGN4X	57502	hgsc.bcm.edu	37	X	5810976	5810976	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chrX:5810976G>A	ENST00000381095.3	-	6	2960	c.2333C>T	c.(2332-2334)aCc>aTc	p.T778I	NLGN4X_ENST00000381092.1_Missense_Mutation_p.T778I|NLGN4X_ENST00000275857.6_Missense_Mutation_p.T778I|NLGN4X_ENST00000381093.2_Missense_Mutation_p.T798I|NLGN4X_ENST00000538097.1_Missense_Mutation_p.T778I	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	778					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CATGGTGATGGTGTTTGGCGT	0.542																																					p.T778I		Atlas-SNP	.											.	NLGN4X	191	.	0			c.C2333T						.						313.0	256.0	275.0					X																	5810976		2203	4300	6503	SO:0001583	missense	57502	exon6			GTGATGGTGTTTG	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2333C>T	chrX.hg19:g.5810976G>A	ENSP00000370485:p.Thr778Ile	179.0	0.0		140.0	73.0	NM_181332	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	hg19	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486139	0.63962	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1	3.82	3.82	0.43975	.	0.000000	0.35838	N	0.002954	T	0.40595	0.1123	M	0.69823	2.125	0.46458	D	0.999051	P;P;D	0.55385	0.951;0.951;0.971	P;P;P	0.58721	0.703;0.703;0.844	T	0.44298	-0.9337	10	0.87932	D	0	.	14.222	0.65833	0.0:0.0:1.0:0.0	.	835;778;798	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	I	778;798;778;778;778	ENSP00000370485:T778I;ENSP00000370483:T798I;ENSP00000275857:T778I;ENSP00000370482:T778I;ENSP00000439203:T778I	ENSP00000275857:T778I	T	-	2	0	NLGN4X	5820976	1.000000	0.71417	0.993000	0.49108	0.906000	0.53458	6.565000	0.73974	1.508000	0.48769	0.513000	0.50165	ACC	.	.		0.542	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
MSL3	10943	hgsc.bcm.edu	37	X	11783626	11783626	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chrX:11783626C>A	ENST00000312196.4	+	9	1054	c.949C>A	c.(949-951)Cca>Aca	p.P317T	MSL3_ENST00000361672.2_Missense_Mutation_p.P168T|MSL3_ENST00000398527.2_Missense_Mutation_p.P305T|MSL3_ENST00000380693.3_Missense_Mutation_p.P151T|MSL3_ENST00000337339.2_Missense_Mutation_p.P317T	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	317	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.|Required for the histone acetyltransferase activity of the MSL complex.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						TTTGTTGAATCCATCCACGCC	0.572																																					p.P317T		Atlas-SNP	.											.	MSL3	88	.	0			c.C949A						.						114.0	104.0	108.0					X																	11783626		2203	4300	6503	SO:0001583	missense	10943	exon9			TTGAATCCATCCA	AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.949C>A	chrX.hg19:g.11783626C>A	ENSP00000312244:p.Pro317Thr	87.0	0.0		77.0	58.0	NM_078628	A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Missense_Mutation	SNP	ENST00000312196.4	hg19	CCDS14147.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321924	0.81580	.	.	ENSG00000005302	ENST00000312196;ENST00000337339;ENST00000361672;ENST00000398527;ENST00000380693;ENST00000380692	T;T;T;T;T;T	0.13657	3.15;3.04;2.75;2.94;2.77;2.57	4.61	4.61	0.57282	.	0.109676	0.64402	D	0.000006	T	0.40247	0.1109	M	0.81942	2.565	0.52501	D	0.999955	D;D;D;D;D	0.89917	0.998;0.992;0.995;0.998;1.0	D;P;D;D;D	0.91635	0.966;0.883;0.919;0.966;0.999	T	0.32719	-0.9896	10	0.38643	T	0.18	.	17.0067	0.86395	0.0:1.0:0.0:0.0	.	305;168;258;317;317	B4DUV8;B7Z227;Q8N5Y2-2;Q8N5Y2;A6NHW8	.;.;.;MS3L1_HUMAN;.	T	317;317;168;305;151;151	ENSP00000312244:P317T;ENSP00000338078:P317T;ENSP00000354562:P168T;ENSP00000381538:P305T;ENSP00000370069:P151T;ENSP00000370068:P151T	ENSP00000312244:P317T	P	+	1	0	MSL3	11693547	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.436000	0.73417	2.021000	0.59480	0.600000	0.82982	CCA	.	.		0.572	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055757.1	NM_006800	
FANCB	2187	hgsc.bcm.edu	37	X	14876077	14876077	+	Splice_Site	SNP	C	C	T			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chrX:14876077C>T	ENST00000324138.3	-	4	1258		c.e4-1		FANCB_ENST00000398334.1_Splice_Site	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B						DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ATGGTTCACTCTaataaataa	0.303								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												.		Atlas-SNP	.											.	FANCB	78	.	0			c.1105-1G>A						.						70.0	62.0	65.0					X																	14876077		2203	4300	6503	SO:0001630	splice_region_variant	2187	exon6	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTCACTCTAATAA	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1105-1G>A	chrX.hg19:g.14876077C>T		156.0	0.0		127.0	93.0	NM_001018113	B2RMZ4|Q7Z2U2|Q86XG1	Splice_Site	SNP	ENST00000324138.3	hg19	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138913	0.56936	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4792	0.67567	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FANCB	14785998	1.000000	0.71417	0.733000	0.30861	0.391000	0.30476	4.028000	0.57246	2.255000	0.74692	0.513000	0.50165	.	.	.		0.303	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	Intron
KIAA1109	84162	hgsc.bcm.edu	37	4	123097024	123097040	+	Frame_Shift_Del	DEL	ATTTTTCGGTGGTGGAA	ATTTTTCGGTGGTGGAA	-			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	ATTTTTCGGTGGTGGAA	ATTTTTCGGTGGTGGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:123097024_123097040delATTTTTCGGTGGTGGAA	ENST00000264501.4	+	6	686_702	c.313_329delATTTTTCGGTGGTGGAA	c.(313-330)atttttcggtggtggaaafs	p.IFRWWK105fs	KIAA1109_ENST00000455637.1_Frame_Shift_Del_p.IFRWWK105fs|KIAA1109_ENST00000388738.3_Frame_Shift_Del_p.IFRWWK105fs			Q2LD37	K1109_HUMAN	KIAA1109	105					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGGATTCATCATTTTTCGGTGGTGGAAAATGTATAAC	0.272																																					p.104_110del		Atlas-Indel,Pindel	.											KIAA1109,colon,carcinoma,0,1	KIAA1109	424	.	0			c.312_328del						.																																			SO:0001589	frameshift_variant	84162	exon4			.	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.313_329delATTTTTCGGTGGTGGAA	chr4.hg19:g.123097024_123097040delATTTTTCGGTGGTGGAA	ENSP00000264501:p.Ile105fs	360.0	0.0		250.0	26.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Frame_Shift_Del	DEL	ENST00000264501.4	hg19	CCDS43267.1																																																																																			.	.		0.272	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
TRAIP	10293	hgsc.bcm.edu	37	3	49866583	49866584	+	Frame_Shift_Del	DEL	CT	CT	-	rs35129566	byFrequency	TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr3:49866583_49866584delCT	ENST00000331456.2	-	15	1475_1476	c.1362_1363delAG	c.(1360-1365)acagtgfs	p.V455fs		NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	455	Interaction with CYLD.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGAGAAGGCACTGTCTTCACCC	0.54																																					p.455_455del		Atlas-Indel,Pindel	.											.	TRAIP	47	.	0			c.1363_1364del						.																																			SO:0001589	frameshift_variant	10293	exon15			.	BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.1362_1363delAG	chr3.hg19:g.49866583_49866584delCT	ENSP00000328203:p.Val455fs	196.0	0.0		204.0	79.0	NM_005879	B5BU84|B5BUL3|O00467	Frame_Shift_Del	DEL	ENST00000331456.2	hg19	CCDS2806.1																																																																																			.	.		0.540	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350518.1	NM_005879	
ZFHX3	463	hgsc.bcm.edu	37	16	72991696	72991697	+	In_Frame_Ins	INS	-	-	GCCGCC	rs576025667		TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr16:72991696_72991697insGCCGCC	ENST00000268489.5	-	2	3020_3021	c.2348_2349insGGCGGC	c.(2347-2349)gca>gcGGCGGCa	p.783_783A>AAA	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	783	Poly-Ala.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGATATTGgctgccgccgccgc	0.649																																					p.A783delinsAAA		Atlas-INDEL	.											.	ZFHX3	404	.	0			c.2349_2350insGGCGGC						.																																			SO:0001652	inframe_insertion	463	exon2			.	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2343_2348dupGGCGGC	chr16.hg19:g.72991697_72991702dupGCCGCC	ENSP00000268489:p.AlaAla783dup	36.0	0.0		60.0	15.0	NM_006885	D3DWS8|O15101|Q13719	In_Frame_Ins	INS	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.		0.649	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
FGA	2243	hgsc.bcm.edu	37	4	155507454	155507455	+	In_Frame_Ins	INS	-	-	CAG			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr4:155507454_155507455insCAG	ENST00000302053.3	-	5	1204_1205	c.1126_1127insCTG	c.(1126-1128)gag>gCTGag	p.375_376insA	FGA_ENST00000403106.3_In_Frame_Ins_p.375_376insA	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	375					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.E376K(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TACAGAGCTCTCAGAGGTCCAG	0.55																																					p.E376delinsAE	NSCLC(143;340 1922 20892 22370 48145)	Atlas-Indel,Pindel	.											.	FGA	179	.	1	Substitution - Missense(1)	endometrium(1)	c.1127_1128insCTG						.																																			SO:0001652	inframe_insertion	2243	exon5			.		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1124_1126dupCTG	chr4.hg19:g.155507455_155507457dupCAG	ENSP00000306361:p.Ser375_Glu376insAla	98.0	0.0		88.0	22.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	In_Frame_Ins	INS	ENST00000302053.3	hg19	CCDS3787.1																																																																																			.	.		0.550	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
VWF	7450	hgsc.bcm.edu	37	12	6145595	6145601	+	Frame_Shift_Del	DEL	CTCCTTG	CTCCTTG	-			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	CTCCTTG	CTCCTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr12:6145595_6145601delCTCCTTG	ENST00000261405.5	-	19	2753_2759	c.2499_2505delCAAGGAG	c.(2497-2505)ggcaaggagfs	p.GKE833fs		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	833	CX.|E1.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGGGGCATACTCCTTGCCCTGATGGA	0.585																																					p.834_836del		Atlas-Indel,Pindel	.											.	VWF	338	.	0			c.2500_2506del						.																																			SO:0001589	frameshift_variant	7450	exon19			.		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2499_2505delCAAGGAG	chr12.hg19:g.6145595_6145601delCTCCTTG	ENSP00000261405:p.Gly833fs	83.0	0.0		78.0	19.0	NM_000552	Q8TCE8|Q99806	Frame_Shift_Del	DEL	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.		0.585	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
THADA	63892	hgsc.bcm.edu	37	2	43801892	43801893	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-DD-A73A-01A-12D-A32G-10	TCGA-DD-A73A-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f9800ae3-b791-4398-8e47-b95090ce40c4	f9cccec6-b538-4d9d-a04a-c06ed1337e87	g.chr2:43801892_43801893insAA	ENST00000405006.4	-	11	1662_1663	c.1311_1312insTT	c.(1309-1314)tttgtgfs	p.V438fs	THADA_ENST00000402360.2_Frame_Shift_Ins_p.V438fs|THADA_ENST00000404790.1_Frame_Shift_Ins_p.V438fs|THADA_ENST00000330266.7_Frame_Shift_Ins_p.V148fs|THADA_ENST00000415080.2_Frame_Shift_Ins_p.V148fs|THADA_ENST00000405975.2_Frame_Shift_Ins_p.V438fs|THADA_ENST00000403856.1_Frame_Shift_Ins_p.V438fs	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	438										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GTCAATTCCACAAAGAAAGGAT	0.421																																					p.V438fs		Atlas-Indel,Pindel	.											.	THADA	131	.	0			c.1312_1313insTT						.																																			SO:0001589	frameshift_variant	63892	exon11			.	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.1310_1311dupTT	chr2.hg19:g.43801893_43801894dupAA	ENSP00000385995:p.Val438fs	104.0	0.0		96.0	32.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Frame_Shift_Ins	INS	ENST00000405006.4	hg19	CCDS46268.1																																																																																			.	.		0.421	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
