#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAAH	2166	hgsc.bcm.edu	37	1	46867761	46867761	+	Splice_Site	SNP	A	A	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:46867761A>G	ENST00000243167.8	+	2	279		c.e2-1		FAAH_ENST00000493735.1_Splice_Site	NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase						fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	TGTTCCCCACAGAACCCAGAC	0.627																																					.		Atlas-SNP	.											.	FAAH	36	.	0			c.196-2A>G						.						37.0	33.0	34.0					1																	46867761		2202	4300	6502	SO:0001630	splice_region_variant	2166	exon2			CCCCACAGAACCC	U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.196-1A>G	chr1.hg19:g.46867761A>G		66.0	0.0		72.0	27.0	NM_001441	D3DQ19|Q52M86|Q5TDF8	Splice_Site	SNP	ENST00000243167.8	hg19	CCDS535.1	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485490	0.63962	.	.	ENSG00000117480	ENST00000243167	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2997	0.60317	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAAH	46640348	1.000000	0.71417	0.997000	0.53966	0.906000	0.53458	7.064000	0.76721	1.808000	0.52836	0.450000	0.29827	.	.	.		0.627	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021443.1	NM_001441	Intron
LDLRAD1	388633	hgsc.bcm.edu	37	1	54477846	54477846	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:54477846G>A	ENST00000371360.1	-	4	327	c.310C>T	c.(310-312)Cac>Tac	p.H104Y	LDLRAD1_ENST00000545928.1_Missense_Mutation_p.H61Y|LDLRAD1_ENST00000420619.1_Missense_Mutation_p.H65Y|LDLRAD1_ENST00000371362.3_Intron	NM_001010978.2	NP_001010978.2	Q5T700	LRAD1_HUMAN	low density lipoprotein receptor class A domain containing 1	104	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.					integral component of membrane (GO:0016021)				large_intestine(3)|prostate(1)|skin(3)	7						TCCTCGCCGTGGGTACAGGTG	0.592																																					p.H104Y		Atlas-SNP	.											.	LDLRAD1	22	.	0			c.C310T						.						126.0	96.0	106.0					1																	54477846		2203	4300	6503	SO:0001583	missense	388633	exon4			CGCCGTGGGTACA		CCDS30725.1, CCDS60145.1, CCDS60146.1, CCDS60147.1	1p32.3	2008-02-05	2005-10-07		ENSG00000203985	ENSG00000203985			32069	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 1"""				Standard	NM_001010978		Approved		uc001cwm.2	Q5T700	OTTHUMG00000008433	ENST00000371360.1:c.310C>T	chr1.hg19:g.54477846G>A	ENSP00000360411:p.His104Tyr	27.0	0.0		22.0	13.0	NM_001010978	A0PJY0|B7ZME3|Q5T6Z9	Missense_Mutation	SNP	ENST00000371360.1	hg19	CCDS30725.1	.	.	.	.	.	.	.	.	.	.	G	5.287	0.238307	0.10023	.	.	ENSG00000203985	ENST00000371360;ENST00000545928;ENST00000420619	D;D;D	0.95588	-3.75;-3.71;-3.71	3.97	3.05	0.35203	.	0.238406	0.29059	N	0.013275	D	0.92338	0.7569	M	0.64997	1.995	0.09310	N	1	B;B	0.14438	0.003;0.01	B;B	0.11329	0.004;0.006	D	0.86249	0.1648	10	0.87932	D	0	-9.9624	5.0431	0.14469	0.109:0.0:0.6855:0.2055	.	61;104	B7ZME3;Q5T700	.;LRAD1_HUMAN	Y	104;61;65	ENSP00000360411:H104Y;ENSP00000445871:H61Y;ENSP00000411017:H65Y	ENSP00000360411:H104Y	H	-	1	0	LDLRAD1	54250434	0.047000	0.20315	0.208000	0.23602	0.101000	0.19017	1.327000	0.33746	1.012000	0.39366	0.655000	0.94253	CAC	.	.		0.592	LDLRAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023243.1	NM_001010978	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144868027	144868027	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:144868027G>T	ENST00000369354.3	-	33	5601	c.5412C>A	c.(5410-5412)taC>taA	p.Y1804*	PDE4DIP_ENST00000369359.4_Nonsense_Mutation_p.Y1940*|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Nonsense_Mutation_p.Y1889*|PDE4DIP_ENST00000313382.9_Nonsense_Mutation_p.Y1698*|PDE4DIP_ENST00000369356.4_Nonsense_Mutation_p.Y1804*			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1804					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCTGCCCAGGTACCCAGGCT	0.552			T	PDGFRB	MPD																																p.Y1804X		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.C5412A						.						226.0	230.0	229.0					1																	144868027		2203	4296	6499	SO:0001587	stop_gained	9659	exon33			GCCCAGGTACCCA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5412C>A	chr1.hg19:g.144868027G>T	ENSP00000358360:p.Tyr1804*	159.0	0.0		223.0	79.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Nonsense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	48	14.479251	0.99797	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	.	.	.	5.23	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1445	0.59452	0.0:0.0:0.8404:0.1595	.	.	.	.	X	1698;1804;1804;1889;1940	.	ENSP00000327209:Y1698X	Y	-	3	2	PDE4DIP	143579384	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.484000	0.35508	2.724000	0.93272	0.650000	0.86243	TAC	.	.		0.552	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
SEMA6C	10500	hgsc.bcm.edu	37	1	151105186	151105186	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:151105186C>T	ENST00000341697.3	-	19	4258	c.2567G>A	c.(2566-2568)gGc>gAc	p.G856D	RP11-68I18.10_ENST00000563624.1_RNA|SEMA6C_ENST00000479820.1_Intron			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	856					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGCCCGGTGGCCGGAGAAAGG	0.786																																					p.G888D		Atlas-SNP	.											.	SEMA6C	70	.	0			c.G2663A						.						2.0	2.0	2.0					1																	151105186		1393	2881	4274	SO:0001583	missense	10500	exon20			CGGTGGCCGGAGA	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.2567G>A	chr1.hg19:g.151105186C>T	ENSP00000344148:p.Gly856Asp	52.0	0.0		108.0	27.0	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	hg19	CCDS984.1	.	.	.	.	.	.	.	.	.	.	C	2.082	-0.410535	0.04799	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.18502	2.23;2.4;2.21;2.23	3.44	1.51	0.23008	.	0.852975	0.09933	N	0.736934	T	0.02267	0.0070	N	0.08118	0	0.09310	N	1	B;B;B	0.22211	0.002;0.066;0.02	B;B;B	0.18561	0.001;0.022;0.01	T	0.45920	-0.9228	10	0.40728	T	0.16	.	4.5733	0.12221	0.135:0.2453:0.6196:0.0	.	848;888;856	Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;SEM6C_HUMAN	D	856;848;888;856	ENSP00000357910:G856D;ENSP00000357908:G848D;ENSP00000357909:G888D;ENSP00000344148:G856D	ENSP00000344148:G856D	G	-	2	0	SEMA6C	149371810	0.001000	0.12720	0.000000	0.03702	0.058000	0.15608	0.500000	0.22562	0.166000	0.19597	-0.519000	0.04390	GGC	.	.		0.786	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
OR6Y1	391112	hgsc.bcm.edu	37	1	158517298	158517298	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:158517298C>A	ENST00000302617.3	-	1	597	c.598G>T	c.(598-600)Gct>Tct	p.A200S		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					ACCATCTCAGCCTGTGAGGCA	0.478																																					p.A200S		Atlas-SNP	.											.	OR6Y1	73	.	0			c.G598T						.						87.0	77.0	80.0					1																	158517298		2202	4300	6502	SO:0001583	missense	391112	exon1			TCTCAGCCTGTGA	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.598G>T	chr1.hg19:g.158517298C>A	ENSP00000304807:p.Ala200Ser	61.0	0.0		130.0	67.0	NM_001005189	Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	hg19	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816663	0.50633	.	.	ENSG00000197532	ENST00000302617	T	0.80214	-1.35	5.02	5.02	0.67125	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41938	D	0.000800	T	0.72977	0.3528	N	0.20881	0.62	0.26968	N	0.965653	D	0.69078	0.997	D	0.66196	0.942	T	0.65405	-0.6176	10	0.26408	T	0.33	.	13.2112	0.59825	0.1599:0.8401:0.0:0.0	.	200	Q8NGX8	OR6Y1_HUMAN	S	200	ENSP00000304807:A200S	ENSP00000304807:A200S	A	-	1	0	OR6Y1	156783922	0.000000	0.05858	0.995000	0.50966	0.979000	0.70002	0.135000	0.15952	2.763000	0.94921	0.655000	0.94253	GCT	.	.		0.478	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189	
LHX9	56956	hgsc.bcm.edu	37	1	197896793	197896793	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:197896793G>A	ENST00000367387.4	+	4	1231	c.806G>A	c.(805-807)cGc>cAc	p.R269H	LHX9_ENST00000337020.2_Missense_Mutation_p.R269H|LHX9_ENST00000367390.3_Missense_Mutation_p.R260H|LHX9_ENST00000367391.1_Missense_Mutation_p.R260H|LHX9_ENST00000561173.1_Missense_Mutation_p.R275H	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	269					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						AAGACCAAGCGCATGCGAACC	0.527																																					p.R269H		Atlas-SNP	.											.	LHX9	144	.	0			c.G806A						.						256.0	250.0	252.0					1																	197896793		2203	4300	6503	SO:0001583	missense	56956	exon4			CCAAGCGCATGCG	AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.806G>A	chr1.hg19:g.197896793G>A	ENSP00000356357:p.Arg269His	93.0	0.0		215.0	114.0	NM_020204	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	hg19	CCDS1393.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707531	0.89018	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000337020;ENST00000367387	D;D;D;D	0.97138	-4.26;-4.26;-4.26;-4.26	5.88	5.88	0.94601	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98960	0.9646	M	0.93763	3.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99215	1.0877	10	0.72032	D	0.01	.	20.2441	0.98394	0.0:0.0:1.0:0.0	.	269;260;260	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	H	260;260;269;269	ENSP00000356361:R260H;ENSP00000356360:R260H;ENSP00000337969:R269H;ENSP00000356357:R269H	ENSP00000337969:R269H	R	+	2	0	LHX9	196163416	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	9.476000	0.97823	2.774000	0.95407	0.655000	0.94253	CGC	.	.		0.527	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204	
MARK1	4139	hgsc.bcm.edu	37	1	220791830	220791830	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:220791830G>T	ENST00000366917.4	+	8	997	c.731G>T	c.(730-732)gGc>gTc	p.G244V	MARK1_ENST00000366918.4_Missense_Mutation_p.G222V|MARK1_ENST00000402574.1_Missense_Mutation_p.G109V					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TGGAGTCTGGGCGTCATTCTC	0.433																																					p.G244V		Atlas-SNP	.											.	MARK1	161	.	0			c.G731T						.						90.0	92.0	91.0					1																	220791830		2203	4300	6503	SO:0001583	missense	4139	exon8			GTCTGGGCGTCAT	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.731G>T	chr1.hg19:g.220791830G>T	ENSP00000355884:p.Gly244Val	104.0	0.0		163.0	36.0	NM_018650		Missense_Mutation	SNP	ENST00000366917.4	hg19	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324094	0.81580	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.72725	-0.68;-0.68;-0.68	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91469	0.7307	H	0.98849	4.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.996;1.0;0.999	D	0.94440	0.7657	10	0.87932	D	0	.	19.9145	0.97053	0.0:0.0:1.0:0.0	.	244;109;244;222	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	V	109;222;244	ENSP00000386017:G109V;ENSP00000355885:G222V;ENSP00000355884:G244V	ENSP00000355884:G244V	G	+	2	0	MARK1	218858453	1.000000	0.71417	0.799000	0.32177	0.522000	0.34438	9.807000	0.99171	2.709000	0.92574	0.655000	0.94253	GGC	.	.		0.433	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
TP53BP2	7159	hgsc.bcm.edu	37	1	224009040	224009040	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:224009040A>C	ENST00000343537.7	-	2	348	c.57T>G	c.(55-57)aaT>aaG	p.N19K	TP53BP2_ENST00000391878.2_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	13					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		AGTGCTGCTCATTGTTACTGA	0.423																																					p.N19K		Atlas-SNP	.											.	TP53BP2	144	.	0			c.T57G						.						214.0	218.0	217.0					1																	224009040		2001	4189	6190	SO:0001583	missense	7159	exon2			CTGCTCATTGTTA	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.57T>G	chr1.hg19:g.224009040A>C	ENSP00000341957:p.Asn19Lys	70.0	0.0		135.0	65.0	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	hg19	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464737	0.63513	.	.	ENSG00000143514	ENST00000343537	D	0.83673	-1.75	5.75	-5.15	0.02866	.	0.189267	0.53938	D	0.000042	T	0.76535	0.4001	L	0.54323	1.7	0.80722	D	1	B	0.24258	0.1	B	0.24541	0.054	T	0.59451	-0.7452	10	0.72032	D	0.01	.	15.6636	0.77209	0.4471:0.0:0.5529:0.0	.	19	B4DG66	.	K	19	ENSP00000341957:N19K	ENSP00000341957:N19K	N	-	3	2	TP53BP2	222075663	0.004000	0.15560	0.741000	0.31004	0.997000	0.91878	-0.898000	0.04105	-1.004000	0.03421	0.482000	0.46254	AAT	.	.		0.423	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
DNAH14	127602	hgsc.bcm.edu	37	1	225284905	225284905	+	Intron	SNP	A	A	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:225284905A>G	ENST00000445597.2	+	16	3051				DNAH14_ENST00000439375.2_Missense_Mutation_p.Y1220C|DNAH14_ENST00000430092.1_Missense_Mutation_p.Y1220C			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AATTGGCTTTATCTTGAACCA	0.313																																					p.Y1220C		Atlas-SNP	.											.	DNAH14	300	.	0			c.A3659G						.						138.0	117.0	123.0					1																	225284905		692	1589	2281	SO:0001627	intron_variant	127602	exon22			GGCTTTATCTTGA	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3051+11414A>G	chr1.hg19:g.225284905A>G		48.0	0.0		138.0	7.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.47	3.398881	0.62177	.	.	ENSG00000185842	ENST00000430092;ENST00000439375;ENST00000328556	T;T;T	0.72942	-0.7;-0.7;-0.7	5.83	-0.762	0.11034	.	0.942796	0.08686	N	0.908742	T	0.78387	0.4275	H	0.97440	4.005	0.80722	D	1	B	0.17667	0.023	B	0.18871	0.023	T	0.70788	-0.4777	10	0.87932	D	0	.	5.7349	0.18061	0.5449:0.2503:0.2048:0.0	.	1220	Q0VDD8-4	.	C	1220;1220;298	ENSP00000414402:Y1220C;ENSP00000392061:Y1220C;ENSP00000332424:Y298C	ENSP00000332424:Y298C	Y	+	2	0	DNAH14	223351528	1.000000	0.71417	0.871000	0.34182	0.987000	0.75469	1.222000	0.32515	-0.377000	0.07930	0.438000	0.28831	TAT	.	.		0.313	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
FH	2271	hgsc.bcm.edu	37	1	241667442	241667442	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:241667442C>T	ENST00000366560.3	-	7	1046	c.1008G>A	c.(1006-1008)atG>atA	p.M336I		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	336					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		TTGCTATCTTCATCAGACTGC	0.473			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												p.M336I	Melanoma(148;1573 2486 7381 46575)	Atlas-SNP	.	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	.	FH	64	.	0			c.G1008A						.						103.0	86.0	92.0					1																	241667442		2203	4300	6503	SO:0001583	missense	2271	exon7	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	TATCTTCATCAGA	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1008G>A	chr1.hg19:g.241667442C>T	ENSP00000355518:p.Met336Ile	98.0	0.0		213.0	109.0	NM_000143	B1ANK7	Missense_Mutation	SNP	ENST00000366560.3	hg19	CCDS1617.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852960	0.91355	.	.	ENSG00000091483	ENST00000366560	D	0.99298	-5.71	5.73	5.73	0.89815	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.159969	0.64402	D	0.000001	D	0.99152	0.9707	M	0.62016	1.91	0.80722	D	1	D	0.54047	0.964	P	0.61201	0.885	D	0.99723	1.1010	10	0.72032	D	0.01	-35.535	17.3941	0.87440	0.0:1.0:0.0:0.0	.	336	P07954	FUMH_HUMAN	I	336	ENSP00000355518:M336I	ENSP00000355518:M336I	M	-	3	0	FH	239734065	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.293000	0.78740	2.709000	0.92574	0.655000	0.94253	ATG	.	.		0.473	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	NM_000143	
FH	2271	hgsc.bcm.edu	37	1	241667444	241667444	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr1:241667444T>G	ENST00000366560.3	-	7	1044	c.1006A>C	c.(1006-1008)Atg>Ctg	p.M336L		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	336					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		GCTATCTTCATCAGACTGCAG	0.473			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												p.M336L	Melanoma(148;1573 2486 7381 46575)	Atlas-SNP	.	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	.	FH	64	.	0			c.A1006C						.						103.0	85.0	91.0					1																	241667444		2203	4300	6503	SO:0001583	missense	2271	exon7	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	TCTTCATCAGACT	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1006A>C	chr1.hg19:g.241667444T>G	ENSP00000355518:p.Met336Leu	94.0	0.0		215.0	110.0	NM_000143	B1ANK7	Missense_Mutation	SNP	ENST00000366560.3	hg19	CCDS1617.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.765506	0.69878	.	.	ENSG00000091483	ENST00000366560	D	0.99319	-5.74	5.73	5.73	0.89815	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.159969	0.64402	D	0.000001	D	0.98692	0.9561	M	0.77103	2.36	0.80722	D	1	B	0.26195	0.144	B	0.34590	0.186	D	0.98543	1.0633	10	0.59425	D	0.04	-35.535	13.9704	0.64237	0.0:0.0:0.0:1.0	.	336	P07954	FUMH_HUMAN	L	336	ENSP00000355518:M336L	ENSP00000355518:M336L	M	-	1	0	FH	239734067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.498000	0.81546	2.187000	0.69744	0.533000	0.62120	ATG	.	.		0.473	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	NM_000143	
DPP10	57628	hgsc.bcm.edu	37	2	116503668	116503668	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr2:116503668C>G	ENST00000410059.1	+	10	1339	c.859C>G	c.(859-861)Caa>Gaa	p.Q287E	DPP10_ENST00000393147.2_Missense_Mutation_p.Q291E|DPP10_ENST00000310323.8_Missense_Mutation_p.Q280E|DPP10_ENST00000409163.1_Missense_Mutation_p.Q237E	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	287						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AAAGGCAGGTCAAGTGAACCC	0.333																																					p.Q291E		Atlas-SNP	.											.	DPP10	415	.	0			c.C871G						.						84.0	78.0	80.0					2																	116503668		2203	4300	6503	SO:0001583	missense	57628	exon10			GCAGGTCAAGTGA	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.859C>G	chr2.hg19:g.116503668C>G	ENSP00000386565:p.Gln287Glu	74.0	0.0		106.0	61.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	hg19	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888090	0.33348	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.21	5.21	0.72293	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.18923	0.0454	N	0.13168	0.305	0.58432	D	0.999998	B;B;B;B	0.10296	0.002;0.003;0.002;0.002	B;B;B;B	0.15484	0.008;0.007;0.013;0.013	T	0.06534	-1.0821	10	0.07175	T	0.84	-9.865	17.9186	0.88959	0.0:1.0:0.0:0.0	.	280;291;283;287	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	E	287;237;291;280;237	ENSP00000386565:Q287E;ENSP00000387038:Q237E;ENSP00000376855:Q291E;ENSP00000309066:Q280E	ENSP00000309066:Q280E	Q	+	1	0	DPP10	116220138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.233000	0.58651	2.718000	0.92993	0.585000	0.79938	CAA	.	.		0.333	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
SP3	6670	hgsc.bcm.edu	37	2	174820570	174820570	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr2:174820570T>C	ENST00000310015.6	-	4	1200	c.670A>G	c.(670-672)Atc>Gtc	p.I224V	SP3_ENST00000455789.2_Missense_Mutation_p.I171V|SP3_ENST00000483084.1_5'Flank|SP3_ENST00000418194.2_Missense_Mutation_p.I156V	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	224	Transactivation domain (Gln-rich).				B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			AGATTCTGGATGTTAGCAGAA	0.438																																					p.I224V		Atlas-SNP	.											.	SP3	82	.	0			c.A670G						.						151.0	155.0	154.0					2																	174820570		2203	4300	6503	SO:0001583	missense	6670	exon4			TCTGGATGTTAGC	M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.670A>G	chr2.hg19:g.174820570T>C	ENSP00000310301:p.Ile224Val	62.0	0.0		103.0	68.0	NM_003111	A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Missense_Mutation	SNP	ENST00000310015.6	hg19	CCDS2254.1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.851429	0.32699	.	.	ENSG00000172845	ENST00000310015;ENST00000455789;ENST00000418194	T;T;T	0.06068	3.37;3.35;3.35	5.95	5.95	0.96441	.	0.096173	0.64402	D	0.000001	T	0.08313	0.0207	L	0.47190	1.495	0.32573	N	0.529519	B;B;B	0.19706	0.022;0.022;0.038	B;B;B	0.21708	0.016;0.016;0.036	T	0.03739	-1.1008	10	0.39692	T	0.17	.	12.8669	0.57944	0.0:0.0:0.1357:0.8643	.	221;224;171	B7ZLN9;Q02447;Q02447-6	.;SP3_HUMAN;.	V	224;171;156	ENSP00000310301:I224V;ENSP00000388903:I171V;ENSP00000406140:I156V	ENSP00000310301:I224V	I	-	1	0	SP3	174528816	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.752000	0.62176	2.272000	0.75746	0.460000	0.39030	ATC	.	.		0.438	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1	NM_003111	
TTN	7273	hgsc.bcm.edu	37	2	179560965	179560965	+	Silent	SNP	A	A	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr2:179560965A>G	ENST00000591111.1	-	112	30107	c.29883T>C	c.(29881-29883)gcT>gcC	p.A9961A	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.A10278A|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Silent_p.A9034A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACTTCTTCAGCTTTAGAGG	0.328																																					p.A10278A		Atlas-SNP	.											.	TTN	18412	.	0			c.T30834C						.						34.0	28.0	30.0					2																	179560965		1790	4034	5824	SO:0001819	synonymous_variant	7273	exon114			TTCTTCAGCTTTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29883T>C	chr2.hg19:g.179560965A>G		71.0	0.0		82.0	49.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.328	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
STRADB	55437	hgsc.bcm.edu	37	2	202344886	202344886	+	Silent	SNP	C	C	T	rs146098224		TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr2:202344886C>T	ENST00000194530.3	+	12	1610	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	415					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						AAGACTCATACTGGGAATTCT	0.393																																					p.Y415Y		Atlas-SNP	.											.	STRADB	33	.	0			c.C1245T						.						134.0	136.0	135.0					2																	202344886		2203	4300	6503	SO:0001819	synonymous_variant	55437	exon12			CTCATACTGGGAA	AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1245C>T	chr2.hg19:g.202344886C>T		50.0	0.0		131.0	7.0	NM_018571	Q5BKY7|Q9P1L0	Silent	SNP	ENST00000194530.3	hg19	CCDS2348.1																																																																																			.	.		0.393	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256297.1	NM_018571	
PSMD1	5707	hgsc.bcm.edu	37	2	231931711	231931711	+	Silent	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr2:231931711C>T	ENST00000308696.6	+	5	558	c.396C>T	c.(394-396)ggC>ggT	p.G132G	PSMD1_ENST00000373635.4_Silent_p.G132G|PSMD1_ENST00000409643.1_Silent_p.G132G	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	132					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GATTGGAAGGCATCGTAAATA	0.403																																					p.G132G		Atlas-SNP	.											.	PSMD1	77	.	0			c.C396T						.						92.0	80.0	84.0					2																	231931711		2203	4300	6503	SO:0001819	synonymous_variant	5707	exon5			GGAAGGCATCGTA	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.396C>T	chr2.hg19:g.231931711C>T		85.0	0.0		112.0	14.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Silent	SNP	ENST00000308696.6	hg19	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	C	9.125	1.009968	0.19277	.	.	ENSG00000173692	ENST00000444007	.	.	.	5.5	2.64	0.31445	.	.	.	.	.	T	0.56381	0.1981	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49854	-0.8895	4	.	.	.	-19.4227	8.226	0.31568	0.0:0.5538:0.2694:0.1768	.	.	.	.	Y	32	.	.	H	+	1	0	PSMD1	231639955	0.993000	0.37304	1.000000	0.80357	0.934000	0.57294	0.288000	0.18939	0.678000	0.31325	0.591000	0.81541	CAT	.	.		0.403	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
GALNT15	117248	hgsc.bcm.edu	37	3	16217085	16217085	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr3:16217085G>A	ENST00000339732.5	+	1	930	c.427G>A	c.(427-429)Gtg>Atg	p.V143M	GALNT15_ENST00000470031.1_3'UTR|GALNT15_ENST00000437509.1_Missense_Mutation_p.V143M	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	143					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GGACGGGGAGGTGTCTGAAGA	0.647																																					p.V143M		Atlas-SNP	.											.	.	.	.	0			c.G427A						.						36.0	30.0	32.0					3																	16217085		2203	4299	6502	SO:0001583	missense	117248	exon1			GGGGAGGTGTCTG	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.427G>A	chr3.hg19:g.16217085G>A	ENSP00000344260:p.Val143Met	41.0	0.0		31.0	18.0	NM_054110	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	hg19	CCDS33711.1	.	.	.	.	.	.	.	.	.	.	G	3.814	-0.039093	0.07497	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	T;T	0.57595	0.61;0.39	3.43	1.58	0.23477	.	2.240140	0.02772	U	0.119801	T	0.34716	0.0907	N	0.08118	0	0.09310	N	1	B	0.22480	0.07	B	0.24541	0.054	T	0.29701	-1.0003	10	0.42905	T	0.14	.	6.6406	0.22906	0.3242:0.0:0.6758:0.0	.	143	Q8N3T1	GLTL2_HUMAN	M	143	ENSP00000344260:V143M;ENSP00000395873:V143M	ENSP00000344260:V143M	V	+	1	0	GALNTL2	16192089	0.159000	0.22864	0.056000	0.19401	0.275000	0.26752	3.323000	0.52014	0.802000	0.34089	0.442000	0.29010	GTG	.	.		0.647	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	G	rs121913396|rs121913416		TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr3:41266098A>G	ENST00000349496.5	+	3	375	c.95A>G	c.(94-96)gAc>gGc	p.D32G	CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25G|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32G|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32G	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,128	CTNNB1	4904	.	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95G						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>G	chr3.hg19:g.41266098A>G	ENSP00000344456:p.Asp32Gly	106.0	0.0		145.0	82.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308122	0.81247	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.74137	-0.3762	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	G	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25G;ENSP00000385604:D32G;ENSP00000412219:D32G;ENSP00000379486:D32G;ENSP00000344456:D32G;ENSP00000411226:D25G;ENSP00000379488:D32G;ENSP00000409302:D32G;ENSP00000401599:D32G	ENSP00000344456:D32G	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
MAPKAPK3	7867	hgsc.bcm.edu	37	3	50677796	50677796	+	Splice_Site	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr3:50677796G>A	ENST00000446044.1	+	5	815		c.e5-1		MAPKAPK3_ENST00000357955.2_Splice_Site	NM_001243926.1	NP_001230855.1	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated protein kinase 3						activation of MAPK activity (GO:0000187)|innate immune response (GO:0045087)|macropinocytosis (GO:0044351)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|Ras protein signal transduction (GO:0007265)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		CCCACCTACAGCTCCTGTATG	0.542																																					.		Atlas-SNP	.											.	MAPKAPK3	32	.	0			c.220-1G>A						.						109.0	116.0	113.0					3																	50677796		2203	4300	6503	SO:0001630	splice_region_variant	7867	exon5			CCTACAGCTCCTG	U43784	CCDS2832.1	3p21.3	2004-03-10			ENSG00000114738	ENSG00000114738			6888	protein-coding gene	gene with protein product		602130				8626550, 8622688	Standard	NM_004635		Approved	3pK, MAPKAP3, 3PK	uc003dba.2	Q16644	OTTHUMG00000156850	ENST00000446044.1:c.220-1G>A	chr3.hg19:g.50677796G>A		78.0	0.0		79.0	36.0	NM_001243926	B5BU67	Splice_Site	SNP	ENST00000446044.1	hg19	CCDS2832.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973063	0.53614	.	.	ENSG00000114738	ENST00000446044;ENST00000430409;ENST00000357955;ENST00000457064	.	.	.	5.58	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4652	0.75394	0.0:0.0:0.86:0.14	.	.	.	.	.	-1	.	.	.	+	.	.	MAPKAPK3	50652800	1.000000	0.71417	0.977000	0.42913	0.407000	0.30961	9.835000	0.99442	1.324000	0.45282	0.655000	0.94253	.	.	.		0.542	MAPKAPK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346237.1	NM_004635	Intron
OR5H6	79295	hgsc.bcm.edu	37	3	97983496	97983496	+	Missense_Mutation	SNP	C	C	T	rs398062605|rs74203917|rs145155372	byFrequency	TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr3:97983496C>T	ENST00000383696.2	+	1	409	c.368C>T	c.(367-369)aCt>aTt	p.T123I	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CTTGTAACCACTGTAACCACA	0.383																																					p.T123I		Atlas-SNP	.											.	OR5H6	89	.	0			c.C368T						.						94.0	59.0	70.0					3																	97983496		2193	4234	6427	SO:0001583	missense	79295	exon1			TAACCACTGTAAC	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.368C>T	chr3.hg19:g.97983496C>T	ENSP00000373196:p.Thr123Ile	53.0	0.0		79.0	7.0	NM_001005479	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	hg19	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	2.074	-0.412329	0.04799	.	.	ENSG00000230301	ENST00000383696	T	0.00469	7.21	2.19	-0.203	0.13204	GPCR, rhodopsin-like superfamily (1);	0.914442	0.09287	N	0.822835	T	0.00241	0.0007	N	0.11560	0.145	0.09310	N	1	B	0.23591	0.088	B	0.23275	0.045	T	0.37776	-0.9691	10	0.72032	D	0.01	.	4.9951	0.14235	0.0:0.4399:0.3432:0.217	.	123	Q8NGV6	OR5H6_HUMAN	I	123	ENSP00000373196:T123I	ENSP00000373196:T123I	T	+	2	0	OR5H6	99466186	0.000000	0.05858	0.076000	0.20297	0.003000	0.03518	0.098000	0.15189	0.251000	0.21505	-1.188000	0.01700	ACT	.	.		0.383	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
VEPH1	79674	hgsc.bcm.edu	37	3	157098983	157098983	+	Silent	SNP	A	A	C			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr3:157098983A>C	ENST00000362010.2	-	7	1396	c.1089T>G	c.(1087-1089)ctT>ctG	p.L363L	VEPH1_ENST00000392833.2_Silent_p.L363L|VEPH1_ENST00000543418.1_Silent_p.L363L|RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392832.2_Silent_p.L363L	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	363						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTTGTCGGGTAAGGAGTTTAG	0.522																																					p.L363L		Atlas-SNP	.											.	VEPH1	129	.	0			c.T1089G						.						190.0	175.0	180.0					3																	157098983		2203	4300	6503	SO:0001819	synonymous_variant	79674	exon7			TCGGGTAAGGAGT	AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1089T>G	chr3.hg19:g.157098983A>C		85.0	0.0		104.0	43.0	NM_001167911	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Silent	SNP	ENST00000362010.2	hg19	CCDS3179.1																																																																																			.	.		0.522	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621	
CPEB2	132864	hgsc.bcm.edu	37	4	15067830	15067830	+	Silent	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr4:15067830C>T	ENST00000507071.1	+	11	1683	c.1596C>T	c.(1594-1596)ggC>ggT	p.G532G	CPEB2_ENST00000259997.5_Silent_p.G540G|CPEB2_ENST00000345451.3_Silent_p.G502G|CPEB2_ENST00000538197.1_Silent_p.G977G|CPEB2_ENST00000382395.3_Silent_p.G510G|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000442003.2_Silent_p.G950G|CPEB2_ENST00000382401.3_Silent_p.G505G|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000541112.1_Silent_p.G969G			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	532					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						AATGCCAGGGCGCACGCTGTG	0.438																																					p.G977G		Atlas-SNP	.											CPEB2_ENST00000538197,caecum,carcinoma,0,2	CPEB2	77	.	0			c.C2931T						.						271.0	253.0	259.0					4																	15067830		2203	4300	6503	SO:0001819	synonymous_variant	132864	exon12			CCAGGGCGCACGC	AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1596C>T	chr4.hg19:g.15067830C>T		113.0	0.0		119.0	42.0	NM_001177382	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Silent	SNP	ENST00000507071.1	hg19																																																																																				.	.		0.438	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000207349.2	XM_059607	
KIT	3815	hgsc.bcm.edu	37	4	55604594	55604594	+	Splice_Site	SNP	G	G	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr4:55604594G>T	ENST00000288135.5	+	21	2899		c.e21-1			NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog						actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTTTTCTCCAGATTTACTCCA	0.483		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												.		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.2803-1G>T						.						182.0	172.0	175.0					4																	55604594		2203	4300	6503	SO:0001630	splice_region_variant	3815	exon21	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TCTCCAGATTTAC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2803-1G>T	chr4.hg19:g.55604594G>T		87.0	0.0		69.0	31.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Splice_Site	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475945	0.63737	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4545	0.87603	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIT	55299351	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	8.058000	0.89460	2.649000	0.89929	0.561000	0.74099	.	.	.		0.483	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		Intron
SOX30	11063	hgsc.bcm.edu	37	5	157065387	157065387	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr5:157065387A>T	ENST00000265007.6	-	4	2072	c.1731T>A	c.(1729-1731)agT>agA	p.S577R	SOX30_ENST00000519442.1_Missense_Mutation_p.S272R|SOX30_ENST00000311371.5_Intron	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	577	Pro-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGATTGGAGCACTTCTGGGAC	0.547																																					p.S577R	Esophageal Squamous(31;525 799 19355 21125 41744)	Atlas-SNP	.											.	SOX30	67	.	0			c.T1731A						.						97.0	94.0	95.0					5																	157065387		2203	4300	6503	SO:0001583	missense	11063	exon4			TGGAGCACTTCTG	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1731T>A	chr5.hg19:g.157065387A>T	ENSP00000265007:p.Ser577Arg	60.0	0.0		87.0	38.0	NM_178424	O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	hg19	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908333	0.52333	.	.	ENSG00000039600	ENST00000265007;ENST00000519442	D;D	0.98044	-4.47;-4.68	5.61	1.44	0.22558	.	0.128095	0.53938	D	0.000047	D	0.93841	0.8030	N	0.24115	0.695	0.27152	N	0.961391	P;D	0.54397	0.664;0.966	B;P	0.44860	0.235;0.462	D	0.89330	0.3646	10	0.87932	D	0	.	8.8124	0.34976	0.637:0.0:0.363:0.0	.	272;577	B4DXW7;O94993	.;SOX30_HUMAN	R	577;272	ENSP00000265007:S577R;ENSP00000427984:S272R	ENSP00000265007:S577R	S	-	3	2	SOX30	156997965	0.994000	0.37717	0.992000	0.48379	0.970000	0.65996	0.524000	0.22940	0.010000	0.14839	0.528000	0.53228	AGT	.	.		0.547	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
RNF39	80352	hgsc.bcm.edu	37	6	30043421	30043421	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr6:30043421G>A	ENST00000244360.6	-	1	243	c.146C>T	c.(145-147)gCg>gTg	p.A49V	RNF39_ENST00000376751.3_Missense_Mutation_p.A49V	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	49						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CTTCGAGCGCGCAGATGGCGG	0.672																																					p.A49V	NSCLC(8;188 360 1520 20207 31481)	Atlas-SNP	.											.	RNF39	27	.	0			c.C146T						.						25.0	27.0	26.0					6																	30043421		2201	4296	6497	SO:0001583	missense	80352	exon1			GAGCGCGCAGATG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.146C>T	chr6.hg19:g.30043421G>A	ENSP00000244360:p.Ala49Val	69.0	0.0		151.0	8.0	NM_025236	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	hg19	CCDS4673.1	.	.	.	.	.	.	.	.	.	.	g	18.49	3.635272	0.67130	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.71103	-0.06;-0.54	3.79	0.627	0.17675	.	.	.	.	.	T	0.21427	0.0516	N	0.08118	0	0.09310	N	1	B;B	0.31318	0.013;0.319	B;B	0.18561	0.005;0.022	T	0.07616	-1.0763	9	0.35671	T	0.21	-2.6255	5.6728	0.17731	0.1038:0.0:0.454:0.4422	.	49;49	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	V	49	ENSP00000365942:A49V;ENSP00000244360:A49V	ENSP00000244360:A49V	A	-	2	0	RNF39	30151400	0.003000	0.15002	0.014000	0.15608	0.861000	0.49209	0.783000	0.26802	0.216000	0.20781	0.436000	0.28706	GCG	.	.		0.672	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
IER3	8870	hgsc.bcm.edu	37	6	30712289	30712289	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr6:30712289G>A	ENST00000259874.5	-	1	42	c.7C>T	c.(7-9)Cac>Tac	p.H3Y	XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000456573.2_5'Flank|FLOT1_ENST00000470643.1_5'Flank|IER3_ENST00000376377.2_Missense_Mutation_p.H3Y|FLOT1_ENST00000376389.3_5'Flank	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3	3					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)	1						CTGCGAGAGTGACACATGGTG	0.642																																					p.H3Y		Atlas-SNP	.											.	IER3	5	.	0			c.C7T						.						5.0	4.0	4.0					6																	30712289		1325	2403	3728	SO:0001583	missense	8870	exon1			GAGAGTGACACAT	AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265	ENST00000259874.5:c.7C>T	chr6.hg19:g.30712289G>A	ENSP00000259874:p.His3Tyr	71.0	0.0		135.0	105.0	NM_003897	Q5SU30|Q92691|Q93044	Missense_Mutation	SNP	ENST00000259874.5	hg19	CCDS4689.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727072	0.69074	.	.	ENSG00000137331	ENST00000259874;ENST00000376377;ENST00000376382	T	0.48522	0.81	4.9	3.97	0.46021	.	0.704428	0.13527	N	0.381256	T	0.32763	0.0840	L	0.57536	1.79	0.28407	N	0.918345	P	0.46912	0.886	B	0.44133	0.442	T	0.17379	-1.0371	10	0.87932	D	0	.	9.7288	0.40348	0.0:0.0:0.7938:0.2062	.	3	P46695	IEX1_HUMAN	Y	3	ENSP00000259874:H3Y	ENSP00000259874:H3Y	H	-	1	0	IER3	30820268	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	1.999000	0.40806	2.265000	0.75225	0.549000	0.68633	CAC	.	.		0.642	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2		
TREML2	79865	hgsc.bcm.edu	37	6	41166095	41166095	+	Missense_Mutation	SNP	T	T	C	rs141238140		TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr6:41166095T>C	ENST00000483722.1	-	2	313	c.128A>G	c.(127-129)tAt>tGt	p.Y43C		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	43	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTAGCCCTTATAGGAGCACTG	0.522																																					p.Y43C		Atlas-SNP	.											.	TREML2	41	.	0			c.A128G						.						158.0	166.0	163.0					6																	41166095		2203	4300	6503	SO:0001583	missense	79865	exon2			CCCTTATAGGAGC	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.128A>G	chr6.hg19:g.41166095T>C	ENSP00000418767:p.Tyr43Cys	42.0	0.0		76.0	5.0	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	hg19	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	14.49	2.551853	0.45487	.	.	ENSG00000112195	ENST00000483722	T	0.68624	-0.34	4.75	4.75	0.60458	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000157	T	0.81307	0.4795	M	0.93106	3.38	0.38602	D	0.95069	D	0.89917	1.0	D	0.97110	1.0	D	0.85899	0.1433	10	0.87932	D	0	-20.157	10.9548	0.47351	0.0:0.0:0.0:1.0	.	43	Q5T2D2	TRML2_HUMAN	C	43	ENSP00000418767:Y43C	ENSP00000418767:Y43C	Y	-	2	0	TREML2	41274073	1.000000	0.71417	1.000000	0.80357	0.352000	0.29268	1.308000	0.33528	1.901000	0.55032	0.460000	0.39030	TAT	.	.		0.522	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
TREML2	79865	hgsc.bcm.edu	37	6	41166123	41166123	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr6:41166123C>T	ENST00000483722.1	-	2	285	c.100G>A	c.(100-102)Ggg>Agg	p.G34R		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	34	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGAGTCTCCCCTTCAAGGAGC	0.493																																					p.G34R		Atlas-SNP	.											.	TREML2	41	.	0			c.G100A						.						127.0	130.0	129.0					6																	41166123		2203	4300	6503	SO:0001583	missense	79865	exon2			TCTCCCCTTCAAG	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.100G>A	chr6.hg19:g.41166123C>T	ENSP00000418767:p.Gly34Arg	38.0	0.0		67.0	6.0	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	hg19	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	14.59	2.581804	0.46006	.	.	ENSG00000112195	ENST00000483722	D	0.81499	-1.5	4.75	4.75	0.60458	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000044	D	0.86623	0.5977	M	0.75085	2.285	0.40423	D	0.979861	D	0.89917	1.0	D	0.97110	1.0	D	0.88269	0.2928	10	0.72032	D	0.01	-23.1011	13.6225	0.62144	0.0:1.0:0.0:0.0	.	34	Q5T2D2	TRML2_HUMAN	R	34	ENSP00000418767:G34R	ENSP00000418767:G34R	G	-	1	0	TREML2	41274101	1.000000	0.71417	0.998000	0.56505	0.028000	0.11728	3.388000	0.52509	2.344000	0.79699	0.563000	0.77884	GGG	.	.		0.493	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
CNR1	1268	hgsc.bcm.edu	37	6	88854115	88854115	+	Silent	SNP	C	C	T	rs35057475		TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr6:88854115C>T	ENST00000537554.1	-	2	4441	c.879G>A	c.(877-879)gcG>gcA	p.A293A	CNR1_ENST00000369499.2_Silent_p.A293A|CNR1_ENST00000535130.1_Silent_p.A293A|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000549716.1_Silent_p.A232A|CNR1_ENST00000468898.1_Silent_p.A260A|CNR1_ENST00000549890.1_Silent_p.A293A|CNR1_ENST00000428600.2_Silent_p.A293A|CNR1_ENST00000369501.2_Silent_p.A293A	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	293					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TATACATGTACGCATACACGA	0.507																																					p.A293A		Atlas-SNP	.											.	CNR1	91	.	0			c.G879A						.						81.0	72.0	75.0					6																	88854115		2203	4300	6503	SO:0001819	synonymous_variant	1268	exon4			CATGTACGCATAC	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.879G>A	chr6.hg19:g.88854115C>T		45.0	0.0		47.0	20.0	NM_001160258	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Silent	SNP	ENST00000537554.1	hg19	CCDS5015.1																																																																																			.	C|0.987;T|0.013		0.507	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2		
ZC2HC1A	51101	hgsc.bcm.edu	37	8	79598709	79598709	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr8:79598709C>A	ENST00000263849.4	+	4	320	c.218C>A	c.(217-219)cCa>cAa	p.P73Q	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	73							metal ion binding (GO:0046872)										tAGCCAGAACCACCAAAGAAA	0.303																																					p.P73Q		Atlas-SNP	.											.	.	.	.	0			c.C218A						.						41.0	36.0	38.0					8																	79598709		2201	4300	6501	SO:0001583	missense	51101	exon4			CAGAACCACCAAA		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.218C>A	chr8.hg19:g.79598709C>A	ENSP00000263849:p.Pro73Gln	154.0	0.0		276.0	81.0	NM_016010	Q9Y372	Missense_Mutation	SNP	ENST00000263849.4	hg19	CCDS6223.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977151	0.74360	.	.	ENSG00000104427	ENST00000263849	T	0.46819	0.86	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.70587	0.3241	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.71126	-0.4683	9	.	.	.	-13.5331	19.429	0.94756	0.0:1.0:0.0:0.0	.	73	Q96GY0	F164A_HUMAN	Q	73	ENSP00000263849:P73Q	.	P	+	2	0	FAM164A	79761264	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.216000	0.77974	2.667000	0.90743	0.585000	0.79938	CCA	.	.		0.303	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
KIAA0196	9897	hgsc.bcm.edu	37	8	126044596	126044596	+	Silent	SNP	T	T	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr8:126044596T>A	ENST00000318410.7	-	27	3571	c.3222A>T	c.(3220-3222)ccA>ccT	p.P1074P	KIAA0196_ENST00000517845.1_Silent_p.P926P	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	1074					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GGACAAGTGGTGGCCAATCAA	0.527																																					p.P1074P		Atlas-SNP	.											.	KIAA0196	90	.	0			c.A3222T						.						113.0	105.0	108.0					8																	126044596		2203	4300	6503	SO:0001819	synonymous_variant	9897	exon27			AAGTGGTGGCCAA		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.3222A>T	chr8.hg19:g.126044596T>A		82.0	0.0		89.0	30.0	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	hg19	CCDS6355.1																																																																																			.	.		0.527	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
KCNK9	51305	hgsc.bcm.edu	37	8	140631270	140631270	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr8:140631270G>T	ENST00000520439.1	-	2	419	c.356C>A	c.(355-357)cCg>cAg	p.P119Q	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.P119Q	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	119					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CAGTGTCAGCGGGATGCCCAG	0.592																																					p.P119Q		Atlas-SNP	.											.	KCNK9	100	.	0			c.C356A						.						80.0	65.0	70.0					8																	140631270		2203	4300	6503	SO:0001583	missense	51305	exon2			GTCAGCGGGATGC	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.356C>A	chr8.hg19:g.140631270G>T	ENSP00000430676:p.Pro119Gln	59.0	0.0		90.0	30.0	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	hg19	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896193	0.72639	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.34275	1.37;1.37;1.37	5.73	5.73	0.89815	Ion transport 2 (1);	0.059114	0.64402	D	0.000001	T	0.76821	0.4041	H	0.98407	4.225	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85951	0.1464	10	0.87932	D	0	.	18.8824	0.92362	0.0:0.0:1.0:0.0	.	119	Q9NPC2	KCNK9_HUMAN	Q	119	ENSP00000429847:P119Q;ENSP00000302166:P119Q;ENSP00000430676:P119Q	ENSP00000302166:P119Q	P	-	2	0	KCNK9	140700452	1.000000	0.71417	0.992000	0.48379	0.492000	0.33523	9.606000	0.98325	2.692000	0.91855	0.655000	0.94253	CCG	.	.		0.592	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
SPTAN1	6709	hgsc.bcm.edu	37	9	131339464	131339464	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr9:131339464A>G	ENST00000372731.4	+	7	952	c.842A>G	c.(841-843)gAt>gGt	p.D281G	SPTAN1_ENST00000358161.5_Missense_Mutation_p.D281G|SPTAN1_ENST00000372739.3_Missense_Mutation_p.D281G	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	281					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						ATGGCCTCTGATGATTTTGGC	0.483																																					p.D281G	NSCLC(120;833 1744 2558 35612 37579)	Atlas-SNP	.											.	SPTAN1	266	.	0			c.A842G						.						154.0	159.0	157.0					9																	131339464		2203	4300	6503	SO:0001583	missense	6709	exon7			CCTCTGATGATTT	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.842A>G	chr9.hg19:g.131339464A>G	ENSP00000361816:p.Asp281Gly	64.0	0.0		67.0	33.0	NM_003127	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	hg19	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.922003	0.92319	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.51325	0.71;0.71;0.71	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.65657	0.2712	L	0.58302	1.8	0.80722	D	1	D;D;D;B;D	0.76494	0.998;0.997;0.999;0.179;0.969	P;D;D;P;P	0.79108	0.908;0.992;0.986;0.472;0.898	T	0.65187	-0.6229	10	0.49607	T	0.09	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	281;281;281;281;281	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	G	281	ENSP00000350882:D281G;ENSP00000361816:D281G;ENSP00000361824:D281G	ENSP00000350882:D281G	D	+	2	0	SPTAN1	130379285	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	GAT	.	.		0.483	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
COMMD3	23412	hgsc.bcm.edu	37	10	22607754	22607754	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr10:22607754T>G	ENST00000376836.3	+	6	875	c.431T>G	c.(430-432)aTg>aGg	p.M144R	BMI1_ENST00000376663.3_5'Flank|COMMD3-BMI1_ENST00000602390.1_Intron|COMMD3_ENST00000483684.1_3'UTR|COMMD3-BMI1_ENST00000463409.2_3'UTR	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	144	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.									kidney(2)|lung(2)|ovary(1)	5						CTTCATAGGATGTACAGACCT	0.328																																					p.M144R		Atlas-SNP	.											.	COMMD3	13	.	0			c.T431G						.						184.0	195.0	191.0					10																	22607754		2203	4300	6503	SO:0001583	missense	23412	exon6			ATAGGATGTACAG	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.431T>G	chr10.hg19:g.22607754T>G	ENSP00000366032:p.Met144Arg	157.0	0.0		315.0	60.0	NM_012071	D3DRU7|Q5T8Y9	Missense_Mutation	SNP	ENST00000376836.3	hg19	CCDS7137.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	11.93|11.93|11.93	1.786458|1.786458|1.786458	0.31593|0.31593|0.31593	.|.|.	.|.|.	ENSG00000148444|ENSG00000148444|ENSG00000148444	ENST00000448361|ENST00000456711|ENST00000376836;ENST00000376787	.|.|T	.|.|0.09911	.|.|2.93	5.22|5.22|5.22	4.08|4.08|4.08	0.47627|0.47627|0.47627	.|.|COMM domain (1);	.|.|0.359901	.|.|0.32719	.|.|N	.|.|0.005740	T|T|T	0.06962|0.06962|0.06962	0.0177|0.0177|0.0177	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B	.|.|0.30973	.|.|0.302	.|.|B	.|.|0.28011	.|.|0.085	T|T|T	0.36553|0.36553|0.36553	-0.9743|-0.9743|-0.9743	5|5|10	.|.|0.32370	.|.|T	.|.|0.25	-17.4337|-17.4337|-17.4337	3.3919|3.3919|3.3919	0.07291|0.07291|0.07291	0.2727:0.1607:0.0:0.5666|0.2727:0.1607:0.0:0.5666|0.2727:0.1607:0.0:0.5666	.|.|.	.|.|144	.|.|Q9UBI1	.|.|COMD3_HUMAN	G|E|R	98|111|144;111	.|.|ENSP00000366032:M144R	.|.|ENSP00000365983:M111R	C|D|M	+|+|+	1|3|2	0|2|0	COMMD3|COMMD3|COMMD3	22647760|22647760|22647760	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.987000|0.987000|0.987000	0.75469|0.75469|0.75469	2.974000|2.974000|2.974000	0.49272|0.49272|0.49272	0.929000|0.929000|0.929000	0.37192|0.37192|0.37192	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TGT|GAT|ATG	.	.		0.328	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
FAM24A	118670	hgsc.bcm.edu	37	10	124672364	124672364	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr10:124672364C>G	ENST00000368894.1	+	3	333	c.212C>G	c.(211-213)aCc>aGc	p.T71S		NM_001029888.1	NP_001025059.1	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	71						extracellular region (GO:0005576)				large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	9		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		GCCAAAGCCACCACCATGGAG	0.502																																					p.T71S		Atlas-SNP	.											.	FAM24A	16	.	0			c.C212G						.						165.0	122.0	136.0					10																	124672364		2203	4300	6503	SO:0001583	missense	118670	exon3			AAGCCACCACCAT		CCDS31304.1	10q26.13	2008-08-27			ENSG00000203795	ENSG00000203795			23470	protein-coding gene	gene with protein product							Standard	NM_001029888		Approved	AC073585.4	uc001lgv.3	A6NFZ4	OTTHUMG00000019193	ENST00000368894.1:c.212C>G	chr10.hg19:g.124672364C>G	ENSP00000357889:p.Thr71Ser	76.0	0.0		96.0	44.0	NM_001029888		Missense_Mutation	SNP	ENST00000368894.1	hg19	CCDS31304.1	.	.	.	.	.	.	.	.	.	.	C	9.160	1.018506	0.19355	.	.	ENSG00000203795	ENST00000368894	.	.	.	3.3	-6.6	0.01824	.	0.512553	0.14559	U	0.312155	T	0.12732	0.0309	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.07214	-1.0784	9	0.41790	T	0.15	.	4.4073	0.11416	0.2991:0.4328:0.0:0.2682	.	71	A6NFZ4	FA24A_HUMAN	S	71	.	ENSP00000357889:T71S	T	+	2	0	FAM24A	124662354	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.968000	0.01507	-1.416000	0.02019	-1.355000	0.01225	ACC	.	.		0.502	FAM24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050824.1	XM_058332	
CHRM4	1132	hgsc.bcm.edu	37	11	46407538	46407538	+	Silent	SNP	C	C	G			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:46407538C>G	ENST00000433765.2	-	1	569	c.570G>C	c.(568-570)ctG>ctC	p.L190L		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	190					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CTGGGTTGGACAGGAACTGGA	0.582																																					p.L190L	Esophageal Squamous(171;1020 1936 4566 30205 42542)	Atlas-SNP	.											.	CHRM4	47	.	0			c.G570C						.						36.0	40.0	39.0					11																	46407538		2187	4288	6475	SO:0001819	synonymous_variant	1132	exon1			GTTGGACAGGAAC	M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.570G>C	chr11.hg19:g.46407538C>G		67.0	0.0		80.0	38.0	NM_000741	B2RPP4|Q0VD60|Q4VBK7	Silent	SNP	ENST00000433765.2	hg19	CCDS44581.1																																																																																			.	.		0.582	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334985.1	NM_000741	
OR9G4	283189	hgsc.bcm.edu	37	11	56510613	56510613	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:56510613G>T	ENST00000302957.3	-	1	674	c.675C>A	c.(673-675)agC>agA	p.S225R		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						TAGCAAGAATGCTGGAGAGTA	0.478																																					p.S225R		Atlas-SNP	.											.	OR9G4	73	.	0			c.C675A						.						106.0	96.0	99.0					11																	56510613		2201	4296	6497	SO:0001583	missense	283189	exon1			AAGAATGCTGGAG	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.675C>A	chr11.hg19:g.56510613G>T	ENSP00000307515:p.Ser225Arg	54.0	0.0		50.0	25.0	NM_001005284	Q6IF62|Q96RA9	Missense_Mutation	SNP	ENST00000302957.3	hg19	CCDS31537.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606903	0.46527	.	.	ENSG00000172457	ENST00000302957	T	0.38240	1.15	5.07	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.147954	0.31290	N	0.007906	T	0.48187	0.1486	M	0.93678	3.445	0.09310	N	1	P	0.46784	0.884	B	0.44224	0.444	T	0.54682	-0.8257	10	0.87932	D	0	-9.9661	5.5382	0.17023	0.0788:0.1403:0.6361:0.1448	.	225	Q8NGQ1	OR9G4_HUMAN	R	225	ENSP00000307515:S225R	ENSP00000307515:S225R	S	-	3	2	OR9G4	56267189	0.000000	0.05858	0.593000	0.28771	0.818000	0.46254	-0.504000	0.06375	0.724000	0.32296	0.643000	0.83706	AGC	.	.		0.478	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284	
EML3	256364	hgsc.bcm.edu	37	11	62373664	62373664	+	Silent	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:62373664C>T	ENST00000394773.2	-	13	1834	c.1527G>A	c.(1525-1527)caG>caA	p.Q509Q	EML3_ENST00000494176.2_Silent_p.Q481Q|EML3_ENST00000278845.4_Silent_p.Q510Q|RP11-831H9.3_ENST00000532626.1_RNA|EML3_ENST00000531557.1_Silent_p.Q292Q|EML3_ENST00000529309.1_Silent_p.Q509Q|EML3_ENST00000438258.1_5'UTR	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	509						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GAGCGTGAGCCTGGGCCACAA	0.612																																					p.Q509Q		Atlas-SNP	.											.	EML3	61	.	0			c.G1527A						.						46.0	41.0	43.0					11																	62373664		2202	4299	6501	SO:0001819	synonymous_variant	256364	exon13			GTGAGCCTGGGCC	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.1527G>A	chr11.hg19:g.62373664C>T		66.0	0.0		66.0	23.0	NM_153265	Q6ZQW7|Q8NA55	Silent	SNP	ENST00000394773.2	hg19	CCDS8023.2	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067978	0.36470	.	.	ENSG00000149499	ENST00000394776	.	.	.	5.25	3.38	0.38709	.	.	.	.	.	T	0.54303	0.1850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46911	-0.9157	4	.	.	.	-19.5325	5.5567	0.17121	0.0:0.6587:0.1633:0.178	.	.	.	.	S	504	.	.	G	-	1	0	EML3	62130240	1.000000	0.71417	0.996000	0.52242	0.805000	0.45488	1.944000	0.40263	0.600000	0.29862	0.467000	0.42956	GGC	.	.		0.612	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265	
KIAA1731	85459	hgsc.bcm.edu	37	11	93402866	93402866	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:93402866C>T	ENST00000325212.6	+	5	620	c.458C>T	c.(457-459)gCa>gTa	p.A153V	KIAA1731_ENST00000344196.4_5'UTR|KIAA1731_ENST00000411936.1_Missense_Mutation_p.A153V			Q9C0D2	K1731_HUMAN	KIAA1731	153						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CGAAAGGAAGCACTGCTTGTG	0.368																																					p.A153V		Atlas-SNP	.											.	KIAA1731	173	.	0			c.C458T						.						159.0	148.0	151.0					11																	93402866		692	1591	2283	SO:0001583	missense	85459	exon5			AGGAAGCACTGCT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.458C>T	chr11.hg19:g.93402866C>T	ENSP00000316681:p.Ala153Val	62.0	0.0		70.0	29.0	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	hg19	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846934	0.71603	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.19669	2.14;2.13	5.41	4.3	0.51218	.	0.000000	0.44902	D	0.000407	T	0.35740	0.0942	M	0.73962	2.25	0.80722	D	1	D	0.60160	0.987	P	0.53518	0.728	T	0.07028	-1.0794	10	0.32370	T	0.25	-13.5718	13.2994	0.60315	0.0:0.9137:0.0:0.0863	.	153	Q9C0D2	K1731_HUMAN	V	153	ENSP00000316681:A153V;ENSP00000406505:A153V	ENSP00000316681:A153V	A	+	2	0	KIAA1731	93042514	0.996000	0.38824	1.000000	0.80357	0.995000	0.86356	3.660000	0.54496	2.532000	0.85374	0.650000	0.86243	GCA	.	.		0.368	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
IL10RA	3587	hgsc.bcm.edu	37	11	117864027	117864027	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:117864027A>T	ENST00000227752.3	+	4	559	c.439A>T	c.(439-441)Agg>Tgg	p.R147W	IL10RA_ENST00000545409.1_De_novo_Start_InFrame|IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000541785.1_Missense_Mutation_p.R127W	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	147					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		TCAGCTACCCAGGCCCAAGAT	0.517																																					p.R147W		Atlas-SNP	.											.	IL10RA	46	.	0			c.A439T						.						91.0	82.0	85.0					11																	117864027		2200	4296	6496	SO:0001583	missense	3587	exon4			CTACCCAGGCCCA	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.439A>T	chr11.hg19:g.117864027A>T	ENSP00000227752:p.Arg147Trp	48.0	0.0		65.0	26.0	NM_001558	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	hg19	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.136760	0.56936	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000536858	T;T	0.55413	0.52;0.52	5.73	3.23	0.37069	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.345700	0.26143	N	0.026095	T	0.67192	0.2867	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.974	T	0.68198	-0.5472	10	0.66056	D	0.02	-28.2915	9.4332	0.38624	0.6505:0.3495:0.0:0.0	.	127;147	F5GYV8;Q13651	.;I10R1_HUMAN	W	147;127;127	ENSP00000227752:R147W;ENSP00000441397:R127W	ENSP00000227752:R147W	R	+	1	2	IL10RA	117369237	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	2.605000	0.46283	0.961000	0.38030	0.533000	0.62120	AGG	.	.		0.517	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
TRIM29	23650	hgsc.bcm.edu	37	11	120008342	120008342	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:120008342G>A	ENST00000341846.5	-	1	819	c.398C>T	c.(397-399)tCg>tTg	p.S133L		NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	133					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		CCGGGACTCCGAGAAAATGGA	0.647																																					p.S133L		Atlas-SNP	.											.	TRIM29	78	.	0			c.C398T						.						91.0	104.0	100.0					11																	120008342		2203	4300	6503	SO:0001583	missense	23650	exon1			GACTCCGAGAAAA	AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.398C>T	chr11.hg19:g.120008342G>A	ENSP00000343129:p.Ser133Leu	43.0	0.0		29.0	10.0	NM_012101	Q96AA9|Q9BZY7	Missense_Mutation	SNP	ENST00000341846.5	hg19	CCDS8428.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654592	0.47467	.	.	ENSG00000137699	ENST00000341846	T	0.39592	1.07	5.19	4.28	0.50868	.	0.295747	0.26369	N	0.024768	T	0.35098	0.0920	L	0.32530	0.975	0.80722	D	1	D	0.62365	0.991	P	0.48270	0.572	T	0.06303	-1.0834	9	.	.	.	.	8.0019	0.30301	0.0807:0.0:0.7619:0.1574	.	133	Q14134	TRI29_HUMAN	L	133	ENSP00000343129:S133L	.	S	-	2	0	TRIM29	119513552	0.868000	0.29978	0.972000	0.41901	0.021000	0.10359	3.101000	0.50283	1.197000	0.43143	-0.253000	0.11424	TCG	.	.		0.647	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	NM_012101	
OR8A1	390275	hgsc.bcm.edu	37	11	124440804	124440804	+	Silent	SNP	A	A	C			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr11:124440804A>C	ENST00000284287.3	+	1	912	c.840A>C	c.(838-840)acA>acC	p.T280T		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	280					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		AACCCTCCACAATCAGTTCCT	0.498																																					p.T280T		Atlas-SNP	.											.	OR8A1	61	.	0			c.A840C						.						89.0	77.0	81.0					11																	124440804		2201	4299	6500	SO:0001819	synonymous_variant	390275	exon1			CTCCACAATCAGT	BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.840A>C	chr11.hg19:g.124440804A>C		74.0	0.0		86.0	39.0	NM_001005194	Q6IEW7|Q96RC6	Silent	SNP	ENST00000284287.3	hg19	CCDS31712.1																																																																																			.	.		0.498	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387062.1	NM_001005194	
LRRC43	254050	hgsc.bcm.edu	37	12	122687883	122687883	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr12:122687883C>T	ENST00000339777.4	+	12	1893	c.1865C>T	c.(1864-1866)cCg>cTg	p.P622L	B3GNT4_ENST00000324189.4_5'Flank|B3GNT4_ENST00000546192.1_5'Flank|LRRC43_ENST00000425921.1_Missense_Mutation_p.P437L|B3GNT4_ENST00000535274.1_5'Flank	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	622										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GCCGTGATTCCGATCTACGAA	0.602																																					p.P622L		Atlas-SNP	.											.	LRRC43	105	.	0			c.C1865T						.						91.0	100.0	97.0					12																	122687883		1959	4145	6104	SO:0001583	missense	254050	exon12			TGATTCCGATCTA	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1865C>T	chr12.hg19:g.122687883C>T	ENSP00000344233:p.Pro622Leu	26.0	0.0		22.0	9.0	NM_001098519	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	hg19	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526503	0.27299	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.55052	0.54;0.96	4.71	-1.91	0.07641	.	2.303270	0.01732	N	0.028908	T	0.42517	0.1206	L	0.45581	1.43	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.12319	-1.0552	10	0.35671	T	0.21	-2.7639	2.8934	0.05684	0.3279:0.2928:0.0:0.3794	.	622	Q8N309	LRC43_HUMAN	L	622;493;437	ENSP00000344233:P622L;ENSP00000416628:P437L	ENSP00000289014:P493L	P	+	2	0	LRRC43	121253836	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.068000	0.03447	-0.062000	0.13088	-0.314000	0.08810	CCG	.	.		0.602	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
F10	2159	hgsc.bcm.edu	37	13	113803570	113803570	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr13:113803570G>A	ENST00000375559.3	+	8	1244	c.1206G>A	c.(1204-1206)atG>atA	p.M402I	F10_ENST00000409306.1_3'UTR|F10_ENST00000375551.3_3'UTR	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	402	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	CCCAGAACATGTTCTGTGCCG	0.622																																					p.M402I		Atlas-SNP	.											.	F10	53	.	0			c.G1206A						.						60.0	66.0	64.0					13																	113803570		2203	4300	6503	SO:0001583	missense	2159	exon8			GAACATGTTCTGT		CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.1206G>A	chr13.hg19:g.113803570G>A	ENSP00000364709:p.Met402Ile	71.0	0.0		69.0	34.0	NM_000504	Q14340	Missense_Mutation	SNP	ENST00000375559.3	hg19	CCDS9530.1	.	.	.	.	.	.	.	.	.	.	G	32	5.105458	0.94245	.	.	ENSG00000126218	ENST00000375559	D	0.94000	-3.33	5.37	5.37	0.77165	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.97328	0.9126	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97952	1.0332	10	0.87932	D	0	.	19.132	0.93412	0.0:0.0:1.0:0.0	.	402	P00742	FA10_HUMAN	I	402	ENSP00000364709:M402I	ENSP00000364709:M402I	M	+	3	0	F10	112851571	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.658000	0.98594	2.510000	0.84645	0.650000	0.86243	ATG	.	.		0.622	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
IRF9	10379	hgsc.bcm.edu	37	14	24631525	24631526	+	Missense_Mutation	DNP	TT	TT	GC			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr14:24631525_24631526TT>GC	ENST00000396864.3	+	2	459_460	c.172_173TT>GC	c.(172-174)TTc>GCc	p.F58A	IRF9_ENST00000557894.1_Intron|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	58					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		GGATGCTGCCTTCTTCAAGGTG	0.545																																					p.F58V|p.F58S		Atlas-SNP	.											.	IRF9	33	.	0			c.T172G|c.T173C						.																																			SO:0001583	missense	10379	exon2			GCTGCCTTCTTCA|CTGCCTTCTTCAA	M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	Exception_encountered	chr14.hg19:g.24631525_24631526delinsGC	ENSP00000380073:p.Phe58Ala	65.0|64.0	0.0		52.0	17.0	NM_006084	D3DS61	Missense_Mutation	SNP	ENST00000396864.3	hg19	CCDS9615.1																																																																																			.	.		0.545	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071927.2		
TEX9	374618	hgsc.bcm.edu	37	15	56683606	56683606	+	Silent	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr15:56683606C>T	ENST00000352903.2	+	7	585	c.561C>T	c.(559-561)gaC>gaT	p.D187D	RP11-48G14.2_ENST00000564401.1_lincRNA|TEX9_ENST00000558083.2_Silent_p.D112D|TEX9_ENST00000561221.2_Silent_p.D187D|TEX9_ENST00000537232.1_Silent_p.D112D	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	187										cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TTAGTAATGACATTGGAACAG	0.303																																					p.D187D		Atlas-SNP	.											.	TEX9	29	.	0			c.C561T						.						91.0	92.0	92.0					15																	56683606		2192	4292	6484	SO:0001819	synonymous_variant	374618	exon7			TAATGACATTGGA	BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.561C>T	chr15.hg19:g.56683606C>T		138.0	0.0		144.0	69.0	NM_198524	B4DH73	Silent	SNP	ENST00000352903.2	hg19	CCDS10157.1																																																																																			.	.		0.303	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255048.2	NM_198524	
COX5A	9377	hgsc.bcm.edu	37	15	75221554	75221554	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr15:75221554G>C	ENST00000322347.6	-	2	273	c.120C>G	c.(118-120)tgC>tgG	p.C40W	COX5A_ENST00000564811.1_Missense_Mutation_p.C40W|COX5A_ENST00000568517.1_5'UTR|COX5A_ENST00000562233.1_Missense_Mutation_p.C40W|COX5A_ENST00000568783.1_Missense_Mutation_p.C40W|COX5A_ENST00000567270.1_Intron	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	40					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						CATGGGAATAGCAGCGAACTG	0.388																																					p.C40W		Atlas-SNP	.											.	COX5A	9	.	0			c.C120G						.						132.0	121.0	125.0					15																	75221554		2197	4295	6492	SO:0001583	missense	9377	exon2			GGAATAGCAGCGA	M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.120C>G	chr15.hg19:g.75221554G>C	ENSP00000317780:p.Cys40Trp	70.0	0.0		82.0	37.0	NM_004255	P30045|Q8TB65	Missense_Mutation	SNP	ENST00000322347.6	hg19	CCDS10273.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867897	0.32977	.	.	ENSG00000178741	ENST00000322347	.	.	.	5.58	5.58	0.84498	.	0.142736	0.64402	D	0.000004	T	0.49029	0.1533	N	0.19112	0.55	0.80722	D	1	D	0.58620	0.983	P	0.54759	0.76	T	0.44205	-0.9343	9	0.38643	T	0.18	-13.3356	11.6708	0.51399	0.0812:0.0:0.9188:0.0	.	40	P20674	COX5A_HUMAN	W	40	.	ENSP00000317780:C40W	C	-	3	2	COX5A	73008607	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	2.365000	0.44196	2.656000	0.90262	0.644000	0.83932	TGC	.	.		0.388	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286417.1	NM_004255	
GNPTG	84572	hgsc.bcm.edu	37	16	1412312	1412312	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr16:1412312G>A	ENST00000204679.4	+	7	560	c.517G>A	c.(517-519)Gcc>Acc	p.A173T	LA16c-316G12.2_ENST00000569831.1_RNA	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit	173					carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				CCACCCCCACGCCTTGCTAGG	0.687																																					p.A173T		Atlas-SNP	.											.	GNPTG	18	.	0			c.G517A						.						29.0	29.0	29.0					16																	1412312		2198	4298	6496	SO:0001583	missense	84572	exon7			CCCCACGCCTTGC	BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835	ENST00000204679.4:c.517G>A	chr16.hg19:g.1412312G>A	ENSP00000204679:p.Ala173Thr	36.0	0.0		31.0	12.0	NM_032520	B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	ENST00000204679.4	hg19	CCDS10436.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699783	0.30142	.	.	ENSG00000090581	ENST00000204679	D	0.82433	-1.61	5.29	0.164	0.14990	.	0.362761	0.32120	N	0.006552	T	0.75391	0.3843	L	0.55481	1.735	0.22081	N	0.999376	P	0.40180	0.705	B	0.38264	0.269	T	0.65323	-0.6196	10	0.41790	T	0.15	-21.3775	8.8578	0.35238	0.1039:0.0:0.5257:0.3705	.	173	Q9UJJ9	GNPTG_HUMAN	T	173	ENSP00000204679:A173T	ENSP00000204679:A173T	A	+	1	0	GNPTG	1352313	0.996000	0.38824	0.640000	0.29408	0.891000	0.51852	1.731000	0.38135	-0.272000	0.09259	-0.266000	0.10368	GCC	.	.		0.687	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109058.2	NM_032520	
ITGAL	3683	hgsc.bcm.edu	37	16	30507788	30507788	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr16:30507788T>C	ENST00000356798.6	+	15	1913	c.1733T>C	c.(1732-1734)aTt>aCt	p.I578T	RP11-297C4.1_ENST00000563751.1_RNA|ITGAL_ENST00000358164.5_Missense_Mutation_p.I495T|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	578					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CTCTCAGGAATTCAGTGGTTT	0.562																																					p.I578T	NSCLC(110;1462 1641 3311 33990 49495)	Atlas-SNP	.											.	ITGAL	149	.	0			c.T1733C						.						148.0	133.0	138.0					16																	30507788		2197	4300	6497	SO:0001583	missense	3683	exon15			CAGGAATTCAGTG		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1733T>C	chr16.hg19:g.30507788T>C	ENSP00000349252:p.Ile578Thr	105.0	0.0		104.0	49.0	NM_002209	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	hg19	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.161694	0.78226	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.56941	0.43;0.43	5.94	5.94	0.96194	.	0.330476	0.26275	N	0.025315	T	0.55970	0.1954	M	0.65320	2	0.80722	D	1	P;P	0.45594	0.862;0.773	P;P	0.44477	0.451;0.451	T	0.61879	-0.6972	10	0.87932	D	0	.	13.9183	0.63914	0.0:0.0:0.0:1.0	.	495;578	Q96HB1;P20701	.;ITAL_HUMAN	T	578;495	ENSP00000349252:I578T;ENSP00000350886:I495T	ENSP00000349252:I578T	I	+	2	0	ITGAL	30415289	0.901000	0.30685	0.944000	0.38274	0.913000	0.54294	2.736000	0.47385	2.272000	0.75746	0.460000	0.39030	ATT	.	.		0.562	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
ERN1	2081	hgsc.bcm.edu	37	17	62133223	62133223	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr17:62133223T>A	ENST00000433197.3	-	13	1579	c.1484A>T	c.(1483-1485)cAg>cTg	p.Q495L		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						GAAGGGCAgctgctgctgctg	0.632																																					p.Q495L		Atlas-SNP	.											.	ERN1	102	.	0			c.A1484T						.						5.0	6.0	6.0					17																	62133223		2017	4062	6079	SO:0001583	missense	2081	exon13			GGCAGCTGCTGCT	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1484A>T	chr17.hg19:g.62133223T>A	ENSP00000401445:p.Gln495Leu	27.0	0.0		77.0	5.0	NM_001433		Missense_Mutation	SNP	ENST00000433197.3	hg19	CCDS45762.1	.	.	.	.	.	.	.	.	.	.	T	3.711	-0.059492	0.07317	.	.	ENSG00000178607	ENST00000433197	T	0.16457	2.34	0.14	0.14	0.14804	.	.	.	.	.	T	0.13157	0.0319	L	0.48642	1.525	0.24475	N	0.994376	B	0.22003	0.063	B	0.15052	0.012	T	0.27905	-1.0060	8	0.33141	T	0.24	-15.5741	.	.	.	.	495	O75460	ERN1_HUMAN	L	495	ENSP00000401445:Q495L	ENSP00000401445:Q495L	Q	-	2	0	ERN1	59486955	0.994000	0.37717	0.998000	0.56505	0.867000	0.49689	-0.604000	0.05667	0.157000	0.19338	0.155000	0.16302	CAG	.	.		0.632	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443734.2	NM_001433	
C3	718	hgsc.bcm.edu	37	19	6697550	6697550	+	Silent	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:6697550G>A	ENST00000245907.6	-	21	2693	c.2601C>T	c.(2599-2601)ctC>ctT	p.L867L		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	867					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CTGGATTGTGGAGTAGTTCCA	0.597																																					p.L867L		Atlas-SNP	.											.	C3	192	.	0			c.C2601T						.						89.0	71.0	77.0					19																	6697550		2203	4300	6503	SO:0001819	synonymous_variant	718	exon21			ATTGTGGAGTAGT	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2601C>T	chr19.hg19:g.6697550G>A		50.0	0.0		50.0	24.0	NM_000064	A7E236	Silent	SNP	ENST00000245907.6	hg19	CCDS32883.1																																																																																			.	.		0.597	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
ANGPTL6	83854	hgsc.bcm.edu	37	19	10204121	10204121	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:10204121G>A	ENST00000253109.4	-	5	1364	c.1126C>T	c.(1126-1128)Cgg>Tgg	p.R376W	ANGPTL6_ENST00000592641.1_Missense_Mutation_p.R376W|ANGPTL6_ENST00000589181.1_Missense_Mutation_p.R336W	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	376	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			TGGCCAAGCCGCAGGCGGTAG	0.597																																					p.R376W		Atlas-SNP	.											.	ANGPTL6	28	.	0			c.C1126T						.						66.0	59.0	61.0					19																	10204121		2203	4300	6503	SO:0001583	missense	83854	exon5			CAAGCCGCAGGCG	AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.1126C>T	chr19.hg19:g.10204121G>A	ENSP00000253109:p.Arg376Trp	66.0	0.0		95.0	39.0	NM_031917	A5PKV7|Q9BZZ0	Missense_Mutation	SNP	ENST00000253109.4	hg19	CCDS12224.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331110	0.60853	.	.	ENSG00000130812	ENST00000253109	T	0.77750	-1.12	4.47	2.15	0.27550	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.64402	D	0.000002	D	0.86748	0.6007	M	0.81179	2.53	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.87522	0.2447	10	0.52906	T	0.07	.	12.9306	0.58284	0.0:0.0:0.6971:0.3029	.	376	Q8NI99	ANGL6_HUMAN	W	376	ENSP00000253109:R376W	ENSP00000253109:R376W	R	-	1	2	ANGPTL6	10065121	0.998000	0.40836	1.000000	0.80357	0.950000	0.60333	1.322000	0.33689	1.106000	0.41623	-0.515000	0.04445	CGG	.	.		0.597	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451142.1	NM_031917	
CALR	811	hgsc.bcm.edu	37	19	13054718	13054718	+	Missense_Mutation	SNP	C	C	G	rs148604761	byFrequency	TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:13054718C>G	ENST00000316448.5	+	9	1318	c.1245C>G	c.(1243-1245)gaC>gaG	p.D415E	RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000541222.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000592268.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	415	C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	AGGCCAAGGACGAGCTGTAGA	0.587																																					p.D415E		Atlas-SNP	.											.	CALR	31	.	0			c.C1245G						.						165.0	132.0	143.0					19																	13054718		2203	4299	6502	SO:0001583	missense	811	exon9			CAAGGACGAGCTG	M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1245C>G	chr19.hg19:g.13054718C>G	ENSP00000320866:p.Asp415Glu	95.0	0.0		97.0	44.0	NM_004343	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	ENST00000316448.5	hg19	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.364361	0.41902	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.51325	0.71	5.59	-8.66	0.00866	.	0.000000	0.64402	D	0.000001	T	0.28067	0.0692	N	0.19112	0.55	0.41172	D	0.986179	B	0.13145	0.007	B	0.12837	0.008	T	0.03148	-1.1067	10	0.87932	D	0	-34.4168	17.0204	0.86432	0.0:0.1445:0.0:0.8555	.	415	P27797	CALR_HUMAN	E	415;294	ENSP00000320866:D415E	ENSP00000320866:D415E	D	+	3	2	CALR	12915718	0.007000	0.16637	0.758000	0.31321	0.660000	0.38997	-1.013000	0.03645	-1.360000	0.02172	-1.013000	0.02462	GAC	.	C|1.000;T|0.000		0.587	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
FCGBP	8857	hgsc.bcm.edu	37	19	40408468	40408468	+	Silent	SNP	C	C	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:40408468C>T	ENST00000221347.6	-	8	4378	c.4371G>A	c.(4369-4371)aaG>aaA	p.K1457K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1457	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGAACTCCTCCTTCTGATACT	0.622																																					p.K1457K		Atlas-SNP	.											.	FCGBP	416	.	0			c.G4371A						.						42.0	46.0	45.0					19																	40408468		2203	4300	6503	SO:0001819	synonymous_variant	8857	exon8			CTCCTCCTTCTGA	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4371G>A	chr19.hg19:g.40408468C>T		242.0	0.0		213.0	67.0	NM_003890	O95784	Silent	SNP	ENST00000221347.6	hg19	CCDS12546.1																																																																																			.	.		0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
PRX	57716	hgsc.bcm.edu	37	19	40903727	40903727	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:40903727G>T	ENST00000324001.7	-	7	802	c.532C>A	c.(532-534)Cct>Act	p.P178T	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	178	Arg/Lys-rich (basic).				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCGGGACAGGACCCTTGACA	0.711																																					p.P178T		Atlas-SNP	.											.	PRX	151	.	0			c.C532A						.						8.0	10.0	9.0					19																	40903727		2179	4260	6439	SO:0001583	missense	57716	exon7			GGACAGGACCCTT	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.532C>A	chr19.hg19:g.40903727G>T	ENSP00000326018:p.Pro178Thr	29.0	0.0		21.0	12.0	NM_181882	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	hg19	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129647	0.56721	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01981	4.52	4.71	4.71	0.59529	.	0.272829	0.26411	N	0.024530	T	0.06781	0.0173	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57100	-0.7869	10	0.19147	T	0.46	-3.4696	14.6881	0.69065	0.0:0.0:1.0:0.0	.	178	Q9BXM0	PRAX_HUMAN	T	178	ENSP00000326018:P178T	ENSP00000326018:P178T	P	-	1	0	PRX	45595567	1.000000	0.71417	0.998000	0.56505	0.708000	0.40852	4.177000	0.58276	2.437000	0.82529	0.591000	0.81541	CCT	.	.		0.711	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
LMTK3	114783	hgsc.bcm.edu	37	19	49002759	49002759	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:49002759C>A	ENST00000600059.1	-	11	1794	c.1567G>T	c.(1567-1569)Gtg>Ttg	p.V523L	LMTK3_ENST00000270238.3_Missense_Mutation_p.V552L			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	523	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		ACAGGCAGCACGCTGGGCGTG	0.721																																					p.V552L		Atlas-SNP	.											.	LMTK3	125	.	0			c.G1654T						.						2.0	2.0	2.0					19																	49002759		1321	2812	4133	SO:0001583	missense	114783	exon12			GCAGCACGCTGGG	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.1567G>T	chr19.hg19:g.49002759C>A	ENSP00000472020:p.Val523Leu	51.0	0.0		49.0	23.0	NM_001080434	Q4G0U1	Missense_Mutation	SNP	ENST00000600059.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.88	3.496970	0.64186	.	.	ENSG00000142235	ENST00000270238	T	0.81163	-1.46	3.55	3.55	0.40652	.	0.190349	0.31156	U	0.008156	D	0.83266	0.5217	L	0.47716	1.5	0.44927	D	0.997945	D	0.76494	0.999	P	0.59595	0.86	D	0.85212	0.1021	10	0.72032	D	0.01	.	13.0352	0.58867	0.0:1.0:0.0:0.0	.	523	Q96Q04	LMTK3_HUMAN	L	552	ENSP00000270238:V552L	ENSP00000270238:V552L	V	-	1	0	LMTK3	53694571	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.491000	0.66887	2.020000	0.59435	0.386000	0.25728	GTG	.	.		0.721	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	
SIGLEC8	27181	hgsc.bcm.edu	37	19	51960896	51960896	+	Silent	SNP	C	C	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:51960896C>A	ENST00000321424.3	-	2	618	c.552G>T	c.(550-552)ggG>ggT	p.G184G	SIGLEC8_ENST00000340550.5_Intron|SIGLEC8_ENST00000430817.1_Intron|SIGLEC8_ENST00000597352.1_5'UTR	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	184	Ig-like C2-type 1.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TGGGGGGTGTCCCCTGCTTAC	0.647																																					p.G184G		Atlas-SNP	.											.	SIGLEC8	130	.	0			c.G552T						.						71.0	77.0	75.0					19																	51960896		2203	4300	6503	SO:0001819	synonymous_variant	27181	exon2			GGGTGTCCCCTGC	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.552G>T	chr19.hg19:g.51960896C>A		34.0	0.0		40.0	17.0	NM_014442	Q7Z728	Silent	SNP	ENST00000321424.3	hg19	CCDS33086.1																																																																																			.	.		0.647	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
SLC12A5	57468	hgsc.bcm.edu	37	20	44664102	44664102	+	Silent	SNP	C	C	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr20:44664102C>A	ENST00000454036.2	+	3	325	c.276C>A	c.(274-276)acC>acA	p.T92T	SLC12A5_ENST00000608944.1_Silent_p.T18T|SLC12A5_ENST00000243964.3_Silent_p.T69T|SLC12A5_ENST00000372315.1_Silent_p.T69T	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	92					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.T69T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAACTACACCAACCTGCCCC	0.577																																					p.T92T		Atlas-SNP	.											SLC12A5,colon,carcinoma,0,1	SLC12A5	181	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276A						.						94.0	101.0	98.0					20																	44664102		2203	4300	6503	SO:0001819	synonymous_variant	57468	exon3			CTACACCAACCTG	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.276C>A	chr20.hg19:g.44664102C>A		91.0	0.0		76.0	30.0	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	hg19	CCDS46610.1																																																																																			.	.		0.577	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
RLIM	51132	hgsc.bcm.edu	37	X	73812012	73812012	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chrX:73812012T>A	ENST00000332687.6	-	4	1356	c.1138A>T	c.(1138-1140)Agt>Tgt	p.S380C	RLIM_ENST00000349225.2_Missense_Mutation_p.S380C	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	380					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTGATGGTACTGACATAGGTT	0.423																																					p.S380C	Esophageal Squamous(169;1899 1923 14997 18818 32118)	Atlas-SNP	.											.	RLIM	90	.	0			c.A1138T						.						115.0	103.0	108.0					X																	73812012		2203	4300	6503	SO:0001583	missense	51132	exon5			TGGTACTGACATA	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1138A>T	chrX.hg19:g.73812012T>A	ENSP00000328059:p.Ser380Cys	94.0	0.0		108.0	57.0	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	hg19	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.628996	0.46944	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.16457	2.34;2.34	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.46205	-0.9208	10	0.87932	D	0	-19.3282	14.9929	0.71401	0.0:0.0:0.0:1.0	.	380	Q9NVW2	RNF12_HUMAN	C	380	ENSP00000328059:S380C;ENSP00000253571:S380C	ENSP00000328059:S380C	S	-	1	0	RLIM	73728737	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.695000	0.84257	1.923000	0.55706	0.486000	0.48141	AGT	.	.		0.423	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
ARID2	196528	hgsc.bcm.edu	37	12	46215247	46215247	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr12:46215247delA	ENST00000334344.6	+	6	854	c.682delA	c.(682-684)aagfs	p.K228fs	ARID2_ENST00000422737.1_Frame_Shift_Del_p.K79fs	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	228					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		ATGGAAAGAGAAGACTGATAG	0.289			"""N, S, F"""		hepatocellular carcinoma																																p.E227fs		Atlas-Indel,Pindel	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.681delG						.						70.0	76.0	74.0					12																	46215247		2203	4291	6494	SO:0001589	frameshift_variant	196528	exon6			.		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.682delA	chr12.hg19:g.46215247delA	ENSP00000335044:p.Lys228fs	385.0	0.0		415.0	184.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.		0.289	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
CD97	976	hgsc.bcm.edu	37	19	14516639	14516639	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:14516639delT	ENST00000242786.5	+	14	1789	c.1709delT	c.(1708-1710)ctgfs	p.L571fs	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Frame_Shift_Del_p.L522fs|CD97_ENST00000358600.3_Frame_Shift_Del_p.L478fs	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	571					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTCACTTTCCTGCTGGTGCGG	0.627																																					p.L570fs		Atlas-Indel,Pindel	.											.	CD97	86	.	0			c.1708delC						.						161.0	121.0	135.0					19																	14516639		2203	4300	6503	SO:0001589	frameshift_variant	976	exon14			.		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1709delT	chr19.hg19:g.14516639delT	ENSP00000242786:p.Leu571fs	44.0	0.0		43.0	21.0	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Frame_Shift_Del	DEL	ENST00000242786.5	hg19	CCDS32929.1																																																																																			.	.		0.627	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
ZNF227	7770	hgsc.bcm.edu	37	19	44739094	44739097	+	Frame_Shift_Del	DEL	TTTT	TTTT	-	rs370304805		TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	TTTT	TTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr19:44739094_44739097delTTTT	ENST00000313040.7	+	6	716_719	c.511_514delTTTT	c.(511-516)ttttggfs	p.FW171fs	ZNF227_ENST00000391961.2_Frame_Shift_Del_p.FW120fs|ZNF227_ENST00000589005.1_Frame_Shift_Del_p.FW120fs	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				AGAGTTTCCATTTTGGAGAACCCA	0.348																																					p.170_171del		Atlas-Indel,Pindel	.											.	ZNF227	62	.	0			c.510_513del						.																																			SO:0001589	frameshift_variant	7770	exon6			.	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.511_514delTTTT	chr19.hg19:g.44739094_44739097delTTTT	ENSP00000321049:p.Phe171fs	128.0	0.0		127.0	47.0	NM_182490	B3KRU7|B7Z5P9	Frame_Shift_Del	DEL	ENST00000313040.7	hg19	CCDS12636.1																																																																																			.	.		0.348	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
CAND1	55832	hgsc.bcm.edu	37	12	67701255	67701255	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr12:67701255delT	ENST00000545606.1	+	11	3445	c.3008delT	c.(3007-3009)ctgfs	p.L1004fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	1004					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		ATTGATCCACTGTTAAAGAAC	0.348																																					p.L1003fs		Atlas-Indel,Pindel	.											.	CAND1	100	.	0			c.3007delC						.						46.0	43.0	44.0					12																	67701255		2203	4298	6501	SO:0001589	frameshift_variant	55832	exon11			.		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.3008delT	chr12.hg19:g.67701255delT	ENSP00000442318:p.Leu1004fs	93.0	0.0		86.0	46.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Del	DEL	ENST00000545606.1	hg19	CCDS8977.1																																																																																			.	.		0.348	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
FRMD6	122786	hgsc.bcm.edu	37	14	52186983	52187007	+	Frame_Shift_Del	DEL	ACTCCAGCAGTGCCATCCACCGCAA	ACTCCAGCAGTGCCATCCACCGCAA	-	rs369688308|rs200768573|rs372877962|rs549602598		TCGA-DD-A73D-01A-12D-A32G-10	TCGA-DD-A73D-10A-01D-A32G-10	ACTCCAGCAGTGCCATCCACCGCAA	ACTCCAGCAGTGCCATCCACCGCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6ace15b-9da3-4260-86f4-4e0cfb35e204	4d8c018d-9b4f-4288-ac78-501085f38978	g.chr14:52186983_52187007delACTCCAGCAGTGCCATCCACCGCAA	ENST00000344768.5	+	11	1431_1455	c.1235_1259delACTCCAGCAGTGCCATCCACCGCAA	c.(1234-1260)tactccagcagtgccatccaccgcaagfs	p.YSSSAIHRK412fs	FRMD6_ENST00000553556.1_Frame_Shift_Del_p.YSSSAIHRK54fs|FRMD6_ENST00000395718.2_Frame_Shift_Del_p.YSSSAIHRK404fs|FRMD6_ENST00000356218.4_Frame_Shift_Del_p.YSSSAIHRK404fs|FRMD6_ENST00000554167.1_Frame_Shift_Del_p.YSSSAIHRK335fs			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	412					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GAAGACAGCTACTCCAGCAGTGCCATCCACCGCAAGCTGAAAACC	0.613																																					p.412_420del		Atlas-Indel,Pindel	.											.	FRMD6	100	.	0			c.1234_1258del						.																																			SO:0001589	frameshift_variant	122786	exon11			.	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1235_1259delACTCCAGCAGTGCCATCCACCGCAA	chr14.hg19:g.52186983_52187007delACTCCAGCAGTGCCATCCACCGCAA	ENSP00000343899:p.Tyr412fs	67.0	0.0		56.0	11.0	NM_001267046	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Frame_Shift_Del	DEL	ENST00000344768.5	hg19	CCDS58318.1																																																																																			.	.		0.613	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
