#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGL	178	hgsc.bcm.edu	37	1	100366399	100366399	+	Silent	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr1:100366399T>G	ENST00000294724.4	+	26	4048	c.3570T>G	c.(3568-3570)ccT>ccG	p.P1190P	AGL_ENST00000361522.4_Silent_p.P1173P|AGL_ENST00000361302.3_Silent_p.P1174P|AGL_ENST00000370163.3_Silent_p.P1190P|AGL_ENST00000370165.3_Silent_p.P1190P|AGL_ENST00000370161.2_Silent_p.P1174P|AGL_ENST00000361915.3_Silent_p.P1190P	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1190					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ATTCTGCTCCTTTGCCTGCTG	0.343																																					p.P1190P		Atlas-SNP	.											.	AGL	137	.	0			c.T3570G						.						149.0	142.0	144.0					1																	100366399		2203	4300	6503	SO:0001819	synonymous_variant	178	exon26			TGCTCCTTTGCCT	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.3570T>G	chr1.hg19:g.100366399T>G		125.0	0.0		120.0	19.0	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	ENST00000294724.4	hg19	CCDS759.1																																																																																			.	.		0.343	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
SPAG17	200162	hgsc.bcm.edu	37	1	118574431	118574431	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr1:118574431C>A	ENST00000336338.5	-	25	3558	c.3493G>T	c.(3493-3495)Gtg>Ttg	p.V1165L		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1165						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ACAGGAACCACTGTTGGAGTG	0.353																																					p.V1165L		Atlas-SNP	.											.	SPAG17	263	.	0			c.G3493T						.						137.0	129.0	132.0					1																	118574431		2203	4300	6503	SO:0001583	missense	200162	exon25			GAACCACTGTTGG		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3493G>T	chr1.hg19:g.118574431C>A	ENSP00000337804:p.Val1165Leu	159.0	0.0		152.0	30.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	hg19	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	4.535	0.099225	0.08681	.	.	ENSG00000155761	ENST00000336338	T	0.29397	1.57	5.52	3.66	0.41972	.	0.824566	0.10906	N	0.621108	T	0.05547	0.0146	N	0.22421	0.69	0.09310	N	1	B	0.28350	0.208	B	0.29598	0.104	T	0.41502	-0.9505	10	0.13853	T	0.58	.	3.0627	0.06204	0.1411:0.5653:0.1368:0.1568	.	1165	Q6Q759	SPG17_HUMAN	L	1165	ENSP00000337804:V1165L	ENSP00000337804:V1165L	V	-	1	0	SPAG17	118375954	0.041000	0.20044	0.688000	0.30117	0.254000	0.26022	0.643000	0.24750	0.701000	0.31803	0.655000	0.94253	GTG	.	.		0.353	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
ANP32E	81611	hgsc.bcm.edu	37	1	150204152	150204152	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr1:150204152G>A	ENST00000314136.8	-	2	536	c.167C>T	c.(166-168)tCg>tTg	p.S56L	ANP32E_ENST00000369119.3_Missense_Mutation_p.S8L|ANP32E_ENST00000369116.4_Intron|ANP32E_ENST00000533654.1_Missense_Mutation_p.S56L|ANP32E_ENST00000369115.2_Intron|ANP32E_ENST00000369114.5_Missense_Mutation_p.S56L|ANP32E_ENST00000436748.2_Missense_Mutation_p.S56L	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	56					histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCGGGCCAGCGAACTTAGTTC	0.413																																					p.S56L		Atlas-SNP	.											.	ANP32E	28	.	0			c.C167T						.						106.0	104.0	105.0					1																	150204152		2203	4300	6503	SO:0001583	missense	81611	exon2			GCCAGCGAACTTA	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.167C>T	chr1.hg19:g.150204152G>A	ENSP00000324074:p.Ser56Leu	64.0	0.0		101.0	9.0	NM_030920	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	ENST00000314136.8	hg19	CCDS946.1	.	.	.	.	.	.	.	.	.	.	G	35	5.563696	0.96527	.	.	ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000436748;ENST00000369114;ENST00000533654	T;T;T;T;T	0.00408	7.54;7.54;7.54;7.54;7.54	6.06	6.06	0.98353	.	0.059521	0.64402	D	0.000001	T	0.01189	0.0039	M	0.91663	3.23	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.988;0.997	T	0.57877	-0.7735	10	0.87932	D	0	.	19.609	0.95594	0.0:0.0:1.0:0.0	.	56;56;56;8	E9PLC4;E9PEA6;Q9BTT0;Q5TB20	.;.;AN32E_HUMAN;.	L	56;8;56;56;56	ENSP00000324074:S56L;ENSP00000358115:S8L;ENSP00000393718:S56L;ENSP00000358110:S56L;ENSP00000435215:S56L	ENSP00000324074:S56L	S	-	2	0	ANP32E	148470776	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	9.202000	0.95026	2.882000	0.98803	0.655000	0.94253	TCG	.	.		0.413	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1	NM_030920	
TROVE2	6738	hgsc.bcm.edu	37	1	193045776	193045776	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr1:193045776A>G	ENST00000367446.3	+	4	1157	c.947A>G	c.(946-948)aAg>aGg	p.K316R	TROVE2_ENST00000400968.2_Splice_Site_p.K316R|TROVE2_ENST00000432079.1_Splice_Site_p.K41R|TROVE2_ENST00000416058.2_Splice_Site_p.K41R|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367441.1_Splice_Site_p.K316R|TROVE2_ENST00000367445.3_Splice_Site_p.K316R|TROVE2_ENST00000367443.1_Splice_Site_p.K316R|TROVE2_ENST00000367444.3_Splice_Site_p.K316R	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	316	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						CTATTAAAAAAGGTAAGCATT	0.318																																					p.K316R		Atlas-SNP	.											.	TROVE2	50	.	0			c.A947G						.						71.0	70.0	70.0					1																	193045776		1804	4066	5870	SO:0001630	splice_region_variant	6738	exon4			TAAAAAAGGTAAG	BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.948+1A>G	chr1.hg19:g.193045776A>G		219.0	0.0		298.0	44.0	NM_004600	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	ENST00000367446.3	hg19	CCDS1379.1	.	.	.	.	.	.	.	.	.	.	A	19.45	3.830097	0.71258	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	T;T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67;2.67	5.38	4.25	0.50352	TROVE (2);	0.044639	0.85682	N	0.000000	T	0.20007	0.0481	L	0.39514	1.22	0.53005	D	0.999965	B;B;B;D	0.63880	0.04;0.04;0.127;0.993	B;B;B;P	0.59761	0.075;0.075;0.092;0.863	T	0.04565	-1.0942	10	0.11794	T	0.64	-19.8266	11.1853	0.48653	0.9278:0.0:0.0722:0.0	.	316;316;316;316	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	R	316;41;316;316;316;316;316	ENSP00000383752:K316R;ENSP00000411421:K41R;ENSP00000356416:K316R;ENSP00000356413:K316R;ENSP00000356415:K316R;ENSP00000356414:K316R;ENSP00000356411:K316R	ENSP00000356411:K316R	K	+	2	0	TROVE2	191312399	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.691000	0.74573	1.003000	0.39130	0.456000	0.33151	AAG	.	.		0.318	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600	Missense_Mutation
SIPA1L2	57568	hgsc.bcm.edu	37	1	232649711	232649711	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr1:232649711C>T	ENST00000366630.1	-	2	1733	c.1375G>A	c.(1375-1377)Gaa>Aaa	p.E459K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E459K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	459					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CTGGGCACTTCCAAGACGGAG	0.483																																					p.E459K		Atlas-SNP	.											.	SIPA1L2	218	.	0			c.G1375A						.						153.0	149.0	150.0					1																	232649711		1965	4160	6125	SO:0001583	missense	57568	exon1			GCACTTCCAAGAC	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.1375G>A	chr1.hg19:g.232649711C>T	ENSP00000355589:p.Glu459Lys	99.0	0.0		119.0	39.0	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	hg19	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981252	0.93044	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.86030	-2.06;-2.06	5.39	5.39	0.77823	.	0.055252	0.64402	D	0.000001	D	0.93779	0.8011	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.94331	0.7562	10	0.87932	D	0	-36.6723	19.3561	0.94414	0.0:1.0:0.0:0.0	.	459	Q9P2F8	SI1L2_HUMAN	K	459	ENSP00000355589:E459K;ENSP00000262861:E459K	ENSP00000262861:E459K	E	-	1	0	SIPA1L2	230716334	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	7.651000	0.83577	2.810000	0.96702	0.650000	0.86243	GAA	.	.		0.483	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
PCBP1	5093	hgsc.bcm.edu	37	2	70315623	70315623	+	Missense_Mutation	SNP	A	A	G	rs548418658		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr2:70315623A>G	ENST00000303577.5	+	1	1039	c.748A>G	c.(748-750)Atg>Gtg	p.M250V	PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	250					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						TCACTTTGCCATGATGCACGG	0.527																																					p.M250V	Colon(85;1146 1307 3484 18706 25380)	Atlas-SNP	.											.	PCBP1	28	.	0			c.A748G						.						77.0	72.0	73.0					2																	70315623		2203	4300	6503	SO:0001583	missense	5093	exon1			TTTGCCATGATGC		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.748A>G	chr2.hg19:g.70315623A>G	ENSP00000305556:p.Met250Val	139.0	0.0		140.0	23.0	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	hg19	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.192143	0.38707	.	.	ENSG00000169564	ENST00000303577	T	0.29397	1.57	4.32	4.32	0.51571	.	0.420286	0.18063	N	0.152899	T	0.33030	0.0849	M	0.69823	2.125	0.42082	D	0.991251	B	0.25563	0.129	B	0.29942	0.109	T	0.09058	-1.0692	10	0.15499	T	0.54	.	12.0954	0.53752	1.0:0.0:0.0:0.0	.	250	Q15365	PCBP1_HUMAN	V	250	ENSP00000305556:M250V	ENSP00000305556:M250V	M	+	1	0	PCBP1	70169127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.928000	0.48908	2.181000	0.69327	0.533000	0.62120	ATG	.	.		0.527	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
SLC39A10	57181	hgsc.bcm.edu	37	2	196593046	196593046	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr2:196593046G>A	ENST00000409086.3	+	9	2585	c.2310G>A	c.(2308-2310)atG>atA	p.M770I	SLC39A10_ENST00000359634.5_Missense_Mutation_p.M770I|SLC39A10_ENST00000541054.1_Missense_Mutation_p.M320I	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	770					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			CTGCAGGCATGTTCCTCTATG	0.413																																					p.M770I		Atlas-SNP	.											.	SLC39A10	89	.	0			c.G2310A						.						224.0	190.0	202.0					2																	196593046		2203	4300	6503	SO:0001583	missense	57181	exon9			AGGCATGTTCCTC		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.2310G>A	chr2.hg19:g.196593046G>A	ENSP00000386766:p.Met770Ile	131.0	0.0		149.0	27.0	NM_020342	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	hg19	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690335	0.68271	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.46063	0.88;0.88;0.88	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	L	0.50919	1.6	0.80722	D	1	B	0.32968	0.392	B	0.44224	0.444	T	0.40175	-0.9577	10	0.34782	T	0.22	.	19.0594	0.93081	0.0:0.0:1.0:0.0	.	770	Q9ULF5	S39AA_HUMAN	I	770;770;320	ENSP00000386766:M770I;ENSP00000352655:M770I;ENSP00000437787:M320I	ENSP00000352655:M770I	M	+	3	0	SLC39A10	196301291	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.614000	0.82996	2.750000	0.94351	0.561000	0.74099	ATG	.	.		0.413	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
PTH2R	5746	hgsc.bcm.edu	37	2	209345847	209345847	+	Missense_Mutation	SNP	G	G	T	rs151296979		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr2:209345847G>T	ENST00000272847.2	+	10	1247	c.1034G>T	c.(1033-1035)tGg>tTg	p.W345L	PTH2R_ENST00000413482.1_3'UTR|AC019185.4_ENST00000424628.1_RNA	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	345					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.W345L(2)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	ACCAAAATCTGGGAGACCAAT	0.358													G|||	1	0.000199681	0.0	0.0	5008	,	,		17253	0.0		0.001	False		,,,				2504	0.0				p.W345L		Atlas-SNP	.											PTH2R,NS,carcinoma,0,2	PTH2R	92	.	2	Substitution - Missense(2)	lung(2)	c.G1034T						.	G	LEU/TRP	0,4406		0,0,2203	101.0	99.0	99.0		1034	4.7	1.0	2	dbSNP_134	99	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PTH2R	NM_005048.2	61	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	probably-damaging	345/551	209345847	2,13004	2203	4300	6503	SO:0001583	missense	5746	exon10			AAATCTGGGAGAC	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1034G>T	chr2.hg19:g.209345847G>T	ENSP00000272847:p.Trp345Leu	218.0	0.0		259.0	21.0	NM_005048	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	hg19	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987720	0.74589	0.0	2.33E-4	ENSG00000144407	ENST00000272847	T	0.31769	1.48	5.54	4.66	0.58398	GPCR, family 2-like (1);	0.000000	0.47093	D	0.000255	T	0.43942	0.1270	L	0.45228	1.405	0.40834	D	0.983611	D;D	0.63880	0.993;0.993	D;D	0.66497	0.944;0.944	T	0.30504	-0.9976	9	.	.	.	.	12.6927	0.56985	0.081:0.0:0.919:0.0	.	234;345	B4DFN8;P49190	.;PTH2R_HUMAN	L	345	ENSP00000272847:W345L	.	W	+	2	0	PTH2R	209054092	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.302000	0.96175	1.477000	0.48234	0.650000	0.86243	TGG	.	G|1.000;T|0.000		0.358	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
GRM7	2917	hgsc.bcm.edu	37	3	7620315	7620315	+	Silent	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:7620315C>T	ENST00000357716.4	+	8	1996	c.1722C>T	c.(1720-1722)acC>acT	p.T574T	GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000402647.2_Silent_p.T574T|GRM7_ENST00000486284.1_Silent_p.T574T|GRM7_ENST00000389336.4_Silent_p.T574T|GRM7_ENST00000403881.1_Silent_p.T574T	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	574					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						AAAATCGAACCGGATGCCAGG	0.522																																					p.T574T		Atlas-SNP	.											.	GRM7	223	.	0			c.C1722T						.						137.0	135.0	136.0					3																	7620315		2203	4300	6503	SO:0001819	synonymous_variant	2917	exon8			TCGAACCGGATGC	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1722C>T	chr3.hg19:g.7620315C>T		110.0	0.0		109.0	12.0	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	ENST00000357716.4	hg19	CCDS43042.1																																																																																			.	.		0.522	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
SH3BP5	9467	hgsc.bcm.edu	37	3	15300545	15300545	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:15300545T>C	ENST00000383791.3	-	7	902	c.682A>G	c.(682-684)Act>Gct	p.T228A	SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5_ENST00000253688.5_Missense_Mutation_p.T71A|SH3BP5_ENST00000426925.1_Missense_Mutation_p.T71A|SH3BP5_ENST00000408919.3_Missense_Mutation_p.T71A|SH3BP5-AS1_ENST00000413977.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	228					intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						TCATCCACAGTCTTTTTCAGT	0.488																																					p.T228A		Atlas-SNP	.											.	SH3BP5	32	.	0			c.A682G						.						77.0	65.0	69.0					3																	15300545		2203	4300	6503	SO:0001583	missense	9467	exon7			CCACAGTCTTTTT	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.682A>G	chr3.hg19:g.15300545T>C	ENSP00000373301:p.Thr228Ala	85.0	0.0		89.0	7.0	NM_004844	B3KQW6|Q5JWV9	Missense_Mutation	SNP	ENST00000383791.3	hg19	CCDS2625.2	.	.	.	.	.	.	.	.	.	.	T	8.882	0.951889	0.18431	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919;ENST00000366391	T;T	0.78246	-1.16;2.35	5.36	2.88	0.33553	.	0.254800	0.44097	D	0.000487	T	0.59115	0.2170	N	0.19112	0.55	0.41422	D	0.987801	B	0.02656	0.0	B	0.08055	0.003	T	0.48340	-0.9044	10	0.13853	T	0.58	-4.9378	9.8627	0.41125	0.0:0.1458:0.0:0.8542	.	228	O60239	3BP5_HUMAN	A	228;71;71;71;71	ENSP00000373301:T228A;ENSP00000394115:T71A	ENSP00000253688:T71A	T	-	1	0	SH3BP5	15275549	1.000000	0.71417	0.952000	0.39060	0.258000	0.26162	3.313000	0.51935	0.852000	0.35287	0.414000	0.27820	ACT	.	.		0.488	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844	
NR1D2	9975	hgsc.bcm.edu	37	3	24009404	24009404	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:24009404G>T	ENST00000312521.4	+	7	1752	c.1433G>T	c.(1432-1434)gGa>gTa	p.G478V	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	478	Interaction with ZNHIT1.|Ligand-binding.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.G478fs*6(1)		NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						CACTCAATGGGAGCAGGGGAT	0.388																																					p.G478V		Atlas-SNP	.											.,2	NR1D2	52	.	1	Deletion - Frameshift(1)	prostate(1)	c.G1433T						.						143.0	138.0	140.0					3																	24009404		2203	4300	6503	SO:0001583	missense	9975	exon7			CAATGGGAGCAGG	BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.1433G>T	chr3.hg19:g.24009404G>T	ENSP00000310006:p.Gly478Val	105.0	0.0		108.0	23.0	NM_005126	B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	ENST00000312521.4	hg19	CCDS33718.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873683	0.72180	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.96619	-4.07	5.94	5.07	0.68467	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98492	0.9497	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99482	1.0948	10	0.87932	D	0	.	15.1079	0.72334	0.0677:0.0:0.9322:0.0	.	478	Q14995	NR1D2_HUMAN	V	478	ENSP00000310006:G478V	ENSP00000310006:G478V	G	+	2	0	NR1D2	23984408	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	9.789000	0.99068	1.516000	0.48900	-0.136000	0.14681	GGA	.	.		0.388	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341017.3		
SLC4A7	9497	hgsc.bcm.edu	37	3	27490188	27490188	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:27490188T>G	ENST00000295736.5	-	3	286	c.216A>C	c.(214-216)aaA>aaC	p.K72N	SLC4A7_ENST00000437179.1_Missense_Mutation_p.K77N|SLC4A7_ENST00000425128.2_Missense_Mutation_p.K77N|SLC4A7_ENST00000428386.1_Missense_Mutation_p.K72N|SLC4A7_ENST00000455077.1_Missense_Mutation_p.K77N|SLC4A7_ENST00000446700.1_Missense_Mutation_p.K77N|SLC4A7_ENST00000454389.1_Missense_Mutation_p.K81N|SLC4A7_ENST00000440156.1_Missense_Mutation_p.K81N|SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000445684.1_Missense_Mutation_p.K81N|SLC4A7_ENST00000435667.2_Missense_Mutation_p.K81N	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	72					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	ATTCTTTATCTTTTCTTCTCC	0.413																																					p.K77N		Atlas-SNP	.											.	SLC4A7	119	.	0			c.A231C						.						241.0	217.0	225.0					3																	27490188		2203	4300	6503	SO:0001583	missense	9497	exon3			TTTATCTTTTCTT	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.216A>C	chr3.hg19:g.27490188T>G	ENSP00000295736:p.Lys72Asn	133.0	0.0		98.0	12.0	NM_001258379	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	hg19	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.627193	0.46944	.	.	ENSG00000033867	ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000425128;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T	0.79247	-1.16;-1.18;-1.17;-1.25;-1.18;-1.24;-1.18;-1.24;-1.18;0.26;-1.18	5.56	5.56	0.83823	.	0.060857	0.64402	D	0.000003	T	0.74772	0.3760	L	0.42245	1.32	0.58432	D	0.999999	P;B;P;P;P;B;B;P;B	0.38992	0.653;0.178;0.653;0.647;0.546;0.435;0.249;0.546;0.178	B;B;B;B;B;B;B;B;B	0.43809	0.357;0.15;0.357;0.432;0.156;0.347;0.274;0.156;0.15	T	0.71248	-0.4649	10	0.20046	T	0.44	.	15.3698	0.74554	0.0:0.0:0.0:1.0	.	81;77;77;81;81;77;72;72;77	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;B6DY53;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	N	72;72;81;81;77;77;77;81;81;77;72	ENSP00000295736:K72N;ENSP00000416368:K72N;ENSP00000390394:K81N;ENSP00000414797:K81N;ENSP00000394252:K77N;ENSP00000406605:K77N;ENSP00000407382:K77N;ENSP00000406804:K81N;ENSP00000395336:K81N;ENSP00000401949:K77N;ENSP00000388703:K72N	ENSP00000295736:K72N	K	-	3	2	SLC4A7	27465192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.488000	0.35551	2.106000	0.64143	0.528000	0.53228	AAA	.	.		0.413	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	
CADPS	8618	hgsc.bcm.edu	37	3	62860303	62860303	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:62860303A>C	ENST00000383710.4	-	1	751	c.402T>G	c.(400-402)aaT>aaG	p.N134K	CADPS_ENST00000490353.2_Missense_Mutation_p.N134K|CADPS_ENST00000357948.3_Missense_Mutation_p.N134K|CADPS_ENST00000283269.9_Missense_Mutation_p.N134K	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	134					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GCTGCTTGGCATTAAAGGGGT	0.632																																					p.N134K		Atlas-SNP	.											.	CADPS	387	.	0			c.T402G						.						41.0	35.0	37.0					3																	62860303		2193	4274	6467	SO:0001583	missense	8618	exon1			CTTGGCATTAAAG	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.402T>G	chr3.hg19:g.62860303A>C	ENSP00000373215:p.Asn134Lys	92.0	0.0		92.0	13.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	hg19	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	A	16.74	3.206270	0.58343	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	4.73	0.664	0.17890	.	0.260090	0.37761	N	0.001960	D	0.88720	0.6513	M	0.81112	2.525	0.47308	D	0.999381	D;D;D	0.69078	0.997;0.989;0.997	D;D;D	0.75484	0.959;0.969;0.986	D	0.86393	0.1737	10	0.87932	D	0	.	7.8723	0.29573	0.4265:0.0:0.5735:0.0	.	134;134;134	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	K	134	ENSP00000373215:N134K;ENSP00000350632:N134K;ENSP00000283269:N134K;ENSP00000418736:N134K	ENSP00000283269:N134K	N	-	3	2	CADPS	62835343	0.997000	0.39634	1.000000	0.80357	0.957000	0.61999	0.337000	0.19841	0.083000	0.17047	-1.145000	0.01858	AAT	.	.		0.632	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
DZIP3	9666	hgsc.bcm.edu	37	3	108373111	108373111	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:108373111A>G	ENST00000361582.3	+	19	2383	c.2153A>G	c.(2152-2154)aAg>aGg	p.K718R	DZIP3_ENST00000463306.1_Missense_Mutation_p.K718R	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	718					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ATGGAAGACAAGTTCTATAGC	0.408																																					p.K718R		Atlas-SNP	.											.	DZIP3	111	.	0			c.A2153G						.						192.0	173.0	179.0					3																	108373111		2203	4300	6503	SO:0001583	missense	9666	exon19			AAGACAAGTTCTA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.2153A>G	chr3.hg19:g.108373111A>G	ENSP00000355028:p.Lys718Arg	148.0	0.0		120.0	21.0	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	hg19	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	A	17.03	3.284897	0.59867	.	.	ENSG00000198919	ENST00000361582;ENST00000463306	T;T	0.32023	1.47;1.47	4.81	3.66	0.41972	.	0.123171	0.36932	N	0.002337	T	0.32763	0.0840	L	0.44542	1.39	0.28799	N	0.898899	P;D	0.55172	0.948;0.97	B;P	0.51833	0.428;0.681	T	0.14952	-1.0454	10	0.56958	D	0.05	-9.4436	7.0365	0.24996	0.8978:0.0:0.1022:0.0	.	336;718	D3DN61;Q86Y13	.;DZIP3_HUMAN	R	718	ENSP00000355028:K718R;ENSP00000419981:K718R	ENSP00000355028:K718R	K	+	2	0	DZIP3	109855801	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	3.944000	0.56629	0.869000	0.35703	-0.361000	0.07541	AAG	.	.		0.408	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
POLQ	10721	hgsc.bcm.edu	37	3	121209009	121209009	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:121209009A>T	ENST00000264233.5	-	16	2897	c.2769T>A	c.(2767-2769)ttT>ttA	p.F923L		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	923					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTTGGGATATAAATGTGTGTT	0.328								DNA polymerases (catalytic subunits)																													p.F923L	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.T2769A						.						71.0	65.0	67.0					3																	121209009		2203	4300	6503	SO:0001583	missense	10721	exon16			GGATATAAATGTG	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.2769T>A	chr3.hg19:g.121209009A>T	ENSP00000264233:p.Phe923Leu	138.0	0.0		116.0	21.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.662092	0.29515	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.45276	0.9	5.62	1.7	0.24286	.	1.019970	0.07777	N	0.952772	T	0.27629	0.0679	L	0.32530	0.975	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.15484	0.002;0.013	T	0.29274	-1.0017	10	0.15066	T	0.55	.	3.9949	0.09553	0.406:0.3698:0.2242:0.0	.	923;95	O75417;O75417-2	DPOLQ_HUMAN;.	L	546;923;1059	ENSP00000264233:F923L	ENSP00000264233:F923L	F	-	3	2	POLQ	122691699	0.000000	0.05858	0.003000	0.11579	0.926000	0.56050	0.047000	0.14056	0.407000	0.25591	0.455000	0.32223	TTT	.	.		0.328	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
ITGB5	3693	hgsc.bcm.edu	37	3	124592378	124592378	+	Splice_Site	SNP	C	C	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:124592378C>G	ENST00000296181.4	-	2	367	c.71G>C	c.(70-72)gGt>gCt	p.G24A		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	24					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TATGTTGAGACCTTTAAAGCA	0.438																																					p.G24A		Atlas-SNP	.											.	ITGB5	66	.	0			c.G71C						.						282.0	270.0	274.0					3																	124592378		2203	4300	6503	SO:0001630	splice_region_variant	3693	exon2			TTGAGACCTTTAA	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.71-1G>C	chr3.hg19:g.124592378C>G		109.0	0.0		102.0	18.0	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	hg19	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191633	0.58017	.	.	ENSG00000082781	ENST00000296181	D	0.90732	-2.72	5.04	5.04	0.67666	.	0.000000	0.85682	U	0.000000	T	0.78553	0.4301	N	0.08118	0	0.53688	D	0.999975	P	0.37122	0.583	B	0.20767	0.031	T	0.82456	-0.0448	10	0.62326	D	0.03	.	15.402	0.74849	0.0:1.0:0.0:0.0	.	24	P18084	ITB5_HUMAN	A	24	ENSP00000296181:G24A	ENSP00000296181:G24A	G	-	2	0	ITGB5	126075068	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.400000	0.66320	2.613000	0.88420	0.462000	0.41574	GGT	.	.		0.438	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	Missense_Mutation
COL6A6	131873	hgsc.bcm.edu	37	3	130346161	130346161	+	Splice_Site	SNP	A	A	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:130346161A>C	ENST00000358511.6	+	25	4972		c.e25-1		COL6A6_ENST00000453409.2_Splice_Site	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6						cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTCTGTTTACAGGGCAATGAT	0.428																																					.		Atlas-SNP	.											.	COL6A6	497	.	0			c.4942-2A>C						.						177.0	176.0	176.0					3																	130346161		1903	4125	6028	SO:0001630	splice_region_variant	131873	exon25			GTTTACAGGGCAA	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4942-1A>C	chr3.hg19:g.130346161A>C		160.0	0.0		182.0	32.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Splice_Site	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	A	11.26	1.586269	0.28268	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9756	0.53089	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A6	131828851	0.997000	0.39634	0.962000	0.40283	0.130000	0.20726	4.593000	0.61034	2.143000	0.66587	0.528000	0.53228	.	.	.		0.428	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	Intron
ACTL6A	86	hgsc.bcm.edu	37	3	179304415	179304415	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:179304415T>C	ENST00000429709.2	+	13	1417	c.1204T>C	c.(1204-1206)Tct>Cct	p.S402P	ACTL6A_ENST00000392662.1_Missense_Mutation_p.S360P|RP11-15L13.4_ENST00000608818.1_RNA|ACTL6A_ENST00000450518.2_Missense_Mutation_p.S360P|RP11-145M9.6_ENST00000610007.1_RNA	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	402					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			CATTCTAGCCTCTTTGGTTAG	0.338																																					p.S402P		Atlas-SNP	.											.	ACTL6A	43	.	0			c.T1204C						.						84.0	84.0	84.0					3																	179304415		2203	4300	6503	SO:0001583	missense	86	exon13			CTAGCCTCTTTGG	AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.1204T>C	chr3.hg19:g.179304415T>C	ENSP00000397552:p.Ser402Pro	44.0	0.0		51.0	10.0	NM_004301	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Missense_Mutation	SNP	ENST00000429709.2	hg19	CCDS3231.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.496203	0.85069	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662	D;D;D	0.95518	-3.73;-3.73;-3.73	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.98469	0.9490	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99671	1.0996	10	0.87932	D	0	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	402	O96019	ACL6A_HUMAN	P	402;360;360	ENSP00000397552:S402P;ENSP00000394014:S360P;ENSP00000376430:S360P	ENSP00000376430:S360P	S	+	1	0	ACTL6A	180787109	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	7.616000	0.83018	2.254000	0.74563	0.533000	0.62120	TCT	.	.		0.338	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301	
ACTL6A	86	hgsc.bcm.edu	37	3	179304422	179304422	+	Splice_Site	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:179304422T>G	ENST00000429709.2	+	13	1422		c.e13+2		ACTL6A_ENST00000392662.1_Splice_Site|RP11-15L13.4_ENST00000608818.1_RNA|ACTL6A_ENST00000450518.2_Splice_Site|RP11-145M9.6_ENST00000610007.1_RNA	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A						ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			GCCTCTTTGGTTAGTAGATGA	0.338																																					.		Atlas-SNP	.											.	ACTL6A	43	.	0			c.1083+2T>G						.						83.0	82.0	82.0					3																	179304422		2203	4300	6503	SO:0001630	splice_region_variant	86	exon13			CTTTGGTTAGTAG	AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.1209+2T>G	chr3.hg19:g.179304422T>G		41.0	0.0		50.0	11.0	NM_178042	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Splice_Site	SNP	ENST00000429709.2	hg19	CCDS3231.1	.	.	.	.	.	.	.	.	.	.	T	14.61	2.586884	0.46110	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662	.	.	.	5.76	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1116	0.59277	0.0:0.0:0.1338:0.8662	.	.	.	.	.	-1	.	.	.	+	.	.	ACTL6A	180787116	1.000000	0.71417	0.998000	0.56505	0.556000	0.35491	7.616000	0.83018	0.981000	0.38548	0.533000	0.62120	.	.	.		0.338	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301	Intron
MAP3K13	9175	hgsc.bcm.edu	37	3	185146704	185146704	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:185146704G>T	ENST00000265026.3	+	2	669	c.335G>T	c.(334-336)gGa>gTa	p.G112V	MAP3K13_ENST00000446828.1_Intron|MAP3K13_ENST00000424227.1_Missense_Mutation_p.G112V|MAP3K13_ENST00000535426.1_Intron|MAP3K13_ENST00000443863.1_Intron	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AGCACAAGCGGAACTGAAGAC	0.493																																					p.G112V		Atlas-SNP	.											.	MAP3K13	209	.	0			c.G335T						.						107.0	99.0	102.0					3																	185146704		2203	4300	6503	SO:0001583	missense	9175	exon2			CAAGCGGAACTGA	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.335G>T	chr3.hg19:g.185146704G>T	ENSP00000265026:p.Gly112Val	153.0	0.0		186.0	24.0	NM_004721		Missense_Mutation	SNP	ENST00000265026.3	hg19	CCDS3270.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934304	0.34096	.	.	ENSG00000073803	ENST00000447637;ENST00000424227;ENST00000428617;ENST00000265026	T;T;T;T	0.76448	0.31;-1.02;0.78;-1.02	5.61	4.73	0.59995	.	0.484890	0.21493	N	0.073653	T	0.62356	0.2421	N	0.08118	0	0.27651	N	0.9474	B	0.31054	0.306	B	0.33042	0.157	T	0.54774	-0.8243	10	0.28530	T	0.3	.	16.1836	0.81929	0.0:0.2507:0.7493:0.0	.	112	O43283	M3K13_HUMAN	V	112	ENSP00000389495:G112V;ENSP00000399910:G112V;ENSP00000405163:G112V;ENSP00000265026:G112V	ENSP00000265026:G112V	G	+	2	0	MAP3K13	186629398	1.000000	0.71417	0.015000	0.15790	0.772000	0.43724	4.100000	0.57762	1.346000	0.45694	0.655000	0.94253	GGA	.	.		0.493	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
BCL6	604	hgsc.bcm.edu	37	3	187446200	187446200	+	Silent	SNP	C	C	T	rs370060611		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:187446200C>T	ENST00000406870.2	-	6	1854	c.1488G>A	c.(1486-1488)acG>acA	p.T496T	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Silent_p.T496T|BCL6_ENST00000450123.2_Silent_p.T496T|RP11-211G3.3_ENST00000449623.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	496					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		CCTCAGGGAACGTGGGGCCAG	0.597			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""								C|||	1	0.000199681	0.0	0.0014	5008	,	,		19897	0.0		0.0	False		,,,				2504	0.0				p.T496T		Atlas-SNP	.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	107	.	0			c.G1488A						.	C	,,	0,4406		0,0,2203	60.0	52.0	55.0		1488,1488,1488	-4.4	1.0	3		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	BCL6	NM_001130845.1,NM_001134738.1,NM_001706.4	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	496/707,496/651,496/707	187446200	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	604	exon5			AGGGAACGTGGGG		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1488G>A	chr3.hg19:g.187446200C>T		98.0	0.0		101.0	19.0	NM_001134738	A7E241|B8PSA7|D3DNV5	Silent	SNP	ENST00000406870.2	hg19	CCDS3289.1																																																																																			.	.		0.597	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
C1QTNF7	114905	hgsc.bcm.edu	37	4	15443998	15443998	+	Missense_Mutation	SNP	G	G	A	rs372857232		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr4:15443998G>A	ENST00000444304.2	+	3	771	c.445G>A	c.(445-447)Gcc>Acc	p.A149T	C1QTNF7_ENST00000429690.1_Missense_Mutation_p.A149T|C1QTNF7_ENST00000295297.4_Missense_Mutation_p.A156T			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	149	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						GCTCAAATCCGCCTTTTCTGT	0.517																																					p.A156T		Atlas-SNP	.											.	C1QTNF7	36	.	0			c.G466A						.	G	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	221.0	231.0	228.0		466,445,445	5.8	1.0	4		228	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	C1QTNF7	NM_001135170.1,NM_001135171.1,NM_031911.4	58,58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	156/297,149/290,149/290	15443998	1,13005	2203	4300	6503	SO:0001583	missense	114905	exon3			AAATCCGCCTTTT	AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.445G>A	chr4.hg19:g.15443998G>A	ENSP00000388914:p.Ala149Thr	210.0	0.0		240.0	46.0	NM_001135170	B2RBT3|J3KPW3	Missense_Mutation	SNP	ENST00000444304.2	hg19	CCDS3414.1	.	.	.	.	.	.	.	.	.	.	G	34	5.367332	0.95900	0.0	1.16E-4	ENSG00000163145	ENST00000295297;ENST00000429690;ENST00000444304	D;D;D	0.84873	-1.91;-1.91;-1.91	5.8	5.8	0.92144	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	D	0.95376	0.8499	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96191	0.9138	9	.	.	.	.	20.0545	0.97645	0.0:0.0:1.0:0.0	.	149	Q9BXJ2	C1QT7_HUMAN	T	156;149;149	ENSP00000295297:A156T;ENSP00000410722:A149T;ENSP00000388914:A149T	.	A	+	1	0	C1QTNF7	15053096	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	9.830000	0.99415	2.748000	0.94277	0.655000	0.94253	GCC	.	.		0.517	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000250891.2		
GABRG1	2565	hgsc.bcm.edu	37	4	46060363	46060363	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr4:46060363A>G	ENST00000295452.4	-	7	954	c.787T>C	c.(787-789)Ttt>Ctt	p.F263L		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	263					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGGTCAAAAAAAATTGTCATG	0.284																																					p.F263L		Atlas-SNP	.											.	GABRG1	172	.	0			c.T787C						.						93.0	97.0	95.0					4																	46060363		2203	4300	6503	SO:0001583	missense	2565	exon7			CAAAAAAAATTGT	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.787T>C	chr4.hg19:g.46060363A>G	ENSP00000295452:p.Phe263Leu	383.0	0.0		352.0	55.0	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	hg19	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.832567	0.71258	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.78924	-1.22	5.82	5.82	0.92795	Neurotransmitter-gated ion-channel ligand-binding (3);	0.050552	0.85682	D	0.000000	T	0.70351	0.3214	N	0.20766	0.605	0.45806	D	0.998682	B	0.33549	0.417	B	0.39935	0.314	T	0.71886	-0.4457	10	0.49607	T	0.09	.	15.4084	0.74900	1.0:0.0:0.0:0.0	.	263	Q8N1C3	GBRG1_HUMAN	L	263	ENSP00000295452:F263L	ENSP00000295452:F263L	F	-	1	0	GABRG1	45755120	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.201000	0.95017	2.236000	0.73375	0.524000	0.50904	TTT	.	.		0.284	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
FGA	2243	hgsc.bcm.edu	37	4	155507643	155507643	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr4:155507643G>A	ENST00000302053.3	-	5	1016	c.938C>T	c.(937-939)tCt>tTt	p.S313F	FGA_ENST00000403106.3_Missense_Mutation_p.S313F	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	313					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCCAGTCCCAGAGCTCCCAGG	0.572																																					p.S313F	NSCLC(143;340 1922 20892 22370 48145)	Atlas-SNP	.											.	FGA	179	.	0			c.C938T						.						101.0	110.0	107.0					4																	155507643		2203	4300	6503	SO:0001583	missense	2243	exon5			GTCCCAGAGCTCC		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.938C>T	chr4.hg19:g.155507643G>A	ENSP00000306361:p.Ser313Phe	168.0	0.0		103.0	11.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	hg19	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685721	0.47991	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.80480	-1.38;-1.38	4.85	4.0	0.46444	.	.	.	.	.	T	0.79305	0.4423	M	0.62723	1.935	0.09310	N	1	P;P	0.43094	0.799;0.531	P;B	0.45610	0.487;0.154	T	0.72004	-0.4421	9	0.62326	D	0.03	.	6.0833	0.19952	0.1018:0.1936:0.7046:0.0	.	313;313	P02671-2;P02671	.;FIBA_HUMAN	F	313	ENSP00000306361:S313F;ENSP00000385981:S313F	ENSP00000306361:S313F	S	-	2	0	FGA	155727093	0.174000	0.23070	0.003000	0.11579	0.032000	0.12392	3.489000	0.53237	2.212000	0.71576	0.563000	0.77884	TCT	.	.		0.572	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
TARS	6897	hgsc.bcm.edu	37	5	33455170	33455170	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:33455170G>T	ENST00000265112.3	+	5	885	c.574G>T	c.(574-576)Ggg>Tgg	p.G192W	TARS_ENST00000455217.2_Splice_Site_p.G225W|TARS_ENST00000414361.2_Splice_Site_p.G71W|TARS_ENST00000541634.1_Splice_Site_p.G88W|TARS_ENST00000502553.1_Splice_Site_p.G192W	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	192					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CCTCGAAGAAGGGTAAGCCAT	0.383																																					p.G225W		Atlas-SNP	.											.	TARS	66	.	0			c.G673T						.						80.0	75.0	77.0					5																	33455170		2203	4300	6503	SO:0001630	splice_region_variant	6897	exon6			GAAGAAGGGTAAG	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.575+1G>T	chr5.hg19:g.33455170G>T		82.0	0.0		68.0	9.0	NM_001258438	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	ENST00000265112.3	hg19	CCDS3899.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907597	0.72868	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T;T;T	0.06933	3.24;3.24;3.24;3.24;3.24	5.86	5.86	0.93980	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.046695	0.85682	D	0.000000	T	0.18215	0.0437	L	0.41492	1.28	0.54753	D	0.999983	P;D;D;D	0.59357	0.94;0.985;0.957;0.972	P;P;P;P	0.54210	0.571;0.745;0.649;0.571	T	0.00036	-1.2257	10	0.87932	D	0	-24.8767	20.2429	0.98386	0.0:0.0:1.0:0.0	.	71;225;88;192	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	W	192;192;88;225;71	ENSP00000424387:G192W;ENSP00000265112:G192W;ENSP00000438469:G88W;ENSP00000387710:G225W;ENSP00000394291:G71W	ENSP00000265112:G192W	G	+	1	0	TARS	33490927	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	4.327000	0.59247	2.797000	0.96272	0.644000	0.83932	GGG	.	.		0.383	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207367.1	NM_152295	Missense_Mutation
FYB	2533	hgsc.bcm.edu	37	5	39135012	39135012	+	Silent	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:39135012G>T	ENST00000351578.6	-	8	1810	c.1620C>A	c.(1618-1620)atC>atA	p.I540I	FYB_ENST00000512982.1_Silent_p.I540I|FYB_ENST00000515010.1_Silent_p.I540I|FYB_ENST00000505428.1_Silent_p.I540I|FYB_ENST00000540520.1_Silent_p.I550I	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	540	SH3.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTGTGATGCGGATGATTTCAA	0.438																																					p.I550I		Atlas-SNP	.											.	FYB	354	.	0			c.C1650A						.						202.0	186.0	191.0					5																	39135012		1890	4140	6030	SO:0001819	synonymous_variant	2533	exon8			GATGCGGATGATT	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1620C>A	chr5.hg19:g.39135012G>T		129.0	0.0		138.0	18.0	NM_001243093	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	ENST00000351578.6	hg19	CCDS47200.1																																																																																			.	.		0.438	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
MEGF10	84466	hgsc.bcm.edu	37	5	126758426	126758426	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:126758426C>T	ENST00000274473.6	+	14	1922	c.1655C>T	c.(1654-1656)cCt>cTt	p.P552L	MEGF10_ENST00000418761.2_Missense_Mutation_p.P552L|MEGF10_ENST00000503335.2_Missense_Mutation_p.P552L|MEGF10_ENST00000508365.1_Missense_Mutation_p.P552L	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	552	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GGCTGCCACCCTACCACGGGC	0.582																																					p.P552L		Atlas-SNP	.											.	MEGF10	152	.	0			c.C1655T						.						35.0	34.0	34.0					5																	126758426		2203	4300	6503	SO:0001583	missense	84466	exon14			GCCACCCTACCAC	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1655C>T	chr5.hg19:g.126758426C>T	ENSP00000274473:p.Pro552Leu	181.0	0.0		223.0	47.0	NM_032446	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	hg19	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108842	0.77096	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	5.28	5.28	0.74379	EGF-like, laminin (1);Epidermal growth factor-like, type 3 (1);	0.326765	0.28161	N	0.016371	D	0.87317	0.6147	M	0.91196	3.185	0.80722	D	1	P;D	0.57899	0.912;0.981	P;D	0.65773	0.662;0.938	D	0.89000	0.3421	10	0.54805	T	0.06	-2.0654	19.2744	0.94026	0.0:1.0:0.0:0.0	.	552;552	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	L	552	ENSP00000423354:P552L;ENSP00000423195:P552L;ENSP00000416284:P552L;ENSP00000274473:P552L	ENSP00000274473:P552L	P	+	2	0	MEGF10	126786325	0.934000	0.31675	0.998000	0.56505	0.985000	0.73830	3.183000	0.50918	2.636000	0.89361	0.650000	0.86243	CCT	.	.		0.582	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
SLC12A2	6558	hgsc.bcm.edu	37	5	127483379	127483379	+	Silent	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:127483379T>G	ENST00000262461.2	+	11	2028	c.1839T>G	c.(1837-1839)tcT>tcG	p.S613S	SLC12A2_ENST00000343225.4_Silent_p.S613S	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	613					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	CCACTCTTTCTTCAGCATTAG	0.328																																					p.S613S		Atlas-SNP	.											.	SLC12A2	119	.	0			c.T1839G						.						122.0	121.0	121.0					5																	127483379		2203	4296	6499	SO:0001819	synonymous_variant	6558	exon11			TCTTTCTTCAGCA		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1839T>G	chr5.hg19:g.127483379T>G		111.0	0.0		156.0	47.0	NM_001046	Q8N713|Q8WWH7	Silent	SNP	ENST00000262461.2	hg19	CCDS4144.1																																																																																			.	.		0.328	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
HSPA9	3313	hgsc.bcm.edu	37	5	137897301	137897301	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:137897301T>G	ENST00000297185.3	-	10	1275	c.1150A>C	c.(1150-1152)Att>Ctt	p.I384L	HSPA9_ENST00000501917.2_Intron|SNORD63_ENST00000384262.1_RNA|SNORD63_ENST00000411005.1_RNA	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	384					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCCACAAGAATCACTTCTCCT	0.483																																					p.I384L		Atlas-SNP	.											.	HSPA9	49	.	0			c.A1150C						.						127.0	104.0	112.0					5																	137897301		2203	4300	6503	SO:0001583	missense	3313	exon10			CAAGAATCACTTC	L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.1150A>C	chr5.hg19:g.137897301T>G	ENSP00000297185:p.Ile384Leu	104.0	0.0		125.0	32.0	NM_004134	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Missense_Mutation	SNP	ENST00000297185.3	hg19	CCDS4208.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.284501	0.23392	.	.	ENSG00000113013	ENST00000297185;ENST00000541333;ENST00000540484	T	0.01025	5.43	5.37	4.2	0.49525	Heat shock protein 70, conserved site (1);	0.112190	0.64402	D	0.000009	T	0.00724	0.0024	N	0.16833	0.445	0.41132	D	0.98589	B;B	0.02656	0.0;0.0	B;B	0.11329	0.003;0.006	T	0.58674	-0.7595	10	0.13853	T	0.58	-13.3409	8.4308	0.32757	0.0:0.1523:0.0:0.8477	.	315;384	B7Z1V7;P38646	.;GRP75_HUMAN	L	384;337;370	ENSP00000297185:I384L	ENSP00000297185:I384L	I	-	1	0	HSPA9	137925200	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.105000	0.41825	0.985000	0.38656	0.533000	0.62120	ATT	.	.		0.483	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1	NM_004134	
CPEB4	80315	hgsc.bcm.edu	37	5	173382953	173382953	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:173382953A>T	ENST00000265085.5	+	10	3457	c.2003A>T	c.(2002-2004)gAt>gTt	p.D668V	CPEB4_ENST00000517880.1_Missense_Mutation_p.D261V|CPEB4_ENST00000334035.5_Missense_Mutation_p.D651V|CPEB4_ENST00000519467.1_3'UTR|CPEB4_ENST00000520867.1_Missense_Mutation_p.D643V|CPEB4_ENST00000522336.1_Missense_Mutation_p.D278V	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	668					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAGCTGTGTGATGAATGTCAG	0.433																																					p.D668V		Atlas-SNP	.											.	CPEB4	54	.	0			c.A2003T						.						107.0	107.0	107.0					5																	173382953		2203	4300	6503	SO:0001583	missense	80315	exon10			TGTGTGATGAATG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.2003A>T	chr5.hg19:g.173382953A>T	ENSP00000265085:p.Asp668Val	90.0	0.0		93.0	24.0	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	hg19	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584464	0.65992	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000522336;ENST00000517880	T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.51686	0.1689	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.998;0.999;0.998	T	0.57412	-0.7816	10	0.87932	D	0	-23.7175	16.4288	0.83833	1.0:0.0:0.0:0.0	.	643;651;278;668	B7ZLQ8;Q17RY0-2;E5RFP2;Q17RY0	.;.;.;CPEB4_HUMAN	V	668;643;651;278;261	ENSP00000265085:D668V;ENSP00000429092:D643V;ENSP00000334533:D651V;ENSP00000430345:D278V;ENSP00000427990:D261V	ENSP00000265085:D668V	D	+	2	0	CPEB4	173315559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.284000	0.95882	2.282000	0.76494	0.533000	0.62120	GAT	.	.		0.433	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
HIST1H1T	3010	hgsc.bcm.edu	37	6	26108149	26108149	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr6:26108149C>T	ENST00000338379.4	-	1	215	c.173G>A	c.(172-174)cGa>cAa	p.R58Q		NM_005323.3	NP_005314.2	P22492	H1T_HUMAN	histone cluster 1, H1t	58	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				binding of sperm to zona pellucida (GO:0007339)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|nucleosome assembly (GO:0006334)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(1)|lung(3)|ovary(2)|prostate(1)	9						CATACCTACTCGTTCCTGTGA	0.532																																					p.R58Q		Atlas-SNP	.											.	HIST1H1T	40	.	0			c.G173A						.						128.0	109.0	116.0					6																	26108149		2203	4300	6503	SO:0001583	missense	3010	exon1			CCTACTCGTTCCT	M60094	CCDS34349.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000187475	ENSG00000187475		"""Histones / Replication-dependent"""	4720	protein-coding gene	gene with protein product		142712	"""H1 histone family, member T (testis-specific)"", ""histone 1, H1t"""	H1FT		8175896, 12408966	Standard	NM_005323		Approved	H1t	uc003ngj.3	P22492	OTTHUMG00000014430	ENST00000338379.4:c.173G>A	chr6.hg19:g.26108149C>T	ENSP00000341214:p.Arg58Gln	105.0	0.0		114.0	7.0	NM_005323	Q6ISI1|Q8IUE8	Missense_Mutation	SNP	ENST00000338379.4	hg19	CCDS34349.1	.	.	.	.	.	.	.	.	.	.	.	34	5.378140	0.95945	.	.	ENSG00000187475	ENST00000338379	T	0.33654	1.4	5.35	5.35	0.76521	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.130748	0.52532	D	0.000067	T	0.73233	0.3561	H	0.98646	4.29	0.51767	D	0.999934	D	0.89917	1.0	D	0.85130	0.997	D	0.83868	0.0272	10	0.87932	D	0	-9.4827	18.2308	0.89934	0.0:1.0:0.0:0.0	.	58	P22492	H1T_HUMAN	Q	58	ENSP00000341214:R58Q	ENSP00000341214:R58Q	R	-	2	0	HIST1H1T	26216128	0.997000	0.39634	0.012000	0.15200	0.008000	0.06430	5.917000	0.69989	2.780000	0.95670	0.655000	0.94253	CGA	.	.		0.532	HIST1H1T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040093.2	NM_005323	
VPS52	6293	hgsc.bcm.edu	37	6	33231842	33231842	+	Silent	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr6:33231842G>A	ENST00000445902.2	-	15	1781	c.1563C>T	c.(1561-1563)gtC>gtT	p.V521V	VPS52_ENST00000436044.2_Silent_p.V396V|VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000478934.1_5'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	521					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						GGTTGATACTGACAAGAGCGG	0.547																																					p.V521V		Atlas-SNP	.											.	VPS52	56	.	0			c.C1563T						.						158.0	149.0	152.0					6																	33231842		2203	4300	6503	SO:0001819	synonymous_variant	6293	exon15			GATACTGACAAGA	AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1563C>T	chr6.hg19:g.33231842G>A		72.0	0.0		97.0	12.0	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Silent	SNP	ENST00000445902.2	hg19	CCDS4770.2																																																																																			.	.		0.547	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
ZNF318	24149	hgsc.bcm.edu	37	6	43309850	43309850	+	Splice_Site	SNP	C	C	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr6:43309850C>G	ENST00000361428.2	-	8	3453	c.3376G>C	c.(3376-3378)Ggc>Cgc	p.G1126R	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1126					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GGAAACATACCTTTTGCAGGA	0.468																																					p.G1126R		Atlas-SNP	.											.	ZNF318	175	.	0			c.G3376C						.						211.0	159.0	177.0					6																	43309850		2203	4300	6503	SO:0001630	splice_region_variant	24149	exon8			ACATACCTTTTGC	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.3376+1G>C	chr6.hg19:g.43309850C>G		70.0	0.0		77.0	17.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	hg19	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463657	0.63513	.	.	ENSG00000171467	ENST00000361428	T	0.72505	-0.66	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.80813	0.4695	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80721	-0.1256	9	.	.	.	-12.1032	16.6605	0.85239	0.0:1.0:0.0:0.0	.	1126	Q5VUA4	ZN318_HUMAN	R	1126	ENSP00000354964:G1126R	.	G	-	1	0	ZNF318	43417828	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.019000	0.70818	2.596000	0.87737	0.563000	0.77884	GGC	.	.		0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	Missense_Mutation
MAP3K7	6885	hgsc.bcm.edu	37	6	91281491	91281491	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr6:91281491T>A	ENST00000369329.3	-	2	317	c.156A>T	c.(154-156)aaA>aaT	p.K52N	MAP3K7_ENST00000369327.3_Missense_Mutation_p.K52N|MAP3K7_ENST00000369332.3_Missense_Mutation_p.K52N|MAP3K7_ENST00000369325.3_Missense_Mutation_p.K52N	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	52	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TCCACTTAGCTTTGCAAACAA	0.343																																					p.K52N		Atlas-SNP	.											.	MAP3K7	100	.	0			c.A156T						.						128.0	120.0	123.0					6																	91281491		2203	4299	6502	SO:0001583	missense	6885	exon2			CTTAGCTTTGCAA	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.156A>T	chr6.hg19:g.91281491T>A	ENSP00000358335:p.Lys52Asn	81.0	0.0		95.0	17.0	NM_145333	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	hg19	CCDS5028.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928857	0.73327	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000450832	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.57	4.21	0.49690	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.080378	0.85682	D	0.000000	T	0.59756	0.2217	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.989;0.983;0.993;0.994	T	0.67401	-0.5680	10	0.87932	D	0	.	10.1804	0.42963	0.0:0.1225:0.0:0.8775	.	52;52;52;52	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	N	52	ENSP00000358338:K52N;ENSP00000358335:K52N;ENSP00000358331:K52N;ENSP00000358333:K52N	ENSP00000358331:K52N	K	-	3	2	MAP3K7	91338212	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.318000	0.33643	2.122000	0.65172	0.455000	0.32223	AAA	.	.		0.343	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	
UST	10090	hgsc.bcm.edu	37	6	149340294	149340294	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr6:149340294T>A	ENST00000367463.4	+	6	804	c.701T>A	c.(700-702)cTt>cAt	p.L234H		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	234					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		GAGTGTATTCTTGAAAACTAT	0.418																																					p.L234H		Atlas-SNP	.											.	UST	42	.	0			c.T701A						.						176.0	165.0	169.0					6																	149340294		2203	4300	6503	SO:0001583	missense	10090	exon6			GTATTCTTGAAAA	AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.701T>A	chr6.hg19:g.149340294T>A	ENSP00000356433:p.Leu234His	70.0	0.0		58.0	13.0	NM_005715	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	hg19	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450040	0.84101	.	.	ENSG00000111962	ENST00000367463	T	0.51325	0.71	5.95	5.95	0.96441	.	0.063973	0.64402	D	0.000005	T	0.59622	0.2207	M	0.72479	2.2	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.58853	-0.7563	10	0.36615	T	0.2	-20.3248	16.4237	0.83790	0.0:0.0:0.0:1.0	.	234	Q9Y2C2	UST_HUMAN	H	234	ENSP00000356433:L234H	ENSP00000356433:L234H	L	+	2	0	UST	149381987	1.000000	0.71417	0.988000	0.46212	0.958000	0.62258	8.015000	0.88690	2.279000	0.76181	0.533000	0.62120	CTT	.	.		0.418	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
AKAP12	9590	hgsc.bcm.edu	37	6	151673861	151673861	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr6:151673861G>T	ENST00000253332.1	+	3	4524	c.4335G>T	c.(4333-4335)gaG>gaT	p.E1445D	AKAP12_ENST00000354675.6_Missense_Mutation_p.E1347D|AKAP12_ENST00000402676.2_Missense_Mutation_p.E1445D|AKAP12_ENST00000359755.5_Missense_Mutation_p.E1340D			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1445					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AAACGTTGGAGCCTGCAGGTG	0.488																																					p.E1445D	Melanoma(141;1616 1805 10049 24534 51979)	Atlas-SNP	.											.	AKAP12	170	.	0			c.G4335T						.						85.0	89.0	88.0					6																	151673861		2203	4300	6503	SO:0001583	missense	9590	exon4			GTTGGAGCCTGCA	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.4335G>T	chr6.hg19:g.151673861G>T	ENSP00000253332:p.Glu1445Asp	113.0	0.0		106.0	5.0	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	ENST00000253332.1	hg19	CCDS5229.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714171	0.30413	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.15139	2.45;2.45;2.48;2.48	4.86	0.261	0.15592	.	0.503502	0.14876	N	0.293280	T	0.03220	0.0094	L	0.34521	1.04	0.09310	N	1	B;B;B	0.19706	0.013;0.037;0.038	B;B;B	0.18561	0.022;0.022;0.01	T	0.41680	-0.9495	10	0.33940	T	0.23	.	3.6095	0.08055	0.1507:0.0992:0.5608:0.1894	.	1340;1347;1445	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	D	1445;1445;1347;1340	ENSP00000384537:E1445D;ENSP00000253332:E1445D;ENSP00000346702:E1347D;ENSP00000352794:E1340D	ENSP00000253332:E1445D	E	+	3	2	AKAP12	151715554	0.000000	0.05858	0.016000	0.15963	0.116000	0.19942	0.310000	0.19356	0.102000	0.17638	0.650000	0.86243	GAG	.	.		0.488	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
DAGLB	221955	hgsc.bcm.edu	37	7	6476018	6476018	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr7:6476018C>T	ENST00000297056.6	-	3	563	c.394G>A	c.(394-396)Ggc>Agc	p.G132S	DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000428902.2_Intron|DAGLB_ENST00000479922.2_5'UTR|DAGLB_ENST00000425398.2_Missense_Mutation_p.G132S|DAGLB_ENST00000436575.1_Missense_Mutation_p.G91S	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	132					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GCGATGATGCCGTTTACAACT	0.522																																					p.G132S		Atlas-SNP	.											.	DAGLB	74	.	0			c.G394A						.						159.0	142.0	148.0					7																	6476018		2203	4300	6503	SO:0001583	missense	221955	exon3			TGATGCCGTTTAC	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.394G>A	chr7.hg19:g.6476018C>T	ENSP00000297056:p.Gly132Ser	158.0	0.0		180.0	25.0	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	hg19	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662530	0.47572	.	.	ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000436575;ENST00000471132;ENST00000432248	T;T;T	0.40756	1.04;1.02;1.03	5.87	5.87	0.94306	.	0.180091	0.47852	D	0.000220	T	0.39708	0.1088	L	0.54323	1.7	0.80722	D	1	P;P	0.52316	0.952;0.87	B;B	0.38655	0.278;0.084	T	0.20907	-1.0261	10	0.17832	T	0.49	-4.2775	20.5827	0.99408	0.0:1.0:0.0:0.0	.	132;132	B4DQU0;Q8NCG7	.;DGLB_HUMAN	S	132;132;91;132;132	ENSP00000297056:G132S;ENSP00000391171:G132S;ENSP00000404785:G91S	ENSP00000297056:G132S	G	-	1	0	DAGLB	6442543	1.000000	0.71417	0.962000	0.40283	0.051000	0.14879	6.986000	0.76200	2.941000	0.99782	0.655000	0.94253	GGC	.	.		0.522	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
ABCA13	154664	hgsc.bcm.edu	37	7	48626793	48626793	+	Missense_Mutation	SNP	C	C	T	rs563692415		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr7:48626793C>T	ENST00000435803.1	+	57	14573	c.14549C>T	c.(14548-14550)gCg>gTg	p.A4850V	ABCA13_ENST00000544596.1_Missense_Mutation_p.A580V	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4850	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAAGCCCACGCGGACAAACCT	0.557																																					p.A4850V		Atlas-SNP	.											ABCA13_ENST00000435803,rectum,carcinoma,+1,2	ABCA13	1192	.	0			c.C14549T						.						43.0	48.0	46.0					7																	48626793		2024	4188	6212	SO:0001583	missense	154664	exon57			CCCACGCGGACAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14549C>T	chr7.hg19:g.48626793C>T	ENSP00000411096:p.Ala4850Val	65.0	0.0		64.0	6.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	1.942	-0.443420	0.04604	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.94184	-3.37;-3.37;-3.37	5.71	-0.712	0.11226	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.760684	0.11485	N	0.559299	D	0.89174	0.6640	L	0.58428	1.81	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.76105	-0.3081	10	0.30854	T	0.27	.	7.0876	0.25266	0.1224:0.1475:0.0:0.7301	.	580;2552;4850	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	V	4850;623;580	ENSP00000411096:A4850V;ENSP00000391042:A623V;ENSP00000442634:A580V	ENSP00000391042:A623V	A	+	2	0	ABCA13	48597339	0.097000	0.21791	0.017000	0.16124	0.151000	0.21798	0.423000	0.21313	-0.283000	0.09115	-0.143000	0.13931	GCG	.	.		0.557	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
TAC1	6863	hgsc.bcm.edu	37	7	97363076	97363076	+	Silent	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr7:97363076C>A	ENST00000319273.5	+	3	462	c.165C>A	c.(163-165)atC>atA	p.I55I	TAC1_ENST00000350485.4_Silent_p.I55I|TAC1_ENST00000346867.4_Silent_p.I55I	NM_003182.2	NP_003173.1	P20366	TKN1_HUMAN	tachykinin, precursor 1	55					associative learning (GO:0008306)|cell-cell signaling (GO:0007267)|detection of abiotic stimulus (GO:0009582)|inflammatory response (GO:0006954)|insemination (GO:0007320)|long-term memory (GO:0007616)|negative regulation of heart rate (GO:0010459)|neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of blood pressure (GO:0008217)|response to hormone (GO:0009725)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)|tachykinin receptor signaling pathway (GO:0007217)	axon (GO:0030424)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				large_intestine(4)|lung(6)|urinary_tract(1)	11	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)					TGCAGAGAATCGCCCGGAGAC	0.592																																					p.I55I		Atlas-SNP	.											.	TAC1	21	.	0			c.C165A						.						97.0	88.0	91.0					7																	97363076		2203	4300	6503	SO:0001819	synonymous_variant	6863	exon3			GAGAATCGCCCGG	M68907	CCDS5649.1, CCDS5650.1, CCDS5651.1	7q21-q22	2013-02-26	2008-01-17		ENSG00000006128	ENSG00000006128		"""Endogenous ligands"""	11517	protein-coding gene	gene with protein product	"""substance K"", ""substance P"", ""neurokinin 1"", ""neurokinin 2"", ""neuromedin L"", ""neurokinin alpha"", ""neuropeptide K"", ""neuropeptide gamma"", ""preprotachykinin"""	162320	"""tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuromedin L, neurokinin alpha, neuropeptide K, neuropeptide gamma)"""	TAC2, NKNA		1708336	Standard	NM_003182		Approved	NPK	uc003uop.4	P20366	OTTHUMG00000154069	ENST00000319273.5:c.165C>A	chr7.hg19:g.97363076C>A		121.0	0.0		142.0	25.0	NM_003182	O60600|O60601|Q00072|Q53GH4|Q549V0|Q549V1|Q549V2|Q6FHM1	Silent	SNP	ENST00000319273.5	hg19	CCDS5649.1																																																																																			.	.		0.592	TAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333696.1	NM_003182	
ASNS	440	hgsc.bcm.edu	37	7	97482512	97482512	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr7:97482512G>A	ENST00000394309.3	-	12	1807	c.1336C>T	c.(1336-1338)Cat>Tat	p.H446Y	ASNS_ENST00000394308.3_Missense_Mutation_p.H446Y|ASNS_ENST00000444334.1_Missense_Mutation_p.H425Y|ASNS_ENST00000437628.1_Missense_Mutation_p.H363Y|ASNS_ENST00000455086.1_Missense_Mutation_p.H363Y|ASNS_ENST00000422745.1_Missense_Mutation_p.H425Y|ASNS_ENST00000175506.4_Missense_Mutation_p.H446Y	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	446	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CTCAGGAGATGTTTTTCTATC	0.378																																					p.H446Y	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Atlas-SNP	.											.	ASNS	97	.	0			c.C1336T						.						53.0	51.0	52.0					7																	97482512		2199	4298	6497	SO:0001583	missense	440	exon12			GGAGATGTTTTTC	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1336C>T	chr7.hg19:g.97482512G>A	ENSP00000377846:p.His446Tyr	91.0	0.0		74.0	14.0	NM_133436	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	hg19	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	G	0.524	-0.860980	0.02610	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08	3.63	2.74	0.32292	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.273854	0.41823	D	0.000804	T	0.14743	0.0356	N	0.03016	-0.435	0.40279	D	0.978379	B	0.06786	0.001	B	0.12156	0.007	T	0.07888	-1.0749	10	0.09590	T	0.72	-24.2124	6.02	0.19625	0.2296:0.0:0.7704:0.0	.	446	P08243	ASNS_HUMAN	Y	446;446;363;446;425;363;425	ENSP00000175506:H446Y;ENSP00000377846:H446Y;ENSP00000414379:H363Y;ENSP00000377845:H446Y;ENSP00000414901:H425Y;ENSP00000408472:H363Y;ENSP00000406994:H425Y	ENSP00000175506:H446Y	H	-	1	0	ASNS	97320448	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.381000	0.52455	1.100000	0.41517	0.561000	0.74099	CAT	.	.		0.378	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
TRRAP	8295	hgsc.bcm.edu	37	7	98529221	98529221	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr7:98529221A>G	ENST00000359863.4	+	26	3994	c.3785A>G	c.(3784-3786)cAt>cGt	p.H1262R	TRRAP_ENST00000355540.3_Missense_Mutation_p.H1262R|TRRAP_ENST00000446306.3_Missense_Mutation_p.H1261R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1262					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CAGGCCATGCATTCGCTGCAG	0.527																																					p.H1262R		Atlas-SNP	.											.	TRRAP	863	.	0			c.A3785G						.						91.0	79.0	83.0					7																	98529221		2203	4300	6503	SO:0001583	missense	8295	exon26			CCATGCATTCGCT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3785A>G	chr7.hg19:g.98529221A>G	ENSP00000352925:p.His1262Arg	150.0	0.0		160.0	22.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	hg19	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.16|13.16	2.155382|2.155382	0.38021|0.38021	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.63744|.	3.64;-0.06|.	6.06|6.06	6.06|6.06	0.98353|0.98353	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56775|0.56775	0.2008|0.2008	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P;B;P|.	0.39311|.	0.667;0.055;0.596|.	B;B;B|.	0.37989|.	0.262;0.022;0.177|.	T|T	0.52555|0.52555	-0.8560|-0.8560	10|5	0.15499|.	T|.	0.54|.	.|.	16.6127|16.6127	0.84892|0.84892	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1262;976;1262|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	R|V	1262;1262;1260|977	ENSP00000352925:H1262R;ENSP00000347733:H1262R|.	ENSP00000347733:H1262R|.	H|I	+|+	2|1	0|0	TRRAP|TRRAP	98367157|98367157	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.992000|0.992000	0.81027|0.81027	8.958000|8.958000	0.93099|0.93099	2.322000|2.322000	0.78497|0.78497	0.528000|0.528000	0.53228|0.53228	CAT|ATT	.	.		0.527	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
PLXNA4	91584	hgsc.bcm.edu	37	7	131895838	131895838	+	Missense_Mutation	SNP	G	G	A	rs377154325		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr7:131895838G>A	ENST00000359827.3	-	10	3124	c.2162C>T	c.(2161-2163)aCg>aTg	p.T721M	PLXNA4_ENST00000321063.4_Missense_Mutation_p.T721M			Q9HCM2	PLXA4_HUMAN	plexin A4	721					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGCCTTCAGCGTGATAGGCTT	0.652																																					p.T721M		Atlas-SNP	.											PLXNA4_ENST00000359827,right_upper_lobe,carcinoma,0,2	PLXNA4	873	.	0			c.C2162T						.						31.0	35.0	34.0					7																	131895838		2147	4271	6418	SO:0001583	missense	91584	exon10			TTCAGCGTGATAG	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2162C>T	chr7.hg19:g.131895838G>A	ENSP00000352882:p.Thr721Met	60.0	0.0		61.0	6.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005611	0.93287	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.01059	5.39;5.39	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.00603	-1.1649	10	0.59425	D	0.04	.	19.7362	0.96205	0.0:0.0:1.0:0.0	.	721	Q9HCM2	PLXA4_HUMAN	M	721	ENSP00000323194:T721M;ENSP00000352882:T721M	ENSP00000323194:T721M	T	-	2	0	PLXNA4	131546378	1.000000	0.71417	0.974000	0.42286	0.986000	0.74619	9.796000	0.99103	2.661000	0.90470	0.655000	0.94253	ACG	.	.		0.652	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
GPR124	25960	hgsc.bcm.edu	37	8	37697733	37697733	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr8:37697733C>A	ENST00000412232.2	+	17	2619	c.2606C>A	c.(2605-2607)cCc>cAc	p.P869H	GPR124_ENST00000315215.7_Missense_Mutation_p.P652H	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	869					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGGAGGGCACCCCCTCCGCAA	0.607																																					p.P869H		Atlas-SNP	.											.	GPR124	85	.	0			c.C2606A						.						71.0	61.0	64.0					8																	37697733		2203	4300	6503	SO:0001583	missense	25960	exon17			GGGCACCCCCTCC	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2606C>A	chr8.hg19:g.37697733C>A	ENSP00000406367:p.Pro869His	35.0	0.0		39.0	6.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	hg19	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	16.06	3.015195	0.54468	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.60299	0.2;0.41	3.91	3.91	0.45181	GPCR, family 2-like (1);	0.128231	0.53938	D	0.000054	T	0.69387	0.3105	L	0.58810	1.83	0.48135	D	0.999591	D;D	0.89917	0.999;1.0	D;D	0.77004	0.948;0.989	T	0.69921	-0.5014	10	0.48119	T	0.1	-32.445	11.7443	0.51811	0.1762:0.8238:0.0:0.0	.	652;869	Q96PE1-2;Q96PE1	.;GP124_HUMAN	H	862;652;869	ENSP00000323508:P652H;ENSP00000406367:P869H	ENSP00000323508:P652H	P	+	2	0	GPR124	37816891	0.997000	0.39634	0.932000	0.37286	0.311000	0.27955	3.688000	0.54699	2.188000	0.69820	0.650000	0.86243	CCC	.	.		0.607	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
SPIDR	23514	hgsc.bcm.edu	37	8	48647955	48647955	+	Silent	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr8:48647955C>T	ENST00000297423.4	+	20	3075	c.2691C>T	c.(2689-2691)tgC>tgT	p.C897C	SPIDR_ENST00000518060.1_3'UTR|SPIDR_ENST00000518074.1_Missense_Mutation_p.H838Y|SPIDR_ENST00000517693.1_Silent_p.C372C|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Silent_p.C827C	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	897					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											CGACCAGCTGCATTGGATTGG	0.522																																					p.C897C		Atlas-SNP	.											.	KIAA0146	64	.	0			c.C2691T						.						114.0	123.0	120.0					8																	48647955		1974	4150	6124	SO:0001819	synonymous_variant	23514	exon20			CAGCTGCATTGGA	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.2691C>T	chr8.hg19:g.48647955C>T		158.0	0.0		172.0	26.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Silent	SNP	ENST00000297423.4	hg19	CCDS43737.1	.	.	.	.	.	.	.	.	.	.	C	4.216	0.038919	0.08148	.	.	ENSG00000164808	ENST00000518074	.	.	.	5.73	3.91	0.45181	.	.	.	.	.	T	0.53642	0.1809	.	.	.	0.80722	D	1	D	0.54964	0.969	P	0.51016	0.656	T	0.54234	-0.8324	7	0.56958	D	0.05	.	4.0397	0.09745	0.1658:0.5675:0.0:0.2667	.	838	B4E0Y6	.	Y	838	.	ENSP00000429487:H838Y	H	+	1	0	KIAA0146	48810508	0.002000	0.14202	0.220000	0.23810	0.103000	0.19146	-0.027000	0.12371	0.744000	0.32741	0.511000	0.50034	CAT	.	.		0.522	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
GDAP1	54332	hgsc.bcm.edu	37	8	75274140	75274140	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr8:75274140C>T	ENST00000220822.7	+	4	586	c.506C>T	c.(505-507)tCt>tTt	p.S169F	GDAP1_ENST00000434412.2_Missense_Mutation_p.S101F|GDAP1_ENST00000521096.1_3'UTR	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	169	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			AACACAGAGTCTGAGCTGAAG	0.373																																					p.S169F		Atlas-SNP	.											.	GDAP1	36	.	0			c.C506T						.						108.0	102.0	104.0					8																	75274140		2203	4300	6503	SO:0001583	missense	54332	exon4			CAGAGTCTGAGCT		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.506C>T	chr8.hg19:g.75274140C>T	ENSP00000220822:p.Ser169Phe	93.0	0.0		101.0	10.0	NM_018972	A8K957|E7FJF3|E7FJF4	Missense_Mutation	SNP	ENST00000220822.7	hg19	CCDS34911.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705255	0.89018	.	.	ENSG00000104381	ENST00000220822;ENST00000434412	D;D	0.99113	-5.44;-5.44	5.27	5.27	0.74061	Glutathione S-transferase/chloride channel, C-terminal (1);	0.126959	0.53938	D	0.000042	D	0.97920	0.9316	L	0.29908	0.895	0.58432	D	0.999995	P	0.50819	0.939	P	0.49421	0.61	D	0.98956	1.0796	10	0.72032	D	0.01	-20.1664	19.0885	0.93215	0.0:1.0:0.0:0.0	.	169	Q8TB36	GDAP1_HUMAN	F	169;101	ENSP00000220822:S169F;ENSP00000417006:S101F	ENSP00000220822:S169F	S	+	2	0	GDAP1	75436695	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.958000	0.76025	2.758000	0.94735	0.561000	0.74099	TCT	.	.		0.373	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
MATN2	4147	hgsc.bcm.edu	37	8	98900398	98900398	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr8:98900398A>G	ENST00000520016.1	+	1	194	c.70A>G	c.(70-72)Agg>Ggg	p.R24G	MATN2_ENST00000521689.1_Missense_Mutation_p.R24G|MATN2_ENST00000254898.5_Missense_Mutation_p.R24G|MATN2_ENST00000522025.2_Intron|MATN2_ENST00000524308.1_Missense_Mutation_p.R24G			O00339	MATN2_HUMAN	matrilin 2	24						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGCCGAGGCCAGGGAGCGGTC	0.622																																					p.R24G		Atlas-SNP	.											.	MATN2	165	.	0			c.A70G						.						33.0	34.0	34.0					8																	98900398		1969	4169	6138	SO:0001583	missense	4147	exon2			GAGGCCAGGGAGC	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.70A>G	chr8.hg19:g.98900398A>G	ENSP00000430487:p.Arg24Gly	45.0	0.0		37.0	8.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	hg19	CCDS55264.1	.	.	.	.	.	.	.	.	.	.	A	8.106	0.777825	0.16120	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000520016	D;T;D;T	0.83250	-1.68;-0.83;-1.7;-0.8	5.02	1.07	0.20283	.	0.000000	0.47093	D	0.000260	T	0.66761	0.2822	N	0.24115	0.695	0.23215	N	0.998105	B;B;B	0.27498	0.003;0.001;0.18	B;B;B	0.21917	0.002;0.001;0.037	T	0.57963	-0.7720	10	0.72032	D	0.01	-9.9689	4.9832	0.14176	0.503:0.1701:0.0:0.3269	.	24;24;24	O00339-2;O00339;Q8N2G3	.;MATN2_HUMAN;.	G	24	ENSP00000429977:R24G;ENSP00000254898:R24G;ENSP00000430221:R24G;ENSP00000430487:R24G	ENSP00000254898:R24G	R	+	1	2	MATN2	98969574	1.000000	0.71417	0.113000	0.21522	0.012000	0.07955	0.985000	0.29578	0.027000	0.15297	-0.333000	0.08304	AGG	.	.		0.622	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
STKLD1	169436	hgsc.bcm.edu	37	9	136245946	136245946	+	Silent	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr9:136245946C>T	ENST00000371957.3	+	2	234	c.127C>T	c.(127-129)Ctg>Ttg	p.L43L	SURF4_ENST00000485435.2_5'Flank|C9orf96_ENST00000468046.1_3'UTR|C9orf96_ENST00000426926.2_Silent_p.L43L|SURF4_ENST00000371989.3_5'Flank|C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		43	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGGGGTGAACCTGGTGGTGGA	0.493																																					p.L43L		Atlas-SNP	.											.	C9orf96	77	.	0			c.C127T						.						114.0	98.0	103.0					9																	136245946		2203	4300	6503	SO:0001819	synonymous_variant	169436	exon2			GTGAACCTGGTGG																												ENST00000371957.3:c.127C>T	chr9.hg19:g.136245946C>T		113.0	0.0		124.0	26.0	NM_153710	Q5T8U8|Q6ZMP6|Q6ZMQ5	Silent	SNP	ENST00000371957.3	hg19	CCDS35169.1																																																																																			.	.		0.493	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		
CDK1	983	hgsc.bcm.edu	37	10	62551796	62551796	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr10:62551796T>C	ENST00000395284.3	+	6	780	c.638T>C	c.(637-639)cTc>cCc	p.L213P	CDK1_ENST00000448257.2_Missense_Mutation_p.L213P|CDK1_ENST00000316629.4_Missense_Mutation_p.L156P|CDK1_ENST00000373809.2_Missense_Mutation_p.L156P	NM_001786.4	NP_001777.1	P06493	CDK1_HUMAN	cyclin-dependent kinase 1	213	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell aging (GO:0007569)|cell migration (GO:0016477)|cellular response to hydrogen peroxide (GO:0070301)|centrosome cycle (GO:0007098)|chromosome condensation (GO:0030261)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|pronuclear fusion (GO:0007344)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|Ras protein signal transduction (GO:0007265)|regulation of embryonic development (GO:0045995)|regulation of Schwann cell differentiation (GO:0014038)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to activity (GO:0014823)|response to amine (GO:0014075)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organic cyclic compound (GO:0014070)|response to toxic substance (GO:0009636)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|histone kinase activity (GO:0035173)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			ovary(1)	1						ATTGATCAACTCTTCAGGATT	0.323																																					p.L213P		Atlas-SNP	.											.	CDK1	24	.	0			c.T638C						.						72.0	73.0	73.0					10																	62551796		2203	4299	6502	SO:0001583	missense	983	exon6			ATCAACTCTTCAG	BC014563	CCDS7260.1, CCDS44408.1	10q21.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000170312	ENSG00000170312		"""Cyclin-dependent kinases"""	1722	protein-coding gene	gene with protein product		116940	"""cell division cycle 2, G1 to S and G2 to M"""	CDC2		3553962, 19884882	Standard	NM_001786		Approved	CDC28A	uc001jld.3	P06493	OTTHUMG00000018290	ENST00000395284.3:c.638T>C	chr10.hg19:g.62551796T>C	ENSP00000378699:p.Leu213Pro	156.0	0.0		176.0	14.0	NM_001786	A8K7C4|C9J497|O60764	Missense_Mutation	SNP	ENST00000395284.3	hg19	CCDS44408.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.874754	0.72180	.	.	ENSG00000170312	ENST00000395284;ENST00000316629;ENST00000448257;ENST00000373809	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80048	0.4552	M	0.94063	3.49	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.985;1.0;0.995	D	0.85517	0.1201	10	0.87932	D	0	-17.9858	16.1708	0.81812	0.0:0.0:0.0:1.0	.	156;219;213	P06493-2;Q5H9N4;P06493	.;.;CDK1_HUMAN	P	213;156;213;156	ENSP00000378699:L213P;ENSP00000325970:L156P;ENSP00000397973:L213P;ENSP00000362915:L156P	ENSP00000325970:L156P	L	+	2	0	CDK1	62221802	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.953000	0.87836	2.225000	0.72522	0.533000	0.62120	CTC	.	.		0.323	CDK1-007	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048211.2	NM_001786	
HERC4	26091	hgsc.bcm.edu	37	10	69748547	69748547	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr10:69748547A>G	ENST00000395198.3	-	15	1926	c.1679T>C	c.(1678-1680)gTa>gCa	p.V560A	HERC4_ENST00000277817.6_Missense_Mutation_p.V450A|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000373700.4_Missense_Mutation_p.V560A|HERC4_ENST00000412272.2_Missense_Mutation_p.V560A	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	560					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						AAAAAGTTCTACTATCTTGAG	0.318																																					p.V560A		Atlas-SNP	.											.	HERC4	78	.	0			c.T1679C						.						109.0	119.0	116.0					10																	69748547		2202	4294	6496	SO:0001583	missense	26091	exon15			AGTTCTACTATCT	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1679T>C	chr10.hg19:g.69748547A>G	ENSP00000378624:p.Val560Ala	332.0	0.0		363.0	52.0	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	hg19	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.857521	0.51376	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.56444	0.69;0.47;0.46;0.46	5.49	5.49	0.81192	.	0.053101	0.85682	D	0.000000	T	0.54127	0.1839	L	0.56199	1.76	0.80722	D	1	B;B;B;B;B;B	0.30563	0.285;0.245;0.002;0.159;0.245;0.159	B;B;B;B;B;B	0.36335	0.122;0.222;0.008;0.111;0.222;0.111	T	0.56986	-0.7888	10	0.62326	D	0.03	.	15.5826	0.76455	1.0:0.0:0.0:0.0	.	560;450;560;410;560;560	Q5GLZ8-3;Q5GLZ8-6;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;.;HERC4_HUMAN	A	450;560;560;560	ENSP00000277817:V450A;ENSP00000416504:V560A;ENSP00000378624:V560A;ENSP00000362804:V560A	ENSP00000277817:V450A	V	-	2	0	HERC4	69418553	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.619000	0.74219	2.073000	0.62155	0.533000	0.62120	GTA	.	.		0.318	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
CDH23	64072	hgsc.bcm.edu	37	10	73563052	73563052	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr10:73563052G>T	ENST00000224721.6	+	54	7767	c.7762G>T	c.(7762-7764)Gcc>Tcc	p.A2588S	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.A343S	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2583	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.		E -> Q (in dbSNP:rs41281338). {ECO:0000269|PubMed:11138009, ECO:0000269|PubMed:12075507, ECO:0000269|PubMed:18429043}.		calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GACCGTGGTGGCCACAGATGG	0.617																																					p.A2583S		Atlas-SNP	.											.	CDH23	365	.	0			c.G7747T						.						26.0	31.0	29.0					10																	73563052		2048	4180	6228	SO:0001583	missense	64072	exon53			GTGGTGGCCACAG	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7762G>T	chr10.hg19:g.73563052G>T	ENSP00000224721:p.Ala2588Ser	82.0	0.0		83.0	9.0	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	hg19		.	.	.	.	.	.	.	.	.	.	G	17.80	3.479062	0.63849	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.75477	-0.94	5.02	3.16	0.36331	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.89143	0.6631	H	0.96142	3.775	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.79108	0.983;0.992	D	0.89925	0.4062	10	0.62326	D	0.03	.	11.2263	0.48886	0.1498:0.0:0.8502:0.0	.	2583;2583	E9PEX1;Q9H251	.;CAD23_HUMAN	S	2588;2583;2586;343	ENSP00000381768:A343S	ENSP00000224721:A2588S	A	+	1	0	CDH23	73233058	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	9.739000	0.98837	0.632000	0.30432	-0.269000	0.10298	GCC	.	.		0.617	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
CFAP58	159686	hgsc.bcm.edu	37	10	106128252	106128252	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr10:106128252T>G	ENST00000369704.3	+	6	998	c.864T>G	c.(862-864)aaT>aaG	p.N288K	CCDC147_ENST00000312902.5_De_novo_Start_OutOfFrame	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		288						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AGCAAGAGAATGAACAGCACA	0.438																																					p.N288K		Atlas-SNP	.											.	CCDC147	137	.	0			c.T864G						.						118.0	106.0	110.0					10																	106128252		2203	4300	6503	SO:0001583	missense	159686	exon6			AGAGAATGAACAG																												ENST00000369704.3:c.864T>G	chr10.hg19:g.106128252T>G	ENSP00000358718:p.Asn288Lys	99.0	0.0		141.0	18.0	NM_001008723	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	hg19	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	T	9.881	1.201489	0.22121	.	.	ENSG00000120051	ENST00000369704	T	0.33654	1.4	6.17	-6.95	0.01628	.	0.284681	0.44285	D	0.000468	T	0.30262	0.0759	L	0.51422	1.61	0.80722	D	1	B	0.33583	0.418	B	0.35655	0.207	T	0.05550	-1.0878	10	0.34782	T	0.22	-28.6057	18.5683	0.91124	0.0:0.1865:0.0:0.8135	.	288	Q5T655	CC147_HUMAN	K	288	ENSP00000358718:N288K	ENSP00000358718:N288K	N	+	3	2	CCDC147	106118242	0.010000	0.17322	0.734000	0.30879	0.341000	0.28922	-1.361000	0.02597	-1.265000	0.02449	-0.912000	0.02778	AAT	.	.		0.438	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
TACC2	10579	hgsc.bcm.edu	37	10	123970808	123970808	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr10:123970808G>T	ENST00000369005.1	+	9	7208	c.6868G>T	c.(6868-6870)Ggc>Tgc	p.G2290C	TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000334433.3_Missense_Mutation_p.G2290C|TACC2_ENST00000360561.3_Missense_Mutation_p.G368C|TACC2_ENST00000368999.1_Missense_Mutation_p.G368C|TACC2_ENST00000513429.1_Missense_Mutation_p.G436C|TACC2_ENST00000260733.3_Missense_Mutation_p.G368C|TACC2_ENST00000515273.1_Missense_Mutation_p.G2294C|TACC2_ENST00000453444.2_Missense_Mutation_p.G2294C|TACC2_ENST00000369004.3_Missense_Mutation_p.G368C|TACC2_ENST00000515603.1_Missense_Mutation_p.G2245C|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000358010.1_Missense_Mutation_p.G436C	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2290					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CAAAAAGATAGGCAAAAAGCC	0.517																																					p.G2290C		Atlas-SNP	.											.	TACC2	271	.	0			c.G6868T						.						53.0	61.0	58.0					10																	123970808		2203	4300	6503	SO:0001583	missense	10579	exon9			AAGATAGGCAAAA	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6868G>T	chr10.hg19:g.123970808G>T	ENSP00000358001:p.Gly2290Cys	199.0	0.0		222.0	32.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	hg19	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132741	0.77662	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539;ENST00000496913	T;T;T;T;T;T;T;T;T;T;T;T;T	0.39056	2.45;2.05;2.59;2.52;2.45;2.05;2.59;1.89;1.9;1.87;1.9;1.73;1.1	5.12	5.12	0.69794	.	0.000000	0.37623	N	0.002017	T	0.68311	0.2987	M	0.82056	2.57	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.72437	-0.4294	10	0.66056	D	0.02	-13.2516	18.9406	0.92604	0.0:0.0:1.0:0.0	.	385;2294;368;2245;2294;368;368;436;2290	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	C	2290;436;2294;2245;2290;436;2294;2280;368;368;368;368;385;29	ENSP00000358001:G2290C;ENSP00000425062:G436C;ENSP00000424467:G2294C;ENSP00000427618:G2245C;ENSP00000334280:G2290C;ENSP00000350701:G436C;ENSP00000395048:G2294C;ENSP00000353763:G368C;ENSP00000357995:G368C;ENSP00000422815:G368C;ENSP00000260733:G368C;ENSP00000420967:G385C;ENSP00000422725:G29C	ENSP00000260733:G368C	G	+	1	0	TACC2	123960798	1.000000	0.71417	0.986000	0.45419	0.896000	0.52359	9.632000	0.98428	2.557000	0.86248	0.555000	0.69702	GGC	.	.		0.517	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
CDHR5	53841	hgsc.bcm.edu	37	11	618860	618860	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr11:618860T>C	ENST00000358353.3	-	14	2021	c.1699A>G	c.(1699-1701)Agt>Ggt	p.S567G	CDHR5_ENST00000349570.7_Intron|IRF7_ENST00000397562.3_5'Flank|CDHR5_ENST00000397542.2_Missense_Mutation_p.S567G|IRF7_ENST00000397570.1_5'Flank|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397574.2_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	567	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						GTGCCCCCACTGGGTGTGGCT	0.672																																					p.S567G		Atlas-SNP	.											.	CDHR5	77	.	0			c.A1699G						.																																			SO:0001583	missense	53841	exon13			CCCCACTGGGTGT	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1699A>G	chr11.hg19:g.618860T>C	ENSP00000351118:p.Ser567Gly	116.0	0.0		166.0	8.0	NM_021924	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	hg19	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	C	3.103	-0.184385	0.06340	.	.	ENSG00000099834	ENST00000397542;ENST00000358353	T;T	0.50277	0.75;0.75	2.59	-2.0	0.07433	.	.	.	.	.	T	0.18383	0.0441	N	0.02916	-0.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30327	-0.9982	9	0.07990	T	0.79	.	9.3241	0.37982	0.0:0.2294:0.0:0.7706	.	561;567	Q9HBB8-4;Q9HBB8	.;CDHR5_HUMAN	G	567	ENSP00000380676:S567G;ENSP00000351118:S567G	ENSP00000351118:S567G	S	-	1	0	CDHR5	608860	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.029000	0.03585	-0.744000	0.04778	-0.222000	0.12452	AGT	.	.		0.672	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
RSF1	51773	hgsc.bcm.edu	37	11	77409660	77409660	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr11:77409660C>T	ENST00000308488.6	-	7	2889	c.2587G>A	c.(2587-2589)Gaa>Aaa	p.E863K	RSF1_ENST00000480887.1_Missense_Mutation_p.E611K|RSF1_ENST00000360355.2_Missense_Mutation_p.E832K			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	863					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.E863*(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CCAGACCCTTCACTTTCATCA	0.403																																					p.E863K		Atlas-SNP	.											RSF1,NS,carcinoma,0,1	RSF1	105	.	1	Substitution - Nonsense(1)	lung(1)	c.G2587A						.						162.0	153.0	156.0					11																	77409660		2200	4292	6492	SO:0001583	missense	51773	exon7			ACCCTTCACTTTC	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.2587G>A	chr11.hg19:g.77409660C>T	ENSP00000311513:p.Glu863Lys	127.0	0.0		127.0	22.0	NM_016578	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	hg19	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	C	32	5.135599	0.94517	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000526324	D;D;D;D	0.86497	-2.12;-2.13;-2.13;-2.07	4.68	4.68	0.58851	Zinc finger, FYVE/PHD-type (1);	0.000000	0.52532	D	0.000077	T	0.82111	0.4966	L	0.29908	0.895	0.51482	D	0.999926	P	0.43094	0.799	B	0.40066	0.318	D	0.84601	0.0672	10	0.54805	T	0.06	-12.7817	17.7579	0.88455	0.0:1.0:0.0:0.0	.	863	Q96T23	RSF1_HUMAN	K	863;611;832;664	ENSP00000311513:E863K;ENSP00000434509:E611K;ENSP00000353511:E832K;ENSP00000432022:E664K	ENSP00000311513:E863K	E	-	1	0	RSF1	77087308	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.929000	0.63455	2.580000	0.87095	0.591000	0.81541	GAA	.	.		0.403	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
BCL9L	283149	hgsc.bcm.edu	37	11	118771950	118771950	+	Silent	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr11:118771950C>T	ENST00000334801.3	-	6	3466	c.2502G>A	c.(2500-2502)aaG>aaA	p.K834K	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	834	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GCATCAGCATCTTCTGCGGGC	0.647																																					p.K834K		Atlas-SNP	.											.	BCL9L	254	.	0			c.G2502A						.						72.0	70.0	70.0					11																	118771950		2200	4295	6495	SO:0001819	synonymous_variant	283149	exon6			CAGCATCTTCTGC	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2502G>A	chr11.hg19:g.118771950C>T		47.0	0.0		55.0	14.0	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	hg19	CCDS8403.1																																																																																			.	.		0.647	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
ARHGEF12	23365	hgsc.bcm.edu	37	11	120318992	120318992	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr11:120318992A>C	ENST00000397843.2	+	20	1838	c.1672A>C	c.(1672-1674)Aaa>Caa	p.K558Q	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.K539Q|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.K455Q	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	558	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTTGGGAGTAAAAGTGAAAGA	0.418			T	MLL	AML																																p.K558Q		Atlas-SNP	.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	133	.	0			c.A1672C						.						93.0	91.0	92.0					11																	120318992		1860	4087	5947	SO:0001583	missense	23365	exon20			GGAGTAAAAGTGA	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1672A>C	chr11.hg19:g.120318992A>C	ENSP00000380942:p.Lys558Gln	91.0	0.0		108.0	19.0	NM_015313	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	hg19	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.486866	0.84854	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.83673	-1.75;-1.75;-1.75	5.28	5.28	0.74379	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.123853	0.36134	N	0.002761	D	0.88040	0.6330	M	0.71581	2.175	0.33793	D	0.625737	P;P;D	0.53885	0.909;0.954;0.963	P;P;P	0.55260	0.745;0.662;0.772	D	0.92849	0.6295	10	0.72032	D	0.01	-19.2225	15.213	0.73241	1.0:0.0:0.0:0.0	.	455;539;558	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	Q	558;539;455	ENSP00000380942:K558Q;ENSP00000349056:K539Q;ENSP00000432984:K455Q	ENSP00000349056:K539Q	K	+	1	0	ARHGEF12	119824202	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.940000	0.75917	1.995000	0.58328	0.477000	0.44152	AAA	.	.		0.418	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
SNX19	399979	hgsc.bcm.edu	37	11	130785826	130785826	+	Silent	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr11:130785826T>C	ENST00000265909.4	-	1	578	c.9A>G	c.(7-9)acA>acG	p.T3T	SNX19_ENST00000539184.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000530356.1_Intron|SNX19_ENST00000533214.1_Silent_p.T3T|SNX19_ENST00000533318.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	3					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		GCACTGTTTCTGTCTTCATGG	0.522																																					p.T3T		Atlas-SNP	.											.	SNX19	84	.	0			c.A9G						.						47.0	42.0	44.0					11																	130785826		2201	4297	6498	SO:0001819	synonymous_variant	399979	exon1			TGTTTCTGTCTTC	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.9A>G	chr11.hg19:g.130785826T>C		65.0	0.0		56.0	12.0	NM_014758	E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	hg19	CCDS31721.1																																																																																			.	.		0.522	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
NOP2	4839	hgsc.bcm.edu	37	12	6669440	6669440	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr12:6669440C>A	ENST00000322166.5	-	15	1734	c.1613G>T	c.(1612-1614)cGa>cTa	p.R538L	NOP2_ENST00000399466.2_Missense_Mutation_p.R534L|NOP2_ENST00000537442.1_Missense_Mutation_p.R538L|NOP2_ENST00000382421.3_Missense_Mutation_p.R571L|NOP2_ENST00000545200.1_Missense_Mutation_p.R534L|NOP2_ENST00000542015.1_5'UTR|NOP2_ENST00000541778.1_Missense_Mutation_p.R534L	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	538					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						GGGCACCAGTCGCACATTCCT	0.542																																					p.R571L		Atlas-SNP	.											.	NOP2	44	.	0			c.G1712T						.						69.0	71.0	70.0					12																	6669440		1931	4140	6071	SO:0001583	missense	4839	exon16			ACCAGTCGCACAT		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.1613G>T	chr12.hg19:g.6669440C>A	ENSP00000313272:p.Arg538Leu	83.0	0.0		83.0	14.0	NM_001258309	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	hg19	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510252	0.85282	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778	T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88	4.95	4.95	0.65309	.	0.122440	0.56097	D	0.000027	T	0.39784	0.1091	L	0.41961	1.31	0.80722	D	1	D;P	0.65815	0.995;0.943	D;P	0.66497	0.944;0.493	T	0.14727	-1.0462	10	0.87932	D	0	-23.2785	11.8077	0.52165	0.0:0.9199:0.0:0.0801	.	534;534	Q05BA7;P46087-2	.;.	L	538;571;534;534;538;534	ENSP00000444437:R538L;ENSP00000371858:R571L;ENSP00000439422:R534L;ENSP00000382392:R534L;ENSP00000313272:R538L;ENSP00000443150:R534L	ENSP00000313272:R538L	R	-	2	0	NOP2	6539701	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.767000	0.68850	2.569000	0.86673	0.655000	0.94253	CGA	.	.		0.542	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170	
GRIN2B	2904	hgsc.bcm.edu	37	12	13906726	13906726	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr12:13906726A>T	ENST00000609686.1	-	3	744	c.535T>A	c.(535-537)Tac>Aac	p.Y179N		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	179					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAGTCCTGGTAGCCAGGGAAA	0.483																																					p.Y179N		Atlas-SNP	.											.	GRIN2B	303	.	0			c.T535A						.						128.0	122.0	124.0					12																	13906726		2203	4300	6503	SO:0001583	missense	2904	exon3			CCTGGTAGCCAGG		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.535T>A	chr12.hg19:g.13906726A>T	ENSP00000477455:p.Tyr179Asn	183.0	0.0		166.0	10.0	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	hg19	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259110	0.80246	.	.	ENSG00000150086	ENST00000279593	D	0.86097	-2.07	5.13	5.13	0.70059	Extracellular ligand-binding receptor (1);	0.061515	0.64402	D	0.000002	D	0.92743	0.7693	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93686	0.7003	10	0.62326	D	0.03	.	14.9427	0.71006	1.0:0.0:0.0:0.0	.	179	Q13224	NMDE2_HUMAN	N	179	ENSP00000279593:Y179N	ENSP00000279593:Y179N	Y	-	1	0	GRIN2B	13797993	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.259000	0.95561	1.923000	0.55706	0.459000	0.35465	TAC	.	.		0.483	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
KRT71	112802	hgsc.bcm.edu	37	12	52940080	52940080	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr12:52940080C>T	ENST00000267119.5	-	7	1384	c.1315G>A	c.(1315-1317)Gag>Aag	p.E439K		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	439	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		CTGCACTCCTCGCTCTCCAGT	0.612																																					p.E439K		Atlas-SNP	.											.	KRT71	70	.	0			c.G1315A						.						56.0	50.0	52.0					12																	52940080		2203	4300	6503	SO:0001583	missense	112802	exon7			ACTCCTCGCTCTC	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1315G>A	chr12.hg19:g.52940080C>T	ENSP00000267119:p.Glu439Lys	90.0	0.0		86.0	4.0	NM_033448	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	hg19	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719502	0.89205	.	.	ENSG00000139648	ENST00000267119	D	0.93366	-3.21	4.34	3.44	0.39384	Filament (1);	0.000000	0.40640	N	0.001047	D	0.96682	0.8917	M	0.86420	2.815	0.48040	D	0.99957	D	0.89917	1.0	D	0.91635	0.999	D	0.97060	0.9770	10	0.87932	D	0	.	13.2682	0.60146	0.0:0.92:0.0:0.08	.	439	Q3SY84	K2C71_HUMAN	K	439	ENSP00000267119:E439K	ENSP00000267119:E439K	E	-	1	0	KRT71	51226347	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.048000	0.71046	1.136000	0.42199	0.561000	0.74099	GAG	.	.		0.612	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448	
CAND1	55832	hgsc.bcm.edu	37	12	67691629	67691629	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr12:67691629A>G	ENST00000545606.1	+	6	1287	c.850A>G	c.(850-852)Aga>Gga	p.R284G		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	284					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		ATCATTTGTAAGAAGGTAAGT	0.323																																					p.R284G		Atlas-SNP	.											.	CAND1	100	.	0			c.A850G						.						68.0	73.0	72.0					12																	67691629		2201	4296	6497	SO:0001583	missense	55832	exon6			TTTGTAAGAAGGT		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.850A>G	chr12.hg19:g.67691629A>G	ENSP00000442318:p.Arg284Gly	64.0	0.0		65.0	10.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.876108	0.33162	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047	T	0.32515	1.45	5.81	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	L	0.49699	1.58	0.80722	D	1	P	0.41624	0.757	B	0.41813	0.367	T	0.02533	-1.1145	9	.	.	.	-15.6081	12.9803	0.58559	0.8649:0.1351:0.0:0.0	.	284	Q86VP6	CAND1_HUMAN	G	284;284;126	ENSP00000442318:R284G	.	R	+	1	2	CAND1	65977896	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.195000	0.58400	1.004000	0.39156	0.528000	0.53228	AGA	.	.		0.323	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
ACACB	32	hgsc.bcm.edu	37	12	109692117	109692117	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr12:109692117G>T	ENST00000338432.7	+	44	6263	c.6144G>T	c.(6142-6144)atG>atT	p.M2048I	ACACB_ENST00000543201.1_Missense_Mutation_p.M714I|ACACB_ENST00000377854.5_Missense_Mutation_p.M1978I|ACACB_ENST00000377848.3_Missense_Mutation_p.M2048I			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2048	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CCCGGTGGATGCTTGCAGGAA	0.507																																					p.M2048I		Atlas-SNP	.											.	ACACB	330	.	0			c.G6144T						.						139.0	142.0	141.0					12																	109692117		2203	4300	6503	SO:0001583	missense	32	exon43			GTGGATGCTTGCA	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6144G>T	chr12.hg19:g.109692117G>T	ENSP00000341044:p.Met2048Ile	105.0	0.0		137.0	31.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	hg19	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000214	0.74818	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3	5.27	5.27	0.74061	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.113610	0.85682	D	0.000000	D	0.96728	0.8932	M	0.64567	1.98	0.80722	D	1	B	0.28082	0.2	B	0.37451	0.25	D	0.95614	0.8675	10	0.56958	D	0.05	.	18.8734	0.92325	0.0:0.0:1.0:0.0	.	2048	O00763	ACACB_HUMAN	I	2048;2048;1978;1279;714	ENSP00000341044:M2048I;ENSP00000367079:M2048I;ENSP00000367085:M1978I;ENSP00000444075:M714I	ENSP00000341044:M2048I	M	+	3	0	ACACB	108176500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.605000	0.74155	2.648000	0.89879	0.655000	0.94253	ATG	.	.		0.507	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
B3GNT4	79369	hgsc.bcm.edu	37	12	122691390	122691390	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr12:122691390C>A	ENST00000324189.4	+	3	948	c.592C>A	c.(592-594)Ctg>Atg	p.L198M	B3GNT4_ENST00000545141.1_Intron|B3GNT4_ENST00000535274.1_Missense_Mutation_p.L173M|B3GNT4_ENST00000546192.1_Missense_Mutation_p.L173M	NM_030765.2	NP_110392.1	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4	198					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		GCTCAAGGAGCTGCACCTGCA	0.577																																					p.L198M		Atlas-SNP	.											.	B3GNT4	35	.	0			c.C592A						.						44.0	47.0	46.0					12																	122691390		2203	4300	6503	SO:0001583	missense	79369	exon3			AAGGAGCTGCACC	AB049586	CCDS9227.1	12q24	2013-02-19						"""Beta 3-glycosyltransferases"""	15683	protein-coding gene	gene with protein product		605864				11042166	Standard	NM_030765		Approved	B3GN-T4, beta3Gn-T4	uc001ubx.3	Q9C0J1		ENST00000324189.4:c.592C>A	chr12.hg19:g.122691390C>A	ENSP00000319636:p.Leu198Met	55.0	0.0		52.0	7.0	NM_030765	Q8N5W4|Q8N934|Q8ND21|Q8WWR5|Q8WY02|Q96QH5	Missense_Mutation	SNP	ENST00000324189.4	hg19	CCDS9227.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.450887	0.63290	.	.	ENSG00000176383	ENST00000324189;ENST00000546192;ENST00000535274	T;T;T	0.57273	0.41;0.41;0.41	5.2	4.29	0.51040	.	0.158628	0.29293	N	0.012575	T	0.57725	0.2073	L	0.35542	1.07	0.34620	D	0.718496	D	0.71674	0.998	D	0.74348	0.983	T	0.64188	-0.6466	10	0.29301	T	0.29	.	10.6445	0.45613	0.149:0.7073:0.1437:0.0	.	198	Q9C0J1	B3GN4_HUMAN	M	198;173;173	ENSP00000319636:L198M;ENSP00000438840:L173M;ENSP00000444534:L173M	ENSP00000319636:L198M	L	+	1	2	B3GNT4	121257343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.003000	0.29809	1.275000	0.44379	0.655000	0.94253	CTG	.	.		0.577	B3GNT4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401595.1	NM_030765	
MGAT2	4247	hgsc.bcm.edu	37	14	50089289	50089289	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr14:50089289A>G	ENST00000305386.2	+	1	1801	c.1303A>G	c.(1303-1305)Agg>Ggg	p.R435G	RPL36AL_ENST00000298289.6_5'Flank|RP11-649E7.5_ENST00000555043.1_RNA	NM_002408.3	NP_002399.1	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	435					cellular protein metabolic process (GO:0044267)|oligosaccharide biosynthetic process (GO:0009312)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0008455)|carbohydrate binding (GO:0030246)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)	11	all_epithelial(31;0.0021)|Breast(41;0.0124)					GGGAGATATTAGGGACCATGA	0.368																																					p.R435G		Atlas-SNP	.											.	MGAT2	26	.	0			c.A1303G						.						40.0	44.0	43.0					14																	50089289		2191	4289	6480	SO:0001583	missense	4247	exon1			GATATTAGGGACC	U15128	CCDS9690.1	14q21	2013-02-25			ENSG00000168282	ENSG00000168282	2.4.1.143	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7045	protein-coding gene	gene with protein product		602616				7635144	Standard	NM_002408		Approved	GNT-II	uc001wwr.3	Q10469	OTTHUMG00000140271	ENST00000305386.2:c.1303A>G	chr14.hg19:g.50089289A>G	ENSP00000307423:p.Arg435Gly	82.0	0.0		70.0	7.0	NM_002408	B3KPC5|B3KQM0	Missense_Mutation	SNP	ENST00000305386.2	hg19	CCDS9690.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801054	0.50315	.	.	ENSG00000168282	ENST00000305386;ENST00000504161	D	0.94280	-3.39	6.14	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.96830	0.8965	M	0.87547	2.89	0.48901	D	0.999727	D	0.89917	1.0	D	0.97110	1.0	D	0.97385	0.9985	10	0.87932	D	0	-14.2725	14.0596	0.64790	0.7236:0.2764:0.0:0.0	.	435	Q10469	MGAT2_HUMAN	G	435;441	ENSP00000307423:R435G	ENSP00000307423:R435G	R	+	1	2	MGAT2	49159039	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.215000	0.42862	2.367000	0.80283	0.529000	0.55759	AGG	.	.		0.368	MGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276807.1	NM_002408	
DDHD1	80821	hgsc.bcm.edu	37	14	53540535	53540535	+	Silent	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr14:53540535T>C	ENST00000323669.5	-	5	1319	c.1320A>G	c.(1318-1320)gaA>gaG	p.E440E	DDHD1_ENST00000395606.1_Silent_p.E447E|DDHD1_ENST00000357758.3_Silent_p.E440E	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	440					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					AAAAATGCCTTTCTTCTATTT	0.308																																					p.E447E		Atlas-SNP	.											.	DDHD1	202	.	0			c.A1341G						.						87.0	88.0	87.0					14																	53540535		2203	4300	6503	SO:0001819	synonymous_variant	80821	exon6			ATGCCTTTCTTCT	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.1320A>G	chr14.hg19:g.53540535T>C		163.0	0.0		175.0	22.0	NM_001160147	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Silent	SNP	ENST00000323669.5	hg19	CCDS53895.1																																																																																			.	.		0.308	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
VSX2	338917	hgsc.bcm.edu	37	14	74726418	74726418	+	Silent	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr14:74726418C>A	ENST00000261980.2	+	4	783	c.693C>A	c.(691-693)ccC>ccA	p.P231P		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	231	CVC. {ECO:0000255|PROSITE- ProRule:PRU00829}.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		ACTCCATCCCCCTGCCCGAGT	0.652																																					p.P231P		Atlas-SNP	.											.	VSX2	32	.	0			c.C693A						.						111.0	90.0	97.0					14																	74726418		2203	4300	6503	SO:0001819	synonymous_variant	338917	exon4			CATCCCCCTGCCC	AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.693C>A	chr14.hg19:g.74726418C>A		93.0	0.0		132.0	25.0	NM_182894	A1A4X6	Silent	SNP	ENST00000261980.2	hg19	CCDS9827.1																																																																																			.	.		0.652	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412323.1	NM_182894	
TJP1	7082	hgsc.bcm.edu	37	15	29997825	29997825	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr15:29997825G>A	ENST00000346128.6	-	26	5449	c.4975C>T	c.(4975-4977)Cct>Tct	p.P1659S	TJP1_ENST00000356107.6_Missense_Mutation_p.P1659S|TJP1_ENST00000545208.2_Missense_Mutation_p.P1579S|TJP1_ENST00000400011.2_Missense_Mutation_p.P1583S	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1659	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCTCCTTGAGGGATAATTATA	0.463																																					p.P1659S	Melanoma(77;681 1843 6309 6570)	Atlas-SNP	.											.	TJP1	140	.	0			c.C4975T						.						90.0	88.0	89.0					15																	29997825		1910	4134	6044	SO:0001583	missense	7082	exon26			CTTGAGGGATAAT		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4975C>T	chr15.hg19:g.29997825G>A	ENSP00000281537:p.Pro1659Ser	140.0	0.0		141.0	23.0	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	hg19	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	G	33	5.195963	0.94960	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	D;D	0.82167	-1.58;-1.58	4.96	4.96	0.65561	ZU5 (3);	0.111165	0.64402	D	0.000007	D	0.92110	0.7499	M	0.84948	2.725	0.80722	D	1	D;D;D;D	0.89917	0.991;0.97;0.972;1.0	P;P;D;D	0.85130	0.857;0.696;0.918;0.997	D	0.93222	0.6609	10	0.87932	D	0	.	18.4059	0.90536	0.0:0.0:1.0:0.0	.	1652;1579;1659;1583	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	S	1659;1583;1659;1579;1579	ENSP00000281537:P1659S;ENSP00000382890:P1583S	ENSP00000281537:P1659S	P	-	1	0	TJP1	27785117	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	9.657000	0.98554	2.585000	0.87301	0.655000	0.94253	CCT	.	.		0.463	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
JMJD7	100137047	hgsc.bcm.edu	37	15	42127787	42127787	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr15:42127787A>G	ENST00000397299.4	+	4	514	c.474A>G	c.(472-474)ggA>ggG	p.G158G	PLA2G4B_ENST00000542534.2_Splice_Site_p.G158G|JMJD7_ENST00000408047.1_Splice_Site_p.G59G|PLA2G4B_ENST00000452633.1_5'Flank|JMJD7-PLA2G4B_ENST00000342159.4_Splice_Site_p.G158G|JMJD7-PLA2G4B_ENST00000476036.1_3'UTR|JMJD7-PLA2G4B_ENST00000382448.4_Splice_Site_p.G158G	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	158	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.									NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						GCCCTGCAGGAAAGATGCCCG	0.567																																					p.G158G		Atlas-SNP	.											.	JMJD7-PLA2G4B	90	.	0			c.A474G						.						87.0	83.0	84.0					15																	42127787		2203	4300	6503	SO:0001630	splice_region_variant	8681	exon4			TGCAGGAAAGATG		CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.473-1A>G	chr15.hg19:g.42127787A>G		99.0	0.0		120.0	8.0	NM_005090	A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	ENST00000397299.4	hg19	CCDS45240.1																																																																																			.	.		0.567	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326082.1	NM_001114632	Silent
LCTL	197021	hgsc.bcm.edu	37	15	66857654	66857654	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr15:66857654G>A	ENST00000341509.5	-	1	181	c.50C>T	c.(49-51)cCc>cTc	p.P17L	LCTL_ENST00000537670.1_Intron|LCTL_ENST00000563438.1_Intron	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	17					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCCCAGCCTGGGCACCAGCAG	0.632																																					p.P17L		Atlas-SNP	.											.	LCTL	73	.	0			c.C50T						.						35.0	36.0	36.0					15																	66857654		2200	4299	6499	SO:0001583	missense	197021	exon1			AGCCTGGGCACCA	AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.50C>T	chr15.hg19:g.66857654G>A	ENSP00000343490:p.Pro17Leu	242.0	0.0		242.0	45.0	NM_207338	B3KQY0	Missense_Mutation	SNP	ENST00000341509.5	hg19	CCDS10220.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.710072	0.00094	.	.	ENSG00000188501	ENST00000341509	T	0.30981	1.51	4.18	-0.0437	0.13858	.	0.981786	0.08343	N	0.960539	T	0.12732	0.0309	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34800	-0.9814	10	0.09843	T	0.71	-1.7633	5.6031	0.17365	0.2793:0.1482:0.5725:0.0	.	17	Q6UWM7	LCTL_HUMAN	L	17	ENSP00000343490:P17L	ENSP00000343490:P17L	P	-	2	0	LCTL	64644708	0.000000	0.05858	0.015000	0.15790	0.002000	0.02628	0.291000	0.18994	-0.173000	0.10761	-1.728000	0.00702	CCC	.	.		0.632	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338	
IREB2	3658	hgsc.bcm.edu	37	15	78758781	78758781	+	Silent	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr15:78758781G>A	ENST00000258886.8	+	5	728	c.579G>A	c.(577-579)caG>caA	p.Q193Q	IREB2_ENST00000560440.1_Silent_p.Q193Q|IREB2_ENST00000559427.1_3'UTR	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	193					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TTTCTTCGCAGATTGAGAATA	0.433																																					p.Q193Q	NSCLC(200;764 2208 35157 49871 50830)	Atlas-SNP	.											.	IREB2	106	.	0			c.G579A						.						128.0	125.0	126.0					15																	78758781		2196	4293	6489	SO:0001819	synonymous_variant	3658	exon5			TTCGCAGATTGAG	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.579G>A	chr15.hg19:g.78758781G>A		140.0	0.0		150.0	15.0	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Silent	SNP	ENST00000258886.8	hg19	CCDS10302.1																																																																																			.	.		0.433	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
MESP1	55897	hgsc.bcm.edu	37	15	90294296	90294296	+	Missense_Mutation	SNP	G	G	A	rs3841586|rs71934166		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr15:90294296G>A	ENST00000300057.4	-	1	245	c.167C>T	c.(166-168)gCg>gTg	p.A56V	MESP1_ENST00000559894.1_5'UTR	NM_018670.3	NP_061140.1	Q9BRJ9	MESP1_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 1	56					cardiac atrium formation (GO:0003210)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell differentiation (GO:0055007)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cardiac ventricle formation (GO:0003211)|cardioblast anterior-lateral migration (GO:0003259)|cardioblast migration to the midline involved in heart field formation (GO:0060975)|embryonic heart tube morphogenesis (GO:0003143)|endothelial cell differentiation (GO:0045446)|gastrulation (GO:0007369)|growth involved in heart morphogenesis (GO:0003241)|heart looping (GO:0001947)|lateral mesoderm development (GO:0048368)|mesodermal cell migration (GO:0008078)|negative regulation of endodermal cell fate specification (GO:0042664)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|positive regulation of heart induction by negative regulation of canonical Wnt signaling pathway (GO:0090082)|positive regulation of hepatocyte differentiation (GO:0070368)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of Notch signaling pathway involved in heart induction (GO:0035481)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|signal transduction involved in regulation of gene expression (GO:0023019)|sinoatrial node cell differentiation (GO:0060921)|sinus venosus morphogenesis (GO:0003236)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|kidney(1)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			GCCTGGCCGCGCGGGGCTCGC	0.786																																					p.A56V		Atlas-SNP	.											.	MESP1	7	.	0			c.C167T						.						2.0	3.0	2.0					15																	90294296		862	2258	3120	SO:0001583	missense	55897	exon1			GGCCGCGCGGGGC		CCDS10355.1	15q26.1	2014-06-30	2014-06-30		ENSG00000166823	ENSG00000166823		"""Basic helix-loop-helix proteins"""	29658	protein-coding gene	gene with protein product		608689	"""mesoderm posterior 1 homolog (mouse)"""			8787751, 11578861	Standard	NM_018670		Approved	MGC10676, bHLHc5	uc002bol.3	Q9BRJ9	OTTHUMG00000149810	ENST00000300057.4:c.167C>T	chr15.hg19:g.90294296G>A	ENSP00000300057:p.Ala56Val	5.0	0.0		13.0	5.0	NM_018670	Q9NSF1|Q9NSF2	Missense_Mutation	SNP	ENST00000300057.4	hg19	CCDS10355.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797307	0.31777	.	.	ENSG00000166823	ENST00000300057	T	0.79940	-1.32	3.11	-3.69	0.04450	.	.	.	.	.	T	0.55146	0.1902	N	0.19112	0.55	0.09310	N	1	P	0.42692	0.787	B	0.27262	0.078	T	0.50118	-0.8865	9	0.25106	T	0.35	.	7.6367	0.28270	0.0:0.4869:0.2532:0.2599	.	56	Q9BRJ9	MESP1_HUMAN	V	56	ENSP00000300057:A56V	ENSP00000300057:A56V	A	-	2	0	MESP1	88095300	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.025000	0.12413	-0.477000	0.06832	0.448000	0.29417	GCG	.	.		0.786	MESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313421.1	NM_018670	
MVP	9961	hgsc.bcm.edu	37	16	29848234	29848234	+	Silent	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr16:29848234C>T	ENST00000357402.5	+	7	1002	c.864C>T	c.(862-864)gtC>gtT	p.V288V	MVP_ENST00000452209.2_Missense_Mutation_p.R103W|MVP_ENST00000395353.1_Silent_p.V288V	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	288					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						TCGACCCTGTCGGACCGGATG	0.617																																					p.V288V		Atlas-SNP	.											.	MVP	80	.	0			c.C864T						.						68.0	53.0	58.0					16																	29848234		2197	4300	6497	SO:0001819	synonymous_variant	9961	exon7			CCCTGTCGGACCG	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.864C>T	chr16.hg19:g.29848234C>T		102.0	0.0		112.0	23.0	NM_017458	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Silent	SNP	ENST00000357402.5	hg19	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.242225	0.39598	.	.	ENSG00000013364	ENST00000452209	T	0.64991	-0.13	5.47	-10.9	0.00192	.	.	.	.	.	T	0.53769	0.1817	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.63857	-0.6542	6	0.87932	D	0	-16.0431	8.2486	0.31704	0.0646:0.3999:0.4325:0.103	.	.	.	.	W	103	ENSP00000387916:R103W	ENSP00000387916:R103W	R	+	1	2	MVP	29755735	0.001000	0.12720	0.000000	0.03702	0.843000	0.47879	-2.758000	0.00787	-3.446000	0.00162	0.462000	0.41574	CGG	.	.		0.617	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	
KIFC3	3801	hgsc.bcm.edu	37	16	57796115	57796115	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr16:57796115T>G	ENST00000379655.4	-	13	1942	c.1685A>C	c.(1684-1686)aAg>aCg	p.K562T	KIFC3_ENST00000541240.1_Missense_Mutation_p.K584T|KIFC3_ENST00000543930.1_Missense_Mutation_p.K420T|KIFC3_ENST00000445690.2_Missense_Mutation_p.K562T|KIFC3_ENST00000562903.1_Missense_Mutation_p.K423T|KIFC3_ENST00000465878.2_Missense_Mutation_p.K423T|KIFC3_ENST00000540079.2_Missense_Mutation_p.K460T|KIFC3_ENST00000539578.1_Missense_Mutation_p.K504T|KIFC3_ENST00000421376.2_Missense_Mutation_p.K423T	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	562	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				GTCAGACGCCTTCTCCTGCAC	0.637																																					p.K562T		Atlas-SNP	.											.	KIFC3	55	.	0			c.A1685C						.						48.0	45.0	46.0					16																	57796115		2198	4300	6498	SO:0001583	missense	3801	exon13			GACGCCTTCTCCT	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1685A>C	chr16.hg19:g.57796115T>G	ENSP00000368976:p.Lys562Thr	33.0	0.0		32.0	8.0	NM_001130100	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	hg19	CCDS10789.2	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822928	0.71028	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000421376;ENST00000541240;ENST00000540079;ENST00000543930;ENST00000539578	T;T;T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9;-0.9;-0.9	4.42	4.42	0.53409	Kinesin, motor domain (4);	0.049261	0.85682	D	0.000000	T	0.65575	0.2704	L	0.27944	0.81	0.53688	D	0.999971	P;P;P;B;B;P;P	0.44816	0.641;0.844;0.641;0.01;0.077;0.792;0.756	B;B;P;B;B;P;B	0.47102	0.337;0.402;0.456;0.021;0.082;0.537;0.429	T	0.67393	-0.5682	10	0.59425	D	0.04	.	7.48	0.27400	0.0:0.0993:0.0:0.9007	.	584;504;420;460;267;562;423	B7Z484;F5H4I9;B7Z896;F5H3M2;B7Z3I6;Q9BVG8;A8K6S2	.;.;.;.;.;KIFC3_HUMAN;.	T	562;562;423;584;460;420;504	ENSP00000368976:K562T;ENSP00000401696:K562T;ENSP00000396399:K423T;ENSP00000442008:K584T;ENSP00000438805:K460T;ENSP00000444012:K420T;ENSP00000444884:K504T	ENSP00000368976:K562T	K	-	2	0	KIFC3	56353616	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.081000	0.50120	1.636000	0.50526	0.482000	0.46254	AAG	.	.		0.637	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550	
CNOT1	23019	hgsc.bcm.edu	37	16	58572172	58572172	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr16:58572172T>C	ENST00000317147.5	-	37	5468		c.e37-2		CNOT1_ENST00000245138.4_Splice_Site|CNOT1_ENST00000569240.1_Splice_Site	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ATTAGGCACCTAGAAAAAGTT	0.358																																					.		Atlas-SNP	.											.	CNOT1	359	.	0			c.5136-2A>G						.						59.0	57.0	58.0					16																	58572172		2198	4300	6498	SO:0001630	splice_region_variant	23019	exon38			GGCACCTAGAAAA	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.5136-2A>G	chr16.hg19:g.58572172T>C		86.0	0.0		97.0	10.0	NM_016284	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Splice_Site	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132861	0.77662	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0121	0.80409	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CNOT1	57129673	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	8.040000	0.89188	2.180000	0.69256	0.482000	0.46254	.	.	.		0.358	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	Intron
CDH8	1006	hgsc.bcm.edu	37	16	61687819	61687819	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr16:61687819T>C	ENST00000577390.1	-	12	3047	c.2093A>G	c.(2092-2094)aAg>aGg	p.K698R	CDH8_ENST00000577730.1_Intron|CDH8_ENST00000299345.6_Missense_Mutation_p.K698R	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	698					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TTTAATATCCTTACGGGGTAA	0.418																																					p.K698R		Atlas-SNP	.											.	CDH8	273	.	0			c.A2093G						.						105.0	105.0	105.0					16																	61687819		2203	4300	6503	SO:0001583	missense	1006	exon12			ATATCCTTACGGG	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2093A>G	chr16.hg19:g.61687819T>C	ENSP00000462701:p.Lys698Arg	127.0	0.0		150.0	22.0	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	hg19	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	T	0.539	-0.854473	0.02630	.	.	ENSG00000150394	ENST00000299345	T	0.75821	-0.97	5.7	4.61	0.57282	Cadherin, cytoplasmic domain (1);	0.048168	0.85682	N	0.000000	T	0.49029	0.1533	N	0.10629	0.01	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44406	-0.9330	10	0.02654	T	1	.	10.8247	0.46625	0.0:0.0736:0.0:0.9264	.	698	P55286	CADH8_HUMAN	R	698	ENSP00000299345:K698R	ENSP00000299345:K698R	K	-	2	0	CDH8	60245320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.937000	0.70162	0.993000	0.38866	0.533000	0.62120	AAG	.	.		0.418	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
OVCA2	124641	hgsc.bcm.edu	37	17	1945365	1945365	+	Silent	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr17:1945365G>T	ENST00000572195.1	+	1	39	c.24G>T	c.(22-24)cgG>cgT	p.R8R	DPH1_ENST00000570477.1_Intron|DPH1_ENST00000263083.6_Intron|RP11-667K14.3_ENST00000572790.1_lincRNA|RP11-667K14.4_ENST00000572404.1_RNA	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2	8					metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)										GACCCCTGCGGGTCCTGTGCC	0.716											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R8R		Atlas-SNP	.											.	.	.	.	0			c.G24T						.						4.0	5.0	5.0					17																	1945365		1952	3954	5906	SO:0001819	synonymous_variant	124641	exon1			CCTGCGGGTCCTG	AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.24G>T	chr17.hg19:g.1945365G>T		44.0	0.0	599	38.0	8.0	NM_080822	Q86XN3|Q8IW87|Q9UCX9	Silent	SNP	ENST00000572195.1	hg19	CCDS11015.1																																																																																			.	.		0.716	OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255636.5	NM_080822	
TXNDC17	84817	hgsc.bcm.edu	37	17	6545140	6545140	+	Silent	SNP	A	A	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr17:6545140A>G	ENST00000250101.5	+	2	538	c.213A>G	c.(211-213)gtA>gtG	p.V71V	KIAA0753_ENST00000361413.3_5'Flank|TXNDC17_ENST00000577146.1_3'UTR|TXNDC17_ENST00000570330.1_Silent_p.V46V|TXNDC17_ENST00000574838.1_Silent_p.V71V|KIAA0753_ENST00000572370.1_5'Flank	NM_032731.3	NP_116120.1	Q9BRA2	TXD17_HUMAN	thioredoxin domain containing 17	71	Thioredoxin.				oxidation-reduction process (GO:0055114)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|peroxidase activity (GO:0004601)|protein-disulfide reductase activity (GO:0047134)			endometrium(1)|kidney(1)|ovary(1)	3						ACTGCCAAGTAGGAGAAAAGC	0.448																																					p.V71V		Atlas-SNP	.											.	TXNDC17	10	.	0			c.A213G						.						98.0	98.0	98.0					17																	6545140		2203	4300	6503	SO:0001819	synonymous_variant	84817	exon2			CCAAGTAGGAGAA	BC006405	CCDS11077.1	17p13.2	2007-08-16	2007-08-16	2007-08-16	ENSG00000129235	ENSG00000129235			28218	protein-coding gene	gene with protein product	"""thioredoxin (Trx)-related protein, 14 kDa"""		"""thioredoxin-like 5"""	TXNL5		14607844, 14607843	Standard	NM_032731		Approved	MGC14353, TRP14	uc002gdf.4	Q9BRA2	OTTHUMG00000102053	ENST00000250101.5:c.213A>G	chr17.hg19:g.6545140A>G		102.0	0.0		90.0	4.0	NM_032731	A8K7E8	Silent	SNP	ENST00000250101.5	hg19	CCDS11077.1																																																																																			.	.		0.448	TXNDC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219854.2	NM_032731	
TTC19	54902	hgsc.bcm.edu	37	17	15903433	15903433	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr17:15903433G>T	ENST00000261647.5	+	2	655	c.186G>T	c.(184-186)gcG>gcT	p.A62A	ZSWIM7_ENST00000472495.1_5'Flank|ZSWIM7_ENST00000486655.1_5'Flank|ZSWIM7_ENST00000399277.1_5'Flank|TTC19_ENST00000486880.2_Splice_Site_p.A183A|TTC19_ENST00000497842.2_3'UTR|ZSWIM7_ENST00000399280.2_5'Flank	NM_001271420.1|NM_017775.3	NP_001258349.1|NP_060245.3	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	62					cytokinesis (GO:0000910)|mitochondrial respiratory chain complex III assembly (GO:0034551)	centrosome (GO:0005813)|midbody (GO:0030496)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(2)|skin(1)|stomach(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TTCCCGCAGCGCTCGCCTGGT	0.796																																					p.A62A		Atlas-SNP	.											.	TTC19	10	.	0			c.G186T						.						4.0	7.0	6.0					17																	15903433		1860	3797	5657	SO:0001630	splice_region_variant	54902	exon2			CGCAGCGCTCGCC	AK094819	CCDS11174.1, CCDS11174.2	17p11.2	2013-01-11			ENSG00000011295	ENSG00000011295		"""Tetratricopeptide (TTC) repeat domain containing"""	26006	protein-coding gene	gene with protein product		613814					Standard	NM_017775		Approved	FLJ20343, MGC19520	uc002gph.3	Q6DKK2	OTTHUMG00000059306	ENST00000261647.5:c.185-1G>T	chr17.hg19:g.15903433G>T		614.0	1.0		532.0	93.0	NM_017775	A8MZ52|B3KP62|B4DN65|Q2M248|Q7L3U8|Q9H6G3|Q9NXB2	Silent	SNP	ENST00000261647.5	hg19	CCDS11174.2																																																																																			.	.		0.796	TTC19-001	NOVEL	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000131725.6	NM_017775	Silent
MEOX1	4222	hgsc.bcm.edu	37	17	41738603	41738603	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr17:41738603G>T	ENST00000318579.4	-	1	719	c.300C>A	c.(298-300)gaC>gaA	p.D100E	MEOX1_ENST00000393661.2_5'UTR|MEOX1_ENST00000329168.3_Missense_Mutation_p.D100E|MEOX1_ENST00000549132.1_Missense_Mutation_p.T71K	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	100					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		TGCGCCGGGCGTCTGAGACAG	0.667																																					p.D100E		Atlas-SNP	.											.	MEOX1	29	.	0			c.C300A						.						49.0	56.0	54.0					17																	41738603		2203	4300	6503	SO:0001583	missense	4222	exon1			CCGGGCGTCTGAG		CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.300C>A	chr17.hg19:g.41738603G>T	ENSP00000321684:p.Asp100Glu	101.0	0.0		103.0	14.0	NM_004527	A8K524|A8MWF9|Q15069	Missense_Mutation	SNP	ENST00000318579.4	hg19	CCDS11466.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.092|0.092	-1.165880|-1.165880	0.01673|0.01673	.|.	.|.	ENSG00000005102|ENSG00000005102	ENST00000318579;ENST00000329168|ENST00000549132	D;T|.	0.89681|.	-2.55;1.48|.	4.63|4.63	0.13|0.13	0.14746|0.14746	.|.	0.105878|.	0.64402|.	N|.	0.000005|.	T|T	0.06645|0.06645	0.0170|0.0170	N|N	0.00210|0.00210	-1.845|-1.845	0.19775|0.19775	N|N	0.99995|0.99995	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.28364|0.28364	-1.0046|-1.0046	10|6	0.02654|0.87932	T|D	1|0	-20.2265|-20.2265	6.095|6.095	0.20015|0.20015	0.0:0.5446:0.2891:0.1663|0.0:0.5446:0.2891:0.1663	.|.	100;100|.	Q15069;P50221|.	.;MEOX1_HUMAN|.	E|K	100|71	ENSP00000321684:D100E;ENSP00000328678:D100E|.	ENSP00000321684:D100E|ENSP00000449049:T71K	D|T	-|-	3|2	2|0	MEOX1|MEOX1	39094129|39094129	0.962000|0.962000	0.33011|0.33011	0.978000|0.978000	0.43139|0.43139	0.417000|0.417000	0.31264|0.31264	0.141000|0.141000	0.16076|0.16076	0.152000|0.152000	0.19188|0.19188	-0.128000|-0.128000	0.14901|0.14901	GAC|ACG	.	.		0.667	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409452.1		
KCNH6	81033	hgsc.bcm.edu	37	17	61623214	61623214	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr17:61623214T>C	ENST00000583023.1	+	14	2947	c.2936T>C	c.(2935-2937)tTc>tCc	p.F979S	KCNH6_ENST00000581784.1_Missense_Mutation_p.F890S|KCNH6_ENST00000314672.5_Missense_Mutation_p.F943S|KCNH6_ENST00000456941.2_Missense_Mutation_p.F890S	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	979					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CAGCTGGACTTCCAGAGACAT	0.552																																					p.F979S		Atlas-SNP	.											.	KCNH6	122	.	0			c.T2936C						.						90.0	86.0	88.0					17																	61623214		2203	4300	6503	SO:0001583	missense	81033	exon14			TGGACTTCCAGAG	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2936T>C	chr17.hg19:g.61623214T>C	ENSP00000463533:p.Phe979Ser	60.0	0.0		50.0	4.0	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	hg19	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.044176	0.55110	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99270	-5.66	4.57	3.48	0.39840	.	0.570419	0.15330	U	0.268084	D	0.97461	0.9169	L	0.44542	1.39	0.32052	N	0.596766	B;B;B;B	0.27559	0.004;0.181;0.066;0.112	B;B;B;B	0.26310	0.004;0.042;0.068;0.063	D	0.99975	1.2161	10	0.87932	D	0	.	9.708	0.40227	0.0:0.0826:0.0:0.9174	.	820;943;890;979	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	S	979;890	ENSP00000396900:F890S	ENSP00000318212:F979S	F	+	2	0	KCNH6	58976946	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.531000	0.45650	1.810000	0.52873	0.460000	0.39030	TTC	.	.		0.552	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
TSHZ1	10194	hgsc.bcm.edu	37	18	72998511	72998511	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr18:72998511G>T	ENST00000580243.1	+	2	1497	c.1149G>T	c.(1147-1149)caG>caT	p.Q383H	TSHZ1_ENST00000322038.5_Missense_Mutation_p.Q338H			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	383					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CCAAGGATCAGAAAGCAGCGA	0.627																																					p.Q338H		Atlas-SNP	.											.	TSHZ1	104	.	0			c.G1014T						.						103.0	108.0	106.0					18																	72998511		2203	4300	6503	SO:0001583	missense	10194	exon2			GGATCAGAAAGCA	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1149G>T	chr18.hg19:g.72998511G>T	ENSP00000464391:p.Gln383His	107.0	0.0		126.0	7.0	NM_005786	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	hg19		.	.	.	.	.	.	.	.	.	.	G	2.165	-0.391360	0.04932	.	.	ENSG00000179981	ENST00000322038	T	0.13901	2.55	5.27	3.37	0.38596	.	0.299193	0.32952	N	0.005442	T	0.14743	0.0356	L	0.41824	1.3	0.36632	D	0.876367	D	0.56521	0.976	P	0.49999	0.628	T	0.05146	-1.0903	10	0.48119	T	0.1	-32.1355	6.7208	0.23328	0.1539:0.1471:0.699:0.0	.	383	Q6ZSZ6	TSH1_HUMAN	H	338	ENSP00000323584:Q338H	ENSP00000323584:Q338H	Q	+	3	2	TSHZ1	71127499	1.000000	0.71417	0.990000	0.47175	0.273000	0.26683	1.583000	0.36579	1.986000	0.57962	0.459000	0.35465	CAG	.	.		0.627	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
CACTIN	58509	hgsc.bcm.edu	37	19	3623843	3623843	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr19:3623843G>A	ENST00000429344.2	-	2	537	c.485C>T	c.(484-486)aCg>aTg	p.T162M	CACTIN_ENST00000221899.3_Missense_Mutation_p.T94M|CACTIN_ENST00000248420.5_Missense_Mutation_p.T162M	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	162					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CTCCTCGGGCGTCTCGAAGGC	0.687																																					p.T162M		Atlas-SNP	.											.	.	.	.	0			c.C485T						.						30.0	37.0	34.0					19																	3623843		2095	4196	6291	SO:0001583	missense	58509	exon2			TCGGGCGTCTCGA	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.485C>T	chr19.hg19:g.3623843G>A	ENSP00000415078:p.Thr162Met	42.0	0.0		40.0	7.0	NM_021231	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	hg19	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548248	0.65311	.	.	ENSG00000105298	ENST00000429344;ENST00000248420;ENST00000221899	.	.	.	5.09	5.09	0.68999	.	0.054374	0.64402	D	0.000002	D	0.82917	0.5141	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85628	0.1268	9	0.87932	D	0	.	17.4868	0.87691	0.0:0.0:1.0:0.0	.	162	Q8WUQ7	CS029_HUMAN	M	162;162;94	.	ENSP00000221899:T94M	T	-	2	0	C19orf29	3574843	1.000000	0.71417	0.938000	0.37757	0.087000	0.18053	9.695000	0.98691	2.379000	0.81126	0.561000	0.74099	ACG	.	.		0.687	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
FSD1	79187	hgsc.bcm.edu	37	19	4310529	4310529	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr19:4310529G>A	ENST00000221856.6	+	6	573	c.426G>A	c.(424-426)atG>atA	p.M142I	FSD1_ENST00000598010.1_3'UTR|FSD1_ENST00000597590.1_Missense_Mutation_p.M142I	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	142	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGACAACATGAGTCACCTCA	0.607																																					p.M142I		Atlas-SNP	.											.	FSD1	51	.	0			c.G426A						.						84.0	73.0	76.0					19																	4310529		2203	4300	6503	SO:0001583	missense	79187	exon6			CAACATGAGTCAC	AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.426G>A	chr19.hg19:g.4310529G>A	ENSP00000221856:p.Met142Ile	85.0	0.0		98.0	7.0	NM_024333	B2RDT0|Q9BXN0|Q9HAG4	Missense_Mutation	SNP	ENST00000221856.6	hg19	CCDS12127.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074849	0.76415	.	.	ENSG00000105255	ENST00000221856	T	0.46063	0.88	5.23	5.23	0.72850	COS domain (1);	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	M	0.66939	2.045	0.80722	D	1	D;P	0.63046	0.992;0.462	P;B	0.61722	0.893;0.258	T	0.62590	-0.6822	10	0.56958	D	0.05	.	16.2944	0.82763	0.0:0.0:1.0:0.0	.	129;142	B4DIC5;Q9BTV5	.;FSD1_HUMAN	I	142	ENSP00000221856:M142I	ENSP00000221856:M142I	M	+	3	0	FSD1	4261529	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.254000	0.95512	2.453000	0.82957	0.511000	0.50034	ATG	.	.		0.607	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458091.1	NM_024333	
ZNF208	7757	hgsc.bcm.edu	37	19	22155400	22155400	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr19:22155400T>G	ENST00000397126.4	-	4	2584	c.2436A>C	c.(2434-2436)aaA>aaC	p.K812N	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	812					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TACTAAAGGTTTTGCCACATT	0.373																																					p.K812N		Atlas-SNP	.											.	ZNF208	817	.	0			c.A2436C						.						57.0	66.0	63.0					19																	22155400		2087	4239	6326	SO:0001583	missense	7757	exon4			AAAGGTTTTGCCA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2436A>C	chr19.hg19:g.22155400T>G	ENSP00000380315:p.Lys812Asn	77.0	0.0		76.0	9.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	hg19	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.047636	0.36085	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.27890	1.64	2.57	0.183	0.15082	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48409	0.1498	.	.	.	0.22562	N	0.998987	D	0.89917	1.0	D	0.81914	0.995	T	0.29518	-1.0009	8	0.87932	D	0	.	6.4872	0.22095	0.0:0.2483:0.0:0.7517	.	712	O43345	ZN208_HUMAN	N	812;712	ENSP00000380315:K812N	ENSP00000380315:K812N	K	-	3	2	ZNF208	21947240	0.002000	0.14202	0.079000	0.20413	0.169000	0.22640	-0.456000	0.06754	0.005000	0.14708	0.232000	0.17820	AAA	.	.		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
FFAR1	2864	hgsc.bcm.edu	37	19	35842806	35842806	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr19:35842806C>T	ENST00000246553.2	+	1	362	c.352C>T	c.(352-354)Cgg>Tgg	p.R118W		NM_005303.2	NP_005294.1	O14842	FFAR1_HUMAN	free fatty acid receptor 1	118					energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|positive regulation of GTPase activity (GO:0043547)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.R118W(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;4.58e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.67e-19)|all cancers(14;2.01e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		Icosapent(DB00159)	CCAAGCCTTCCGGAGGCCGTG	0.677																																					p.R118W		Atlas-SNP	.											FFAR1,caecum,carcinoma,-2,1	FFAR1	33	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.C352T						.						50.0	51.0	51.0					19																	35842806		2203	4300	6503	SO:0001583	missense	2864	exon1			GCCTTCCGGAGGC	AF024687	CCDS12458.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000126266	ENSG00000126266		"""GPCR / Class A : Fatty acid receptors"""	4498	protein-coding gene	gene with protein product		603820	"""G protein-coupled receptor 40"""	GPR40		15684720	Standard	NM_005303		Approved	FFA1R	uc002nzc.2	O14842		ENST00000246553.2:c.352C>T	chr19.hg19:g.35842806C>T	ENSP00000246553:p.Arg118Trp	76.0	0.0		77.0	18.0	NM_005303	Q0VAS2|Q4VBL4	Missense_Mutation	SNP	ENST00000246553.2	hg19	CCDS12458.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760021	0.49468	.	.	ENSG00000126266	ENST00000246553	T	0.39787	1.06	4.23	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.083641	0.45867	D	0.000323	T	0.60818	0.2298	M	0.74467	2.265	0.39849	D	0.973219	D	0.89917	1.0	D	0.87578	0.998	T	0.65796	-0.6081	10	0.72032	D	0.01	-23.9206	9.3832	0.38327	0.2129:0.7871:0.0:0.0	.	118	O14842	FFAR1_HUMAN	W	118	ENSP00000246553:R118W	ENSP00000246553:R118W	R	+	1	2	FFAR1	40534646	0.798000	0.28890	0.744000	0.31058	0.028000	0.11728	1.397000	0.34543	2.171000	0.68590	0.561000	0.74099	CGG	.	.		0.677	FFAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466112.2	NM_005303	
ZNF350	59348	hgsc.bcm.edu	37	19	52472325	52472325	+	Silent	SNP	C	C	A			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr19:52472325C>A	ENST00000243644.4	-	3	302	c.75G>T	c.(73-75)ctG>ctT	p.L25L	HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'UTR	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	25	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		GAGCAGCGCCCAGGAGTTGCC	0.512																																					p.L25L		Atlas-SNP	.											.	ZNF350	48	.	0			c.G75T						.						171.0	151.0	158.0					19																	52472325		2203	4300	6503	SO:0001819	synonymous_variant	59348	exon3			AGCGCCCAGGAGT	AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.75G>T	chr19.hg19:g.52472325C>A		124.0	0.0		147.0	27.0	NM_021632	Q96G73|Q9HAQ4	Silent	SNP	ENST00000243644.4	hg19	CCDS12845.1																																																																																			.	.		0.512	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632	
ZNF185	7739	hgsc.bcm.edu	37	X	152128322	152128322	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chrX:152128322G>T	ENST00000370268.4	+	17	1523	c.1486G>T	c.(1486-1488)Ggt>Tgt	p.G496C	ZNF185_ENST00000535861.1_Missense_Mutation_p.G528C|ZNF185_ENST00000539731.1_Missense_Mutation_p.G499C|ZNF185_ENST00000318529.8_Missense_Mutation_p.G275C|ZNF185_ENST00000318504.7_Missense_Mutation_p.G437C|ZNF185_ENST00000454925.1_Missense_Mutation_p.G134C|ZNF185_ENST00000449285.2_Missense_Mutation_p.G497C|ZNF185_ENST00000370270.2_Missense_Mutation_p.G528C|ZNF185_ENST00000324823.6_Missense_Mutation_p.G264C			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	496						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGCCCCAAGAGGTGGCCAAGG	0.582																																					p.G528C		Atlas-SNP	.											.	ZNF185	92	.	0			c.G1582T						.						46.0	51.0	49.0					X																	152128322		1983	4131	6114	SO:0001583	missense	7739	exon18			CCAAGAGGTGGCC	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1486G>T	chrX.hg19:g.152128322G>T	ENSP00000359291:p.Gly496Cys	131.0	0.0		142.0	42.0	NM_001178106	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	ENST00000370268.4	hg19	CCDS48184.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	9.541|9.541|9.541	1.113407|1.113407|1.113407	0.20795|0.20795|0.20795	.|.|.	.|.|.	ENSG00000147394|ENSG00000147394|ENSG00000147394	ENST00000454925|ENST00000535861;ENST00000539731;ENST00000449285;ENST00000318504;ENST00000535156;ENST00000324823;ENST00000370268;ENST00000318529;ENST00000370270;ENST00000436731|ENST00000426821	.|T;T;T;T;T|.	.|0.47869|.	.|0.83;0.83;0.83;0.83;0.83|.	3.99|3.99|3.99	-0.954|-0.954|-0.954	0.10359|0.10359|0.10359	.|.|.	.|1.172330|.	.|0.06385|.	.|N|.	.|0.715848|.	T|T|T	0.26919|0.26919|0.26919	0.0659|0.0659|0.0659	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|P;B;B;P;P;P;B;D;P|.	.|0.76494|.	.|0.649;0.4;0.009;0.587;0.644;0.649;0.338;0.999;0.506|.	.|B;B;B;B;B;B;B;D;B|.	.|0.65874|.	.|0.149;0.11;0.017;0.146;0.207;0.21;0.168;0.939;0.126|.	T|T|T	0.31503|0.31503|0.31503	-0.9941|-0.9941|-0.9941	5|10|6	.|0.66056|0.72032	.|D|D	.|0.02|0.01	0.1733|0.1733|0.1733	3.3893|3.3893|3.3893	0.07283|0.07283|0.07283	0.4573:0.0:0.3543:0.1884|0.4573:0.0:0.3543:0.1884|0.4573:0.0:0.3543:0.1884	.|.|.	.|497;437;467;499;528;496;134;275;259|.	.|O15231-3;B8K2L9;B8K2M0;F5GZL4;F5GXF7;O15231;Q8N1R8;F8W8V7;O15231-2|.	.|.;.;.;.;.;ZN185_HUMAN;.;.;.|.	D|C|M	136|528;499;497;437;331;264;496;275;259;201|281	.|ENSP00000440847:G528C;ENSP00000444367:G499C;ENSP00000395228:G497C;ENSP00000312782:G437C;ENSP00000359291:G496C|.	.|ENSP00000312782:G437C|ENSP00000409121:R281M	E|G|R	+|+|+	3|1|2	2|0|0	ZNF185|ZNF185|ZNF185	151878978|151878978|151878978	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.062000|0.062000|0.062000	0.15995|0.15995|0.15995	0.009000|0.009000|0.009000	0.13219|0.13219|0.13219	-0.361000|-0.361000|-0.361000	0.08125|0.08125|0.08125	-0.297000|-0.297000|-0.297000	0.09499|0.09499|0.09499	GAG|GGT|AGG	.	.		0.582	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
ERICH3	127254	hgsc.bcm.edu	37	1	75072555	75072556	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr1:75072555_75072556insT	ENST00000326665.5	-	10	1436_1437	c.1218_1219insA	c.(1216-1221)aaaccgfs	p.P407fs	C1orf173_ENST00000420661.2_Frame_Shift_Ins_p.P210fs|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		407										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GGCAAAGACGGTTTTTTGTCAA	0.421																																					p.P407fs		Atlas-INDEL	.											C1orf173,NS,carcinoma,+2,1	C1orf173	380	.	0			c.1219_1220insA						.																																			SO:0001589	frameshift_variant	127254	exon10			.																												ENST00000326665.5:c.1219dupA	chr1.hg19:g.75072561_75072561dupT	ENSP00000322609:p.Pro407fs	78.0	0.0		79.0	12.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Frame_Shift_Ins	INS	ENST00000326665.5	hg19	CCDS30755.1																																																																																			.	.		0.421	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
IRX1	79192	hgsc.bcm.edu	37	5	3599554	3599556	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	CAT	CAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:3599554_3599556delCAT	ENST00000302006.3	+	2	544_546	c.492_494delCAT	c.(490-495)gccatc>gcc	p.I166del	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	166					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TCATGCTGGCCATCATCACCAAG	0.626																																					p.164_165del		Atlas-INDEL	.											IRX1,NS,carcinoma,0,1	IRX1	106	.	0			c.491_493del						.																																			SO:0001651	inframe_deletion	79192	exon2			.	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.492_494delCAT	chr5.hg19:g.3599557_3599559delCAT	ENSP00000305244:p.Ile166del	131.0	0.0		139.0	12.0	NM_024337	Q7Z2F8|Q8N312	In_Frame_Del	DEL	ENST00000302006.3	hg19	CCDS34132.1																																																																																			.	.		0.626	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178772259	178772260	+	In_Frame_Ins	INS	-	-	GCA	rs568040559|rs372468383|rs193247334	byFrequency	TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr5:178772259_178772260insGCA	ENST00000251582.7	-	1	171_172	c.70_71insTGC	c.(70-72)ccg>cTGCcg	p.23_24insL	ADAMTS2_ENST00000274609.5_In_Frame_Ins_p.23_24insL	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	23					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		gagcggcggcggcagcagcagc	0.812														904	0.180511	0.1135	0.1354	5008	,	,		3151	0.2718		0.1382	False		,,,				2504	0.2526				p.P24delinsLP		Atlas-INDEL	.											.	ADAMTS2	190	.	0			c.71_72insTGC						.																																			SO:0001652	inframe_insertion	9509	exon1			.	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.68_70dupTGC	chr5.hg19:g.178772266_178772268dupGCA	ENSP00000251582:p.Leu23_Leu23dup	2.0	1.0		14.0	10.0	NM_014244		In_Frame_Ins	INS	ENST00000251582.7	hg19	CCDS4444.1																																																																																			.	.		0.812	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
KLF15	28999	hgsc.bcm.edu	37	3	126071187	126071235	+	Frame_Shift_Del	DEL	GGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGT	GGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGT	-	rs374592098|rs538422160|rs201547298		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	GGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGT	GGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr3:126071187_126071235delGGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGT	ENST00000296233.3	-	2	761_809	c.531_579delACACAAGAGCCACCTCCATCCTGGGTCCAGCGGGAGAGAGCGCTGTTCC	c.(529-579)ccacacaagagccacctccatcctgggtccagcgggagagagcgctgttccfs	p.PHKSHLHPGSSGRERCS177fs	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	177					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		CTGGTGGAGGGGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGTGGCCCAGCTG	0.643																																					p.178_194del		Atlas-INDEL	.											.	KLF15	40	.	0			c.532_580del						.																																			SO:0001589	frameshift_variant	28999	exon2			.	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.531_579delACACAAGAGCCACCTCCATCCTGGGTCCAGCGGGAGAGAGCGCTGTTCC	chr3.hg19:g.126071187_126071235delGGAACAGCGCTCTCTCCCGCTGGACCCAGGATGGAGGTGGCTCTTGTGT	ENSP00000296233:p.Pro177fs	125.0	0.0		120.0	11.0	NM_014079		Frame_Shift_Del	DEL	ENST00000296233.3	hg19	CCDS3036.1																																																																																			.	.		0.643	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
DSPP	1834	hgsc.bcm.edu	37	4	88535860	88535861	+	In_Frame_Ins	INS	-	-	AGCAGCAGTAGCAGTGAC			TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr4:88535860_88535861insAGCAGCAGTAGCAGTGAC	ENST00000282478.7	+	4	2079_2080	c.2046_2047insAGCAGCAGTAGCAGTGAC	c.(2047-2049)agc>AGCAGCAGTAGCAGTGACagc	p.683_683S>SSSSSDS	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Ins_p.683_683S>SSSSSDS			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	683	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtagcagtgacagcagcaacag	0.475																																					p.D682delinsDSSSSSD		Atlas-INDEL	.											.	DSPP	174	.	0			c.2046_2047insAGCAGCAGTAGCAGTGAC						.																																			SO:0001652	inframe_insertion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2029_2046dupAGCAGCAGTAGCAGTGAC	chr4.hg19:g.88535860_88535861insAGCAGCAGTAGCAGTGAC	ENSP00000282478:p.SerSerSerSerAspSer683dup	218.0	0.0		202.0	27.0	NM_014208	A8MUI0|O95815	In_Frame_Ins	INS	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.475	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
MSH6	2956	hgsc.bcm.edu	37	2	48010529	48010544	+	Frame_Shift_Del	DEL	GCTGGGCCTGGGCCCA	GCTGGGCCTGGGCCCA	-	rs63751098		TCGA-DD-AACC-01A-11D-A40R-10	TCGA-DD-AACC-10A-01D-A40U-10	GCTGGGCCTGGGCCCA	GCTGGGCCTGGGCCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b2bc7ba7-16b9-4c71-9492-c0e1b05f9fec	145154db-d25e-4815-923c-613aace5297a	g.chr2:48010529_48010544delGCTGGGCCTGGGCCCA	ENST00000234420.5	+	1	309_324	c.157_172delGCTGGGCCTGGGCCCA	c.(157-174)gctgggcctgggcccaggfs	p.AGPGPR53fs	MSH6_ENST00000538136.1_5'Flank|MSH6_ENST00000540021.1_Frame_Shift_Del_p.AGPGPR53fs|RNU6-688P_ENST00000516063.1_RNA	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	53				AAPGASPSPGGDAAWSEAGPGP -> GCPRGLSFPRRGCGL ERGWAWA (in Ref. 2; BAA23674/BAA23675). {ECO:0000305}.	ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTGGAGCGAGGCTGGGCCTGGGCCCAGGCCCTTGGC	0.75			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.52_57del		Atlas-INDEL	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	341	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.156_171del	GRCh37	CM034828	MSH6	M	rs63751098	.																																			SO:0001589	frameshift_variant	2956	exon1	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	.	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.157_172delGCTGGGCCTGGGCCCA	chr2.hg19:g.48010529_48010544delGCTGGGCCTGGGCCCA	ENSP00000234420:p.Ala53fs	74.0	0.0		86.0	14.0	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Frame_Shift_Del	DEL	ENST00000234420.5	hg19	CCDS1836.1																																																																																			.	.		0.750	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
