#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPL11	6135	hgsc.bcm.edu	37	1	24020395	24020395	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:24020395G>T	ENST00000374550.3	+	3	301	c.256G>T	c.(256-258)Ggt>Tgt	p.G86C	RPL11_ENST00000482370.1_3'UTR	NM_000975.3|NM_001199802.1	NP_000966.2|NP_001186731.1	P62913	RL11_HUMAN	ribosomal protein L11	86					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein localization to nucleus (GO:0034504)|protein targeting (GO:0006605)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		CTTGGAGAAGGGTCTAAAGGT	0.428																																					p.G86C		Atlas-SNP	.											.	RPL11	21	.	0			c.G256T						.						107.0	90.0	96.0					1																	24020395		2203	4300	6503	SO:0001583	missense	6135	exon3			GAGAAGGGTCTAA	L05092	CCDS238.1	1p36.1-p35	2011-04-06			ENSG00000142676	ENSG00000142676		"""L ribosomal proteins"""	10301	protein-coding gene	gene with protein product		604175				9582194, 10343117	Standard	NM_000975		Approved	L11	uc001bhk.3	P62913	OTTHUMG00000002926	ENST00000374550.3:c.256G>T	chr1.hg19:g.24020395G>T	ENSP00000363676:p.Gly86Cys	68.0	0.0		96.0	43.0	NM_000975	P25121|P39026|Q8TDH2|Q9Y674	Missense_Mutation	SNP	ENST00000374550.3	hg19	CCDS238.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561797	0.86335	.	.	ENSG00000142676	ENST00000374550;ENST00000443624;ENST00000458455	T;T;T	0.77098	-1.07;-1.07;-1.07	5.47	5.47	0.80525	Ribosomal protein L5 domain (2);	0.000000	0.85682	D	0.000000	D	0.91858	0.7423	H	0.94620	3.56	0.80722	D	1	D;D	0.76494	0.992;0.999	D;D	0.83275	0.99;0.996	D	0.93767	0.7071	10	0.87932	D	0	-0.2468	19.3166	0.94216	0.0:0.0:1.0:0.0	.	85;86	P62913-2;P62913	.;RL11_HUMAN	C	86;84;84	ENSP00000363676:G86C;ENSP00000390839:G84C;ENSP00000398888:G84C	ENSP00000363676:G86C	G	+	1	0	RPL11	23892982	1.000000	0.71417	0.998000	0.56505	0.593000	0.36681	9.654000	0.98509	2.572000	0.86782	0.655000	0.94253	GGT	.	.		0.428	RPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008168.1	NM_000975	
IL22RA1	58985	hgsc.bcm.edu	37	1	24448089	24448089	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:24448089C>G	ENST00000270800.1	-	7	969	c.931G>C	c.(931-933)Gag>Cag	p.E311Q		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	311					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		CCTGCGGGCTCCCTGGGTCCA	0.632																																					p.E311Q		Atlas-SNP	.											.	IL22RA1	62	.	0			c.G931C						.						57.0	59.0	58.0					1																	24448089		2203	4300	6503	SO:0001583	missense	58985	exon7			CGGGCTCCCTGGG	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.931G>C	chr1.hg19:g.24448089C>G	ENSP00000270800:p.Glu311Gln	77.0	0.0		82.0	24.0	NM_021258	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	hg19	CCDS247.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711474	0.48517	.	.	ENSG00000142677	ENST00000270800	T	0.12672	2.66	4.89	4.89	0.63831	.	1.053850	0.07523	N	0.910839	T	0.25344	0.0616	L	0.32530	0.975	0.29920	N	0.822852	D;D	0.71674	0.998;0.994	P;P	0.59761	0.863;0.796	T	0.11036	-1.0604	10	0.37606	T	0.19	-7.6637	13.5568	0.61763	0.0:1.0:0.0:0.0	.	243;311	B4E2V9;Q8N6P7	.;I22R1_HUMAN	Q	311	ENSP00000270800:E311Q	ENSP00000270800:E311Q	E	-	1	0	IL22RA1	24320676	0.916000	0.31088	0.945000	0.38365	0.064000	0.16182	3.549000	0.53681	2.263000	0.75096	0.462000	0.41574	GAG	.	.		0.632	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1		
EPHA10	284656	hgsc.bcm.edu	37	1	38187384	38187384	+	Silent	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:38187384C>T	ENST00000373048.4	-	11	2093	c.2094G>A	c.(2092-2094)ctG>ctA	p.L698L	EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000427468.2_Silent_p.L698L|EPHA10_ENST00000330210.7_Silent_p.L193L|EPHA10_ENST00000540011.1_3'UTR	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	698	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CAAACTGGCCCAGCGTGAGGG	0.677																																					p.L698L		Atlas-SNP	.											.	EPHA10	120	.	0			c.G2094A						.						17.0	21.0	20.0					1																	38187384		2037	4177	6214	SO:0001819	synonymous_variant	284656	exon11			CTGGCCCAGCGTG	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2094G>A	chr1.hg19:g.38187384C>T		190.0	0.0		214.0	85.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	hg19	CCDS41305.1																																																																																			.	.		0.677	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
FOXE3	2301	hgsc.bcm.edu	37	1	47881990	47881990	+	Start_Codon_SNP	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:47881990G>A	ENST00000335071.2	+	1	247	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_012186.2	NP_036318.1	Q13461	FOXE3_HUMAN	forkhead box E3	1					camera-type eye development (GO:0043010)|cell development (GO:0048468)|positive regulation of epithelial cell proliferation (GO:0050679)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|upper_aerodigestive_tract(1)	5				READ - Rectum adenocarcinoma(2;0.0908)		CGCAGCCGATGGCGGGGCGCA	0.781																																					p.M1I		Atlas-SNP	.											.	FOXE3	8	.	0			c.G3A						.						1.0	1.0	1.0					1																	47881990		295	591	886	SO:0001582	initiator_codon_variant	2301	exon1			GCCGATGGCGGGG	AF275722	CCDS550.1	1p32	2008-02-05			ENSG00000186790	ENSG00000186790		"""Forkhead boxes"""	3808	protein-coding gene	gene with protein product		601094		FKHL12		8825632	Standard	NM_012186		Approved	FREAC8	uc001crk.3	Q13461	OTTHUMG00000007954	ENST00000335071.2:c.3G>A	chr1.hg19:g.47881990G>A	ENSP00000334472:p.Met1Ile	23.0	0.0		36.0	13.0	NM_012186	Q5SVY9|Q9NQV9	Missense_Mutation	SNP	ENST00000335071.2	hg19	CCDS550.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927314	0.34002	.	.	ENSG00000186790	ENST00000335071	D	0.92965	-3.14	3.6	1.6	0.23607	.	.	.	.	.	D	0.85177	0.5637	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.74642	-0.3597	8	0.87932	D	0	.	2.7508	0.05280	0.2502:0.0:0.5238:0.226	.	1	Q13461	FOXE3_HUMAN	I	1	ENSP00000334472:M1I	ENSP00000334472:M1I	M	+	3	0	FOXE3	47654577	0.087000	0.21565	0.000000	0.03702	0.012000	0.07955	0.298000	0.19120	0.172000	0.19760	0.471000	0.43371	ATG	.	.		0.781	FOXE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021836.1	NM_012186	Missense_Mutation
ELTD1	64123	hgsc.bcm.edu	37	1	79392770	79392770	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:79392770A>G	ENST00000370742.3	-	8	947	c.884T>C	c.(883-885)gTt>gCt	p.V295A		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	295					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGCAACTGCAACATTGCCTAT	0.269																																					p.V295A		Atlas-SNP	.											.	ELTD1	143	.	0			c.T884C						.						48.0	45.0	46.0					1																	79392770		1793	4068	5861	SO:0001583	missense	64123	exon8			ACTGCAACATTGC	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.884T>C	chr1.hg19:g.79392770A>G	ENSP00000359778:p.Val295Ala	122.0	0.0		128.0	49.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	hg19	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	a	12.24	1.877362	0.33162	.	.	ENSG00000162618	ENST00000370742	T	0.09911	2.93	6.02	2.44	0.29823	Domain of unknown function DUF3497 (1);	0.439444	0.26255	N	0.025421	T	0.04272	0.0118	L	0.58101	1.795	0.36834	D	0.887066	B	0.10296	0.003	B	0.20577	0.03	T	0.22208	-1.0223	9	.	.	.	.	9.4887	0.38946	0.8013:0.0:0.1987:0.0	.	295	Q9HBW9	ELTD1_HUMAN	A	295	ENSP00000359778:V295A	.	V	-	2	0	ELTD1	79165358	0.924000	0.31332	0.993000	0.49108	0.984000	0.73092	1.698000	0.37794	0.169000	0.19679	0.445000	0.29226	GTT	.	.		0.269	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
FLG	2312	hgsc.bcm.edu	37	1	152277071	152277071	+	Missense_Mutation	SNP	G	G	T	rs545185518		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:152277071G>T	ENST00000368799.1	-	3	10326	c.10291C>A	c.(10291-10293)Cag>Aag	p.Q3431K	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3431	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGGTGTCCTGACCCTCTTGG	0.607									Ichthyosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		19214	0.0		0.0	False		,,,				2504	0.001				p.Q3431K		Atlas-SNP	.											.	FLG	900	.	0			c.C10291A						.						252.0	259.0	257.0					1																	152277071		2203	4299	6502	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGTCCTGACCCTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10291C>A	chr1.hg19:g.152277071G>T	ENSP00000357789:p.Gln3431Lys	65.0	0.0		171.0	14.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828712	0.32329	.	.	ENSG00000143631	ENST00000368799	T	0.01629	4.72	4.06	1.94	0.25998	.	.	.	.	.	T	0.02494	0.0076	M	0.79805	2.47	0.09310	N	1	D	0.57571	0.98	D	0.71656	0.974	T	0.22138	-1.0225	9	0.06365	T	0.9	.	9.9333	0.41537	0.0:0.4413:0.5587:0.0	.	3431	P20930	FILA_HUMAN	K	3431	ENSP00000357789:Q3431K	ENSP00000357789:Q3431K	Q	-	1	0	FLG	150543695	0.000000	0.05858	0.009000	0.14445	0.031000	0.12232	-0.088000	0.11198	0.818000	0.34468	0.454000	0.30748	CAG	.	.		0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156908219	156908219	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:156908219T>A	ENST00000361409.2	-	37	4805	c.4063A>T	c.(4063-4065)Aag>Tag	p.K1355*	ARHGEF11_ENST00000315174.8_Nonsense_Mutation_p.K771*|MIR765_ENST00000390226.1_RNA|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Nonsense_Mutation_p.K1395*	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1355					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCGTAGCCTTTGTTCCGCCT	0.582																																					p.K1395X		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.A4183T						.						112.0	97.0	102.0					1																	156908219		2203	4300	6503	SO:0001587	stop_gained	9826	exon38			TAGCCTTTGTTCC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4063A>T	chr1.hg19:g.156908219T>A	ENSP00000354644:p.Lys1355*	40.0	0.0		133.0	98.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Nonsense_Mutation	SNP	ENST00000361409.2	hg19	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	T	48	14.397898	0.99793	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	.	.	.	5.35	-3.43	0.04810	.	0.579300	0.15749	N	0.246528	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-6.9366	6.3238	0.21232	0.0:0.2319:0.325:0.443	.	.	.	.	X	1395;1355;771	.	ENSP00000313470:K771X	K	-	1	0	ARHGEF11	155174843	0.620000	0.27068	0.954000	0.39281	0.988000	0.76386	-0.524000	0.06222	-0.517000	0.06461	0.533000	0.62120	AAG	.	.		0.582	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
DUSP27	92235	hgsc.bcm.edu	37	1	167097070	167097070	+	Missense_Mutation	SNP	G	G	T	rs61748781	byFrequency	TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:167097070G>T	ENST00000361200.2	+	6	2868	c.2702G>T	c.(2701-2703)cGc>cTc	p.R901L	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.R901L|DUSP27_ENST00000443333.1_Missense_Mutation_p.R901L			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	901	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TATTCTTCCCGCAGTAATTCC	0.498																																					p.R901L		Atlas-SNP	.											.	DUSP27	235	.	0			c.G2702T						.						93.0	82.0	86.0					1																	167097070		2203	4300	6503	SO:0001583	missense	92235	exon5			CTTCCCGCAGTAA	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2702G>T	chr1.hg19:g.167097070G>T	ENSP00000354483:p.Arg901Leu	42.0	0.0		111.0	78.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639224	0.29157	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03607	3.87;3.87;3.87	5.25	2.11	0.27256	.	2.098730	0.01678	N	0.025950	T	0.02047	0.0064	L	0.51422	1.61	0.34339	D	0.68856	B	0.32893	0.389	B	0.32090	0.14	T	0.20273	-1.0280	10	0.87932	D	0	-7.7281	7.5309	0.27683	0.4518:0.0:0.5482:0.0	.	901	Q5VZP5	DUS27_HUMAN	L	901	ENSP00000354483:R901L;ENSP00000271385:R901L;ENSP00000404874:R901L	ENSP00000271385:R901L	R	+	2	0	DUSP27	165363694	0.989000	0.36119	0.998000	0.56505	0.817000	0.46193	0.818000	0.27295	0.482000	0.27582	-0.148000	0.13756	CGC	.	G|0.987;A|0.013		0.498	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
DHX9	1660	hgsc.bcm.edu	37	1	182856333	182856333	+	Missense_Mutation	SNP	G	G	T	rs533935555		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:182856333G>T	ENST00000367549.3	+	28	3687	c.3577G>T	c.(3577-3579)Ggc>Tgc	p.G1193C	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1193	NTD.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TAGCAGTGGAGGCTATGGTAG	0.562																																					p.G1193C	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.G3577T						.						107.0	119.0	115.0					1																	182856333		1991	4170	6161	SO:0001583	missense	1660	exon28			AGTGGAGGCTATG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3577G>T	chr1.hg19:g.182856333G>T	ENSP00000356520:p.Gly1193Cys	126.0	0.0		109.0	5.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.024993	0.35701	.	.	ENSG00000135829	ENST00000367549	D	0.84873	-1.91	4.18	4.18	0.49190	.	0.000000	0.56097	U	0.000029	D	0.83764	0.5325	N	0.08118	0	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.86659	0.1903	10	0.54805	T	0.06	.	14.0001	0.64429	0.0:0.0:1.0:0.0	.	472;1193	B3KU66;Q08211	.;DHX9_HUMAN	C	1193	ENSP00000356520:G1193C	ENSP00000356520:G1193C	G	+	1	0	DHX9	181122956	1.000000	0.71417	0.864000	0.33941	0.659000	0.38960	8.554000	0.90689	1.862000	0.54008	0.561000	0.74099	GGC	.	.		0.562	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
KIF14	9928	hgsc.bcm.edu	37	1	200522691	200522691	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:200522691A>G	ENST00000367350.4	-	30	5210	c.4772T>C	c.(4771-4773)tTg>tCg	p.L1591S		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1591	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						CCAGGGTTTCAACAAATCAGG	0.393																																					p.L1591S		Atlas-SNP	.											.	KIF14	156	.	0			c.T4772C						.						127.0	115.0	119.0					1																	200522691		2203	4300	6503	SO:0001583	missense	9928	exon30			GGTTTCAACAAAT	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.4772T>C	chr1.hg19:g.200522691A>G	ENSP00000356319:p.Leu1591Ser	173.0	0.0		428.0	291.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	hg19	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	A	9.432	1.085785	0.20390	.	.	ENSG00000118193	ENST00000367350	T	0.74106	-0.81	5.59	-5.22	0.02806	.	0.830394	0.10390	N	0.680579	T	0.53514	0.1801	L	0.31294	0.92	0.09310	N	1	B	0.18461	0.028	B	0.14578	0.011	T	0.35699	-0.9778	10	0.18276	T	0.48	.	7.0655	0.25149	0.2982:0.3512:0.3506:0.0	.	1591	Q15058	KIF14_HUMAN	S	1591	ENSP00000356319:L1591S	ENSP00000356319:L1591S	L	-	2	0	KIF14	198789314	0.001000	0.12720	0.000000	0.03702	0.492000	0.33523	0.739000	0.26173	-1.346000	0.02211	0.533000	0.62120	TTG	.	.		0.393	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
RYR2	6262	hgsc.bcm.edu	37	1	237961396	237961396	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr1:237961396G>A	ENST00000366574.2	+	97	14333	c.14016G>A	c.(14014-14016)atG>atA	p.M4672I	RYR2_ENST00000360064.6_Missense_Mutation_p.M4678I|RYR2_ENST00000542537.1_Missense_Mutation_p.M4656I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4672					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TACTTGGCATGGACAAGGCAG	0.433																																					p.M4672I		Atlas-SNP	.											.	RYR2	1273	.	0			c.G14016A						.						97.0	100.0	99.0					1																	237961396		1914	4127	6041	SO:0001583	missense	6262	exon97			TGGCATGGACAAG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14016G>A	chr1.hg19:g.237961396G>A	ENSP00000355533:p.Met4672Ile	117.0	0.0		246.0	189.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280352	0.59758	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000536033	D;D;D	0.91631	-2.88;-2.88;-2.88	5.72	5.72	0.89469	.	0.000000	0.85682	U	0.000000	D	0.90466	0.7014	L	0.49126	1.545	0.58432	D	0.999998	B;B	0.25667	0.002;0.131	B;B	0.19946	0.011;0.027	D	0.87163	0.2216	10	0.62326	D	0.03	.	19.8806	0.96895	0.0:0.0:1.0:0.0	.	105;4672	F5H3C7;Q92736	.;RYR2_HUMAN	I	4672;4678;4656;105	ENSP00000355533:M4672I;ENSP00000353174:M4678I;ENSP00000443798:M4656I	ENSP00000353174:M4678I	M	+	3	0	RYR2	236028019	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.809000	0.86057	2.704000	0.92352	0.650000	0.86243	ATG	.	.		0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CENPA	1058	hgsc.bcm.edu	37	2	27015082	27015082	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:27015082A>G	ENST00000335756.4	+	2	384	c.184A>G	c.(184-186)Ata>Gta	p.I62V	CENPA_ENST00000233505.8_Missense_Mutation_p.I62V|CENPA_ENST00000475662.1_3'UTR	NM_001809.3	NP_001800.1	P49450	CENPA_HUMAN	centromere protein A	62	H3-like.				CENP-A containing nucleosome assembly (GO:0034080)|establishment of mitotic spindle orientation (GO:0000132)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|protein localization to chromosome, centromeric region (GO:0071459)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|condensed chromosome inner kinetochore (GO:0000939)|condensed nuclear chromosome kinetochore (GO:0000778)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(3)|lung(3)|urinary_tract(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACACCTCTTGATAAGGAAGCT	0.527																																					p.I62V	Pancreas(28;769 878 30250 30578 41330)	Atlas-SNP	.											.	CENPA	13	.	0			c.A184G						.						64.0	60.0	61.0					2																	27015082		2203	4300	6503	SO:0001583	missense	1058	exon2			CTCTTGATAAGGA	U14518	CCDS1729.1, CCDS42662.1	2p23.3	2013-11-05	2006-06-16		ENSG00000115163	ENSG00000115163			1851	protein-coding gene	gene with protein product	"""centromere-specific histone"", ""histone H3-like centromeric protein A"""	117139	"""centromere protein A (17kD)"", ""centromere protein A, 17kDa"""				Standard	NM_001042426		Approved	CENP-A, CenH3	uc002rhr.3	P49450	OTTHUMG00000097073	ENST00000335756.4:c.184A>G	chr2.hg19:g.27015082A>G	ENSP00000336868:p.Ile62Val	89.0	0.0		90.0	32.0	NM_001042426	D6W544|Q53T74|Q9BVW2	Missense_Mutation	SNP	ENST00000335756.4	hg19	CCDS1729.1	.	.	.	.	.	.	.	.	.	.	A	16.69	3.193222	0.58017	.	.	ENSG00000115163	ENST00000335756;ENST00000233505	T;T	0.50548	0.74;0.74	5.7	-11.4	0.00090	Histone-fold (2);Histone core (1);	0.534882	0.18069	N	0.152694	T	0.45034	0.1322	M	0.85859	2.78	0.09310	N	1	B;B	0.31351	0.32;0.279	B;B	0.39068	0.091;0.289	T	0.46693	-0.9173	10	0.72032	D	0.01	-17.6173	8.2788	0.31887	0.3967:0.4436:0.0:0.1597	.	62;62	P49450-2;P49450	.;CENPA_HUMAN	V	62	ENSP00000336868:I62V;ENSP00000233505:I62V	ENSP00000233505:I62V	I	+	1	0	CENPA	26868586	0.000000	0.05858	0.000000	0.03702	0.411000	0.31082	-4.525000	0.00221	-1.847000	0.01173	-0.309000	0.09137	ATA	.	.		0.527	CENPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214190.2	NM_001809	
R3HDM1	23518	hgsc.bcm.edu	37	2	136437817	136437817	+	Silent	SNP	T	T	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:136437817T>A	ENST00000264160.4	+	20	2647	c.2277T>A	c.(2275-2277)tcT>tcA	p.S759S	R3HDM1_ENST00000410054.1_Silent_p.S704S|R3HDM1_ENST00000409606.1_Silent_p.S760S|R3HDM1_ENST00000409478.1_Silent_p.S631S|R3HDM1_ENST00000329971.3_Silent_p.S630S	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	759							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		CTAATCAGTCTAATCAAGGAT	0.388																																					p.S759S		Atlas-SNP	.											.	R3HDM1	84	.	0			c.T2277A						.						135.0	131.0	133.0					2																	136437817		2203	4300	6503	SO:0001819	synonymous_variant	23518	exon20			TCAGTCTAATCAA	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.2277T>A	chr2.hg19:g.136437817T>A		114.0	0.0		133.0	56.0	NM_015361	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Silent	SNP	ENST00000264160.4	hg19	CCDS2177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.41|10.41	1.341281|1.341281	0.24339|0.24339	.|.	.|.	ENSG00000048991|ENSG00000048991	ENST00000445855|ENST00000429703	.|.	.|.	.|.	5.99|5.99	3.64|3.64	0.41730|0.41730	.|.	.|.	.|.	.|.	.|.	T|.	0.47655|.	0.1457|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.40308|.	-0.9570|.	4|.	.|.	.|.	.|.	-1.9477|-1.9477	4.0916|4.0916	0.09972|0.09972	0.1457:0.2934:0.0:0.561|0.1457:0.2934:0.0:0.561	.|.	.|.	.|.	.|.	Q|K	55|483	.|.	.|.	L|X	+|+	2|1	0|0	R3HDM1|R3HDM1	136154287|136154287	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	0.704000|0.704000	0.25661|0.25661	1.077000|1.077000	0.40990|0.40990	0.533000|0.533000	0.62120|0.62120	CTA|TAA	.	.		0.388	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	
ITGB6	3694	hgsc.bcm.edu	37	2	161052096	161052096	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:161052096C>T	ENST00000283249.2	-	4	614	c.377G>A	c.(376-378)cGc>cAc	p.R126H	ITGB6_ENST00000409872.1_Missense_Mutation_p.R126H|ITGB6_ENST00000409967.2_Missense_Mutation_p.R126H|ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000428609.2_Missense_Mutation_p.R84H	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	126					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						CTCAGTCTGGCGGACATGCAC	0.537																																					p.R126H		Atlas-SNP	.											.	ITGB6	68	.	0			c.G377A						.						79.0	72.0	74.0					2																	161052096		2203	4300	6503	SO:0001583	missense	3694	exon4			GTCTGGCGGACAT		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.377G>A	chr2.hg19:g.161052096C>T	ENSP00000283249:p.Arg126His	58.0	0.0		58.0	16.0	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	hg19	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781161	0.90282	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	6.05	6.05	0.98169	Integrin beta subunit, N-terminal (2);	0.110420	0.64402	D	0.000004	D	0.96087	0.8725	M	0.63428	1.95	0.54753	D	0.99998	D;D	0.71674	0.998;0.998	D;D	0.65773	0.938;0.938	D	0.95193	0.8310	10	0.51188	T	0.08	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	84;126	E9PEE8;P18564	.;ITB6_HUMAN	H	126;84;126;126	ENSP00000283249:R126H;ENSP00000408024:R84H;ENSP00000386828:R126H;ENSP00000386367:R126H	ENSP00000283249:R126H	R	-	2	0	ITGB6	160760342	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.991000	0.56973	2.878000	0.98634	0.650000	0.86243	CGC	.	.		0.537	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
STK39	27347	hgsc.bcm.edu	37	2	168986092	168986092	+	Silent	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:168986092G>A	ENST00000355999.4	-	10	1753	c.1048C>T	c.(1048-1050)Ctg>Ttg	p.L350L		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	350					cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						CTTGTAAGCAGCTTCTCAATC	0.398																																					p.L350L		Atlas-SNP	.											.	STK39	95	.	0			c.C1048T						.						311.0	284.0	292.0					2																	168986092		1898	4112	6010	SO:0001819	synonymous_variant	27347	exon10			TAAGCAGCTTCTC	AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.1048C>T	chr2.hg19:g.168986092G>A		128.0	0.0		169.0	59.0	NM_013233	O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Silent	SNP	ENST00000355999.4	hg19	CCDS42770.1																																																																																			.	.		0.398	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258112.2	NM_013233	
TTN	7273	hgsc.bcm.edu	37	2	179455790	179455790	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:179455790A>C	ENST00000591111.1	-	254	55963	c.55739T>G	c.(55738-55740)gTt>gGt	p.V18580G	TTN_ENST00000589042.1_Missense_Mutation_p.V20221G|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V17653G|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V11348G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V11281G|TTN_ENST00000460472.2_Missense_Mutation_p.V11156G|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18580	Fibronectin type-III 34. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAAGAGACAACACCCCACGT	0.433																																					p.V20221G		Atlas-SNP	.											.	TTN	18412	.	0			c.T60662G						.						151.0	146.0	148.0					2																	179455790		1893	4116	6009	SO:0001583	missense	7273	exon304			GAGACAACACCCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55739T>G	chr2.hg19:g.179455790A>C	ENSP00000465570:p.Val18580Gly	109.0	0.0		150.0	28.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.761	1.170205	0.21621	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	6.11	6.11	0.99139	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46092	0.1375	L	0.33710	1.025	0.80722	D	1	B;B;B;B	0.09022	0.002;0.002;0.002;0.002	B;B;B;B	0.08055	0.003;0.003;0.003;0.003	T	0.35574	-0.9783	9	0.87932	D	0	.	16.7021	0.85357	1.0:0.0:0.0:0.0	.	11156;11281;11348;18580	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	17653;11156;11348;11281;11154	ENSP00000343764:V17653G;ENSP00000434586:V11156G;ENSP00000340554:V11348G;ENSP00000352154:V11281G	ENSP00000340554:V11348G	V	-	2	0	TTN	179164036	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.756000	0.68757	2.343000	0.79666	0.533000	0.62120	GTT	.	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FAM171B	165215	hgsc.bcm.edu	37	2	187559065	187559065	+	Silent	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:187559065G>A	ENST00000304698.5	+	1	368	c.165G>A	c.(163-165)caG>caA	p.Q55Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	55	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						aacaacaacagcaaaagcagc	0.642																																					p.Q55Q		Atlas-SNP	.											.	FAM171B	146	.	0			c.G165A						.						28.0	31.0	30.0					2																	187559065		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			ACAACAGCAAAAG	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.165G>A	chr2.hg19:g.187559065G>A		109.0	0.0		116.0	8.0	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	hg19	CCDS33347.1																																																																																			.	.		0.642	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
COL3A1	1281	hgsc.bcm.edu	37	2	189873710	189873710	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:189873710T>C	ENST00000304636.3	+	48	3756	c.3586T>C	c.(3586-3588)Tgc>Cgc	p.C1196R	COL3A1_ENST00000317840.5_Missense_Mutation_p.C893R	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1196	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	CCCTGGTCCTTGCTGTGGTGG	0.537																																					p.C1196R		Atlas-SNP	.											.	COL3A1	292	.	0			c.T3586C						.						67.0	75.0	72.0					2																	189873710		2203	4300	6503	SO:0001583	missense	1281	exon48			GGTCCTTGCTGTG	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3586T>C	chr2.hg19:g.189873710T>C	ENSP00000304408:p.Cys1196Arg	128.0	0.0		173.0	70.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	hg19	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	T	14.67	2.604879	0.46423	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.96522	-4.04;-4.04	5.54	5.54	0.83059	.	0.000000	0.56097	D	0.000026	D	0.96959	0.9007	M	0.80508	2.5	0.38538	D	0.949147	D	0.55800	0.973	P	0.53224	0.721	D	0.96981	0.9715	10	0.19590	T	0.45	.	15.6737	0.77297	0.0:0.0:0.0:1.0	.	1196	P02461	CO3A1_HUMAN	R	1196;893	ENSP00000304408:C1196R;ENSP00000315243:C893R	ENSP00000304408:C1196R	C	+	1	0	COL3A1	189581955	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	5.919000	0.70005	2.103000	0.63969	0.533000	0.62120	TGC	.	.		0.537	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209195391	209195391	+	Silent	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr2:209195391A>G	ENST00000264380.4	+	23	4094	c.3936A>G	c.(3934-3936)acA>acG	p.T1312T		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1312					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CAATTCTTACATATTCCTGGT	0.363																																					p.T1312T		Atlas-SNP	.											.	PIKFYVE	223	.	0			c.A3936G						.						161.0	162.0	162.0					2																	209195391		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon23			TCTTACATATTCC	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.3936A>G	chr2.hg19:g.209195391A>G		88.0	0.0		75.0	34.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	hg19	CCDS2382.1																																																																																			.	.		0.363	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64132537	64132537	+	Silent	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr3:64132537G>T	ENST00000295902.6	-	7	2214	c.1629C>A	c.(1627-1629)tcC>tcA	p.S543S	PRICKLE2_ENST00000564377.1_Silent_p.S599S	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	543					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGGATTCCATGGAGCCCCGAG	0.557																																					p.S543S		Atlas-SNP	.											.	PRICKLE2	88	.	0			c.C1629A						.						69.0	71.0	70.0					3																	64132537		2203	4300	6503	SO:0001819	synonymous_variant	166336	exon7			TTCCATGGAGCCC	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1629C>A	chr3.hg19:g.64132537G>T		60.0	0.0		63.0	25.0	NM_198859	Q0VF44	Silent	SNP	ENST00000295902.6	hg19	CCDS2902.1																																																																																			.	.		0.557	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376412	113376412	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr3:113376412T>C	ENST00000478658.1	-	5	4134	c.4117A>G	c.(4117-4119)Atg>Gtg	p.M1373V	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.M1373V			Q68DE3	K2018_HUMAN	KIAA2018	1373						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CTGACCATCATTTGAGTTTGG	0.468																																					p.M1373V		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A4117G						.						104.0	102.0	103.0					3																	113376412		1989	4160	6149	SO:0001583	missense	205717	exon7			CCATCATTTGAGT	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4117A>G	chr3.hg19:g.113376412T>C	ENSP00000420721:p.Met1373Val	76.0	0.0		82.0	37.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.766023	0.31228	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.19105	2.17;2.17	5.68	4.54	0.55810	.	0.182532	0.64402	D	0.000018	T	0.13841	0.0335	L	0.34521	1.04	0.53005	D	0.999969	B	0.16396	0.017	B	0.12837	0.008	T	0.05053	-1.0909	10	0.07644	T	0.81	-5.2402	11.0849	0.48080	0.0:0.0721:0.0:0.9278	.	1373	Q68DE3	K2018_HUMAN	V	1373	ENSP00000320794:M1373V;ENSP00000420721:M1373V	ENSP00000320794:M1373V	M	-	1	0	KIAA2018	114859102	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	3.851000	0.55926	2.169000	0.68431	0.402000	0.26972	ATG	.	.		0.468	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
GFM1	85476	hgsc.bcm.edu	37	3	158363556	158363556	+	Missense_Mutation	SNP	G	G	C	rs140377587	byFrequency	TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr3:158363556G>C	ENST00000486715.1	+	2	577	c.220G>C	c.(220-222)Gca>Cca	p.A74P	GFM1_ENST00000264263.5_Missense_Mutation_p.A74P|GFM1_ENST00000478576.1_Missense_Mutation_p.A74P	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TGGCAGAATTGCAAAGATGCA	0.323																																					p.A74P		Atlas-SNP	.											.	GFM1	83	.	0			c.G220C						.						120.0	122.0	121.0					3																	158363556		2203	4300	6503	SO:0001583	missense	85476	exon2			AGAATTGCAAAGA	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.220G>C	chr3.hg19:g.158363556G>C	ENSP00000419038:p.Ala74Pro	115.0	0.0		108.0	43.0	NM_024996		Missense_Mutation	SNP	ENST00000486715.1	hg19	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483722	0.84854	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.74002	-0.8;-0.8;-0.8	5.68	5.68	0.88126	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.78136	0.4236	L	0.37507	1.11	0.80722	D	1	P;P	0.47677	0.757;0.899	P;P	0.53102	0.718;0.718	T	0.79507	-0.1775	10	0.72032	D	0.01	-4.6008	19.8773	0.96884	0.0:0.0:1.0:0.0	.	74;74	Q96RP9;C9IZ01	EFGM_HUMAN;.	P	74	ENSP00000419038:A74P;ENSP00000418755:A74P;ENSP00000264263:A74P	ENSP00000264263:A74P	A	+	1	0	GFM1	159846250	1.000000	0.71417	0.691000	0.30163	0.968000	0.65278	6.049000	0.71053	2.687000	0.91594	0.650000	0.86243	GCA	.	G|0.998;T|0.002		0.323	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
KIAA1211	57482	hgsc.bcm.edu	37	4	57173769	57173769	+	Silent	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr4:57173769C>T	ENST00000504228.1	+	3	294	c.189C>T	c.(187-189)aaC>aaT	p.N63N	KIAA1211_ENST00000264229.6_Silent_p.N63N|KIAA1211_ENST00000541073.1_Silent_p.N56N			Q6ZU35	K1211_HUMAN	KIAA1211	63										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					ATAAGGCAAACAGTGGAGAGG	0.478																																					p.N63N		Atlas-SNP	.											.	KIAA1211	178	.	0			c.C189T						.						89.0	90.0	90.0					4																	57173769		2001	4167	6168	SO:0001819	synonymous_variant	57482	exon5			GGCAAACAGTGGA	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.189C>T	chr4.hg19:g.57173769C>T		86.0	0.0		107.0	35.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	hg19	CCDS43230.1																																																																																			.	.		0.478	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
TMPRSS11D	9407	hgsc.bcm.edu	37	4	68703989	68703989	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr4:68703989T>C	ENST00000283916.6	-	5	474	c.376A>G	c.(376-378)Aac>Gac	p.N126D	TMPRSS11D_ENST00000509584.1_5'UTR|TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.N9D|UBA6-AS1_ENST00000500538.2_RNA	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	126	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GCTCCATTGTTATTTCTAGTG	0.333																																					p.N126D		Atlas-SNP	.											.	TMPRSS11D	68	.	0			c.A376G						.						97.0	91.0	93.0					4																	68703989		2202	4300	6502	SO:0001583	missense	9407	exon5			CATTGTTATTTCT	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.376A>G	chr4.hg19:g.68703989T>C	ENSP00000283916:p.Asn126Asp	91.0	0.0		114.0	43.0	NM_004262	Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	hg19	CCDS3518.1	.	.	.	.	.	.	.	.	.	.	T	10.99	1.507216	0.27036	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	T;D	0.87571	1.61;-2.27	5.16	3.94	0.45596	SEA (3);	0.457587	0.20162	N	0.097923	D	0.85159	0.5633	L	0.52206	1.635	0.09310	N	1	P	0.51537	0.946	P	0.51487	0.671	T	0.73547	-0.3948	10	0.14252	T	0.57	.	8.3659	0.32387	0.1752:0.0:0.0:0.8248	.	126	O60235	TM11D_HUMAN	D	126;9	ENSP00000283916:N126D;ENSP00000442045:N9D	ENSP00000283916:N126D	N	-	1	0	TMPRSS11D	68386584	0.000000	0.05858	0.008000	0.14137	0.974000	0.67602	0.472000	0.22116	0.869000	0.35703	0.533000	0.62120	AAC	.	.		0.333	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262	
ADH4	127	hgsc.bcm.edu	37	4	100057655	100057655	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr4:100057655A>C	ENST00000265512.7	-	5	618	c.544T>G	c.(544-546)Ttt>Gtt	p.F182V	ADH4_ENST00000423445.1_Missense_Mutation_p.F201V|RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000508393.1_Missense_Mutation_p.F201V|ADH4_ENST00000505590.1_Missense_Mutation_p.F201V	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	182					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		CCAGTTGAAAACCCACATCCA	0.403																																					p.F182V		Atlas-SNP	.											.	ADH4	35	.	0			c.T544G						.						190.0	169.0	176.0					4																	100057655		2203	4300	6503	SO:0001583	missense	127	exon5			TTGAAAACCCACA	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.544T>G	chr4.hg19:g.100057655A>C	ENSP00000265512:p.Phe182Val	70.0	0.0		80.0	31.0	NM_000670	A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	hg19	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	A	8.932	0.963597	0.18583	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590;ENST00000512499;ENST00000504125	T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;4.06;4.06	4.55	4.55	0.56014	GroES-like (1);	0.238899	0.35179	N	0.003399	T	0.16769	0.0403	N	0.16656	0.425	0.41841	D	0.99012	B;B	0.30727	0.185;0.292	B;B	0.42995	0.362;0.404	T	0.02676	-1.1125	10	0.02654	T	1	-12.4301	14.0991	0.65042	1.0:0.0:0.0:0.0	.	201;182	P08319-2;P08319	.;ADH4_HUMAN	V	201;182;201;201;201;164	ENSP00000424630:F201V;ENSP00000265512:F182V;ENSP00000397939:F201V;ENSP00000425416:F201V;ENSP00000423571:F201V;ENSP00000427525:F164V	ENSP00000265512:F182V	F	-	1	0	ADH4	100276678	0.846000	0.29590	0.880000	0.34516	0.713000	0.41058	1.683000	0.37638	1.925000	0.55765	0.528000	0.53228	TTT	.	.		0.403	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	
NUDT6	11162	hgsc.bcm.edu	37	4	123814266	123814266	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr4:123814266A>G	ENST00000304430.5	-	5	701	c.668T>C	c.(667-669)aTg>aCg	p.M223T	FGF2_ENST00000608478.1_3'UTR|NUDT6_ENST00000502270.1_Missense_Mutation_p.M54T|NUDT6_ENST00000339154.2_Missense_Mutation_p.M54T|NUDT6_ENST00000608639.1_5'Flank|FGF2_ENST00000264498.3_3'UTR	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	223	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)			endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						GATGATATACATATCTGACTT	0.423																																					p.M223T		Atlas-SNP	.											.	NUDT6	50	.	0			c.T668C						.						107.0	108.0	108.0					4																	123814266		2203	4300	6503	SO:0001583	missense	11162	exon5			ATATACATATCTG	AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.668T>C	chr4.hg19:g.123814266A>G	ENSP00000306070:p.Met223Thr	52.0	0.0		63.0	26.0	NM_007083	A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	ENST00000304430.5	hg19	CCDS43268.1	.	.	.	.	.	.	.	.	.	.	A	17.94	3.511451	0.64522	.	.	ENSG00000170917	ENST00000304430;ENST00000339154;ENST00000502270	T;T;T	0.27104	1.69;1.69;1.69	5.41	4.16	0.48862	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.129061	0.64402	D	0.000002	T	0.34019	0.0883	L	0.56769	1.78	0.58432	D	0.999999	P	0.43633	0.813	P	0.48552	0.581	T	0.15578	-1.0432	10	0.87932	D	0	-9.9271	11.2964	0.49280	0.8637:0.0:0.0:0.1363	.	223	P53370	NUDT6_HUMAN	T	223;54;54	ENSP00000306070:M223T;ENSP00000344011:M54T;ENSP00000424117:M54T	ENSP00000306070:M223T	M	-	2	0	NUDT6	124033716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.508000	0.73721	2.054000	0.61138	0.528000	0.53228	ATG	.	.		0.423	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095331.3	NM_007083	
FGA	2243	hgsc.bcm.edu	37	4	155507834	155507834	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr4:155507834C>G	ENST00000302053.3	-	5	825	c.747G>C	c.(745-747)aaG>aaC	p.K249N	FGA_ENST00000403106.3_Missense_Mutation_p.K249N	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	249					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CTGTTAATGCCTTCCACTCTG	0.473																																					p.K249N	NSCLC(143;340 1922 20892 22370 48145)	Atlas-SNP	.											.	FGA	179	.	0			c.G747C						.						132.0	138.0	136.0					4																	155507834		2203	4300	6503	SO:0001583	missense	2243	exon5			TAATGCCTTCCAC		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.747G>C	chr4.hg19:g.155507834C>G	ENSP00000306361:p.Lys249Asn	101.0	0.0		104.0	37.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	hg19	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594928	0.28445	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.61980	0.06;0.06	5.43	-2.1	0.07210	.	3.162610	0.00424	N	0.000078	T	0.50069	0.1594	L	0.45698	1.435	0.09310	N	1	B;B	0.15473	0.003;0.013	B;B	0.12156	0.007;0.003	T	0.15665	-1.0429	10	0.38643	T	0.18	.	0.3637	0.00368	0.2467:0.2719:0.2277:0.2537	.	249;249	P02671-2;P02671	.;FIBA_HUMAN	N	249	ENSP00000306361:K249N;ENSP00000385981:K249N	ENSP00000306361:K249N	K	-	3	2	FGA	155727284	0.000000	0.05858	0.010000	0.14722	0.024000	0.10985	-0.849000	0.04322	-0.131000	0.11578	0.655000	0.94253	AAG	.	.		0.473	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
DNAH5	1767	hgsc.bcm.edu	37	5	13876819	13876819	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:13876819T>A	ENST00000265104.4	-	22	3474	c.3370A>T	c.(3370-3372)Agc>Tgc	p.S1124C	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1124	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATAATTGTGCTAAGCACAGAA	0.388									Kartagener syndrome																												p.S1124C		Atlas-SNP	.											.	DNAH5	868	.	0			c.A3370T						.						127.0	129.0	128.0					5																	13876819		2203	4300	6503	SO:0001583	missense	1767	exon22	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TTGTGCTAAGCAC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3370A>T	chr5.hg19:g.13876819T>A	ENSP00000265104:p.Ser1124Cys	163.0	0.0		145.0	69.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.016737	0.54468	.	.	ENSG00000039139	ENST00000265104	T	0.25749	1.78	5.6	4.44	0.53790	.	0.079143	0.85682	D	0.000000	T	0.30039	0.0752	M	0.71036	2.16	0.51233	D	0.999918	B	0.13145	0.007	B	0.16722	0.016	T	0.08207	-1.0733	10	0.59425	D	0.04	.	11.699	0.51560	0.0:0.0694:0.0:0.9306	.	1124	Q8TE73	DYH5_HUMAN	C	1124	ENSP00000265104:S1124C	ENSP00000265104:S1124C	S	-	1	0	DNAH5	13929819	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	5.670000	0.68088	1.066000	0.40716	0.533000	0.62120	AGC	.	.		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
C5orf42	65250	hgsc.bcm.edu	37	5	37213755	37213755	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:37213755C>A	ENST00000508244.1	-	15	2919	c.2826G>T	c.(2824-2826)atG>atT	p.M942I	C5orf42_ENST00000425232.2_Missense_Mutation_p.M942I|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	942						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TGAAACGAGCCATGGACTGGA	0.478																																					p.M942I		Atlas-SNP	.											.	C5orf42	422	.	0			c.G2826T						.						104.0	86.0	91.0					5																	37213755		692	1591	2283	SO:0001583	missense	65250	exon16			ACGAGCCATGGAC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2826G>T	chr5.hg19:g.37213755C>A	ENSP00000421690:p.Met942Ile	390.0	1.0		417.0	164.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762870	0.69763	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.27557	1.66;1.66	5.44	5.44	0.79542	.	0.079006	0.52532	U	0.000067	T	0.47154	0.1430	M	0.73598	2.24	0.80722	D	1	D	0.59767	0.986	P	0.53593	0.73	T	0.49370	-0.8947	10	0.59425	D	0.04	-13.5991	13.5522	0.61738	0.0:0.9251:0.0:0.0749	.	942	E9PH94	.	I	942	ENSP00000421690:M942I;ENSP00000389014:M942I	ENSP00000389014:M942I	M	-	3	0	C5orf42	37249512	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.652000	0.46682	2.542000	0.85734	0.491000	0.48974	ATG	.	.		0.478	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
MAST4	375449	hgsc.bcm.edu	37	5	66430370	66430370	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:66430370A>G	ENST00000403625.2	+	18	2541	c.2246A>G	c.(2245-2247)tAc>tGc	p.Y749C	MAST4_ENST00000404260.3_Missense_Mutation_p.Y752C|MAST4_ENST00000405643.1_Missense_Mutation_p.Y570C|MAST4_ENST00000261569.7_Missense_Mutation_p.Y555C|MAST4_ENST00000403666.1_Missense_Mutation_p.Y560C	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	752	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ACACCTGAATACATTGCACCA	0.413																																					p.Y749C		Atlas-SNP	.											.	MAST4	218	.	0			c.A2246G						.						109.0	117.0	114.0					5																	66430370		1858	4103	5961	SO:0001583	missense	375449	exon18			CTGAATACATTGC	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2246A>G	chr5.hg19:g.66430370A>G	ENSP00000385727:p.Tyr749Cys	103.0	0.0		100.0	38.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.281120	0.59758	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84088	0.5395	H	0.97051	3.93	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.997;0.998	D	0.89641	0.3862	10	0.87932	D	0	-19.1959	15.7031	0.77558	1.0:0.0:0.0:0.0	.	570;752;555;560	E7EWQ5;O15021;O15021-2;O15021-3	.;MAST4_HUMAN;.;.	C	752;749;560;570;570;555;555	ENSP00000385048:Y752C;ENSP00000385727:Y749C;ENSP00000384313:Y560C;ENSP00000384099:Y570C;ENSP00000261569:Y555C	ENSP00000261569:Y555C	Y	+	2	0	MAST4	66466126	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.124000	0.65301	0.528000	0.53228	TAC	.	.		0.413	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
CRHBP	1393	hgsc.bcm.edu	37	5	76254694	76254694	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:76254694G>A	ENST00000274368.4	+	5	1095	c.673G>A	c.(673-675)Gta>Ata	p.V225I	CRHBP_ENST00000506501.1_Missense_Mutation_p.V225I|CRHBP_ENST00000514258.1_3'UTR	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	225					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)			kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		CCTGGGACACGTAAATGGTCT	0.413																																					p.V225I		Atlas-SNP	.											.	CRHBP	46	.	0			c.G673A						.						100.0	81.0	87.0					5																	76254694		2203	4300	6503	SO:0001583	missense	1393	exon5			GGACACGTAAATG	X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.673G>A	chr5.hg19:g.76254694G>A	ENSP00000274368:p.Val225Ile	51.0	0.0		103.0	9.0	NM_001882	Q53F32|Q6FHT5	Missense_Mutation	SNP	ENST00000274368.4	hg19	CCDS4034.1	.	.	.	.	.	.	.	.	.	.	G	9.252	1.041074	0.19669	.	.	ENSG00000145708	ENST00000274368;ENST00000506501	.	.	.	5.22	-1.6	0.08426	.	1.143080	0.06278	N	0.696820	T	0.14614	0.0353	N	0.03608	-0.345	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.002	T	0.24368	-1.0162	9	0.17832	T	0.49	2.4636	5.9571	0.19279	0.0:0.171:0.2459:0.5831	.	225;225	D6RHH7;P24387	.;CRHBP_HUMAN	I	225	.	ENSP00000274368:V225I	V	+	1	0	CRHBP	76290450	0.055000	0.20627	0.024000	0.17045	0.811000	0.45836	0.271000	0.18626	-0.531000	0.06340	-0.738000	0.03535	GTA	.	.		0.413	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2	NM_001882	
CTNNA1	1495	hgsc.bcm.edu	37	5	138269736	138269736	+	Silent	SNP	G	G	A	rs1059181		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:138269736G>A	ENST00000302763.7	+	18	2769	c.2679G>A	c.(2677-2679)ccG>ccA	p.P893P	CTNNA1_ENST00000355078.5_Silent_p.P790P|CTNNA1_ENST00000518825.1_3'UTR|CTNNA1_ENST00000540387.1_Silent_p.P523P	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	893					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACGTGAACCCGGTGCAGGCCC	0.547																																					p.P893P		Atlas-SNP	.											.	CTNNA1	114	.	0			c.G2679A						.						52.0	51.0	51.0					5																	138269736		2203	4300	6503	SO:0001819	synonymous_variant	1495	exon18			GAACCCGGTGCAG	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2679G>A	chr5.hg19:g.138269736G>A		33.0	0.0		74.0	46.0	NM_001903	Q12795|Q8N1C0	Silent	SNP	ENST00000302763.7	hg19	CCDS34243.1																																																																																			.	.		0.547	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
PCDHA13	56136	hgsc.bcm.edu	37	5	140262783	140262783	+	Silent	SNP	C	C	T	rs145698462		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:140262783C>T	ENST00000289272.2	+	1	930	c.930C>T	c.(928-930)ttC>ttT	p.F310F	PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA13_ENST00000409494.1_Silent_p.F310F|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	310	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACTAGATTTCGAAGAAAAGA	0.378																																					p.F310F	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.C930T						.						56.0	64.0	61.0					5																	140262783		2203	4300	6503	SO:0001819	synonymous_variant	56136	exon1			AGATTTCGAAGAA	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.930C>T	chr5.hg19:g.140262783C>T		137.0	0.0		180.0	110.0	NM_031865	O75277	Silent	SNP	ENST00000289272.2	hg19	CCDS4240.1																																																																																			.	C|1.000;A|0.000		0.378	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140779699	140779699	+	Intron	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:140779699C>T	ENST00000576222.1	+	1	2546				PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGGTGCTGCCGGATATCAC	0.622																																					p.P669S		Atlas-SNP	.											.	.	.	.	0			c.C2005T						.						144.0	155.0	152.0					5																	140779699		2181	4265	6446	SO:0001627	intron_variant	56101	exon1			GTGCTGCCGGATA	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+27323C>T	chr5.hg19:g.140779699C>T		55.0	0.0		91.0	61.0	NM_018925	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	hg19	CCDS58980.1																																																																																			.	.		0.622	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
NMUR2	56923	hgsc.bcm.edu	37	5	151784456	151784456	+	Silent	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr5:151784456G>A	ENST00000255262.3	-	1	384	c.219C>T	c.(217-219)caC>caT	p.H73H	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	73					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			TCATAGCCTGGTGCTGCAGAA	0.567																																					p.H73H		Atlas-SNP	.											.	NMUR2	111	.	0			c.C219T						.						106.0	100.0	102.0					5																	151784456		2203	4300	6503	SO:0001819	synonymous_variant	56923	exon1			AGCCTGGTGCTGC	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.219C>T	chr5.hg19:g.151784456G>A		118.0	0.0		185.0	60.0	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Silent	SNP	ENST00000255262.3	hg19	CCDS4321.1																																																																																			.	.		0.567	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
POM121L2	94026	hgsc.bcm.edu	37	6	27277615	27277615	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr6:27277615T>C	ENST00000444565.1	-	1	2334	c.2335A>G	c.(2335-2337)Aca>Gca	p.T779A	POM121L2_ENST00000377451.2_Missense_Mutation_p.T715A	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	779										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						TGTCCATTTGTGGCACCAAAT	0.527																																					p.T779A		Atlas-SNP	.											.	POM121L2	61	.	0			c.A2335G						.						105.0	101.0	102.0					6																	27277615		692	1591	2283	SO:0001583	missense	94026	exon1			CATTTGTGGCACC	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.2335A>G	chr6.hg19:g.27277615T>C	ENSP00000392726:p.Thr779Ala	127.0	0.0		107.0	48.0	NM_033482	C9J1I7	Missense_Mutation	SNP	ENST00000444565.1	hg19	CCDS59497.1	.	.	.	.	.	.	.	.	.	.	T	7.010	0.556546	0.13436	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.13657	2.58;2.57	3.58	-3.09	0.05331	.	1.721060	0.03794	N	0.263359	T	0.01156	0.0038	N	0.04820	-0.15	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34725	-0.9817	10	0.06757	T	0.87	.	4.194	0.10435	0.1673:0.4262:0.0:0.4065	.	779	C9J1I7	.	A	715;779	ENSP00000366671:T715A;ENSP00000392726:T779A	ENSP00000366671:T715A	T	-	1	0	POM121L2	27385594	0.000000	0.05858	0.000000	0.03702	0.815000	0.46073	-0.402000	0.07223	-0.614000	0.05687	0.254000	0.18369	ACA	.	.		0.527	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
HLA-DPB1	3115	hgsc.bcm.edu	37	6	33053995	33053995	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr6:33053995G>T	ENST00000418931.2	+	5	873		c.e5-1			NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						TTTCATTTCAGTTCAACGAGG	0.408																																					.		Atlas-SNP	.											.	HLA-DPB1	28	.	0			c.758-1G>T						.						183.0	197.0	192.0					6																	33053995		2203	4300	6503	SO:0001630	splice_region_variant	3115	exon5			ATTTCAGTTCAAC		CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.758-1G>T	chr6.hg19:g.33053995G>T		93.0	0.0		79.0	18.0	NM_002121	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Splice_Site	SNP	ENST00000418931.2	hg19	CCDS4765.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356465	0.41700	.	.	ENSG00000223865	ENST00000418931;ENST00000411942;ENST00000422592;ENST00000416804	.	.	.	2.95	2.05	0.26809	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.867	0.29543	0.0:0.2569:0.7431:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HLA-DPB1	33161973	0.001000	0.12720	0.004000	0.12327	0.773000	0.43773	0.479000	0.22228	0.780000	0.33566	0.643000	0.83706	.	.	.		0.408	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121	Intron
PPP1R17	10842	hgsc.bcm.edu	37	7	31735231	31735231	+	Silent	SNP	A	A	T	rs367575540		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr7:31735231A>T	ENST00000342032.3	+	3	859	c.231A>T	c.(229-231)atA>atT	p.I77I	PPP1R17_ENST00000409146.3_Intron	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	77					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)										CACCTTTCATACCAGGTAATG	0.433																																					p.I77I		Atlas-SNP	.											.	.	.	.	0			c.A231T						.						116.0	113.0	114.0					7																	31735231		2203	4300	6503	SO:0001819	synonymous_variant	10842	exon3			TTTCATACCAGGT	AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.231A>T	chr7.hg19:g.31735231A>T		106.0	0.0		228.0	130.0	NM_006658	B4DE58|Q9UDQ0	Silent	SNP	ENST00000342032.3	hg19	CCDS5436.1																																																																																			.	.		0.433	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658	
TBX20	57057	hgsc.bcm.edu	37	7	35288373	35288373	+	Missense_Mutation	SNP	G	G	A	rs112862467		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr7:35288373G>A	ENST00000408931.3	-	3	987	c.461C>T	c.(460-462)cCt>cTt	p.P154L		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	154					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						GTTGTCCACAGGGACGATGTC	0.597																																					p.P154L		Atlas-SNP	.											.	TBX20	96	.	0			c.C461T						.						105.0	95.0	98.0					7																	35288373		2203	4300	6503	SO:0001583	missense	57057	exon3			TCCACAGGGACGA	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.461C>T	chr7.hg19:g.35288373G>A	ENSP00000386170:p.Pro154Leu	111.0	0.0		187.0	102.0	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	hg19	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033544	0.93575	.	.	ENSG00000164532	ENST00000408931	D	0.89415	-2.51	5.87	4.98	0.66077	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94361	0.8187	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95097	0.8227	10	0.87932	D	0	.	16.6795	0.85288	0.0:0.0:0.8692:0.1308	.	154	Q9UMR3	TBX20_HUMAN	L	154	ENSP00000386170:P154L	ENSP00000386170:P154L	P	-	2	0	TBX20	35254898	1.000000	0.71417	0.900000	0.35374	0.997000	0.91878	9.813000	0.99286	1.602000	0.50124	0.655000	0.94253	CCT	.	G|0.998;C|0.002		0.597	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
ZNF713	349075	hgsc.bcm.edu	37	7	55990926	55990926	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr7:55990926A>T	ENST00000429591.2	+	2	158	c.120A>T	c.(118-120)caA>caT	p.Q40H	ZNF713_ENST00000482436.1_3'UTR|MRPS17_ENST00000426595.1_Missense_Mutation_p.Q40H	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACCCTGCCCAAAAGAACCTCT	0.537																																					p.Q40H		Atlas-SNP	.											.	ZNF713	47	.	0			c.A120T						.						154.0	128.0	137.0					7																	55990926		2203	4300	6503	SO:0001583	missense	349075	exon2			TGCCCAAAAGAAC	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.120A>T	chr7.hg19:g.55990926A>T	ENSP00000416662:p.Gln40His	79.0	0.0		98.0	16.0	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	hg19	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.351738	0.41700	.	.	ENSG00000249773;ENSG00000178665	ENST00000426595;ENST00000429591	T;T	0.09445	2.98;2.98	2.93	0.0208	0.14126	Krueppel-associated box (4);	.	.	.	.	T	0.44371	0.1290	H	0.97874	4.095	0.24003	N	0.996205	D	0.69078	0.997	D	0.83275	0.996	T	0.28138	-1.0053	9	0.46703	T	0.11	.	9.5826	0.39497	0.2193:0.0:0.7807:0.0	.	40	Q8N859	ZN713_HUMAN	H	40	ENSP00000390331:Q40H;ENSP00000416662:Q40H	ENSP00000390331:Q40H	Q	+	3	2	RP11-15K19.2;ZNF713	55958420	0.998000	0.40836	0.998000	0.56505	0.506000	0.33950	0.463000	0.21972	-0.006000	0.14370	-1.241000	0.01538	CAA	.	.		0.537	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
SLC25A13	10165	hgsc.bcm.edu	37	7	95820436	95820436	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr7:95820436C>A	ENST00000265631.5	-	7	875	c.739G>T	c.(739-741)Gtt>Ttt	p.V247F	SLC25A13_ENST00000542654.1_Missense_Mutation_p.V139F|SLC25A13_ENST00000416240.2_Missense_Mutation_p.V247F			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	247					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	GTCACTTCAACATCTTTCCTG	0.363																																					p.V247F		Atlas-SNP	.											.	SLC25A13	131	.	0			c.G739T						.						207.0	207.0	207.0					7																	95820436		2203	4300	6503	SO:0001583	missense	10165	exon7			CTTCAACATCTTT	AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.739G>T	chr7.hg19:g.95820436C>A	ENSP00000265631:p.Val247Phe	47.0	0.0		48.0	42.0	NM_001160210	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Missense_Mutation	SNP	ENST00000265631.5	hg19	CCDS5645.1	.	.	.	.	.	.	.	.	.	.	C	2.079	-0.411131	0.04799	.	.	ENSG00000004864	ENST00000265631;ENST00000416240;ENST00000542654	T;T;T	0.79454	-1.27;-1.27;-1.27	5.18	4.3	0.51218	EF-hand-like domain (1);	0.071501	0.53938	D	0.000042	T	0.69958	0.3169	L	0.47716	1.5	0.45733	D	0.998639	B;B;B	0.33528	0.416;0.413;0.413	B;B;B	0.34722	0.188;0.092;0.092	T	0.70923	-0.4740	10	0.54805	T	0.06	-17.6928	9.6195	0.39712	0.1435:0.7819:0.0:0.0745	.	139;247;247	F5GX33;Q546F9;Q9UJS0	.;.;CMC2_HUMAN	F	247;247;139	ENSP00000265631:V247F;ENSP00000400101:V247F;ENSP00000440484:V139F	ENSP00000265631:V247F	V	-	1	0	SLC25A13	95658372	0.976000	0.34144	0.994000	0.49952	0.524000	0.34500	0.794000	0.26958	2.868000	0.98415	0.557000	0.71058	GTT	.	.		0.363	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
LMBR1	64327	hgsc.bcm.edu	37	7	156555801	156555801	+	Splice_Site	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr7:156555801C>A	ENST00000353442.5	-	7	856		c.e7+1		LMBR1_ENST00000354505.4_Splice_Site|LMBR1_ENST00000359422.4_Splice_Site|LMBR1_ENST00000540390.1_Splice_Site	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1						embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		AAAATACTTACAGAGAAGTAA	0.279																																					.		Atlas-SNP	.											.	LMBR1	35	.	0			c.619+1G>T						.						29.0	32.0	31.0					7																	156555801		2193	4273	6466	SO:0001630	splice_region_variant	64327	exon8			TACTTACAGAGAA	AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.619+1G>T	chr7.hg19:g.156555801C>A		278.0	1.0		445.0	225.0	NM_022458	A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Splice_Site	SNP	ENST00000353442.5	hg19	CCDS5945.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070462	0.76301	.	.	ENSG00000105983	ENST00000353442;ENST00000359422;ENST00000415428;ENST00000354505;ENST00000540390	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8532	0.92241	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LMBR1	156248562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.989000	0.76219	2.547000	0.85894	0.655000	0.94253	.	.	.		0.279	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347939.3	NM_022458	Intron
SMIM19	114926	hgsc.bcm.edu	37	8	42401693	42401693	+	Silent	SNP	C	C	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr8:42401693C>G	ENST00000438528.3	+	2	127	c.78C>G	c.(76-78)acC>acG	p.T26T	SMIM19_ENST00000414154.2_Silent_p.T26T|SMIM19_ENST00000416469.2_Silent_p.T26T|SMIM19_ENST00000529505.1_3'UTR|SMIM19_ENST00000417410.2_Silent_p.T26T|SMIM19_ENST00000490331.2_Silent_p.T26T	NM_001135676.1	NP_001129148.1	Q96E16	SMI19_HUMAN	small integral membrane protein 19	26						integral component of membrane (GO:0016021)											ATGAAGCCACCAATGTTTACT	0.403																																					p.T26T		Atlas-SNP	.											.	.	.	.	0			c.C78G						.						240.0	208.0	219.0					8																	42401693		2203	4300	6503	SO:0001819	synonymous_variant	0	exon2			AGCCACCAATGTT	BC013035	CCDS6133.2	8p11.21	2013-03-08	2013-03-08	2013-03-08	ENSG00000176209	ENSG00000176209			25166	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 40"""	C8orf40		12477932	Standard	NM_001135674		Approved		uc011lcv.2	Q96E16	OTTHUMG00000157060	ENST00000438528.3:c.78C>G	chr8.hg19:g.42401693C>G		121.0	0.0		107.0	36.0	NM_001135675	B2R4S6|D3DSY4	Silent	SNP	ENST00000438528.3	hg19	CCDS6133.2																																																																																			.	.		0.403	SMIM19-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347309.2	NM_138436	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70591797	70591797	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr8:70591797T>A	ENST00000260126.4	-	8	2546	c.1840A>T	c.(1840-1842)Acc>Tcc	p.T614S	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.T559S|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.T614S	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	614						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TGTCCCACGGTGGGTGGAGTG	0.468																																					p.T614S		Atlas-SNP	.											.	SLCO5A1	142	.	0			c.A1840T						.						150.0	143.0	145.0					8																	70591797		2203	4300	6503	SO:0001583	missense	81796	exon8			CCACGGTGGGTGG	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1840A>T	chr8.hg19:g.70591797T>A	ENSP00000260126:p.Thr614Ser	86.0	0.0		152.0	36.0	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	hg19	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	T	9.842	1.191410	0.21954	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.41065	1.15;1.55;1.01	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.32704	0.0838	N	0.16903	0.455	0.49582	D	0.999806	B;B;B	0.27166	0.17;0.028;0.037	B;B;B	0.34536	0.185;0.025;0.028	T	0.12967	-1.0527	10	0.23891	T	0.37	.	16.1549	0.81657	0.0:0.0:0.0:1.0	.	559;614;614	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	S	614;614;559	ENSP00000260126:T614S;ENSP00000434422:T614S;ENSP00000431611:T559S	ENSP00000260126:T614S	T	-	1	0	SLCO5A1	70754351	1.000000	0.71417	0.995000	0.50966	0.050000	0.14768	4.103000	0.57783	2.209000	0.71365	0.533000	0.62120	ACC	.	.		0.468	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75932274	75932274	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr8:75932274C>T	ENST00000262207.4	+	12	1672	c.1204C>T	c.(1204-1206)Cag>Tag	p.Q402*	CRISPLD1_ENST00000523524.1_Nonsense_Mutation_p.Q214*|CRISPLD1_ENST00000517786.1_Nonsense_Mutation_p.Q216*	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	402	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			AACTGTGGAACAGCTCTGTCC	0.413																																					p.Q402X		Atlas-SNP	.											.	CRISPLD1	94	.	0			c.C1204T						.						137.0	125.0	129.0					8																	75932274		2203	4300	6503	SO:0001587	stop_gained	83690	exon12			GTGGAACAGCTCT	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1204C>T	chr8.hg19:g.75932274C>T	ENSP00000262207:p.Gln402*	120.0	0.0		155.0	47.0	NM_031461	B2RA60|B7Z929	Nonsense_Mutation	SNP	ENST00000262207.4	hg19	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	C	42	9.172352	0.99089	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	14.9966	0.71436	0.0:0.8581:0.1419:0.0	.	.	.	.	X	402;214;216	.	ENSP00000262207:Q402X	Q	+	1	0	CRISPLD1	76094829	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.504000	0.53347	2.834000	0.97654	0.650000	0.86243	CAG	.	.		0.413	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
SLC25A32	81034	hgsc.bcm.edu	37	8	104415462	104415462	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr8:104415462C>A	ENST00000297578.4	-	4	648	c.482G>T	c.(481-483)cGa>cTa	p.R161L	SLC25A32_ENST00000523701.1_5'Flank|SLC25A32_ENST00000543107.1_Missense_Mutation_p.R29L	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	161					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	TTTATATTGTCGGTGTGGGGA	0.338																																					p.R161L		Atlas-SNP	.											.	SLC25A32	36	.	0			c.G482T						.						104.0	103.0	104.0					8																	104415462		2203	4300	6503	SO:0001583	missense	81034	exon4			TATTGTCGGTGTG	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.482G>T	chr8.hg19:g.104415462C>A	ENSP00000297578:p.Arg161Leu	106.0	0.0		138.0	32.0	NM_030780	Q96JZ6|Q96SU7	Missense_Mutation	SNP	ENST00000297578.4	hg19	CCDS6300.1	.	.	.	.	.	.	.	.	.	.	C	9.837	1.190108	0.21954	.	.	ENSG00000164933	ENST00000297578;ENST00000424899;ENST00000543107	T;T	0.79247	-1.25;-1.25	6.06	3.02	0.34903	Mitochondrial carrier domain (2);	0.105224	0.64402	D	0.000009	T	0.61627	0.2362	N	0.20304	0.555	0.48452	D	0.999658	B	0.10296	0.003	B	0.16289	0.015	T	0.49532	-0.8930	10	0.29301	T	0.29	-15.9841	10.2325	0.43264	0.0:0.764:0.0:0.236	.	161	Q9H2D1	MFTC_HUMAN	L	161;145;29	ENSP00000297578:R161L;ENSP00000443497:R29L	ENSP00000297578:R161L	R	-	2	0	SLC25A32	104484638	0.361000	0.24972	0.353000	0.25747	0.475000	0.33008	1.010000	0.29898	0.317000	0.23160	-0.234000	0.12200	CGA	.	.		0.338	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780	
DDX58	23586	hgsc.bcm.edu	37	9	32457126	32457126	+	Silent	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr9:32457126G>T	ENST00000379883.2	-	18	2929	c.2772C>A	c.(2770-2772)tcC>tcA	p.S924S	DDX58_ENST00000379868.1_Silent_p.S721S|DDX58_ENST00000542096.1_Silent_p.S853S|DDX58_ENST00000379882.1_Silent_p.S879S	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	924	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		GATATCATTTGGACATTTCTG	0.418																																					p.S924S		Atlas-SNP	.											.	DDX58	82	.	0			c.C2772A						.						61.0	58.0	59.0					9																	32457126		2203	4300	6503	SO:0001819	synonymous_variant	23586	exon18			TCATTTGGACATT	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2772C>A	chr9.hg19:g.32457126G>T		69.0	0.0		83.0	18.0	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Silent	SNP	ENST00000379883.2	hg19	CCDS6526.1																																																																																			.	.		0.418	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
SLC2A6	11182	hgsc.bcm.edu	37	9	136338644	136338644	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr9:136338644G>C	ENST00000371899.4	-	8	1192	c.1115C>G	c.(1114-1116)aCt>aGt	p.T372S	SLC2A6_ENST00000371897.4_Intron|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	372					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CAGGCCCGCAGTGCTGTTGGG	0.657																																					p.T372S		Atlas-SNP	.											.	SLC2A6	31	.	0			c.C1115G						.						34.0	35.0	34.0					9																	136338644		2198	4298	6496	SO:0001583	missense	11182	exon8			CCCGCAGTGCTGT	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.1115C>G	chr9.hg19:g.136338644G>C	ENSP00000360966:p.Thr372Ser	129.0	0.0		107.0	22.0	NM_017585	A6NNU6|Q5SXD7|Q8NCC2	Missense_Mutation	SNP	ENST00000371899.4	hg19	CCDS6975.1	.	.	.	.	.	.	.	.	.	.	G	1.463	-0.562006	0.03939	.	.	ENSG00000160326	ENST00000371899	D	0.82433	-1.61	4.94	4.03	0.46877	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.139140	0.06579	N	0.749930	T	0.72906	0.3519	N	0.17082	0.46	0.31736	N	0.636381	B	0.18968	0.032	B	0.23716	0.048	T	0.54735	-0.8249	10	0.07175	T	0.84	.	14.337	0.66598	0.0:0.1494:0.8506:0.0	.	372	Q9UGQ3	GTR6_HUMAN	S	372	ENSP00000360966:T372S	ENSP00000360966:T372S	T	-	2	0	SLC2A6	135328465	0.996000	0.38824	0.461000	0.27105	0.050000	0.14768	3.128000	0.50492	1.066000	0.40716	0.561000	0.74099	ACT	.	.		0.657	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
DDX50	79009	hgsc.bcm.edu	37	10	70673827	70673827	+	Missense_Mutation	SNP	A	A	G	rs202146235		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr10:70673827A>G	ENST00000373585.3	+	7	1063	c.956A>G	c.(955-957)aAt>aGt	p.N319S	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	319	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TCTGAAGACAATCCTCAGACT	0.343																																					p.N319S		Atlas-SNP	.											.	DDX50	65	.	0			c.A956G						.						45.0	45.0	45.0					10																	70673827		2203	4300	6503	SO:0001583	missense	79009	exon7			AAGACAATCCTCA	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.956A>G	chr10.hg19:g.70673827A>G	ENSP00000362687:p.Asn319Ser	150.0	0.0		97.0	68.0	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	hg19	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.199549	0.58126	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.04809	3.55	5.49	5.49	0.81192	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.039376	0.85682	D	0.000000	T	0.06050	0.0157	N	0.25647	0.755	0.52099	D	0.999945	B;B	0.24258	0.1;0.086	B;B	0.33121	0.098;0.158	T	0.48927	-0.8991	10	0.27785	T	0.31	-17.6164	15.8838	0.79226	1.0:0.0:0.0:0.0	.	319;319	Q9BQ39;B4DED6	DDX50_HUMAN;.	S	319	ENSP00000362687:N319S	ENSP00000362687:N319S	N	+	2	0	DDX50	70343833	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.216000	0.71823	0.379000	0.24179	AAT	.	A|0.999;G|0.001		0.343	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
TLX1	3195	hgsc.bcm.edu	37	10	102891823	102891823	+	Silent	SNP	C	C	G	rs2742016		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr10:102891823C>G	ENST00000370196.6	+	1	2567	c.525C>G	c.(523-525)ccC>ccG	p.P175P	TLX1NB_ENST00000445873.1_5'Flank|TLX1NB_ENST00000425505.1_5'Flank|TLX1_ENST00000467928.2_Silent_p.P175P			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	175					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TCACCTTCCCCTGGATGGAGA	0.701			T	"""TRB@, TRD@"""	T-ALL																																p.P175P		Atlas-SNP	.		Dom	yes		10	10q24	3195	""" T-cell leukemia, homeobox 1 (HOX11)"""		L	.	TLX1	20	.	0			c.C525G						.						27.0	30.0	29.0					10																	102891823		2169	4231	6400	SO:0001819	synonymous_variant	3195	exon1			CTTCCCCTGGATG	M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.525C>G	chr10.hg19:g.102891823C>G		3.0	0.0		7.0	7.0	NM_005521	A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Silent	SNP	ENST00000370196.6	hg19	CCDS7510.1																																																																																			.	.		0.701	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051193.3	NM_005521	
DUSP5	1847	hgsc.bcm.edu	37	10	112258097	112258097	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr10:112258097C>A	ENST00000369583.3	+	1	502	c.218C>A	c.(217-219)gCg>gAg	p.A73E	RP11-525A16.4_ENST00000609514.1_lincRNA	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	73	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		GCGGCGCGCGCGCGGCTCCTG	0.776																																					p.A73E		Atlas-SNP	.											.	DUSP5	62	.	0			c.C218A						.						2.0	2.0	2.0					10																	112258097		930	2016	2946	SO:0001583	missense	1847	exon1			CGCGCGCGCGGCT	U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	ENST00000369583.3:c.218C>A	chr10.hg19:g.112258097C>A	ENSP00000358596:p.Ala73Glu	21.0	0.0		28.0	23.0	NM_004419	Q12997|Q5T603	Missense_Mutation	SNP	ENST00000369583.3	hg19	CCDS7566.1	.	.	.	.	.	.	.	.	.	.	c	21.9	4.222657	0.79464	.	.	ENSG00000138166	ENST00000369583	T	0.38887	1.11	4.98	4.98	0.66077	Rhodanese-like (5);	0.190857	0.47852	D	0.000208	T	0.38957	0.1060	L	0.51422	1.61	0.36547	D	0.871621	P	0.43169	0.8	B	0.42593	0.392	T	0.38802	-0.9644	10	0.06891	T	0.86	.	17.248	0.87033	0.0:1.0:0.0:0.0	.	73	Q16690	DUS5_HUMAN	E	73	ENSP00000358596:A73E	ENSP00000358596:A73E	A	+	2	0	DUSP5	112248087	0.998000	0.40836	0.999000	0.59377	0.989000	0.77384	1.815000	0.38981	2.309000	0.77851	0.461000	0.40582	GCG	.	.		0.776	DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050333.1	NM_004419	
MUC6	4588	hgsc.bcm.edu	37	11	1028253	1028253	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:1028253C>A	ENST00000421673.2	-	14	1776	c.1726G>T	c.(1726-1728)Gac>Tac	p.D576Y		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	576	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAGCAGGGGTCAGTCTCACGC	0.667																																					p.D576Y		Atlas-SNP	.											.	MUC6	408	.	0			c.G1726T						.						21.0	26.0	24.0					11																	1028253		1938	4118	6056	SO:0001583	missense	4588	exon14			AGGGGTCAGTCTC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.1726G>T	chr11.hg19:g.1028253C>A	ENSP00000406861:p.Asp576Tyr	143.0	0.0		256.0	32.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930742	0.52866	.	.	ENSG00000184956	ENST00000421673	T	0.22336	1.96	4.52	4.52	0.55395	von Willebrand factor, type D domain (1);	0.000000	0.32190	U	0.006450	T	0.50973	0.1647	M	0.90814	3.15	0.32187	N	0.579598	D	0.89917	1.0	D	0.75484	0.986	T	0.66893	-0.5808	10	0.87932	D	0	.	11.1958	0.48711	0.0:0.9142:0.0:0.0858	.	576	Q6W4X9	MUC6_HUMAN	Y	576	ENSP00000406861:D576Y	ENSP00000406861:D576Y	D	-	1	0	MUC6	1018253	0.957000	0.32711	0.985000	0.45067	0.981000	0.71138	2.182000	0.42556	2.261000	0.74972	0.491000	0.48974	GAC	.	.		0.667	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	hgsc.bcm.edu	37	11	1028287	1028287	+	Silent	SNP	C	C	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:1028287C>G	ENST00000421673.2	-	14	1742	c.1692G>C	c.(1690-1692)gcG>gcC	p.A564A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	564	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACAGTTCCCCGCCCGCCAGG	0.662																																					p.A564A		Atlas-SNP	.											.	MUC6	408	.	0			c.G1692C						.						25.0	32.0	30.0					11																	1028287		2025	4143	6168	SO:0001819	synonymous_variant	4588	exon14			GTTCCCCGCCCGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.1692G>C	chr11.hg19:g.1028287C>G		171.0	0.0		281.0	45.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	hg19	CCDS44513.1																																																																																			.	.		0.662	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	hgsc.bcm.edu	37	11	1247915	1247915	+	Silent	SNP	C	C	T	rs377569377		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:1247915C>T	ENST00000529681.1	+	4	328	c.270C>T	c.(268-270)ggC>ggT	p.G90G	MUC5B_ENST00000447027.1_Silent_p.G90G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	90	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTCGACGGCGACGTCTTCC	0.647																																					p.G90G		Atlas-SNP	.											.	MUC5B	473	.	0			c.C270T						.	C		1,4281		0,1,2140	37.0	39.0	39.0		270	-7.2	0.0	11		39	0,8524		0,0,4262	no	coding-synonymous	MUC5B	NM_002458.2		0,1,6402	TT,TC,CC		0.0,0.0234,0.0078		90/5763	1247915	1,12805	2141	4262	6403	SO:0001819	synonymous_variant	727897	exon4			CGACGGCGACGTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.270C>T	chr11.hg19:g.1247915C>T		80.0	0.0		109.0	44.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR2AG1	144125	hgsc.bcm.edu	37	11	6806660	6806660	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:6806660C>A	ENST00000307401.4	+	1	413	c.392C>A	c.(391-393)aCa>aAa	p.T131K		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CATCCTCTGACATACATGACC	0.532																																					p.T131K		Atlas-SNP	.											OR2AG1,NS,carcinoma,0,2	OR2AG1	57	.	0			c.C392A						.						108.0	97.0	101.0					11																	6806660		2201	4296	6497	SO:0001583	missense	144125	exon1			CTCTGACATACAT	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.392C>A	chr11.hg19:g.6806660C>A	ENSP00000307447:p.Thr131Lys	87.0	0.0		164.0	8.0	NM_001004489	B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	ENST00000307401.4	hg19	CCDS31414.1	.	.	.	.	.	.	.	.	.	.	c	5.147	0.212688	0.09757	.	.	ENSG00000170803	ENST00000307401	T	0.01388	4.95	3.89	1.47	0.22746	GPCR, rhodopsin-like superfamily (1);	0.367913	0.23209	N	0.050698	T	0.00998	0.0033	N	0.14661	0.345	0.21445	N	0.999683	B	0.02656	0.0	B	0.04013	0.001	T	0.48043	-0.9069	10	0.56958	D	0.05	.	4.8236	0.13405	0.5093:0.3885:0.1023:0.0	.	131	Q9H205	O2AG1_HUMAN	K	131	ENSP00000307447:T131K	ENSP00000307447:T131K	T	+	2	0	OR2AG1	6763236	0.000000	0.05858	0.999000	0.59377	0.157000	0.22087	-0.317000	0.08060	0.174000	0.19809	-0.339000	0.08088	ACA	.	.		0.532	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489	
OR5T2	219464	hgsc.bcm.edu	37	11	55999712	55999712	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:55999712T>C	ENST00000313264.4	-	1	1025	c.950A>G	c.(949-951)tAc>tGc	p.Y317C		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					CACAATGGTGTAAAATATTGA	0.378																																					p.Y317C		Atlas-SNP	.											.	OR5T2	107	.	0			c.A950G						.						168.0	149.0	155.0					11																	55999712		2201	4296	6497	SO:0001583	missense	219464	exon1			ATGGTGTAAAATA	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.950A>G	chr11.hg19:g.55999712T>C	ENSP00000323688:p.Tyr317Cys	88.0	0.0		94.0	37.0	NM_001004746	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	hg19	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	T	12.65	2.002287	0.35320	.	.	ENSG00000181718	ENST00000313264	T	0.00318	8.12	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38217	U	0.001771	T	0.00875	0.0029	M	0.92268	3.29	0.09310	N	1	D	0.59357	0.985	D	0.63957	0.92	T	0.18681	-1.0329	10	0.87932	D	0	.	13.9683	0.64223	0.0:0.0:0.0:1.0	.	317	Q8NGG2	OR5T2_HUMAN	C	317	ENSP00000323688:Y317C	ENSP00000323688:Y317C	Y	-	2	0	OR5T2	55756288	0.916000	0.31088	0.940000	0.37924	0.618000	0.37518	2.371000	0.44248	2.041000	0.60428	0.391000	0.25812	TAC	.	.		0.378	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
CLCF1	23529	hgsc.bcm.edu	37	11	67135046	67135046	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:67135046G>A	ENST00000312438.7	-	2	265	c.68C>T	c.(67-69)cCt>cTt	p.P23L	AP003419.11_ENST00000543494.1_RNA|CLCF1_ENST00000533438.1_Missense_Mutation_p.P13L|CLCF1_ENST00000528474.1_Missense_Mutation_p.P13L	NM_013246.2	NP_037378.1	Q9UBD9	CLCF1_HUMAN	cardiotrophin-like cytokine factor 1	23				P -> L (in Ref. 7; AAH66231). {ECO:0000305}.	B cell differentiation (GO:0030183)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)	CNTFR-CLCF1 complex (GO:0097059)|CRLF-CLCF1 complex (GO:0097058)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	ciliary neurotrophic factor receptor binding (GO:0005127)|cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			endometrium(1)|urinary_tract(1)	2			BRCA - Breast invasive adenocarcinoma(15;2.39e-06)			TGGCACTGCAGGGAGGTGCCA	0.662																																					p.P23L		Atlas-SNP	.											.	CLCF1	15	.	0			c.C68T						.						101.0	81.0	88.0					11																	67135046		2200	4295	6495	SO:0001583	missense	23529	exon2			ACTGCAGGGAGGT	BC012939	CCDS31617.1, CCDS53666.1	11q13.3	2014-01-28	2006-07-03		ENSG00000175505	ENSG00000175505			17412	protein-coding gene	gene with protein product	"""B-cell stimulating factor 3"", ""cold-induced sweating syndrome 2"", ""novel neurotrophin-1"""	607672	"""CRLF1 associated cytokine-like factor 1"""			10500198, 10448081, 16782820	Standard	NM_001166212		Approved	NNT1, BSF3, CLC, NR6, CISS2, BSF-3, NNT-1	uc010rpp.2	Q9UBD9	OTTHUMG00000167669	ENST00000312438.7:c.68C>T	chr11.hg19:g.67135046G>A	ENSP00000309338:p.Pro23Leu	43.0	0.0		57.0	8.0	NM_013246	B4DNT4|Q6NZA4	Missense_Mutation	SNP	ENST00000312438.7	hg19	CCDS31617.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640479	0.67244	.	.	ENSG00000175505	ENST00000312438;ENST00000533438;ENST00000528474	T;T;T	0.76060	-0.99;-0.98;-0.98	5.26	5.26	0.73747	.	0.372941	0.23962	N	0.042858	T	0.65637	0.2710	N	0.08118	0	0.46203	D	0.998928	P	0.52061	0.95	P	0.47864	0.559	T	0.74188	-0.3746	10	0.87932	D	0	-10.2951	18.8589	0.92265	0.0:0.0:1.0:0.0	.	23	Q9UBD9	CLCF1_HUMAN	L	23;13;13	ENSP00000309338:P23L;ENSP00000434122:P13L;ENSP00000432553:P13L	ENSP00000309338:P23L	P	-	2	0	CLCF1	66891622	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.796000	0.69080	2.646000	0.89796	0.591000	0.81541	CCT	.	.		0.662	CLCF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395478.1	NM_013246	
RPUSD4	84881	hgsc.bcm.edu	37	11	126075666	126075666	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:126075666C>A	ENST00000298317.4	-	4	621	c.568G>T	c.(568-570)Gtg>Ttg	p.V190L	RP11-50B3.4_ENST00000532866.1_RNA|RPUSD4_ENST00000534393.1_5'UTR|RPUSD4_ENST00000533628.1_Missense_Mutation_p.V190L	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	190					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		GGGACATGCACAGTGATGGCC	0.572																																					p.V190L		Atlas-SNP	.											.	RPUSD4	36	.	0			c.G568T						.						51.0	43.0	46.0					11																	126075666		2201	4299	6500	SO:0001583	missense	84881	exon4			CATGCACAGTGAT	BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.568G>T	chr11.hg19:g.126075666C>A	ENSP00000298317:p.Val190Leu	35.0	0.0		59.0	18.0	NM_001144827	E9PML2|Q96K56	Missense_Mutation	SNP	ENST00000298317.4	hg19	CCDS8469.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280807	0.40294	.	.	ENSG00000165526	ENST00000298317;ENST00000533628	T;T	0.14144	2.53;2.53	5.89	3.03	0.35002	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);	0.121669	0.56097	D	0.000034	T	0.09024	0.0223	N	0.26130	0.795	0.22330	N	0.99919	B;B	0.17852	0.02;0.024	B;B	0.24269	0.038;0.052	T	0.32903	-0.9889	10	0.28530	T	0.3	-35.9459	6.7022	0.23230	0.0:0.6595:0.1267:0.2138	.	190;190	E9PML2;Q96CM3	.;RUSD4_HUMAN	L	190	ENSP00000298317:V190L;ENSP00000433065:V190L	ENSP00000298317:V190L	V	-	1	0	RPUSD4	125580876	0.925000	0.31364	0.021000	0.16686	0.923000	0.55619	2.035000	0.41155	0.400000	0.25396	0.655000	0.94253	GTG	.	.		0.572	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386336.1	NM_032795	
CELA1	1990	hgsc.bcm.edu	37	12	51723540	51723540	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:51723540G>T	ENST00000293636.1	-	7	727	c.687C>A	c.(685-687)agC>agA	p.S229R		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	229	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						TACAGCCCCGGCTGGACACAA	0.512																																					p.S229R		Atlas-SNP	.											.	CELA1	39	.	0			c.C687A						.						79.0	79.0	79.0					12																	51723540		2203	4300	6503	SO:0001583	missense	1990	exon7			GCCCCGGCTGGAC		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.687C>A	chr12.hg19:g.51723540G>T	ENSP00000293636:p.Ser229Arg	53.0	0.0		58.0	18.0	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	hg19	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	G	2.454	-0.325591	0.05350	.	.	ENSG00000139610	ENST00000293636	D	0.89050	-2.46	5.51	-1.26	0.09376	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.478838	0.24618	N	0.036995	T	0.76593	0.4009	N	0.21324	0.655	0.09310	N	1	B	0.13145	0.007	B	0.26693	0.072	T	0.63355	-0.6656	10	0.51188	T	0.08	-8.7379	2.2082	0.03941	0.3175:0.2067:0.3722:0.1036	.	229	Q9UNI1	CELA1_HUMAN	R	229	ENSP00000293636:S229R	ENSP00000293636:S229R	S	-	3	2	CELA1	50009807	0.000000	0.05858	0.333000	0.25482	0.011000	0.07611	-1.255000	0.02872	-0.358000	0.08162	-2.056000	0.00403	AGC	.	.		0.512	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
MFSD5	84975	hgsc.bcm.edu	37	12	53647163	53647163	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:53647163G>T	ENST00000329548.4	+	2	735	c.544G>T	c.(544-546)Gct>Tct	p.A182S	MFSD5_ENST00000534842.1_Missense_Mutation_p.A289S	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	182					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CCATGTGCTGGCTGTAGTGGC	0.612																																					p.A289S		Atlas-SNP	.											.	MFSD5	40	.	0			c.G865T						.						129.0	131.0	130.0					12																	53647163		2203	4300	6503	SO:0001583	missense	84975	exon2			GTGCTGGCTGTAG	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.544G>T	chr12.hg19:g.53647163G>T	ENSP00000332624:p.Ala182Ser	39.0	0.0		45.0	19.0	NM_001170790	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	hg19	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492264	0.64074	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	T;T	0.80824	-1.42;-1.42	4.36	4.36	0.52297	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.81098	0.4752	L	0.48260	1.515	0.80722	D	1	P;P	0.46784	0.825;0.884	P;P	0.49597	0.468;0.616	T	0.81611	-0.0854	10	0.42905	T	0.14	-0.8003	15.8223	0.78667	0.0:0.0:1.0:0.0	.	182;289	Q6N075;G3V1N7	MFSD5_HUMAN;.	S	289;289;289;182	ENSP00000442688:A289S;ENSP00000332624:A182S	ENSP00000331231:A289S	A	+	1	0	MFSD5	51933430	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.305000	0.96197	2.268000	0.75426	0.561000	0.74099	GCT	.	.		0.612	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
MUCL1	118430	hgsc.bcm.edu	37	12	55248916	55248916	+	Silent	SNP	T	T	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:55248916T>A	ENST00000308796.6	+	2	121	c.75T>A	c.(73-75)gcT>gcA	p.A25A	MUCL1_ENST00000547990.1_3'UTR|MUCL1_ENST00000546809.1_Silent_p.A20A	NM_058173.2	NP_477521.1	Q96DR8	MUCL1_HUMAN	mucin-like 1	25	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|membrane (GO:0016020)				breast(1)|kidney(1)|lung(1)	3						CGACAACAGCTGCTCCAGCTG	0.428																																					p.A25A		Atlas-SNP	.											.	MUCL1	11	.	0			c.T75A						.						87.0	79.0	82.0					12																	55248916		2203	4300	6503	SO:0001819	synonymous_variant	118430	exon2			AACAGCTGCTCCA	AF414087	CCDS8885.1	12q13.2	2007-07-02							30588	protein-coding gene	gene with protein product	"""small breast epithelial mucin"""	610857				12019145	Standard	NM_058173		Approved	SBEM	uc001sgk.3	Q96DR8		ENST00000308796.6:c.75T>A	chr12.hg19:g.55248916T>A		86.0	0.0		89.0	34.0	NM_058173	Q0VG95|Q32ZB5	Silent	SNP	ENST00000308796.6	hg19	CCDS8885.1																																																																																			.	.		0.428	MUCL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406062.1	NM_058173	
LEMD3	23592	hgsc.bcm.edu	37	12	65563653	65563653	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:65563653C>T	ENST00000308330.2	+	1	303	c.277C>T	c.(277-279)Ccg>Tcg	p.P93S	LEMD3_ENST00000541171.1_3'UTR	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	93					negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		gggggTCCGGCCGGTCTCGGG	0.716																																					p.P93S		Atlas-SNP	.											.	LEMD3	68	.	0			c.C277T						.						1.0	1.0	1.0					12																	65563653		891	2014	2905	SO:0001583	missense	23592	exon1			GTCCGGCCGGTCT	AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.277C>T	chr12.hg19:g.65563653C>T	ENSP00000308369:p.Pro93Ser	737.0	1.0		779.0	304.0	NM_001167614	Q9NT47|Q9NYA5	Missense_Mutation	SNP	ENST00000308330.2	hg19	CCDS8972.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.526354	0.44969	.	.	ENSG00000174106	ENST00000308330	T	0.51325	0.71	3.49	2.56	0.30785	.	0.082180	0.48286	D	0.000194	T	0.28863	0.0716	N	0.24115	0.695	0.35061	D	0.76156	B;B	0.16603	0.018;0.018	B;B	0.15870	0.014;0.014	T	0.24333	-1.0163	9	.	.	.	-3.2809	8.6594	0.34084	0.0:0.7651:0.2349:0.0	.	93;93	B4E2K7;Q9Y2U8	.;MAN1_HUMAN	S	93	ENSP00000308369:P93S	.	P	+	1	0	LEMD3	63849920	1.000000	0.71417	0.997000	0.53966	0.372000	0.29890	1.553000	0.36255	0.992000	0.38840	0.462000	0.41574	CCG	.	.		0.716	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2		
PTPRB	5787	hgsc.bcm.edu	37	12	70953387	70953387	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:70953387G>C	ENST00000261266.5	-	16	3825	c.3796C>G	c.(3796-3798)Ctt>Gtt	p.L1266V	PTPRB_ENST00000551525.1_Missense_Mutation_p.L1483V|PTPRB_ENST00000538708.1_Missense_Mutation_p.L1176V|PTPRB_ENST00000451516.2_Missense_Mutation_p.L1176V|PTPRB_ENST00000334414.6_Missense_Mutation_p.L1484V|PTPRB_ENST00000550358.1_Missense_Mutation_p.L1396V|PTPRB_ENST00000550857.1_Missense_Mutation_p.L1176V	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1266	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AATGACATAAGACTGGGAGGA	0.453																																					p.L1484V		Atlas-SNP	.											.	PTPRB	676	.	0			c.C4450G						.						101.0	98.0	99.0					12																	70953387		1915	4143	6058	SO:0001583	missense	5787	exon18			ACATAAGACTGGG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3796C>G	chr12.hg19:g.70953387G>C	ENSP00000261266:p.Leu1266Val	115.0	0.0		111.0	52.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.346808	0.24426	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;3.7	6.11	2.48	0.30137	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.458009	0.24836	N	0.035204	T	0.36193	0.0958	N	0.25647	0.755	0.25703	N	0.985567	B;B;B;B;B;B;B	0.30281	0.022;0.01;0.212;0.275;0.217;0.156;0.217	B;B;B;B;B;B;B	0.36186	0.037;0.037;0.065;0.219;0.138;0.158;0.138	T	0.15037	-1.0451	10	0.38643	T	0.18	.	4.4825	0.11774	0.2447:0.0:0.5022:0.2531	.	1176;1176;1363;1483;1484;1266;1396	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	V	1484;1176;1396;1176;1176;1266;1483;1363	ENSP00000334928:L1484V;ENSP00000393028:L1176V;ENSP00000448058:L1396V;ENSP00000438927:L1176V;ENSP00000447302:L1176V;ENSP00000261266:L1266V;ENSP00000448349:L1483V;ENSP00000446982:L1363V	ENSP00000261266:L1266V	L	-	1	0	PTPRB	69239654	0.866000	0.29940	0.998000	0.56505	0.966000	0.64601	0.755000	0.26405	1.596000	0.50062	0.655000	0.94253	CTT	.	.		0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
FBXW8	26259	hgsc.bcm.edu	37	12	117383227	117383227	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:117383227A>T	ENST00000309909.5	+	3	564	c.482A>T	c.(481-483)cAg>cTg	p.Q161L	FBXW8_ENST00000455858.2_Missense_Mutation_p.Q95L			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	161					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		AGGCTGTGCCAGCAGGAAGGG	0.493																																					p.Q161L		Atlas-SNP	.											.	FBXW8	53	.	0			c.A482T						.						134.0	111.0	118.0					12																	117383227		2203	4300	6503	SO:0001583	missense	26259	exon3			TGTGCCAGCAGGA	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.482A>T	chr12.hg19:g.117383227A>T	ENSP00000310686:p.Gln161Leu	76.0	0.0		82.0	24.0	NM_153348	Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	hg19	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	A	8.270	0.813058	0.16537	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.33865	1.39;1.39	6.17	2.59	0.31030	F-box domain, Skp2-like (1);	0.454593	0.23989	N	0.042582	T	0.19327	0.0464	N	0.11724	0.165	0.28627	N	0.907861	B;B	0.18741	0.03;0.024	B;B	0.23275	0.045;0.015	T	0.16217	-1.0410	10	0.29301	T	0.29	-11.6751	8.5595	0.33503	0.7197:0.0:0.2803:0.0	.	161;95	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	L	161;95;95	ENSP00000310686:Q161L;ENSP00000389144:Q95L	ENSP00000310686:Q161L	Q	+	2	0	FBXW8	115867610	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	1.063000	0.30567	0.215000	0.20761	0.533000	0.62120	CAG	.	.		0.493	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174	
TMEM132D	121256	hgsc.bcm.edu	37	12	129566302	129566302	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:129566302A>G	ENST00000422113.2	-	7	2250		c.e7+1		TMEM132D_ENST00000389441.4_Splice_Site	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D						negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTTTTTTTTTACCTGAATGGT	0.483																																					.		Atlas-SNP	.											.	TMEM132D	299	.	0			c.1923+2T>C						.						27.0	29.0	28.0					12																	129566302		2201	4294	6495	SO:0001630	splice_region_variant	121256	exon8			TTTTTTACCTGAA	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1923+1T>C	chr12.hg19:g.129566302A>G		69.0	0.0		104.0	41.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Splice_Site	SNP	ENST00000422113.2	hg19	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027425	0.54683	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.837	0.63415	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM132D	128132255	1.000000	0.71417	0.984000	0.44739	0.620000	0.37586	9.104000	0.94239	1.660000	0.50760	0.459000	0.35465	.	.	.		0.483	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	Intron
ZNF268	10795	hgsc.bcm.edu	37	12	133781098	133781098	+	Silent	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr12:133781098T>C	ENST00000536435.2	+	6	3156	c.2826T>C	c.(2824-2826)caT>caC	p.H942H	ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000537565.1_Silent_p.H781H|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000228289.5_Silent_p.H942H|ZNF268_ENST00000541009.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	942					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		AGAGAACTCATGTAGATGACA	0.368																																					p.H942H		Atlas-SNP	.											.	ZNF268	71	.	0			c.T2826C						.						42.0	40.0	41.0					12																	133781098		692	1591	2283	SO:0001819	synonymous_variant	10795	exon6			AACTCATGTAGAT	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.2826T>C	chr12.hg19:g.133781098T>C		1.0	0.0		8.0	7.0	NM_001165881	Q8TDG8|Q96RH4|Q9BZJ9	Silent	SNP	ENST00000536435.2	hg19	CCDS45012.1																																																																																			.	.		0.368	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2	NM_152943	
POSTN	10631	hgsc.bcm.edu	37	13	38154710	38154710	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr13:38154710T>C	ENST00000379747.4	-	11	1634	c.1517A>G	c.(1516-1518)gAt>gGt	p.D506G	POSTN_ENST00000541179.1_Missense_Mutation_p.D506G|POSTN_ENST00000379749.4_Missense_Mutation_p.D506G|POSTN_ENST00000541481.1_Missense_Mutation_p.D506G|POSTN_ENST00000379743.4_Missense_Mutation_p.D506G|POSTN_ENST00000379742.4_Missense_Mutation_p.D506G	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	506	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		AAAGCGCTTATCTTGTTTTAA	0.438																																					p.D506G		Atlas-SNP	.											.	POSTN	161	.	0			c.A1517G						.						287.0	274.0	278.0					13																	38154710		2203	4300	6503	SO:0001583	missense	10631	exon11			CGCTTATCTTGTT	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1517A>G	chr13.hg19:g.38154710T>C	ENSP00000369071:p.Asp506Gly	70.0	0.0		78.0	40.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	hg19	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.458623	0.84317	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92;-2.92;-2.92	5.02	5.02	0.67125	FAS1 domain (3);	0.094148	0.64402	D	0.000001	D	0.96334	0.8804	M	0.86573	2.825	0.51233	D	0.999914	D;D;D;D;D;D;D	0.76494	0.998;0.998;0.985;0.999;0.999;0.984;0.985	D;D;P;D;D;P;P	0.87578	0.995;0.998;0.826;0.998;0.994;0.853;0.826	D	0.96873	0.9641	10	0.62326	D	0.03	-25.7735	15.0317	0.71713	0.0:0.0:0.0:1.0	.	506;506;506;506;506;506;506	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	G	506	ENSP00000437959:D506G;ENSP00000369073:D506G;ENSP00000369071:D506G;ENSP00000369067:D506G;ENSP00000369066:D506G;ENSP00000437953:D506G	ENSP00000369066:D506G	D	-	2	0	POSTN	37052710	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.408000	0.80041	2.000000	0.58554	0.455000	0.32223	GAT	.	.		0.438	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
IPO4	79711	hgsc.bcm.edu	37	14	24653203	24653203	+	Splice_Site	SNP	C	C	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr14:24653203C>G	ENST00000354464.6	-	18	2046		c.e18+1		RP11-468E2.2_ENST00000561419.1_Splice_Site	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CCTTTGCTCACCACAATGCCC	0.632																																					.		Atlas-SNP	.											.	IPO4	74	.	0			c.1869+1G>C						.						28.0	27.0	27.0					14																	24653203		1893	4088	5981	SO:0001630	splice_region_variant	79711	exon19			TGCTCACCACAAT	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1869+1G>C	chr14.hg19:g.24653203C>G		44.0	0.0		45.0	18.0	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Splice_Site	SNP	ENST00000354464.6	hg19	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202111	0.79127	.	.	ENSG00000196497	ENST00000354464;ENST00000399536	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1124	0.93321	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IPO4	23723043	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.575000	0.74018	2.814000	0.96858	0.655000	0.94253	.	.	.		0.632	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	Intron
TRAPPC6B	122553	hgsc.bcm.edu	37	14	39623438	39623438	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr14:39623438G>A	ENST00000330149.5	-	4	554	c.328C>T	c.(328-330)Cag>Tag	p.Q110*	TRAPPC6B_ENST00000347691.5_Intron|TRAPPC6B_ENST00000557764.1_5'UTR	NM_001079537.1	NP_001073005.1	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B	110					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		TCTAAATACTGTTTTCCTGCA	0.353																																					p.Q110X		Atlas-SNP	.											.	TRAPPC6B	13	.	0			c.C328T						.						109.0	101.0	103.0					14																	39623438		1835	4079	5914	SO:0001587	stop_gained	122553	exon4			AATACTGTTTTCC	AK025437	CCDS9670.1, CCDS41947.1	14q13.3	2011-10-10			ENSG00000182400	ENSG00000182400		"""Trafficking protein particle complex"""	23066	protein-coding gene	gene with protein product		610397					Standard	NM_177452		Approved		uc001wut.1	Q86SZ2	OTTHUMG00000140259	ENST00000330149.5:c.328C>T	chr14.hg19:g.39623438G>A	ENSP00000330289:p.Gln110*	54.0	0.0		89.0	21.0	NM_001079537	B3KPS2|Q5JPD6|Q86U35|Q86X35	Nonsense_Mutation	SNP	ENST00000330149.5	hg19	CCDS41947.1	.	.	.	.	.	.	.	.	.	.	G	37	6.260483	0.97421	.	.	ENSG00000182400	ENST00000330149	.	.	.	6.08	5.2	0.72013	.	0.178535	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-1.8261	15.3715	0.74568	0.0664:0.0:0.9336:0.0	.	.	.	.	X	110	.	ENSP00000330289:Q110X	Q	-	1	0	TRAPPC6B	38693189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.007000	0.93597	1.594000	0.50039	0.591000	0.81541	CAG	.	.		0.353	TRAPPC6B-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276775.1	NM_177452	
ATG2B	55102	hgsc.bcm.edu	37	14	96809568	96809568	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr14:96809568T>C	ENST00000359933.4	-	5	1525	c.632A>G	c.(631-633)cAt>cGt	p.H211R		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	211					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGTGGGTTGATGCACATTAAT	0.433																																					p.H211R		Atlas-SNP	.											.	ATG2B	169	.	0			c.A632G						.						118.0	114.0	115.0					14																	96809568		1925	4125	6050	SO:0001583	missense	55102	exon5			GGTTGATGCACAT	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.632A>G	chr14.hg19:g.96809568T>C	ENSP00000353010:p.His211Arg	99.0	0.0		51.0	33.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261047	0.80246	.	.	ENSG00000066739	ENST00000359933	T	0.10099	2.91	5.27	5.27	0.74061	.	0.000000	0.64402	U	0.000001	T	0.12347	0.0300	L	0.42245	1.32	0.58432	D	0.999991	B	0.24258	0.1	B	0.26864	0.074	T	0.05386	-1.0888	10	0.36615	T	0.2	.	15.1796	0.72945	0.0:0.0:0.0:1.0	.	211	Q96BY7	ATG2B_HUMAN	R	211	ENSP00000353010:H211R	ENSP00000353010:H211R	H	-	2	0	ATG2B	95879321	1.000000	0.71417	0.921000	0.36526	0.979000	0.70002	7.499000	0.81566	1.995000	0.58328	0.482000	0.46254	CAT	.	.		0.433	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
PLA2G4E	123745	hgsc.bcm.edu	37	15	42287601	42287601	+	Silent	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr15:42287601G>A	ENST00000399518.3	-	12	1690	c.1204C>T	c.(1204-1206)Ctg>Ttg	p.L402L	PLA2G4E_ENST00000413860.2_Silent_p.L373L|CTD-2382E5.1_ENST00000499478.2_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	390	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		GCACAGTCCAGGAGGTTCAGC	0.607																																					p.L402L		Atlas-SNP	.											.	PLA2G4E	60	.	0			c.C1204T						.						60.0	64.0	63.0					15																	42287601		2040	4199	6239	SO:0001819	synonymous_variant	123745	exon12			AGTCCAGGAGGTT		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.1204C>T	chr15.hg19:g.42287601G>A		65.0	0.0		84.0	30.0	NM_001206670	Q6ZSC0	Silent	SNP	ENST00000399518.3	hg19	CCDS55962.1																																																																																			.	.		0.607	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
CD19	930	hgsc.bcm.edu	37	16	28947906	28947906	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr16:28947906C>T	ENST00000324662.3	+	7	1113	c.1069C>T	c.(1069-1071)Ccc>Tcc	p.P357S	CD19_ENST00000567541.1_Missense_Mutation_p.P357S|CD19_ENST00000538922.1_Missense_Mutation_p.P357S			P15391	CD19_HUMAN	CD19 molecule	357					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						TCTCCCCACACCCACCTCAGG	0.642																																					p.P357S		Atlas-SNP	.											CD19,NS,neuroblastoma,0,1	CD19	65	.	0			c.C1069T						.						48.0	45.0	46.0					16																	28947906		2197	4300	6497	SO:0001583	missense	930	exon7			CCCACACCCACCT		CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.1069C>T	chr16.hg19:g.28947906C>T	ENSP00000313419:p.Pro357Ser	33.0	0.0		37.0	18.0	NM_001178098	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	ENST00000324662.3	hg19	CCDS10644.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474141	0.63737	.	.	ENSG00000177455	ENST00000538922;ENST00000380673;ENST00000324662;ENST00000537306	T;T	0.39997	1.05;1.05	4.14	0.677	0.17964	.	1.085380	0.07160	N	0.850521	T	0.22322	0.0538	N	0.14661	0.345	0.09310	N	1	B;B	0.21753	0.06;0.036	B;B	0.20767	0.031;0.014	T	0.24977	-1.0145	10	0.21014	T	0.42	-3.9298	3.5093	0.07703	0.2334:0.53:0.0:0.2366	.	357;357	F5H635;P15391	.;CD19_HUMAN	S	357;164;357;206	ENSP00000437940:P357S;ENSP00000313419:P357S	ENSP00000313419:P357S	P	+	1	0	CD19	28855407	0.035000	0.19736	0.046000	0.18839	0.851000	0.48451	-0.299000	0.08254	0.050000	0.15949	0.305000	0.20034	CCC	.	.		0.642	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214152.2		
FAM65A	79567	hgsc.bcm.edu	37	16	67575468	67575468	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr16:67575468G>A	ENST00000379312.3	+	11	1070	c.949G>A	c.(949-951)Gaa>Aaa	p.E317K	CTD-2012K14.2_ENST00000567122.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.E333K|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.E313K|FAM65A_ENST00000428437.2_Missense_Mutation_p.E327K|FAM65A_ENST00000422602.2_Missense_Mutation_p.E333K	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	317						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GCTCAGCCTGGAAGTCACATG	0.602																																					p.E333K		Atlas-SNP	.											.	FAM65A	104	.	0			c.G997A						.						110.0	100.0	104.0					16																	67575468		2198	4300	6498	SO:0001583	missense	79567	exon11			AGCCTGGAAGTCA	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.949G>A	chr16.hg19:g.67575468G>A	ENSP00000368614:p.Glu317Lys	94.0	0.0		57.0	41.0	NM_001193523	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	hg19	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.267522|5.267522	0.95399|0.95399	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.03441|.	3.93;3.93;3.93|.	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78155|0.78155	0.4239|0.4239	M|M	0.80616|0.80616	2.505|2.505	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.83275|.	0.996;0.996;0.996;0.996|.	T|T	0.79952|0.79952	-0.1586|-0.1586	10|5	0.54805|.	T|.	0.06|.	-7.3884|-7.3884	18.0724|18.0724	0.89413|0.89413	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	327;333;317;333|.	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9|.	.;.;FA65A_HUMAN;.|.	K|E	317;313;333;327|307	ENSP00000368614:E317K;ENSP00000042381:E313K;ENSP00000400099:E333K|.	ENSP00000042381:E313K|.	E|G	+|+	1|2	0|0	FAM65A|FAM65A	66132969|66132969	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.458000|9.458000	0.97634|0.97634	2.266000|2.266000	0.75297|0.75297	0.555000|0.555000	0.69702|0.69702	GAA|GGA	.	.		0.602	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
AKAP10	11216	hgsc.bcm.edu	37	17	19827755	19827755	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr17:19827755C>A	ENST00000225737.6	-	11	1874	c.1717G>T	c.(1717-1719)Gat>Tat	p.D573Y	AKAP10_ENST00000395536.3_Missense_Mutation_p.D515Y	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	573					blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					GATTCTGGATCCAGACTTGCC	0.318																																					p.D573Y		Atlas-SNP	.											.	AKAP10	47	.	0			c.G1717T						.						68.0	69.0	68.0					17																	19827755		2203	4300	6503	SO:0001583	missense	11216	exon11			CTGGATCCAGACT	AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1717G>T	chr17.hg19:g.19827755C>A	ENSP00000225737:p.Asp573Tyr	328.0	0.0		294.0	67.0	NM_007202	B2R650|Q96AJ7	Missense_Mutation	SNP	ENST00000225737.6	hg19	CCDS11214.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.435059	0.83885	.	.	ENSG00000108599	ENST00000225737;ENST00000395536	T	0.38401	1.14	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.62344	0.2420	M	0.74881	2.28	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.98	T	0.66384	-0.5937	10	0.87932	D	0	-11.6057	17.8951	0.88885	0.0:1.0:0.0:0.0	.	515;515;573	E7EMD6;Q2XPN4;O43572	.;.;AKA10_HUMAN	Y	573;515	ENSP00000225737:D573Y	ENSP00000225737:D573Y	D	-	1	0	AKAP10	19768347	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.882000	0.75589	2.468000	0.83385	0.591000	0.81541	GAT	.	.		0.318	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
TAOK1	57551	hgsc.bcm.edu	37	17	27869796	27869796	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr17:27869796A>G	ENST00000261716.3	+	20	3281	c.2762A>G	c.(2761-2763)cAc>cGc	p.H921R	TAOK1_ENST00000536202.1_Missense_Mutation_p.H773R	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	921					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			CCAGGACCTCACTGGGGTCAT	0.587																																					p.H921R		Atlas-SNP	.											.	TAOK1	151	.	0			c.A2762G						.						59.0	64.0	62.0					17																	27869796		2203	4300	6503	SO:0001583	missense	57551	exon20			GACCTCACTGGGG	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.2762A>G	chr17.hg19:g.27869796A>G	ENSP00000261716:p.His921Arg	143.0	0.0		173.0	75.0	NM_020791	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	hg19	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634436	0.47049	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.73363	-0.67;-0.74	5.79	5.79	0.91817	Protein kinase-like domain (1);	0.048258	0.85682	D	0.000000	T	0.72078	0.3416	L	0.57536	1.79	0.25172	N	0.990277	B;B	0.19331	0.035;0.02	B;B	0.15052	0.012;0.012	T	0.64356	-0.6427	10	0.49607	T	0.09	.	16.1307	0.81436	1.0:0.0:0.0:0.0	.	773;921	B7ZLV6;Q7L7X3	.;TAOK1_HUMAN	R	921;773	ENSP00000261716:H921R;ENSP00000438819:H773R	ENSP00000261716:H921R	H	+	2	0	TAOK1	24893922	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.256000	0.78350	2.209000	0.71365	0.459000	0.35465	CAC	.	.		0.587	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
HCRT	3060	hgsc.bcm.edu	37	17	40336391	40336391	+	Silent	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr17:40336391G>A	ENST00000293330.1	-	2	263	c.177C>T	c.(175-177)caC>caT	p.H59H		NM_001524.1	NP_001515.1	O43612	OREX_HUMAN	hypocretin (orexin) neuropeptide precursor	59					eating behavior (GO:0042755)|negative regulation of DNA replication (GO:0008156)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of transmission of nerve impulse (GO:0051970)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transmission of nerve impulse (GO:0051971)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)				breast(1)|central_nervous_system(1)	2		all_cancers(22;1.39e-06)|all_epithelial(22;9.98e-06)|Breast(137;0.000143)|Ovarian(249;0.0221)|Myeloproliferative disorder(1115;0.0255)|Colorectal(1115;0.069)		BRCA - Breast invasive adenocarcinoma(366;0.124)		TGCCGGCCGCGTGATTGCCCG	0.721																																					p.H59H		Atlas-SNP	.											.	HCRT	3	.	0			c.C177T						.						6.0	7.0	7.0					17																	40336391		2005	3992	5997	SO:0001819	synonymous_variant	3060	exon2			GGCCGCGTGATTG	AF041240	CCDS11421.1	17q21	2013-02-28				ENSG00000161610		"""Endogenous ligands"""	4847	protein-coding gene	gene with protein product	"""prepro-orexin"""	602358				9419374, 9491897	Standard	NM_001524		Approved	PPOX, OX	uc002hzc.1	O43612		ENST00000293330.1:c.177C>T	chr17.hg19:g.40336391G>A		44.0	0.0		49.0	8.0	NM_001524		Silent	SNP	ENST00000293330.1	hg19	CCDS11421.1																																																																																			.	.		0.721	HCRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449792.1	NM_001524	
TMC6	11322	hgsc.bcm.edu	37	17	76121927	76121927	+	Missense_Mutation	SNP	G	G	T	rs117065924	byFrequency	TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr17:76121927G>T	ENST00000590602.1	-	5	469	c.310C>A	c.(310-312)Cgc>Agc	p.R104S	TMC6_ENST00000392467.3_Missense_Mutation_p.R104S|TMC6_ENST00000306591.7_Missense_Mutation_p.R104S|TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000322933.4_5'UTR|TMC6_ENST00000589553.1_5'UTR|TMC6_ENST00000322914.3_Missense_Mutation_p.R104S			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	104					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TGCACCGTGCGGTTGTAGTAC	0.706																																					p.R104S		Atlas-SNP	.											.	TMC6	42	.	0			c.C310A						.						24.0	24.0	24.0					17																	76121927		2097	4143	6240	SO:0001583	missense	11322	exon5			CCGTGCGGTTGTA	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.310C>A	chr17.hg19:g.76121927G>T	ENSP00000465261:p.Arg104Ser	135.0	0.0		111.0	22.0	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	hg19	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	g	16.81	3.225403	0.58668	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591	T;T;T	0.53423	0.62;0.62;0.62	4.02	4.02	0.46733	.	1.723940	0.03486	U	0.215803	T	0.69214	0.3086	M	0.66939	2.045	0.80722	D	1	D;P	0.62365	0.991;0.928	P;P	0.61592	0.891;0.496	T	0.54629	-0.8265	10	0.48119	T	0.1	-22.0581	15.7704	0.78164	0.0:0.0:1.0:0.0	.	104;104	Q7Z403-2;Q7Z403	.;TMC6_HUMAN	S	104	ENSP00000313408:R104S;ENSP00000376260:R104S;ENSP00000306405:R104S	ENSP00000306405:R104S	R	-	1	0	TMC6	73633522	1.000000	0.71417	0.916000	0.36221	0.227000	0.25037	5.112000	0.64634	1.797000	0.52628	0.556000	0.70494	CGC	.	G|0.996;A|0.004		0.706	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
MC2R	4158	hgsc.bcm.edu	37	18	13884907	13884907	+	Missense_Mutation	SNP	G	G	T	rs202040791		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr18:13884907G>T	ENST00000327606.3	-	2	791	c.611C>A	c.(610-612)aCc>aAc	p.T204N		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	204					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)			breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	GATCTTCCTGGTGTGGGATCG	0.572																																					p.T204N	Colon(141;1584 1782 35999 48227 48692)	Atlas-SNP	.											.	MC2R	78	.	0			c.C611A						.						107.0	89.0	95.0					18																	13884907		2203	4300	6503	SO:0001583	missense	4158	exon2			TTCCTGGTGTGGG		CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.611C>A	chr18.hg19:g.13884907G>T	ENSP00000333821:p.Thr204Asn	136.0	0.0		158.0	74.0	NM_000529	A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	ENST00000327606.3	hg19	CCDS11869.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072766	0.55646	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T	0.37584	1.19	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.170809	0.51477	D	0.000086	T	0.33904	0.0879	L	0.29908	0.895	0.28875	N	0.894714	B	0.26876	0.162	B	0.31495	0.131	T	0.37888	-0.9686	10	0.72032	D	0.01	.	18.6835	0.91556	0.0:0.0:1.0:0.0	.	204	Q01718	ACTHR_HUMAN	N	204	ENSP00000333821:T204N	ENSP00000333821:T204N	T	-	2	0	MC2R	13874907	1.000000	0.71417	0.971000	0.41717	0.870000	0.49936	3.462000	0.53042	2.411000	0.81874	0.655000	0.94253	ACC	.	.		0.572	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2		
ATP8B1	5205	hgsc.bcm.edu	37	18	55373803	55373803	+	Silent	SNP	G	G	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr18:55373803G>C	ENST00000283684.4	-	2	197	c.198C>G	c.(196-198)gtC>gtG	p.V66V	RP11-35G9.3_ENST00000599199.1_RNA|ATP8B1_ENST00000589147.1_5'UTR|ATP8B1_ENST00000536015.1_Silent_p.V66V|RP11-35G9.5_ENST00000588925.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	66					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				CGTTTGCTTTGACTTGCCATG	0.353																																					p.V66V		Atlas-SNP	.											.	ATP8B1	126	.	0			c.C198G						.						130.0	110.0	116.0					18																	55373803		2203	4300	6503	SO:0001819	synonymous_variant	5205	exon3			TGCTTTGACTTGC	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.198C>G	chr18.hg19:g.55373803G>C		93.0	0.0		74.0	6.0	NM_005603	Q9BTP8	Silent	SNP	ENST00000283684.4	hg19	CCDS11965.1																																																																																			.	.		0.353	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603	
SEC11C	90701	hgsc.bcm.edu	37	18	56819870	56819870	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr18:56819870A>T	ENST00000587834.1	+	3	772	c.300A>T	c.(298-300)gaA>gaT	p.E100D	SEC11C_ENST00000588875.1_Missense_Mutation_p.E100D	NM_033280.2	NP_150596.1	Q9BY50	SC11C_HUMAN	SEC11 homolog C (S. cerevisiae)	100					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|liver(2)|lung(2)	9		Colorectal(73;0.175)				TTAAAGTTGAAGGACGAGACA	0.393																																					p.E100D		Atlas-SNP	.											.	SEC11C	17	.	0			c.A300T						.						99.0	103.0	102.0					18																	56819870		2203	4300	6503	SO:0001583	missense	90701	exon3			AGTTGAAGGACGA	AF212233	CCDS11970.1	18q21.32	2006-11-07	2006-11-07	2006-11-07	ENSG00000166562	ENSG00000166562			23400	protein-coding gene	gene with protein product			"""SEC11-like 3 (S. cerevisiae)"""	SEC11L3			Standard	NM_033280		Approved	SPC21, SPCS4C	uc002lht.3	Q9BY50	OTTHUMG00000132762	ENST00000587834.1:c.300A>T	chr18.hg19:g.56819870A>T	ENSP00000468633:p.Glu100Asp	122.0	0.0		107.0	45.0	NM_033280	B2RAA3	Missense_Mutation	SNP	ENST00000587834.1	hg19	CCDS11970.1	.	.	.	.	.	.	.	.	.	.	A	13.36	2.213675	0.39102	.	.	ENSG00000166562	ENST00000299714;ENST00000509791	.	.	.	5.48	4.28	0.50868	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S24/S26A/S26B (1);	0.000000	0.64402	D	0.000001	T	0.38241	0.1033	N	0.21240	0.645	0.58432	D	0.999996	B	0.17038	0.02	B	0.20384	0.029	T	0.22591	-1.0212	9	0.25751	T	0.34	-31.0153	6.2582	0.20885	0.7834:0.0:0.075:0.1416	.	100	Q9BY50	SC11C_HUMAN	D	100	.	ENSP00000299714:E100D	E	+	3	2	SEC11C	54970850	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.231000	0.51294	2.081000	0.62600	0.533000	0.62120	GAA	.	.		0.393	SEC11C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256134.2	NM_033280	
EMR1	2015	hgsc.bcm.edu	37	19	6928158	6928158	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:6928158G>A	ENST00000312053.4	+	17	2262	c.2225G>A	c.(2224-2226)tGc>tAc	p.C742Y	EMR1_ENST00000250572.8_Missense_Mutation_p.C677Y|EMR1_ENST00000381404.4_Missense_Mutation_p.C690Y|EMR1_ENST00000381407.5_Missense_Mutation_p.C601Y|EMR1_ENST00000450315.3_Missense_Mutation_p.C565Y	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	742					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					CTCCACAGCTGCTGGCTGAAT	0.498																																					p.C742Y		Atlas-SNP	.											.	EMR1	153	.	0			c.G2225A						.						178.0	166.0	170.0					19																	6928158		2203	4300	6503	SO:0001583	missense	2015	exon17			ACAGCTGCTGGCT	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2225G>A	chr19.hg19:g.6928158G>A	ENSP00000311545:p.Cys742Tyr	42.0	0.0		30.0	20.0	NM_001974	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	hg19	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	g	16.41	3.114514	0.56505	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06	3.78	3.78	0.43462	GPCR, family 2-like (1);	.	.	.	.	D	0.85375	0.5682	H	0.98111	4.15	0.40877	D	0.983962	D;D;D;D;D	0.76494	0.986;0.995;0.999;0.995;0.982	P;D;D;D;P	0.71656	0.873;0.917;0.974;0.917;0.832	D	0.90761	0.4665	9	0.87932	D	0	.	13.1242	0.59344	0.0:0.0:1.0:0.0	.	565;601;677;690;742	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	Y	677;742;690;677;601;565	ENSP00000311545:C742Y;ENSP00000370811:C690Y;ENSP00000250572:C677Y;ENSP00000370814:C601Y;ENSP00000405974:C565Y	ENSP00000250572:C677Y	C	+	2	0	EMR1	6879158	1.000000	0.71417	0.989000	0.46669	0.709000	0.40893	7.847000	0.86896	1.642000	0.50584	0.609000	0.83330	TGC	.	.		0.498	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
MUC16	94025	hgsc.bcm.edu	37	19	8994527	8994527	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:8994527G>C	ENST00000397910.4	-	64	41568	c.41365C>G	c.(41365-41367)Ctc>Gtc	p.L13789V	MUC16_ENST00000380951.5_Missense_Mutation_p.L430V	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13791	SEA 12. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTATCAGGAGATGGCTGGCA	0.428																																					p.L13789V		Atlas-SNP	.											.	MUC16	4315	.	0			c.C41365G						.						176.0	157.0	163.0					19																	8994527		1963	4160	6123	SO:0001583	missense	94025	exon64			TCAGGAGATGGCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41365C>G	chr19.hg19:g.8994527G>C	ENSP00000381008:p.Leu13789Val	134.0	0.0		82.0	54.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	2.230|2.230	-0.376399|-0.376399	0.05000|0.05000	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.32515	.|1.45;1.45	2.69|2.69	-5.39|-5.39	0.02664|0.02664	.|.	.|.	.|.	.|.	.|.	T|T	0.32041|0.32041	0.0816|0.0816	L|L	0.45581|0.45581	1.43|1.43	.|.	.|.	.|.	.|B;P	.|0.48911	.|0.002;0.917	.|B;D	.|0.65684	.|0.001;0.937	T|T	0.16453|0.16453	-1.0402|-1.0402	4|8	.|0.16420	.|T	.|0.52	.|.	0.2962|0.2962	0.00266|0.00266	0.2416:0.1729:0.2809:0.3046|0.2416:0.1729:0.2809:0.3046	.|.	.|21434;13789	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	M|V	628|13789;430	.|ENSP00000381008:L13789V;ENSP00000370338:L430V	.|ENSP00000370338:L430V	I|L	-|-	3|1	3|0	MUC16|MUC16	8855527|8855527	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-6.734000|-6.734000	0.00055|0.00055	-2.040000|-2.040000	0.00916|0.00916	-0.259000|-0.259000	0.10710|0.10710	ATC|CTC	.	.		0.428	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
GGN	199720	hgsc.bcm.edu	37	19	38876196	38876196	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:38876196G>T	ENST00000334928.6	-	3	1838	c.1706C>A	c.(1705-1707)gCc>gAc	p.A569D	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	569	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGTCTGAGAGGCCCCGCTGCC	0.647																																					p.A569D		Atlas-SNP	.											.	GGN	50	.	0			c.C1706A						.						41.0	33.0	36.0					19																	38876196		2203	4300	6503	SO:0001583	missense	199720	exon3			TGAGAGGCCCCGC	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1706C>A	chr19.hg19:g.38876196G>T	ENSP00000334940:p.Ala569Asp	134.0	0.0		153.0	44.0	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	hg19	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254092	0.59212	.	.	ENSG00000179168	ENST00000334928	.	.	.	2.71	1.65	0.23941	.	0.393637	0.18577	N	0.137170	T	0.19644	0.0472	N	0.24115	0.695	0.09310	N	1	P	0.48016	0.904	B	0.43728	0.429	T	0.07404	-1.0774	9	0.54805	T	0.06	1.0967	5.733	0.18051	0.1549:0.0:0.8451:0.0	.	569	Q86UU5	GGN_HUMAN	D	569	.	ENSP00000334940:A569D	A	-	2	0	GGN	43568036	0.113000	0.22115	0.059000	0.19551	0.438000	0.31896	3.002000	0.49496	0.690000	0.31570	0.455000	0.32223	GCC	.	.		0.647	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
HNRNPL	3191	hgsc.bcm.edu	37	19	39329533	39329533	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:39329533C>T	ENST00000221419.5	-	9	1722		c.e9+1		AC104534.3_ENST00000594769.1_Splice_Site|HNRNPL_ENST00000600873.1_Splice_Site	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TGAGCACCTACCAGACATTCA	0.597																																					.		Atlas-SNP	.											.	HNRNPL	67	.	0			c.1355+1G>A						.						117.0	95.0	102.0					19																	39329533		2203	4300	6503	SO:0001630	splice_region_variant	3191	exon10			CACCTACCAGACA	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1355+1G>A	chr19.hg19:g.39329533C>T		62.0	0.0		47.0	21.0	NM_001533	A6ND69|A6NIT8|Q9H3P3	Splice_Site	SNP	ENST00000221419.5	hg19	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	C	32	5.161363	0.94727	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	6.09	6.09	0.99107	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4664	0.94945	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HNRNPL	44021373	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.512000	0.81728	2.899000	0.99337	0.655000	0.94253	.	.	.		0.597	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		Intron
FCGBP	8857	hgsc.bcm.edu	37	19	40408687	40408687	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:40408687C>A	ENST00000221347.6	-	8	4159	c.4152G>T	c.(4150-4152)caG>caT	p.Q1384H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1384	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACACATCTGCTGGTAGTAGT	0.562																																					p.Q1384H		Atlas-SNP	.											.	FCGBP	416	.	0			c.G4152T						.						143.0	123.0	130.0					19																	40408687		2203	4300	6503	SO:0001583	missense	8857	exon8			CATCTGCTGGTAG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4152G>T	chr19.hg19:g.40408687C>A	ENSP00000221347:p.Gln1384His	328.0	0.0		298.0	106.0	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	hg19	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	5.981	0.364972	0.11296	.	.	ENSG00000090920	ENST00000221347	T	0.59364	0.27	4.71	-0.825	0.10809	von Willebrand factor, type D domain (3);	1.244280	0.05942	N	0.637270	T	0.40862	0.1134	N	0.11201	0.11	0.09310	N	1	P	0.46656	0.882	P	0.48488	0.579	T	0.30387	-0.9980	10	0.52906	T	0.07	.	1.6164	0.02705	0.2218:0.4029:0.1997:0.1757	.	1384	Q9Y6R7	FCGBP_HUMAN	H	1384	ENSP00000221347:Q1384H	ENSP00000221347:Q1384H	Q	-	3	2	FCGBP	45100527	0.000000	0.05858	0.935000	0.37517	0.109000	0.19521	-0.211000	0.09332	0.093000	0.17368	-0.194000	0.12790	CAG	.	.		0.562	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
KCNC3	3748	hgsc.bcm.edu	37	19	50826433	50826433	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:50826433C>T	ENST00000477616.1	-	2	2071	c.1777G>A	c.(1777-1779)Ggc>Agc	p.G593S	KCNC3_ENST00000391818.2_Intron|KCNC3_ENST00000474951.1_Intron|KCNC3_ENST00000376959.2_Missense_Mutation_p.G593S	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	593					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	GGGCTGATGCCCCCGCTGCCG	0.751																																					p.G593S	Melanoma(91;1496 2324 50908)	Atlas-SNP	.											.	KCNC3	41	.	0			c.G1777A						.						1.0	1.0	1.0					19																	50826433		928	2154	3082	SO:0001583	missense	3748	exon2			TGATGCCCCCGCT	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1777G>A	chr19.hg19:g.50826433C>T	ENSP00000434241:p.Gly593Ser	45.0	0.0		29.0	8.0	NM_004977		Missense_Mutation	SNP	ENST00000477616.1	hg19	CCDS12793.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091035	0.36855	.	.	ENSG00000131398	ENST00000376959;ENST00000477616;ENST00000443843	D;D	0.97976	-4.63;-4.64	2.83	0.593	0.17478	.	.	.	.	.	D	0.89815	0.6824	N	0.08118	0	0.80722	D	1	B;B	0.23854	0.0;0.092	B;B	0.14578	0.001;0.011	T	0.81590	-0.0863	9	0.07175	T	0.84	.	7.3735	0.26815	0.0:0.7669:0.0:0.2331	.	593;593	Q14003;E7ETH1	KCNC3_HUMAN;.	S	593;593;407	ENSP00000366158:G593S;ENSP00000434241:G593S	ENSP00000366158:G593S	G	-	1	0	KCNC3	55518245	0.453000	0.25721	0.559000	0.28332	0.146000	0.21551	1.259000	0.32956	0.253000	0.21552	0.462000	0.41574	GGC	.	.		0.751	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314288.2	NM_004977	
POLD1	5424	hgsc.bcm.edu	37	19	50921101	50921101	+	Missense_Mutation	SNP	G	G	A	rs541931950		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:50921101G>A	ENST00000440232.2	+	27	3274	c.3221G>A	c.(3220-3222)cGg>cAg	p.R1074Q	CTD-2545M3.6_ENST00000599632.1_Intron|SPIB_ENST00000596074.1_5'Flank|SPIB_ENST00000270632.7_5'Flank|POLD1_ENST00000595904.1_Missense_Mutation_p.R1100Q|SPIB_ENST00000595883.1_5'Flank|SPIB_ENST00000439922.2_5'Flank|SPIB_ENST00000597855.1_5'Flank|POLD1_ENST00000599857.1_Missense_Mutation_p.R1074Q	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	1074					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		ACCCGCAGCCGGGACTGCCCC	0.692								DNA polymerases (catalytic subunits)					-|||	1	0.000199681	0.0	0.0	5008	,	,		9593	0.0		0.0	False		,,,				2504	0.001				p.R1074Q		Atlas-SNP	.											.	POLD1	174	.	0			c.G3221A						.						18.0	19.0	19.0					19																	50921101		2197	4296	6493	SO:0001583	missense	5424	exon27			GCAGCCGGGACTG		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.3221G>A	chr19.hg19:g.50921101G>A	ENSP00000406046:p.Arg1074Gln	129.0	0.0		148.0	68.0	NM_002691	Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	hg19	CCDS12795.1	.	.	.	.	.	.	.	.	.	.	g	31	5.092539	0.94149	.	.	ENSG00000062822	ENST00000440232	T	0.45668	0.89	3.87	3.87	0.44632	.	0.000000	0.64402	U	0.000002	T	0.68705	0.3030	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.99;0.994	T	0.76702	-0.2862	10	0.62326	D	0.03	-27.1432	15.0385	0.71767	0.0:0.0:1.0:0.0	.	1100;1074	E7EVW0;P28340	.;DPOD1_HUMAN	Q	1074	ENSP00000406046:R1074Q	ENSP00000406046:R1074Q	R	+	2	0	POLD1	55612913	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	5.331000	0.65905	1.913000	0.55393	0.444000	0.29173	CGG	.	.		0.692	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1		
LAIR1	3903	hgsc.bcm.edu	37	19	54868132	54868132	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:54868132A>C	ENST00000391742.2	-	6	703	c.551T>G	c.(550-552)tTc>tGc	p.F184C	LAIR1_ENST00000434277.2_Missense_Mutation_p.F183C|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000474878.1_Missense_Mutation_p.F166C|LAIR1_ENST00000391743.3_Missense_Mutation_p.F166C|LAIR1_ENST00000313038.6_Missense_Mutation_p.F177C|LAIR1_ENST00000348231.4_Missense_Mutation_p.F167C			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	184					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		ATGGAGGCAGAAGAGGACCAG	0.547																																					p.F184C		Atlas-SNP	.											.	LAIR1	44	.	0			c.T551G						.						101.0	106.0	104.0					19																	54868132		2203	4300	6503	SO:0001583	missense	3903	exon6			AGGCAGAAGAGGA	AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.551T>G	chr19.hg19:g.54868132A>C	ENSP00000375622:p.Phe184Cys	74.0	0.0		96.0	41.0	NM_002287		Missense_Mutation	SNP	ENST00000391742.2	hg19	CCDS12891.1	.	.	.	.	.	.	.	.	.	.	.	11.85	1.760802	0.31137	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000348231;ENST00000313038;ENST00000474878	T;T;T;T;T;T	0.00524	6.82;6.89;6.93;6.82;6.88;6.83	4.39	2.24	0.28232	.	1.069840	0.07396	N	0.889958	T	0.01489	0.0048	M	0.79123	2.44	0.09310	N	1	D;D;D;D;B;D	0.89917	1.0;0.999;0.999;0.976;0.107;0.999	D;P;D;P;B;P	0.69479	0.964;0.894;0.951;0.711;0.079;0.894	T	0.49925	-0.8887	10	0.87932	D	0	.	4.5526	0.12120	0.7019:0.1964:0.1017:0.0	.	184;166;166;183;167;184	Q6GTX8-4;A8MZ84;Q6GTX8-3;D3YTC8;Q6GTX8-2;Q6GTX8	.;.;.;.;.;LAIR1_HUMAN	C	166;184;183;167;177;166	ENSP00000375623:F166C;ENSP00000375622:F184C;ENSP00000391003:F183C;ENSP00000301193:F167C;ENSP00000319204:F177C;ENSP00000418998:F166C	ENSP00000319204:F177C	F	-	2	0	LAIR1	59559944	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.386000	0.20702	0.422000	0.26005	0.528000	0.53228	TTC	.	.		0.547	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1		
NLRP2	55655	hgsc.bcm.edu	37	19	55494016	55494016	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr19:55494016T>A	ENST00000543010.1	+	6	1093	c.950T>A	c.(949-951)cTc>cAc	p.L317H	NLRP2_ENST00000538819.1_Missense_Mutation_p.L293H|NLRP2_ENST00000427260.2_Missense_Mutation_p.L294H|NLRP2_ENST00000537859.1_Missense_Mutation_p.L295H|NLRP2_ENST00000448584.2_Missense_Mutation_p.L317H|NLRP2_ENST00000391721.4_Missense_Mutation_p.L293H|NLRP2_ENST00000339757.7_Missense_Mutation_p.L295H|NLRP2_ENST00000263437.6_Missense_Mutation_p.L314H	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	317	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GTGCCCGTCCTCCTGGGGAGT	0.647																																					p.L317H		Atlas-SNP	.											.	NLRP2	161	.	0			c.T950A						.						45.0	42.0	43.0					19																	55494016		2203	4300	6503	SO:0001583	missense	55655	exon6			CCGTCCTCCTGGG	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.950T>A	chr19.hg19:g.55494016T>A	ENSP00000445135:p.Leu317His	71.0	0.0		74.0	26.0	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	hg19	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.138920	0.56936	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	D;D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	1.55	1.55	0.23275	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.91717	0.7381	M	0.93197	3.39	0.24777	N	0.992834	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.80752	-0.1242	9	0.87932	D	0	.	7.1971	0.25860	0.0:0.0:0.0:1.0	.	294;295;314;293;317	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	H	317;293;295;317;295;294;293;314	ENSP00000445135:L317H;ENSP00000375601:L293H;ENSP00000344074:L295H;ENSP00000409370:L317H;ENSP00000440601:L295H;ENSP00000402474:L294H;ENSP00000441133:L293H;ENSP00000263437:L314H	ENSP00000263437:L314H	L	+	2	0	NLRP2	60185828	0.002000	0.14202	0.062000	0.19696	0.292000	0.27327	1.259000	0.32956	0.998000	0.38996	0.397000	0.26171	CTC	.	.		0.647	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
BRWD1	54014	hgsc.bcm.edu	37	21	40608663	40608663	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr21:40608663T>C	ENST00000333229.2	-	23	2951	c.2624A>G	c.(2623-2625)aAt>aGt	p.N875S	BRWD1_ENST00000342449.3_Missense_Mutation_p.N875S|BRWD1_ENST00000380800.3_Missense_Mutation_p.N875S	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	875					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AGGCTGCAAATTGATGCCCGC	0.398																																					p.N875S	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											BRWD1_ENST00000333229,caecum,carcinoma,0,2	BRWD1	325	.	0			c.A2624G						.						114.0	108.0	110.0					21																	40608663		2203	4300	6503	SO:0001583	missense	54014	exon23			TGCAAATTGATGC	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.2624A>G	chr21.hg19:g.40608663T>C	ENSP00000330753:p.Asn875Ser	89.0	0.0		95.0	33.0	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	hg19	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	T	17.96	3.517254	0.64634	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.53857	0.6;0.6;0.6	5.32	4.16	0.48862	.	0.134195	0.50627	D	0.000114	T	0.67126	0.2860	M	0.77486	2.375	0.80722	D	1	B;P;B	0.51147	0.013;0.942;0.071	B;P;B	0.58266	0.011;0.836;0.038	T	0.68808	-0.5311	10	0.59425	D	0.04	-6.0218	10.8914	0.46998	0.0:0.0741:0.0:0.9259	.	542;875;875	Q5R2U6;Q9NSI6-2;Q9NSI6	.;.;BRWD1_HUMAN	S	875	ENSP00000330753:N875S;ENSP00000344333:N875S;ENSP00000370178:N875S	ENSP00000330753:N875S	N	-	2	0	BRWD1	39530533	1.000000	0.71417	0.835000	0.33067	0.782000	0.44232	7.527000	0.81931	0.862000	0.35528	0.528000	0.53228	AAT	.	.		0.398	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
PES1	23481	hgsc.bcm.edu	37	22	30985180	30985180	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr22:30985180A>T	ENST00000354694.7	-	2	208	c.102T>A	c.(100-102)ttT>ttA	p.F34L	PES1_ENST00000402284.3_Missense_Mutation_p.F34L|PES1_ENST00000335214.6_Missense_Mutation_p.F34L|PES1_ENST00000405677.1_5'UTR|PES1_ENST00000402281.1_5'UTR	NM_001243225.1|NM_014303.3	NP_001230154.1|NP_055118.1			pescadillo ribosomal biogenesis factor 1											breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						ATATTCACCTAAAGTCAGCCA	0.517																																					p.F34L		Atlas-SNP	.											.	PES1	55	.	0			c.T102A						.						61.0	52.0	55.0					22																	30985180		2203	4300	6503	SO:0001583	missense	23481	exon2			TCACCTAAAGTCA	U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000354694.7:c.102T>A	chr22.hg19:g.30985180A>T	ENSP00000346725:p.Phe34Leu	28.0	0.0		62.0	31.0	NM_014303		Missense_Mutation	SNP	ENST00000354694.7	hg19	CCDS13880.1	.	.	.	.	.	.	.	.	.	.	A	32	5.112796	0.94339	.	.	ENSG00000100029	ENST00000354694;ENST00000402284;ENST00000335214;ENST00000433575	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.42	4.31	0.51392	.	0.049658	0.85682	D	0.000000	T	0.82208	0.4987	M	0.93062	3.375	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;0.995;1.0	D;D;P;D	0.91635	0.999;0.972;0.862;0.999	D	0.85171	0.0998	10	0.87932	D	0	-32.7	11.2474	0.49004	0.1004:0.0:0.8996:0.0	.	34;34;34;34	B2RDF2;B5MCF9;O00541-2;O00541	.;.;.;PESC_HUMAN	L	34	ENSP00000346725:F34L;ENSP00000384252:F34L;ENSP00000334612:F34L;ENSP00000388071:F34L	ENSP00000334612:F34L	F	-	3	2	PES1	29315180	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	4.849000	0.62882	1.107000	0.41642	-0.417000	0.06048	TTT	.	.		0.517	PES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321188.3	NM_014303	
CACNA1I	8911	hgsc.bcm.edu	37	22	40058779	40058779	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr22:40058779A>T	ENST00000402142.3	+	18	3372		c.e18-1		CACNA1I_ENST00000407673.1_Splice_Site|CACNA1I_ENST00000404898.1_Splice_Site|CACNA1I_ENST00000336649.4_Splice_Site|CACNA1I_ENST00000401624.1_Splice_Site|CACNA1I_ENST00000400164.3_Splice_Site	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TCCTCTTGCTAGACCCTGTGC	0.652																																					.		Atlas-SNP	.											.	CACNA1I	264	.	0			c.3373-2A>T						.						31.0	34.0	33.0					22																	40058779		2174	4262	6436	SO:0001630	splice_region_variant	8911	exon18			CTTGCTAGACCCT	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.3373-1A>T	chr22.hg19:g.40058779A>T		56.0	0.0		42.0	25.0	NM_021096	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Splice_Site	SNP	ENST00000402142.3	hg19	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101898	0.76983	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3929	0.74760	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1I	38388725	1.000000	0.71417	0.997000	0.53966	0.465000	0.32709	8.925000	0.92832	2.031000	0.59945	0.523000	0.50628	.	.	.		0.652	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	Intron
MKL1	57591	hgsc.bcm.edu	37	22	40804805	40804805	+	IGR	SNP	G	G	T			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr22:40804805G>T	ENST00000355630.3	-	0	4496				SGSM3_ENST00000248929.9_Nonsense_Mutation_p.E621*|SGSM3_ENST00000454798.2_Nonsense_Mutation_p.E554*	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CAGGTTGGATGAAGATGGCAA	0.662			T	RBM15	acute megakaryocytic leukemia																																p.E621X		Atlas-SNP	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	SGSM3	48	.	0			c.G1861T						.						43.0	50.0	47.0					22																	40804805		2203	4300	6503	SO:0001628	intergenic_variant	27352	exon18			TTGGATGAAGATG	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		chr22.hg19:g.40804805G>T		72.0	0.0		71.0	29.0	NM_015705	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Nonsense_Mutation	SNP	ENST00000355630.3	hg19	CCDS14003.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.497789|7.497789	0.98322|0.98322	.|.	.|.	ENSG00000100359|ENSG00000100359	ENST00000248929;ENST00000454798;ENST00000427834|ENST00000417424	.|.	.|.	.|.	3.92|3.92	3.92|3.92	0.45320|0.45320	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.87932|.	D|.	0|.	.|.	16.7997|16.7997	0.85611|0.85611	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	621;554;66|3	.|.	ENSP00000248929:E621X|.	E|X	+|+	1|2	0|2	SGSM3|SGSM3	39134751|39134751	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.552000|0.552000	0.35366|0.35366	6.554000|6.554000	0.73923|0.73923	2.145000|2.145000	0.66743|0.66743	0.313000|0.313000	0.20887|0.20887	GAA|TGA	.	.		0.662	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
EP300	2033	hgsc.bcm.edu	37	22	41569712	41569712	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr22:41569712A>G	ENST00000263253.7	+	29	5922	c.4703A>G	c.(4702-4704)aAg>aGg	p.K1568R	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1568	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AGGGGCAACAAGAAGAAACCC	0.448			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.K1568R		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.A4703G						.						148.0	157.0	154.0					22																	41569712		2203	4300	6503	SO:0001583	missense	2033	exon29	Familial Cancer Database	Broad Thumb-Hallux syndrome	GCAACAAGAAGAA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4703A>G	chr22.hg19:g.41569712A>G	ENSP00000263253:p.Lys1568Arg	259.0	0.0		301.0	115.0	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	hg19	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.024448	0.93518	.	.	ENSG00000100393	ENST00000263253	D	0.93712	-3.27	5.52	5.52	0.82312	.	0.000000	0.48767	D	0.000170	D	0.96463	0.8846	M	0.78285	2.405	0.46078	D	0.99885	D	0.76494	0.999	D	0.83275	0.996	D	0.96561	0.9415	10	0.52906	T	0.07	-14.6587	15.643	0.77020	1.0:0.0:0.0:0.0	.	1568	Q09472	EP300_HUMAN	R	1568	ENSP00000263253:K1568R	ENSP00000263253:K1568R	K	+	2	0	EP300	39899658	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.237000	0.95368	2.094000	0.63399	0.533000	0.62120	AAG	.	.		0.448	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
PNPLA5	150379	hgsc.bcm.edu	37	22	44285214	44285214	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr22:44285214G>C	ENST00000597664.1	-	4	826	c.697C>G	c.(697-699)Ctc>Gtc	p.L233V	PNPLA5_ENST00000593866.1_Missense_Mutation_p.L119V|PNPLA5_ENST00000216177.4_Missense_Mutation_p.L233V|PNPLA5_ENST00000381198.2_Missense_Mutation_p.L119V			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	233					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)	p.L233I(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CCTACCTCGAGGCTGGGGGGT	0.577																																					p.L233V		Atlas-SNP	.											PNPLA5,NS,carcinoma,0,1	PNPLA5	46	.	1	Substitution - Missense(1)	lung(1)	c.C697G						.						53.0	57.0	56.0					22																	44285214		2203	4300	6503	SO:0001583	missense	150379	exon4			CCTCGAGGCTGGG	Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.697C>G	chr22.hg19:g.44285214G>C	ENSP00000471069:p.Leu233Val	38.0	0.0		40.0	14.0	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Missense_Mutation	SNP	ENST00000597664.1	hg19		.	.	.	.	.	.	.	.	.	.	G	1.095	-0.662893	0.03454	.	.	ENSG00000100341	ENST00000216177;ENST00000381198	T;T	0.79454	-1.27;0.91	4.87	0.232	0.15381	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.693493	0.12851	N	0.433906	T	0.58906	0.2155	N	0.21373	0.66	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.39057	-0.9632	10	0.22706	T	0.39	-0.8965	6.233	0.20747	0.2337:0.1337:0.6326:0.0	.	119;233	Q7Z6Z6-2;Q7Z6Z6	.;PLPL5_HUMAN	V	233;119	ENSP00000216177:L233V;ENSP00000370595:L119V	ENSP00000216177:L233V	L	-	1	0	PNPLA5	42616547	0.047000	0.20315	0.000000	0.03702	0.007000	0.05969	1.114000	0.31196	-0.040000	0.13580	0.491000	0.48974	CTC	.	.		0.577	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
HUWE1	10075	hgsc.bcm.edu	37	X	53617377	53617377	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chrX:53617377G>A	ENST00000342160.3	-	34	4635	c.4178C>T	c.(4177-4179)gCa>gTa	p.A1393V	HUWE1_ENST00000262854.6_Missense_Mutation_p.A1393V|HUWE1_ENST00000218328.8_Missense_Mutation_p.A1393V			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1393					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						AGGTGACTCTGCCCTTTGATC	0.423																																					p.A1393V		Atlas-SNP	.											.	HUWE1	724	.	0			c.C4178T						.						185.0	153.0	164.0					X																	53617377		2203	4300	6503	SO:0001583	missense	10075	exon35			GACTCTGCCCTTT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.4178C>T	chrX.hg19:g.53617377G>A	ENSP00000340648:p.Ala1393Val	50.0	0.0		43.0	37.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518964	0.64634	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.48522	1.13;1.13;0.81	5.93	5.06	0.68205	Armadillo-like helical (1);	0.135447	0.51477	D	0.000087	T	0.40145	0.1105	N	0.14661	0.345	0.41691	D	0.989343	D;P	0.57257	0.979;0.874	P;B	0.49999	0.628;0.443	T	0.24190	-1.0167	10	0.28530	T	0.3	.	14.984	0.71332	0.0:0.1398:0.8602:0.0	.	1393;1393	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	V	1393	ENSP00000340648:A1393V;ENSP00000262854:A1393V;ENSP00000218328:A1393V	ENSP00000218328:A1393V	A	-	2	0	HUWE1	53634102	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.307000	0.96226	1.247000	0.43917	0.600000	0.82982	GCA	.	.		0.423	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
FANCB	2187	hgsc.bcm.edu	37	X	14863080	14863093	+	Frame_Shift_Del	DEL	AGTTACCACTTTCT	AGTTACCACTTTCT	-	rs148560784		TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	AGTTACCACTTTCT	AGTTACCACTTTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chrX:14863080_14863093delAGTTACCACTTTCT	ENST00000324138.3	-	7	1965_1978	c.1812_1825delAGAAAGTGGTAACT	c.(1810-1827)agagaaagtggtaactgtfs	p.ESGNC605fs	FANCB_ENST00000398334.1_Frame_Shift_Del_p.ESGNC605fs	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	605					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TCTTTAGGACAGTTACCACTTTCTCTCTCCATAA	0.355								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.605_609del		Atlas-INDEL	.											.	FANCB	78	.	0			c.1813_1826del						.																																			SO:0001589	frameshift_variant	2187	exon7	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	.	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1812_1825delAGAAAGTGGTAACT	chrX.hg19:g.14863080_14863093delAGTTACCACTTTCT	ENSP00000326819:p.Glu605fs	183.0	0.0		92.0	54.0	NM_152633	B2RMZ4|Q7Z2U2|Q86XG1	Frame_Shift_Del	DEL	ENST00000324138.3	hg19	CCDS14161.1																																																																																			.	.		0.355	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	
MAGEH1	28986	hgsc.bcm.edu	37	X	55478905	55478905	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chrX:55478905C>A	ENST00000342972.1	+	1	368	c.98C>A	c.(97-99)aCc>aAc	p.T33N	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	33	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						GCCTCCGAGACCCCTATGGCC	0.642																																					p.T33N		Atlas-SNP	.											.	MAGEH1	37	.	0			c.C98A						.						21.0	24.0	23.0					X																	55478905		2200	4299	6499	SO:0001583	missense	28986	exon1			CCGAGACCCCTAT	AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.98C>A	chrX.hg19:g.55478905C>A	ENSP00000343706:p.Thr33Asn	46.0	0.0		58.0	44.0	NM_014061	B2R8V9|Q5JRJ3|Q9Y5M2	Missense_Mutation	SNP	ENST00000342972.1	hg19	CCDS14369.1	.	.	.	.	.	.	.	.	.	.	.	4.917	0.170395	0.09391	.	.	ENSG00000187601	ENST00000342972	T	0.15256	2.44	3.03	1.25	0.21368	.	0.229983	0.22467	N	0.059668	T	0.07007	0.0178	N	0.08118	0	0.09310	N	1	B	0.24721	0.11	B	0.21360	0.034	T	0.26503	-1.0101	10	0.45353	T	0.12	.	4.7194	0.12912	0.0:0.6853:0.0:0.3147	.	33	Q9H213	MAGH1_HUMAN	N	33	ENSP00000343706:T33N	ENSP00000343706:T33N	T	+	2	0	MAGEH1	55495630	0.007000	0.16637	0.006000	0.13384	0.015000	0.08874	0.171000	0.16685	0.210000	0.20664	0.529000	0.55759	ACC	.	.		0.642	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056868.1	NM_014061	
KRTAP1-3	81850	hgsc.bcm.edu	37	17	39190968	39190968	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr17:39190968delG	ENST00000344363.5	-	1	139	c.106delC	c.(106-108)cagfs	p.Q36fs		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	36						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCTTGGCTGGCAGCAGCTG	0.607																																					p.Q36fs		Atlas-INDEL	.											.	KRTAP1-3	18	.	0			c.107delA						.						35.0	44.0	41.0					17																	39190968		1964	4161	6125	SO:0001589	frameshift_variant	81850	exon1			.	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.106delC	chr17.hg19:g.39190968delG	ENSP00000344420:p.Gln36fs	69.0	0.0		83.0	14.0	NM_030966	Q07628|Q8IUG0|Q9BYS2	Frame_Shift_Del	DEL	ENST00000344363.5	hg19	CCDS42323.1																																																																																			.	.		0.607	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
KRTAP22-1	337979	hgsc.bcm.edu	37	21	31973566	31973577	+	In_Frame_Del	DEL	TGGTTTTCTGGC	TGGTTTTCTGGC	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	TGGTTTTCTGGC	TGGTTTTCTGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr21:31973566_31973577delTGGTTTTCTGGC	ENST00000334680.2	+	1	153_164	c.127_138delTGGTTTTCTGGC	c.(127-138)tggttttctggcdel	p.WFSG43del	KRTAP6-2_ENST00000334897.3_5'Flank	NM_181620.1	NP_853651.1	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	43						intermediate filament (GO:0005882)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	8						TGAAAGATCTTGGTTTTCTGGCTGCTTCTGAG	0.462																																					p.42_46del		Atlas-INDEL	.											.	KRTAP22-1	16	.	0			c.126_137del						.																																			SO:0001651	inframe_deletion	337979	exon1			.	AP001708	CCDS13601.1	21q22.1	2011-02-10			ENSG00000186924	ENSG00000186924		"""Keratin associated proteins"""	18947	protein-coding gene	gene with protein product						12359730	Standard	NM_181620		Approved	KAP22.1	uc011add.2	Q3MIV0	OTTHUMG00000057778	ENST00000334680.2:c.127_138delTGGTTTTCTGGC	chr21.hg19:g.31973566_31973577delTGGTTTTCTGGC	ENSP00000333887:p.Trp43_Gly46del	84.0	0.0		75.0	20.0	NM_181620		In_Frame_Del	DEL	ENST00000334680.2	hg19	CCDS13601.1																																																																																			.	.		0.462	KRTAP22-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128230.2		
TIRAP	114609	hgsc.bcm.edu	37	11	126162928	126162930	+	In_Frame_Del	DEL	AGT	AGT	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	AGT	AGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:126162928_126162930delAGT	ENST00000392680.2	+	5	1029_1031	c.624_626delAGT	c.(622-627)caagtc>cac	p.208_209QV>H	TIRAP_ENST00000392678.3_In_Frame_Del_p.208_209QV>H|TIRAP_ENST00000392679.1_In_Frame_Del_p.208_209QV>H|RP11-712L6.7_ENST00000533378.1_RNA|RP11-712L6.5_ENST00000528876.1_5'Flank	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	208	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		GCTTTCGTCAAGTCAAAGAAGCT	0.542																																					p.208_209del		Atlas-INDEL	.											.	TIRAP	37	.	0			c.623_625del						.																																			SO:0001651	inframe_deletion	114609	exon5			.	AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.624_626delAGT	chr11.hg19:g.126162928_126162930delAGT	ENSP00000376447:p.Gln208_Val209delinsHis	58.0	0.0		59.0	14.0	NM_148910	B3KW65|Q56UH9|Q56UI0|Q8N5E5	In_Frame_Del	DEL	ENST00000392680.2	hg19	CCDS8472.1																																																																																			.	.		0.542	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000277092.1	NM_148910	
GP1BB	2812	hgsc.bcm.edu	37	22	19711909	19711931	+	Frame_Shift_Del	DEL	GGCCCGCGCTCGCGCCGCAGCCC	GGCCCGCGCTCGCGCCGCAGCCC	-	rs559674113|rs542853528	byFrequency	TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	GGCCCGCGCTCGCGCCGCAGCCC	GGCCCGCGCTCGCGCCGCAGCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr22:19711909_19711931delGGCCCGCGCTCGCGCCGCAGCCC	ENST00000366425.3	+	2	1168_1190	c.543_565delGGCCCGCGCTCGCGCCGCAGCCC	c.(541-567)cgggcccgcgctcgcgccgcagcccggfs	p.RARARAAAR181fs		NM_000407.4	NP_000398.1	P13224	GP1BB_HUMAN	glycoprotein Ib (platelet), beta polypeptide	181					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|platelet activation (GO:0030168)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)					Colorectal(54;0.0993)					TgcgggcccgggcccgcgctcgcgccgcagcccggcTGTCGCT	0.749																																					p.181_188del		Atlas-INDEL	.											.	GP1BB	1	.	0			c.542_564del						.																																			SO:0001589	frameshift_variant	2812	exon2			.		CCDS42980.1	22q11.21-q11.23	2014-09-17			ENSG00000203618	ENSG00000203618		"""CD molecules"""	4440	protein-coding gene	gene with protein product		138720				3422424	Standard	NM_000407		Approved	CD42c		P13224	OTTHUMG00000150397	ENST00000366425.3:c.543_565delGGCCCGCGCTCGCGCCGCAGCCC	chr22.hg19:g.19711909_19711931delGGCCCGCGCTCGCGCCGCAGCCC	ENSP00000383382:p.Arg181fs	613.0	0.0		652.0	85.0	NM_000407	Q14422|Q8NG40	Frame_Shift_Del	DEL	ENST00000366425.3	hg19	CCDS42980.1																																																																																			.	.		0.749	GP1BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318195.1		
LPCAT4	254531	hgsc.bcm.edu	37	15	34659273	34659274	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr15:34659273_34659274insC	ENST00000314891.6	-	1	205_206	c.28_29insG	c.(28-30)gccfs	p.A10fs	LPCAT4_ENST00000562431.1_5'Flank	NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	10					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						ATCTAGGGGGGCCCAGTCCCCC	0.673																																					p.A10fs		Atlas-INDEL	.											.	LPCAT4	36	.	0			c.29_30insG						.																																			SO:0001589	frameshift_variant	254531	exon1			.	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.29dupG	chr15.hg19:g.34659276_34659276dupC	ENSP00000317300:p.Ala10fs	149.0	0.0		178.0	18.0	NM_153613	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Frame_Shift_Ins	INS	ENST00000314891.6	hg19	CCDS32191.1																																																																																			.	.		0.673	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613	
ALB	213	hgsc.bcm.edu	37	4	74286009	74286012	+	Frame_Shift_Del	DEL	CTTA	CTTA	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	CTTA	CTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr4:74286009_74286012delCTTA	ENST00000503124.1	+	12	1581_1584	c.1374_1377delCTTA	c.(1372-1377)ggcttafs	p.GL458fs	ALB_ENST00000509063.1_Intron|ALB_ENST00000295897.4_Frame_Shift_Del_p.GL608fs|ALB_ENST00000415165.2_Frame_Shift_Del_p.GL416fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Frame_Shift_Del_p.GL493fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGCCTTAGGCTTATAACATCACA	0.284																																					p.608_609del		Atlas-INDEL	.											.	ALB	132	.	0			c.1823_1826del						.																																			SO:0001589	frameshift_variant	213	exon14			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1374_1377delCTTA	chr4.hg19:g.74286009_74286012delCTTA	ENSP00000421027:p.Gly458fs	166.0	0.0		168.0	67.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.284	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197544	39197544	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr17:39197544delG	ENST00000306271.4	-	1	169	c.106delC	c.(106-108)cagfs	p.Q36fs		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	36			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.|PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			keratin filament (GO:0045095)				NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCGTGGCTGGCAGGAGCTG	0.607																																					p.Q36fs		Atlas-INDEL	.											.	KRTAP1-1	23	.	0			c.107delA						.						50.0	64.0	60.0					17																	39197544		2017	4199	6216	SO:0001589	frameshift_variant	81851	exon1			.	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.106delC	chr17.hg19:g.39197544delG	ENSP00000305975:p.Gln36fs	82.0	0.0		83.0	21.0	NM_030967	A6NC32|Q96S60|Q96S67	Frame_Shift_Del	DEL	ENST00000306271.4	hg19	CCDS42324.1																																																																																			.	.		0.607	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
FANCB	2187	hgsc.bcm.edu	37	X	14863073	14863078	+	In_Frame_Del	DEL	TTAGGA	TTAGGA	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	TTAGGA	TTAGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chrX:14863073_14863078delTTAGGA	ENST00000324138.3	-	7	1980_1985	c.1827_1832delTCCTAA	c.(1825-1833)tgtcctaaa>tga	p.609_611CPK>*	FANCB_ENST00000398334.1_In_Frame_Del_p.609_611CPK>*	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	609					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ATAACGATCTTTAGGACAGTTACCAC	0.35								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.610_611del		Atlas-INDEL	.											.	FANCB	78	.	0			c.1828_1833del						.																																			SO:0001651	inframe_deletion	2187	exon7	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	.	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1827_1832delTCCTAA	chrX.hg19:g.14863073_14863078delTTAGGA	ENSP00000326819:p.Cys609_Lys611delins*	178.0	0.0		98.0	54.0	NM_152633	B2RMZ4|Q7Z2U2|Q86XG1	In_Frame_Del	DEL	ENST00000324138.3	hg19	CCDS14161.1																																																																																			.	.		0.350	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	
TCEANC	170082	hgsc.bcm.edu	37	X	13680785	13680786	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chrX:13680785_13680786delAC	ENST00000380600.1	+	2	245_246	c.158_159delAC	c.(157-159)tacfs	p.Y53fs	TCEANC_ENST00000545566.1_Frame_Shift_Del_p.Y53fs|TCEANC_ENST00000544987.1_Frame_Shift_Del_p.Y53fs|TCEANC_ENST00000314720.4_Frame_Shift_Del_p.Y83fs|TCEANC_ENST00000490617.1_3'UTR			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	53	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						AGAGCTGTGTACAGAGTCCTCA	0.431																																					p.83_83del		Atlas-INDEL	.											.	TCEANC	29	.	0			c.247_248del						.																																			SO:0001589	frameshift_variant	170082	exon4			.		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.158_159delAC	chrX.hg19:g.13680785_13680786delAC	ENSP00000369974:p.Tyr53fs	92.0	0.0		113.0	87.0	NM_152634	A6NI06|B2RDM3	Frame_Shift_Del	DEL	ENST00000380600.1	hg19																																																																																				.	.		0.431	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634	
TIRAP	114609	hgsc.bcm.edu	37	11	126162932	126162935	+	Frame_Shift_Del	DEL	AAAG	AAAG	-			TCGA-DD-AACH-01A-11D-A40R-10	TCGA-DD-AACH-10A-01D-A40U-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb4838f-fd57-4ed4-8bc8-5d42e7fb0fac	62e49f6d-fde8-4259-a620-199fc7b700e0	g.chr11:126162932_126162935delAAAG	ENST00000392680.2	+	5	1033_1036	c.628_631delAAAG	c.(628-633)aaagaafs	p.KE210fs	TIRAP_ENST00000392678.3_Frame_Shift_Del_p.KE210fs|TIRAP_ENST00000392679.1_Frame_Shift_Del_p.KE210fs|RP11-712L6.7_ENST00000533378.1_RNA|RP11-712L6.5_ENST00000528876.1_5'Flank	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	210	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		TCGTCAAGTCAAAGAAGCTGTCAT	0.544																																					p.209_210del		Atlas-INDEL	.											.	TIRAP	37	.	0			c.627_630del						.																																			SO:0001589	frameshift_variant	114609	exon5			.	AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.628_631delAAAG	chr11.hg19:g.126162932_126162935delAAAG	ENSP00000376447:p.Lys210fs	58.0	0.0		61.0	12.0	NM_148910	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Frame_Shift_Del	DEL	ENST00000392680.2	hg19	CCDS8472.1																																																																																			.	.		0.544	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000277092.1	NM_148910	
