#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMP23B	8510	hgsc.bcm.edu	37	1	1571767	1571767	+	IGR	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:1571767T>A	ENST00000356026.5	+	0	1326				CDK11B_ENST00000407249.3_Missense_Mutation_p.E668V|CDK11B_ENST00000341832.6_Missense_Mutation_p.E621V|CDK11B_ENST00000317673.7_Missense_Mutation_p.E666V|CDK11B_ENST00000340677.5_Missense_Mutation_p.E655V			O75900	MMP23_HUMAN	matrix metallopeptidase 23B						proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	GTAGGGGTGCTCGCTGAAGGT	0.592																																					p.E663V		Atlas-SNP	.											.	CDK11B	37	.	0			c.A1988T						.						88.0	69.0	75.0					1																	1571767		1973	4134	6107	SO:0001628	intergenic_variant	984	exon18			GGGTGCTCGCTGA		CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713		chr1.hg19:g.1571767T>A		96.0	0.0		91.0	38.0	NM_033486	A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	Missense_Mutation	SNP	ENST00000356026.5	hg19	CCDS30559.1																																																																																			.	.		0.592	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158492.2	NM_006983	
ESPN	83715	hgsc.bcm.edu	37	1	6500800	6500800	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:6500800G>T	ENST00000377828.1	+	4	958	c.790G>T	c.(790-792)Ggg>Tgg	p.G264W	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	264					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GCTGCACGGCGGGGAGATCTC	0.741																																					p.G264W		Atlas-SNP	.											.	ESPN	32	.	0			c.G790T						.						5.0	5.0	5.0					1																	6500800		2003	4015	6018	SO:0001583	missense	83715	exon4			CACGGCGGGGAGA	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.790G>T	chr1.hg19:g.6500800G>T	ENSP00000367059:p.Gly264Trp	759.0	1.0		732.0	277.0	NM_031475	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	hg19	CCDS70.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585132	0.86748	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	T;T	0.34072	2.36;1.38	3.84	3.84	0.44239	Ankyrin repeat-containing domain (5);	0.237219	0.35466	N	0.003191	T	0.45458	0.1343	L	0.31157	0.91	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.48293	-0.9048	10	0.87932	D	0	-10.8417	12.6418	0.56714	0.0:0.0:1.0:0.0	.	264	B1AK53	ESPN_HUMAN	W	264;49	ENSP00000367059:G264W;ENSP00000401793:G49W	ENSP00000367059:G264W	G	+	1	0	ESPN	6423387	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.052000	0.76634	1.989000	0.58080	0.430000	0.28490	GGG	.	.		0.741	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
H6PD	9563	hgsc.bcm.edu	37	1	9324489	9324489	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:9324489T>A	ENST00000377403.2	+	5	2239	c.1937T>A	c.(1936-1938)aTc>aAc	p.I646N	H6PD_ENST00000602477.1_Missense_Mutation_p.I657N	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	646	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CACGTCCGGATCCCCTACTAC	0.657																																					p.I646N		Atlas-SNP	.											.	H6PD	71	.	0			c.T1937A						.						40.0	43.0	42.0					1																	9324489		2203	4295	6498	SO:0001583	missense	9563	exon5			TCCGGATCCCCTA	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1937T>A	chr1.hg19:g.9324489T>A	ENSP00000366620:p.Ile646Asn	155.0	0.0		119.0	12.0	NM_004285	Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	ENST00000377403.2	hg19	CCDS101.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250853	0.80135	.	.	ENSG00000049239	ENST00000377403	T	0.50813	0.73	5.72	5.72	0.89469	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.167672	0.52532	D	0.000080	T	0.68311	0.2987	M	0.88842	2.985	0.34413	D	0.696598	D	0.53885	0.963	P	0.54629	0.757	T	0.82663	-0.0346	10	0.87932	D	0	-33.1888	15.1805	0.72952	0.0:0.0:0.0:1.0	.	646	O95479	G6PE_HUMAN	N	646	ENSP00000366620:I646N	ENSP00000366620:I646N	I	+	2	0	H6PD	9247076	1.000000	0.71417	0.829000	0.32907	0.900000	0.52787	7.592000	0.82676	2.187000	0.69744	0.459000	0.35465	ATC	.	.		0.657	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
SPSB1	80176	hgsc.bcm.edu	37	1	9416188	9416188	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:9416188G>A	ENST00000328089.6	+	2	579	c.238G>A	c.(238-240)Gtg>Atg	p.V80M	SPSB1_ENST00000377399.2_Missense_Mutation_p.V80M|SPSB1_ENST00000357898.3_Missense_Mutation_p.V80M	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	80	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CCGGCATCCGGTGGCCCAGAG	0.582																																					p.V80M		Atlas-SNP	.											SPSB1,right_lower_lobe,carcinoma,0,1	SPSB1	22	.	0			c.G238A						.						153.0	154.0	154.0					1																	9416188		2203	4300	6503	SO:0001583	missense	80176	exon2			CATCCGGTGGCCC		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.238G>A	chr1.hg19:g.9416188G>A	ENSP00000330221:p.Val80Met	129.0	0.0		134.0	13.0	NM_025106	A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Missense_Mutation	SNP	ENST00000328089.6	hg19	CCDS102.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665618	0.88251	.	.	ENSG00000171621	ENST00000328089;ENST00000450402;ENST00000357898;ENST00000377399	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.32	5.32	0.75619	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	T	0.80649	0.4663	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.85590	0.1245	10	0.56958	D	0.05	-10.2896	17.997	0.89187	0.0:0.0:1.0:0.0	.	80	Q96BD6	SPSB1_HUMAN	M	80	ENSP00000330221:V80M;ENSP00000409235:V80M;ENSP00000350573:V80M;ENSP00000366616:V80M	ENSP00000330221:V80M	V	+	1	0	SPSB1	9338775	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.995000	0.88328	2.485000	0.83878	0.655000	0.94253	GTG	.	.		0.582	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106	
CLCN6	1185	hgsc.bcm.edu	37	1	11897423	11897423	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:11897423A>G	ENST00000346436.6	+	20	2214	c.2162A>G	c.(2161-2163)tAc>tGc	p.Y721C	CLCN6_ENST00000376496.3_Missense_Mutation_p.Y721C|CLCN6_ENST00000376487.3_Missense_Mutation_p.Y699C|CLCN6_ENST00000312413.6_3'UTR	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	721					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CCCAACCTATACCCTGACCAG	0.587																																					p.Y721C		Atlas-SNP	.											.	CLCN6	77	.	0			c.A2162G						.						132.0	124.0	127.0					1																	11897423		2203	4300	6503	SO:0001583	missense	1185	exon20			ACCTATACCCTGA	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.2162A>G	chr1.hg19:g.11897423A>G	ENSP00000234488:p.Tyr721Cys	83.0	0.0		90.0	9.0	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	hg19	CCDS138.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147386	0.77888	.	.	ENSG00000011021	ENST00000346436;ENST00000376487;ENST00000376496	D;D;D	0.91843	-2.88;-2.87;-2.92	5.67	5.67	0.87782	.	0.055154	0.85682	D	0.000000	D	0.91452	0.7302	L	0.44542	1.39	0.80722	D	1	D;P	0.53619	0.961;0.934	P;B	0.50378	0.639;0.338	D	0.91017	0.4854	10	0.40728	T	0.16	-28.6138	15.1051	0.72315	1.0:0.0:0.0:0.0	.	699;721	F8W9R3;P51797	.;CLCN6_HUMAN	C	721;699;721	ENSP00000234488:Y721C;ENSP00000365670:Y699C;ENSP00000365679:Y721C	ENSP00000234488:Y721C	Y	+	2	0	CLCN6	11820010	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.962000	0.93254	2.163000	0.67991	0.459000	0.35465	TAC	.	.		0.587	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
TNFRSF1B	7133	hgsc.bcm.edu	37	1	12251908	12251908	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:12251908A>G	ENST00000376259.3	+	4	474	c.385A>G	c.(385-387)Agc>Ggc	p.S129G	TNFRSF1B_ENST00000536782.1_Missense_Mutation_p.S129G|MIR4632_ENST00000584158.1_RNA|TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	129					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	CTGCGCGCTGAGCAAGCAGGA	0.692																																					p.S129G		Atlas-SNP	.											.	TNFRSF1B	28	.	0			c.A385G						.						25.0	26.0	26.0					1																	12251908		2203	4300	6503	SO:0001583	missense	7133	exon4			GCGCTGAGCAAGC	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.385A>G	chr1.hg19:g.12251908A>G	ENSP00000365435:p.Ser129Gly	218.0	0.0		174.0	32.0	NM_001066	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	ENST00000376259.3	hg19	CCDS145.1	.	.	.	.	.	.	.	.	.	.	A	10.14	1.267486	0.23136	.	.	ENSG00000028137	ENST00000376259;ENST00000400863;ENST00000536782	T;T	0.73152	0.65;-0.72	4.12	-6.95	0.01628	TNFR/CD27/30/40/95 cysteine-rich region (2);	.	.	.	.	T	0.26122	0.0637	N	0.00142	-2.005	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43637	-0.9379	9	0.25751	T	0.34	0.3146	8.5316	0.33337	0.317:0.1378:0.5452:0.0	.	129	P20333	TNR1B_HUMAN	G	129	ENSP00000365435:S129G;ENSP00000440425:S129G	ENSP00000365435:S129G	S	+	1	0	TNFRSF1B	12174495	0.000000	0.05858	0.000000	0.03702	0.246000	0.25737	-2.446000	0.01010	-1.660000	0.01486	-0.421000	0.06004	AGC	.	.		0.692	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066	
EPHB2	2048	hgsc.bcm.edu	37	1	23235588	23235588	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:23235588T>C	ENST00000400191.3	+	13	2444	c.2426T>C	c.(2425-2427)gTg>gCg	p.V809A	EPHB2_ENST00000374632.3_Missense_Mutation_p.V810A|EPHB2_ENST00000374630.3_Missense_Mutation_p.V809A|EPHB2_ENST00000374627.1_Missense_Mutation_p.V804A	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	809	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GCCAGTGATGTGTGGAGCTAC	0.577																																					p.V810A		Atlas-SNP	.											.	EPHB2	257	.	0			c.T2429C						.						133.0	119.0	124.0					1																	23235588		2203	4300	6503	SO:0001583	missense	2048	exon13			GTGATGTGTGGAG	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2426T>C	chr1.hg19:g.23235588T>C	ENSP00000383053:p.Val809Ala	137.0	0.0		112.0	41.0	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	hg19		.	.	.	.	.	.	.	.	.	.	T	17.94	3.511541	0.64522	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34	4.96	4.96	0.65561	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.160375	0.40818	N	0.001019	D	0.94817	0.8326	H	0.94385	3.53	0.80722	D	1	D;D;D;B	0.59357	0.983;0.985;0.973;0.415	P;D;D;P	0.75484	0.866;0.986;0.979;0.771	D	0.94918	0.8071	10	0.38643	T	0.18	.	13.64	0.62243	0.0:0.0:0.0:1.0	.	751;809;827;810	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	A	751;809;809;810;804	ENSP00000363761:V809A;ENSP00000383053:V809A;ENSP00000363763:V810A;ENSP00000363758:V804A	ENSP00000363755:V751A	V	+	2	0	EPHB2	23108175	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	3.211000	0.51137	2.088000	0.63022	0.524000	0.50904	GTG	.	.		0.577	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
PHC2	1912	hgsc.bcm.edu	37	1	33794569	33794569	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:33794569T>C	ENST00000257118.5	-	13	2377	c.2324A>G	c.(2323-2325)cAt>cGt	p.H775R	PHC2_ENST00000373418.3_Missense_Mutation_p.H240R|PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000419414.2_Missense_Mutation_p.H776R|PHC2_ENST00000373422.3_Missense_Mutation_p.H381R|PHC2_ENST00000373416.1_Missense_Mutation_p.H240R|PHC2_ENST00000431992.1_Missense_Mutation_p.H746R|RP11-415J8.3_ENST00000457957.2_RNA	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	775					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GTCCCGCATATGCATGTCGGG	0.577																																					p.H775R		Atlas-SNP	.											.	PHC2	78	.	0			c.A2324G						.						90.0	87.0	88.0					1																	33794569		2203	4300	6503	SO:0001583	missense	1912	exon13			CGCATATGCATGT	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.2324A>G	chr1.hg19:g.33794569T>C	ENSP00000257118:p.His775Arg	58.0	0.0		47.0	11.0	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	hg19	CCDS378.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.43|19.43	3.826442|3.826442	0.71143|0.71143	.|.	.|.	ENSG00000134686|ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000373418;ENST00000419414;ENST00000373416|ENST00000307890	T;T;T;T|.	0.40225|.	2.05;1.64;1.04;2.05|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.255382|.	0.45126|.	D|.	0.000383|.	T|T	0.56775|0.56775	0.2008|0.2008	L|L	0.50333|0.50333	1.59|1.59	0.51012|0.51012	D|D	0.999906|0.999906	D;D;D;D|.	0.76494|.	0.993;0.993;0.993;0.999|.	D;D;D;D|.	0.80764|.	0.977;0.977;0.977;0.994|.	T|T	0.51647|0.51647	-0.8679|-0.8679	10|6	0.16896|0.07325	T|T	0.51|0.83	-23.9181|-23.9181	14.2004|14.2004	0.65699|0.65699	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	776;747;775;190|.	A8KA40;B7ZLY0;Q8IXK0;Q8IXK0-3|.	.;.;PHC2_HUMAN;.|.	R|V	746;775;381;240;776;240|352	ENSP00000389436:H746R;ENSP00000257118:H775R;ENSP00000362521:H381R;ENSP00000391440:H776R|.	ENSP00000257118:H775R|ENSP00000310685:I352V	H|I	-|-	2|1	0|0	PHC2|PHC2	33567156|33567156	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	1.129000|1.129000	0.31381|0.31381	2.237000|2.237000	0.73441|0.73441	0.459000|0.459000	0.35465|0.35465	CAT|ATA	.	.		0.577	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
RLF	6018	hgsc.bcm.edu	37	1	40701476	40701476	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:40701476G>T	ENST00000372771.4	+	8	1129	c.1102G>T	c.(1102-1104)Ggt>Tgt	p.G368C		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	368					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			ACAAGATGCTGGTCTTGGGGT	0.338																																					p.G368C		Atlas-SNP	.											.	RLF	152	.	0			c.G1102T						.						73.0	75.0	74.0					1																	40701476		2203	4300	6503	SO:0001583	missense	6018	exon8			GATGCTGGTCTTG		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.1102G>T	chr1.hg19:g.40701476G>T	ENSP00000361857:p.Gly368Cys	279.0	0.0		262.0	42.0	NM_012421	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	hg19	CCDS448.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236631	0.58886	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.46451	0.87	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68961	0.3058	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69727	-0.5067	10	0.87932	D	0	-16.009	20.6593	0.99626	0.0:0.0:1.0:0.0	.	61;368	F5H2M5;Q13129	.;RLF_HUMAN	C	368;61	ENSP00000361857:G368C	ENSP00000361857:G368C	G	+	1	0	RLF	40474063	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.827000	0.99397	2.885000	0.99019	0.655000	0.94253	GGT	.	.		0.338	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
INADL	10207	hgsc.bcm.edu	37	1	62263013	62263013	+	Nonsense_Mutation	SNP	C	C	T	rs200079447		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:62263013C>T	ENST00000371158.2	+	11	1429	c.1315C>T	c.(1315-1317)Cga>Tga	p.R439*	INADL_ENST00000316485.6_Nonsense_Mutation_p.R439*	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	439	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.R439*(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TGAAGTATTACGAAATGCAGG	0.423																																					p.R439X		Atlas-SNP	.											INADL,NS,carcinoma,0,2	INADL	179	.	1	Substitution - Nonsense(1)	pancreas(1)	c.C1315T						.						216.0	194.0	201.0					1																	62263013		2203	4300	6503	SO:0001587	stop_gained	10207	exon11			GTATTACGAAATG	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1315C>T	chr1.hg19:g.62263013C>T	ENSP00000360200:p.Arg439*	107.0	0.0		126.0	46.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Nonsense_Mutation	SNP	ENST00000371158.2	hg19	CCDS617.2	.	.	.	.	.	.	.	.	.	.	C	35	5.582251	0.96578	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	.	.	.	4.96	3.05	0.35203	.	0.104080	0.38720	N	0.001582	.	.	.	.	.	.	0.42996	D	0.994504	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0196	0.58779	0.3098:0.6902:0.0:0.0	.	.	.	.	X	439	.	ENSP00000255202:R439X	R	+	1	2	INADL	62035601	0.998000	0.40836	0.014000	0.15608	0.304000	0.27724	1.755000	0.38379	0.652000	0.30806	0.591000	0.81541	CGA	.	C|0.999;T|0.001		0.423	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
IL12RB2	3595	hgsc.bcm.edu	37	1	67855778	67855778	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:67855778T>C	ENST00000262345.1	+	15	2653	c.2013T>C	c.(2011-2013)aaT>aaC	p.N671N	IL12RB2_ENST00000544434.1_Silent_p.N585N|IL12RB2_ENST00000371000.1_Intron|IL12RB2_ENST00000465396.1_3'UTR|IL12RB2_ENST00000541374.1_Intron	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	671					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ATCCAGCAAATAGCACTTGCG	0.433																																					p.N671N		Atlas-SNP	.											.	IL12RB2	94	.	0			c.T2013C						.						125.0	114.0	117.0					1																	67855778		2203	4300	6503	SO:0001819	synonymous_variant	3595	exon15			AGCAAATAGCACT	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.2013T>C	chr1.hg19:g.67855778T>C		94.0	0.0		66.0	8.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Silent	SNP	ENST00000262345.1	hg19	CCDS638.1																																																																																			.	.		0.433	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
ELTD1	64123	hgsc.bcm.edu	37	1	79383362	79383362	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:79383362T>A	ENST00000370742.3	-	12	1769	c.1706A>T	c.(1705-1707)aAc>aTc	p.N569I		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	569					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CCAAATAAAGTTGTTTTCGGT	0.284																																					p.N569I		Atlas-SNP	.											.	ELTD1	143	.	0			c.A1706T						.						60.0	57.0	58.0					1																	79383362		1805	4065	5870	SO:0001583	missense	64123	exon12			ATAAAGTTGTTTT	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1706A>T	chr1.hg19:g.79383362T>A	ENSP00000359778:p.Asn569Ile	371.0	0.0		359.0	51.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	hg19	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357362	0.82243	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	T;T	0.45276	0.9;0.9	5.89	5.89	0.94794	GPCR, family 2-like (1);	0.044830	0.85682	D	0.000000	T	0.42607	0.1210	L	0.31845	0.965	0.58432	D	0.999997	D	0.65815	0.995	D	0.67725	0.953	T	0.27157	-1.0082	9	.	.	.	.	16.3123	0.82883	0.0:0.0:0.0:1.0	.	569	Q9HBW9	ELTD1_HUMAN	I	569;27	ENSP00000359778:N569I;ENSP00000383813:N27I	.	N	-	2	0	ELTD1	79155950	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.719000	0.61937	2.254000	0.74563	0.459000	0.35465	AAC	.	.		0.284	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
MCOLN3	55283	hgsc.bcm.edu	37	1	85487861	85487861	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:85487861G>A	ENST00000370589.2	-	11	1264	c.1212C>T	c.(1210-1212)acC>acT	p.T404T	MCOLN3_ENST00000341115.4_Silent_p.T348T|MCOLN3_ENST00000474447.1_5'UTR|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	404					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		CTGCCTGAAGGGTCAAAATGA	0.478																																					p.T404T		Atlas-SNP	.											.	MCOLN3	74	.	0			c.C1212T						.						82.0	80.0	81.0					1																	85487861		2203	4300	6503	SO:0001819	synonymous_variant	55283	exon11			CTGAAGGGTCAAA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.1212C>T	chr1.hg19:g.85487861G>A		208.0	0.0		212.0	82.0	NM_018298	Q5T4H5|Q5T4H6|Q9NV09	Silent	SNP	ENST00000370589.2	hg19	CCDS701.1																																																																																			.	.		0.478	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
PKN2	5586	hgsc.bcm.edu	37	1	89226006	89226006	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:89226006G>A	ENST00000370521.3	+	3	810	c.451G>A	c.(451-453)Gta>Ata	p.V151I	PKN2_ENST00000370505.3_5'UTR|PKN2_ENST00000370513.5_Missense_Mutation_p.V151I|PKN2_ENST00000316005.7_Missense_Mutation_p.V151I	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	151					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		AGAACTTAAAGTAAAACAAGG	0.333																																					p.V151I		Atlas-SNP	.											.	PKN2	109	.	0			c.G451A						.						91.0	95.0	94.0					1																	89226006		1817	4068	5885	SO:0001583	missense	5586	exon3			CTTAAAGTAAAAC	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.451G>A	chr1.hg19:g.89226006G>A	ENSP00000359552:p.Val151Ile	345.0	0.0		325.0	129.0	NM_006256	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	hg19	CCDS714.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.895418	0.91962	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370513	T;T;T	0.16196	2.36;2.36;2.36	4.5	4.5	0.54988	.	0.000000	0.40469	U	0.001090	T	0.39708	0.1088	M	0.91406	3.205	0.80722	D	1	P;P;P;P	0.51147	0.933;0.776;0.942;0.638	P;P;P;B	0.59288	0.855;0.598;0.778;0.348	T	0.53556	-0.8422	10	0.59425	D	0.04	.	17.5792	0.87960	0.0:0.0:1.0:0.0	.	151;151;151;151	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	I	151	ENSP00000359552:V151I;ENSP00000317851:V151I;ENSP00000359544:V151I	ENSP00000317851:V151I	V	+	1	0	PKN2	88998594	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.586000	0.82596	2.218000	0.71995	0.591000	0.81541	GTA	.	.		0.333	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256	
EVI5	7813	hgsc.bcm.edu	37	1	93131551	93131551	+	Splice_Site	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:93131551T>G	ENST00000370331.1	-	11	1300		c.e11-2		EVI5_ENST00000543509.1_Splice_Site|EVI5_ENST00000540033.1_Splice_Site|EVI5_ENST00000491940.1_5'Flank	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5						cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		GCGTAACCTCTGCCAAGAAAA	0.323																																					.		Atlas-SNP	.											.	EVI5	94	.	0			c.1291-2A>C						.						101.0	100.0	100.0					1																	93131551		2202	4298	6500	SO:0001630	splice_region_variant	7813	exon12			AACCTCTGCCAAG	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1291-2A>C	chr1.hg19:g.93131551T>G		46.0	0.0		58.0	12.0	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Splice_Site	SNP	ENST00000370331.1	hg19	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.616173	0.66672	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8205	0.70068	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EVI5	92904139	1.000000	0.71417	0.983000	0.44433	0.924000	0.55760	7.405000	0.80007	1.887000	0.54652	0.477000	0.44152	.	.	.		0.323	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	Intron
SLC44A3	126969	hgsc.bcm.edu	37	1	95330430	95330430	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:95330430A>T	ENST00000271227.6	+	11	1472	c.1370A>T	c.(1369-1371)tAc>tTc	p.Y457F	SLC44A3_ENST00000532427.1_Missense_Mutation_p.Y377F|SLC44A3_ENST00000446120.2_Missense_Mutation_p.Y421F|SLC44A3_ENST00000529450.1_Missense_Mutation_p.Y425F|SLC44A3_ENST00000467909.1_Missense_Mutation_p.Y409F|SLC44A3_ENST00000527077.1_Missense_Mutation_p.Y389F|SLC44A3_ENST00000530397.1_3'UTR	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	457					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	ATTGTCATGTACATGCAAAAC	0.428																																					p.Y457F		Atlas-SNP	.											.	SLC44A3	109	.	0			c.A1370T						.						205.0	191.0	196.0					1																	95330430		2203	4300	6503	SO:0001583	missense	126969	exon11			TCATGTACATGCA	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1370A>T	chr1.hg19:g.95330430A>T	ENSP00000271227:p.Tyr457Phe	46.0	0.0		48.0	5.0	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	hg19	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	A	12.55	1.971662	0.34754	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427	T;T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76;1.76	5.84	-2.67	0.06059	.	0.974275	0.08449	N	0.944221	T	0.10723	0.0262	M	0.67625	2.065	0.19775	N	0.999955	B;B;B;B;B	0.22080	0.015;0.064;0.015;0.015;0.003	B;B;B;B;B	0.29716	0.018;0.106;0.018;0.018;0.012	T	0.47971	-0.9075	10	0.72032	D	0.01	0.2618	4.3337	0.11076	0.4195:0.1013:0.3807:0.0984	.	377;421;389;425;457	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	F	421;457;389;425;409;377	ENSP00000389143:Y421F;ENSP00000271227:Y457F;ENSP00000433641:Y389F;ENSP00000431836:Y425F;ENSP00000432789:Y409F;ENSP00000436661:Y377F	ENSP00000271227:Y457F	Y	+	2	0	SLC44A3	95103018	0.077000	0.21312	0.000000	0.03702	0.001000	0.01503	0.621000	0.24418	-0.785000	0.04522	-0.408000	0.06270	TAC	.	.		0.428	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
RSBN1	54665	hgsc.bcm.edu	37	1	114354782	114354782	+	Missense_Mutation	SNP	C	C	G	rs372385428		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:114354782C>G	ENST00000261441.5	-	1	316	c.253G>C	c.(253-255)Gtt>Ctt	p.V85L	RP5-1073O3.2_ENST00000418238.1_RNA|RP5-1073O3.2_ENST00000429398.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	85						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCCGTTTAACTCCCCGCGGG	0.711																																					p.V85L		Atlas-SNP	.											.	RSBN1	71	.	0			c.G253C						.						23.0	33.0	29.0					1																	114354782		2170	4286	6456	SO:0001583	missense	54665	exon1			GTTTAACTCCCCG	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.253G>C	chr1.hg19:g.114354782C>G	ENSP00000261441:p.Val85Leu	70.0	0.0		61.0	11.0	NM_018364	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	ENST00000261441.5	hg19	CCDS862.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583608	0.65992	.	.	ENSG00000081019	ENST00000261441	.	.	.	5.11	4.12	0.48240	.	0.365028	0.20479	N	0.091528	T	0.08358	0.0208	N	0.08118	0	0.25877	N	0.983638	B	0.26147	0.143	B	0.27608	0.081	T	0.08911	-1.0699	9	0.52906	T	0.07	-6.5303	7.6603	0.28400	0.0:0.8848:0.0:0.1152	.	85	Q5VWQ0	RSBN1_HUMAN	L	85	.	ENSP00000261441:V85L	V	-	1	0	RSBN1	114156305	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	1.356000	0.34079	2.659000	0.90383	0.561000	0.74099	GTT	.	.		0.711	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
CRNN	49860	hgsc.bcm.edu	37	1	152382558	152382558	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:152382558C>A	ENST00000271835.3	-	3	1062	c.1000G>T	c.(1000-1002)Ggc>Tgc	p.G334C	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	334	Gln-rich.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGCTCCTGCCTTGACCGTGG	0.592																																					p.G334C		Atlas-SNP	.											.	CRNN	78	.	0			c.G1000T						.						235.0	207.0	216.0					1																	152382558		2203	4300	6503	SO:0001583	missense	49860	exon3			TCCTGCCTTGACC	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1000G>T	chr1.hg19:g.152382558C>A	ENSP00000271835:p.Gly334Cys	147.0	0.0		308.0	56.0	NM_016190	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	hg19	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457724	0.43634	.	.	ENSG00000143536	ENST00000271835	T	0.05139	3.49	4.61	2.66	0.31614	.	0.860398	0.10200	N	0.703486	T	0.02571	0.0078	L	0.29908	0.895	0.09310	N	1	D	0.59357	0.985	P	0.46796	0.527	T	0.45190	-0.9278	10	0.59425	D	0.04	.	6.5679	0.22523	0.0:0.716:0.1827:0.1013	.	334	Q9UBG3	CRNN_HUMAN	C	334	ENSP00000271835:G334C	ENSP00000271835:G334C	G	-	1	0	CRNN	150649182	0.001000	0.12720	0.022000	0.16811	0.017000	0.09413	-0.201000	0.09464	1.122000	0.41944	0.536000	0.68110	GGC	.	.		0.592	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
SPRR2A	6700	hgsc.bcm.edu	37	1	153029021	153029021	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:153029021T>A	ENST00000392653.2	-	2	276	c.191A>T	c.(190-192)cAg>cTg	p.Q64L		NM_005988.2	NP_005979.1	P35326	SPR2A_HUMAN	small proline-rich protein 2A	64					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				large_intestine(2)|ovary(1)	3	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATACTTTGACTGGCAGGGTGG	0.537																																					p.Q64L		Atlas-SNP	.											.	SPRR2A	9	.	0			c.A191T						.						227.0	209.0	216.0					1																	153029021		2203	4300	6503	SO:0001583	missense	6700	exon2			TTTGACTGGCAGG	X53064	CCDS1034.1	1q21-q22	2008-02-05			ENSG00000241794	ENSG00000241794			11261	protein-coding gene	gene with protein product		182267				8325635	Standard	NM_005988		Approved		uc001fbd.3	P35326	OTTHUMG00000014395	ENST00000392653.2:c.191A>T	chr1.hg19:g.153029021T>A	ENSP00000376423:p.Gln64Leu	85.0	0.0		170.0	11.0	NM_005988	B2R4T3|D3DV35|Q5T529	Missense_Mutation	SNP	ENST00000392653.2	hg19	CCDS1034.1	.	.	.	.	.	.	.	.	.	.	T	9.305	1.054054	0.19907	.	.	ENSG00000241794	ENST00000392653	T	0.33865	1.39	2.83	2.83	0.33086	.	0.000000	0.33670	N	0.004669	T	0.31949	0.0813	.	.	.	0.23739	N	0.996973	P	0.51449	0.945	P	0.56648	0.803	T	0.05289	-1.0894	9	0.87932	D	0	.	7.3682	0.26785	0.0:0.0:0.0:1.0	.	64	P35326	SPR2A_HUMAN	L	64	ENSP00000376423:Q64L	ENSP00000376423:Q64L	Q	-	2	0	SPRR2A	151295645	0.991000	0.36638	0.969000	0.41365	0.053000	0.15095	3.196000	0.51020	1.274000	0.44362	0.334000	0.21626	CAG	.	.		0.537	SPRR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040049.1	NM_005988	
KCNN3	3782	hgsc.bcm.edu	37	1	154744565	154744565	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:154744565A>G	ENST00000271915.4	-	3	1649	c.1334T>C	c.(1333-1335)tTc>tCc	p.F445S	KCNN3_ENST00000358505.2_Missense_Mutation_p.F132S|KCNN3_ENST00000361147.4_Missense_Mutation_p.F140S	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	450					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GCGGGTGTTGAAGTTGATCTT	0.577																																					p.F445S		Atlas-SNP	.											.	KCNN3	141	.	0			c.T1334C						.						142.0	106.0	118.0					1																	154744565		2203	4300	6503	SO:0001583	missense	3782	exon3			GTGTTGAAGTTGA	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1334T>C	chr1.hg19:g.154744565A>G	ENSP00000271915:p.Phe445Ser	105.0	0.0		226.0	10.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.288440	0.59976	.	.	ENSG00000143603	ENST00000361147;ENST00000271915;ENST00000358505	D;D;D	0.98901	-5.22;-4.06;-5.22	4.66	4.66	0.58398	.	0.000000	0.56097	D	0.000021	D	0.99013	0.9663	M	0.84511	2.7	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.995	D;D;D	0.80764	0.994;0.979;0.962	D	0.99793	1.1032	10	0.87932	D	0	-16.2721	13.9313	0.63998	1.0:0.0:0.0:0.0	.	451;450;140	Q6JXY2;Q9UGI6;Q9UGI6-2	.;KCNN3_HUMAN;.	S	140;445;132	ENSP00000354764:F140S;ENSP00000271915:F445S;ENSP00000351295:F132S	ENSP00000271915:F445S	F	-	2	0	KCNN3	153011189	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.135000	0.94478	1.954000	0.56735	0.459000	0.35465	TTC	.	.		0.577	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
IQGAP3	128239	hgsc.bcm.edu	37	1	156496381	156496381	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:156496381T>A	ENST00000361170.2	-	38	4803	c.4793A>T	c.(4792-4794)cAg>cTg	p.Q1598L	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1598					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATACTGGAGCTGCAGGAGATC	0.493																																					p.Q1598L		Atlas-SNP	.											.	IQGAP3	146	.	0			c.A4793T						.						77.0	69.0	72.0					1																	156496381		2203	4300	6503	SO:0001583	missense	128239	exon38			TGGAGCTGCAGGA	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4793A>T	chr1.hg19:g.156496381T>A	ENSP00000354451:p.Gln1598Leu	66.0	0.0		116.0	10.0	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	hg19	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.650199	0.87958	.	.	ENSG00000183856	ENST00000361170	T	0.03580	3.88	4.76	4.76	0.60689	.	0.066807	0.64402	D	0.000007	T	0.13200	0.0320	M	0.89715	3.055	0.58432	D	0.999998	D	0.63046	0.992	D	0.63381	0.914	T	0.00907	-1.1519	10	0.87932	D	0	-21.9106	13.2453	0.60020	0.0:0.0:0.0:1.0	.	1598	Q86VI3	IQGA3_HUMAN	L	1598	ENSP00000354451:Q1598L	ENSP00000354451:Q1598L	Q	-	2	0	IQGAP3	154763005	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.799000	0.85936	2.003000	0.58678	0.459000	0.35465	CAG	.	.		0.493	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
GPATCH4	54865	hgsc.bcm.edu	37	1	156565217	156565217	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:156565217C>T	ENST00000438976.2	-	8	946	c.916G>A	c.(916-918)Gag>Aag	p.E306K	GPATCH4_ENST00000368232.4_Missense_Mutation_p.E301K|GPATCH4_ENST00000497287.1_5'Flank			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	301							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCCATCTTCTCCTCTTCATGG	0.537																																					p.E306K		Atlas-SNP	.											.	GPATCH4	34	.	0			c.G916A						.						243.0	235.0	238.0					1																	156565217		2203	4300	6503	SO:0001583	missense	54865	exon8			TCTTCTCCTCTTC	BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.916G>A	chr1.hg19:g.156565217C>T	ENSP00000396441:p.Glu306Lys	110.0	0.0		236.0	12.0	NM_015590	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Missense_Mutation	SNP	ENST00000438976.2	hg19	CCDS44245.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032211	0.54790	.	.	ENSG00000160818	ENST00000368232;ENST00000368229;ENST00000438976	T;T	0.43294	0.95;0.95	4.84	3.89	0.44902	.	3.316370	0.00695	N	0.000747	T	0.19805	0.0476	L	0.42245	1.32	0.53005	D	0.999969	B;B	0.17465	0.022;0.022	B;B	0.10450	0.005;0.005	T	0.16689	-1.0394	10	0.14656	T	0.56	-19.8176	10.8507	0.46769	0.0:0.8993:0.0:0.1007	.	306;301	E9PAV9;Q5T3I0	.;GPTC4_HUMAN	K	301;301;306	ENSP00000357215:E301K;ENSP00000396441:E306K	ENSP00000357212:E301K	E	-	1	0	GPATCH4	154831841	0.000000	0.05858	0.046000	0.18839	0.763000	0.43281	-0.805000	0.04530	1.284000	0.44531	0.557000	0.71058	GAG	.	.		0.537	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386947.1	NM_017725	
NES	10763	hgsc.bcm.edu	37	1	156640722	156640722	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:156640722T>A	ENST00000368223.3	-	4	3390	c.3258A>T	c.(3256-3258)tcA>tcT	p.S1086S		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1086	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGGCAGGCTCTGACCCCAACA	0.682																																					p.S1086S		Atlas-SNP	.											.	NES	196	.	0			c.A3258T						.						23.0	26.0	25.0					1																	156640722		2202	4289	6491	SO:0001819	synonymous_variant	10763	exon4			AGGCTCTGACCCC	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3258A>T	chr1.hg19:g.156640722T>A		152.0	0.0		318.0	22.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Silent	SNP	ENST00000368223.3	hg19	CCDS1151.1																																																																																			.	.		0.682	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
ISG20L2	81875	hgsc.bcm.edu	37	1	156697395	156697395	+	Missense_Mutation	SNP	T	T	A	rs35218759		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:156697395T>A	ENST00000313146.6	-	1	832	c.50A>T	c.(49-51)aAg>aTg	p.K17M	RRNAD1_ENST00000368216.4_5'Flank|ISG20L2_ENST00000368219.1_Missense_Mutation_p.K17M|RRNAD1_ENST00000368218.4_5'Flank|ISG20L2_ENST00000472824.2_5'Flank|RRNAD1_ENST00000524343.1_5'Flank	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	17					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTCTAATGCCTTTTTGGGAGG	0.463																																					p.K17M		Atlas-SNP	.											.	ISG20L2	43	.	0			c.A50T						.						70.0	78.0	75.0					1																	156697395		2203	4300	6503	SO:0001583	missense	81875	exon1			AATGCCTTTTTGG	AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.50A>T	chr1.hg19:g.156697395T>A	ENSP00000323424:p.Lys17Met	38.0	0.0		112.0	13.0	NM_030980	D3DVC6|Q64KA2	Missense_Mutation	SNP	ENST00000313146.6	hg19	CCDS1153.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.913471	0.72983	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.33654	1.4;1.4	5.41	4.28	0.50868	.	.	.	.	.	T	0.23965	0.0580	L	0.34521	1.04	0.33313	D	0.566358	D	0.67145	0.996	P	0.54499	0.754	T	0.13575	-1.0504	9	0.72032	D	0.01	-13.1106	8.1337	0.31041	0.0:0.0895:0.0:0.9105	.	17	Q9H9L3	I20L2_HUMAN	M	17	ENSP00000323424:K17M;ENSP00000357202:K17M	ENSP00000323424:K17M	K	-	2	0	ISG20L2	154964019	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	2.179000	0.42528	1.058000	0.40530	0.533000	0.62120	AAG	.	.		0.463	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098969.1	NM_030980	
KIRREL	55243	hgsc.bcm.edu	37	1	158064686	158064686	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:158064686T>A	ENST00000359209.6	+	15	2117	c.2050T>A	c.(2050-2052)Tac>Aac	p.Y684N	KIRREL_ENST00000368172.1_Missense_Mutation_p.Y498N|KIRREL_ENST00000360089.4_Missense_Mutation_p.Y520N|KIRREL_ENST00000392272.2_Missense_Mutation_p.Y581N|KIRREL_ENST00000368173.3_Missense_Mutation_p.Y700N|KIRREL_ENST00000416935.2_Missense_Mutation_p.Y584N			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	684					excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CCAGCTGTCCTACGAGAACTA	0.647																																					p.Y684N		Atlas-SNP	.											.	KIRREL	346	.	0			c.T2050A						.						51.0	53.0	52.0					1																	158064686		2203	4300	6503	SO:0001583	missense	55243	exon15			CTGTCCTACGAGA	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.2050T>A	chr1.hg19:g.158064686T>A	ENSP00000352138:p.Tyr684Asn	242.0	0.0		429.0	35.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	hg19	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	T	17.45	3.391766	0.62066	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.73469	0.23;-0.75;-0.13;-0.38;-0.29;0.07	4.76	4.76	0.60689	.	0.000000	0.39274	N	0.001420	T	0.65481	0.2695	N	0.24115	0.695	0.53005	D	0.99996	D;D;D;D	0.71674	0.998;0.996;0.978;0.996	D;P;P;P	0.63488	0.915;0.853;0.758;0.853	T	0.66528	-0.5901	10	0.28530	T	0.3	-13.5334	12.2244	0.54451	0.0:0.0:0.0:1.0	.	584;520;498;684	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	N	520;700;581;684;584;498	ENSP00000353202:Y520N;ENSP00000357155:Y700N;ENSP00000376098:Y581N;ENSP00000352138:Y684N;ENSP00000389674:Y584N;ENSP00000357154:Y498N	ENSP00000352138:Y684N	Y	+	1	0	KIRREL	156331310	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.577000	0.67444	1.765000	0.52091	0.459000	0.35465	TAC	.	.		0.647	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
SPTA1	6708	hgsc.bcm.edu	37	1	158592934	158592934	+	Nonsense_Mutation	SNP	C	C	A	rs533909383		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:158592934C>A	ENST00000368147.4	-	43	6139	c.5959G>T	c.(5959-5961)Gag>Tag	p.E1987*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1987					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCAGTGATCTCGGGAAGTCTC	0.498																																					p.E1987X		Atlas-SNP	.											.	SPTA1	720	.	0			c.G5959T						.						292.0	295.0	294.0					1																	158592934		1927	4133	6060	SO:0001587	stop_gained	6708	exon43			TGATCTCGGGAAG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5959G>T	chr1.hg19:g.158592934C>A	ENSP00000357129:p.Glu1987*	182.0	0.0		391.0	39.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	44	10.671078	0.99447	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	4.78	2.7	0.31948	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.4875	0.22097	0.0:0.5424:0.0:0.4576	.	.	.	.	X	1987;1984	.	ENSP00000357129:E1984X	E	-	1	0	SPTA1	156859558	0.977000	0.34250	0.436000	0.26797	0.304000	0.27724	1.767000	0.38501	0.422000	0.26005	0.655000	0.94253	GAG	.	.		0.498	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
VSIG8	391123	hgsc.bcm.edu	37	1	159825697	159825698	+	Missense_Mutation	DNP	CA	CA	GT			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:159825697_159825698CA>GT	ENST00000368100.1	-	6	1081_1082	c.946_947TG>AC	c.(946-948)TGc>ACc	p.C316T	C1orf204_ENST00000491974.1_5'Flank|C1orf204_ENST00000368102.1_5'Flank	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	316						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					CAAgtcgccgcaggcccctccg	0.713																																					p.C316S		Atlas-SNP	.											.	VSIG8	24	.	0			c.G947C|c.T946A						.																																			SO:0001583	missense	391123	exon6			TCGCCGCAGGCCC|CGCCGCAGGCCCC		CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.946_947delinsGT	chr1.hg19:g.159825697_159825698delinsGT	ENSP00000357080:p.Cys316Thr	52.0|55.0	0.0		157.0	27.0|28.0	NM_001013661	Q5VU14	Missense_Mutation	SNP	ENST00000368100.1	hg19	CCDS30913.1																																																																																			.	.		0.713	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085978.8	NM_001013661	
NDUFS2	4720	hgsc.bcm.edu	37	1	161180452	161180452	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:161180452A>T	ENST00000367993.3	+	10	1386	c.938A>T	c.(937-939)cAg>cTg	p.Q313L	NDUFS2_ENST00000476409.2_Missense_Mutation_p.Q215L|NDUFS2_ENST00000392179.4_Missense_Mutation_p.Q313L|NDUFS2_ENST00000465923.1_3'UTR	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	313					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	GTTTACGACCAGGTTGAGTTT	0.532																																					p.Q313L		Atlas-SNP	.											.	NDUFS2	33	.	0			c.A938T						.						152.0	119.0	130.0					1																	161180452		2203	4300	6503	SO:0001583	missense	4720	exon9			ACGACCAGGTTGA	BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.938A>T	chr1.hg19:g.161180452A>T	ENSP00000356972:p.Gln313Leu	145.0	0.0		321.0	22.0	NM_001166159	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Missense_Mutation	SNP	ENST00000367993.3	hg19	CCDS1224.1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.874660	0.51695	.	.	ENSG00000158864	ENST00000367993;ENST00000392179;ENST00000476409	D;D;D	0.87809	-2.3;-2.3;-2.3	5.14	5.14	0.70334	NADH-quinone oxidoreductase, subunit D (1);	0.184651	0.47455	D	0.000231	T	0.69378	0.3104	L	0.31065	0.9	0.39344	D	0.965631	B;B;B;B	0.06786	0.0;0.0;0.001;0.001	B;B;B;B	0.09377	0.002;0.002;0.004;0.004	T	0.64875	-0.6304	9	0.22109	T	0.4	.	14.0779	0.64903	1.0:0.0:0.0:0.0	.	262;215;313;313	B7Z792;B7Z9L2;Q53HG2;O75306	.;.;.;NDUS2_HUMAN	L	313;313;215	ENSP00000356972:Q313L;ENSP00000376018:Q313L;ENSP00000446447:Q215L	ENSP00000356972:Q313L	Q	+	2	0	NDUFS2	159447076	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.347000	0.90062	2.155000	0.67459	0.454000	0.30748	CAG	.	.		0.532	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083015.1	NM_004550	
DUSP27	92235	hgsc.bcm.edu	37	1	167096866	167096866	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:167096866T>A	ENST00000361200.2	+	6	2664	c.2498T>A	c.(2497-2499)cTa>cAa	p.L833Q	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.L833Q|DUSP27_ENST00000443333.1_Missense_Mutation_p.L833Q			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	833					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AATGTGGACCTAAAGGAACTT	0.522																																					p.L833Q		Atlas-SNP	.											.	DUSP27	235	.	0			c.T2498A						.						76.0	73.0	74.0					1																	167096866		2203	4300	6503	SO:0001583	missense	92235	exon5			TGGACCTAAAGGA	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2498T>A	chr1.hg19:g.167096866T>A	ENSP00000354483:p.Leu833Gln	164.0	0.0		343.0	30.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.519566	0.27211	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.08282	3.11;3.11;3.11	5.36	4.23	0.50019	.	0.118708	0.35708	N	0.003037	T	0.16214	0.0390	M	0.69823	2.125	0.44477	D	0.997416	D	0.89917	1.0	D	0.87578	0.998	T	0.00684	-1.1611	10	0.87932	D	0	-9.3483	11.0427	0.47840	0.0:0.073:0.0:0.927	.	833	Q5VZP5	DUS27_HUMAN	Q	833	ENSP00000354483:L833Q;ENSP00000271385:L833Q;ENSP00000404874:L833Q	ENSP00000271385:L833Q	L	+	2	0	DUSP27	165363490	1.000000	0.71417	0.116000	0.21606	0.002000	0.02628	7.687000	0.84139	0.861000	0.35504	-0.389000	0.06534	CTA	.	.		0.522	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
SUCO	51430	hgsc.bcm.edu	37	1	172577940	172577940	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:172577940A>T	ENST00000263688.3	+	23	3538	c.3319A>T	c.(3319-3321)Aag>Tag	p.K1107*	SUCO_ENST00000608151.1_Nonsense_Mutation_p.K1259*|SUCO_ENST00000610051.1_Nonsense_Mutation_p.K736*|SUCO_ENST00000367723.4_Nonsense_Mutation_p.K1258*	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1107					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											TCCAGAAAAGAAGGTAATTGT	0.284																																					p.K1107X		Atlas-SNP	.											.	.	.	.	0			c.A3319T						.						66.0	78.0	74.0					1																	172577940		2200	4289	6489	SO:0001587	stop_gained	51430	exon23			GAAAAGAAGGTAA	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3319A>T	chr1.hg19:g.172577940A>T	ENSP00000263688:p.Lys1107*	312.0	0.0		669.0	61.0	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Nonsense_Mutation	SNP	ENST00000263688.3	hg19	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	A	42	9.549242	0.99202	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.116	13.4922	0.61402	1.0:0.0:0.0:0.0	.	.	.	.	X	1259;1107	.	ENSP00000263688:K1107X	K	+	1	0	C1orf9	170844563	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.986000	0.88173	2.082000	0.62665	0.459000	0.35465	AAG	.	.		0.284	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
TNR	7143	hgsc.bcm.edu	37	1	175293604	175293604	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:175293604T>C	ENST00000367674.2	-	22	4553	c.3845A>G	c.(3844-3846)gAc>gGc	p.D1282G	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Missense_Mutation_p.D1282G			Q92752	TENR_HUMAN	tenascin R	1282	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AACATCATTGTCTCTATCCTC	0.488																																					p.D1282G		Atlas-SNP	.											.	TNR	399	.	0			c.A3845G						.						257.0	205.0	222.0					1																	175293604		2203	4300	6503	SO:0001583	missense	7143	exon22			TCATTGTCTCTAT	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3845A>G	chr1.hg19:g.175293604T>C	ENSP00000356646:p.Asp1282Gly	125.0	0.0		298.0	70.0	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	hg19	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.931683	0.92389	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	D;D	0.86297	-2.1;-2.1	5.66	5.66	0.87406	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.95510	0.8541	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96791	0.9582	10	0.87932	D	0	.	15.5673	0.76303	0.0:0.0:0.0:1.0	.	1282	Q92752	TENR_HUMAN	G	1282;1282;1192	ENSP00000356646:D1282G;ENSP00000263525:D1282G	ENSP00000263525:D1282G	D	-	2	0	TNR	173560227	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.930000	0.87610	2.154000	0.67381	0.533000	0.62120	GAC	.	.		0.488	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TNR	7143	hgsc.bcm.edu	37	1	175334337	175334337	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:175334337G>C	ENST00000367674.2	-	12	3104	c.2396C>G	c.(2395-2397)cCc>cGc	p.P799R	TNR_ENST00000263525.2_Missense_Mutation_p.P799R			Q92752	TENR_HUMAN	tenascin R	799	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GTCTGCTGGGGGAGATGGATC	0.522																																					p.P799R		Atlas-SNP	.											.	TNR	399	.	0			c.C2396G						.						103.0	97.0	99.0					1																	175334337		2203	4300	6503	SO:0001583	missense	7143	exon12			GCTGGGGGAGATG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2396C>G	chr1.hg19:g.175334337G>C	ENSP00000356646:p.Pro799Arg	116.0	0.0		266.0	144.0	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	hg19	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.635445	0.87760	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.54866	0.55;0.55	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68339	0.2990	L	0.45228	1.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68051	-0.5511	10	0.66056	D	0.02	.	19.8936	0.96942	0.0:0.0:1.0:0.0	.	799	Q92752	TENR_HUMAN	R	799	ENSP00000356646:P799R;ENSP00000263525:P799R	ENSP00000263525:P799R	P	-	2	0	TNR	173600960	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	9.296000	0.96104	2.793000	0.96121	0.655000	0.94253	CCC	.	.		0.522	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
AXDND1	126859	hgsc.bcm.edu	37	1	179497527	179497527	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:179497527T>C	ENST00000367618.3	+	23	3063	c.2676T>C	c.(2674-2676)caT>caC	p.H892H		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	892	Glu-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						AAAATGTTCATTCCAAACCTC	0.373																																					p.H892H		Atlas-SNP	.											.	AXDND1	142	.	0			c.T2676C						.						127.0	112.0	117.0					1																	179497527		2203	4300	6503	SO:0001819	synonymous_variant	126859	exon23			TGTTCATTCCAAA	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2676T>C	chr1.hg19:g.179497527T>C		64.0	0.0		153.0	24.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Silent	SNP	ENST00000367618.3	hg19	CCDS30948.1																																																																																			.	.		0.373	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
CACNA1E	777	hgsc.bcm.edu	37	1	181685267	181685267	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:181685267T>A	ENST00000367573.2	+	10	1315		c.e10+2		CACNA1E_ENST00000357570.5_Splice_Site|CACNA1E_ENST00000367567.4_Splice_Site|CACNA1E_ENST00000367570.1_Splice_Site|CACNA1E_ENST00000360108.3_Splice_Site|CACNA1E_ENST00000526775.1_Splice_Site|CACNA1E_ENST00000358338.5_Splice_Site	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit						calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCTCTGTGGGTGAGTGGATCC	0.498																																					.		Atlas-SNP	.											.	CACNA1E	778	.	0			c.1315+2T>A						.						67.0	75.0	73.0					1																	181685267		1946	4142	6088	SO:0001630	splice_region_variant	777	exon10			TGTGGGTGAGTGG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1315+2T>A	chr1.hg19:g.181685267T>A		67.0	0.0		126.0	10.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Splice_Site	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	T	10.55	1.380247	0.24944	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.51	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1938	0.31385	0.0:0.0714:0.1361:0.7926	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1E	179951890	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	3.774000	0.55341	1.003000	0.39130	-0.313000	0.08912	.	.	.		0.498	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Intron
CACNA1E	777	hgsc.bcm.edu	37	1	181767735	181767735	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:181767735A>G	ENST00000367573.2	+	48	6707	c.6707A>G	c.(6706-6708)cAc>cGc	p.H2236R	CACNA1E_ENST00000357570.5_Missense_Mutation_p.H2187R|CACNA1E_ENST00000367567.4_Missense_Mutation_p.H1800R|CACNA1E_ENST00000367570.1_Missense_Mutation_p.H2193R|CACNA1E_ENST00000360108.3_Missense_Mutation_p.H2217R|CACNA1E_ENST00000526775.1_Missense_Mutation_p.H2174R|CACNA1E_ENST00000358338.5_Missense_Mutation_p.H2125R	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2236					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTGGCCCTGCACGAAGACTCC	0.612																																					p.H2236R		Atlas-SNP	.											.	CACNA1E	778	.	0			c.A6707G						.						41.0	46.0	44.0					1																	181767735		2141	4256	6397	SO:0001583	missense	777	exon48			CCCTGCACGAAGA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6707A>G	chr1.hg19:g.181767735A>G	ENSP00000356545:p.His2236Arg	72.0	0.0		126.0	14.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	7.992	0.753440	0.15778	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.95756	-3.73;-3.73;-3.73;-3.73;-3.8;-3.74;-3.73	5.55	5.55	0.83447	.	0.344130	0.31507	N	0.007539	D	0.87708	0.6245	N	0.10916	0.065	0.53688	D	0.999976	B;B	0.24823	0.112;0.001	B;B	0.17722	0.019;0.003	D	0.84359	0.0537	10	0.02654	T	1	.	15.432	0.75108	1.0:0.0:0.0:0.0	.	2174;2193	Q15878-2;Q15878-3	.;.	R	2193;2174;2187;2125;1800;2217;2236	ENSP00000356542:H2193R;ENSP00000434814:H2174R;ENSP00000350183:H2187R;ENSP00000351101:H2125R;ENSP00000356539:H1800R;ENSP00000353222:H2217R;ENSP00000356545:H2236R	ENSP00000350183:H2187R	H	+	2	0	CACNA1E	180034358	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.669000	0.74462	2.117000	0.64856	0.456000	0.33151	CAC	.	.		0.612	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
DHX9	1660	hgsc.bcm.edu	37	1	182811771	182811771	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:182811771A>G	ENST00000367549.3	+	2	180	c.70A>G	c.(70-72)Aga>Gga	p.R24G		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	24	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						CTATGAAATTAGAGCAGTGGG	0.378																																					p.R24G	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A70G						.						109.0	101.0	104.0					1																	182811771		1856	4091	5947	SO:0001583	missense	1660	exon2			GAAATTAGAGCAG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.70A>G	chr1.hg19:g.182811771A>G	ENSP00000356520:p.Arg24Gly	123.0	0.0		270.0	26.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.299585	0.81136	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.77098	-1.07	5.46	5.46	0.80206	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.86764	0.6011	M	0.81179	2.53	0.58432	D	0.999999	D	0.71674	0.998	D	0.70487	0.969	D	0.88041	0.2781	10	0.72032	D	0.01	.	10.4261	0.44378	0.7254:0.2746:0.0:0.0	.	24	Q08211	DHX9_HUMAN	G	24	ENSP00000356520:R24G	ENSP00000356520:R24G	R	+	1	2	DHX9	181078394	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.753000	0.68736	2.195000	0.70347	0.528000	0.53228	AGA	.	.		0.378	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DHX9	1660	hgsc.bcm.edu	37	1	182827944	182827944	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:182827944A>G	ENST00000367549.3	+	10	1087	c.977A>G	c.(976-978)cAa>cGa	p.Q326R		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	326					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						CGACAAAACCAAGTGGGTGTG	0.443																																					p.Q326R	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A977G						.						111.0	100.0	104.0					1																	182827944		1898	4132	6030	SO:0001583	missense	1660	exon10			AAAACCAAGTGGG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.977A>G	chr1.hg19:g.182827944A>G	ENSP00000356520:p.Gln326Arg	131.0	0.0		309.0	25.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	11.22	1.574025	0.28092	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.08720	3.06	5.73	3.35	0.38373	.	0.609442	0.18284	N	0.145934	T	0.06188	0.0160	N	0.22421	0.69	0.21719	N	0.999575	B	0.06786	0.001	B	0.06405	0.002	T	0.38802	-0.9644	10	0.18276	T	0.48	.	12.5524	0.56233	0.7276:0.2724:0.0:0.0	.	326	Q08211	DHX9_HUMAN	R	326	ENSP00000356520:Q326R	ENSP00000356520:Q326R	Q	+	2	0	DHX9	181094567	0.973000	0.33851	0.957000	0.39632	0.998000	0.95712	3.001000	0.49488	0.491000	0.27793	0.533000	0.62120	CAA	.	.		0.443	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
HMCN1	83872	hgsc.bcm.edu	37	1	185987388	185987388	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:185987388A>G	ENST00000271588.4	+	34	5603	c.5374A>G	c.(5374-5376)Att>Gtt	p.I1792V	HMCN1_ENST00000367492.2_Missense_Mutation_p.I1792V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1792	Ig-like C2-type 15.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAAACTGGTTATTGCTCAGGC	0.423																																					p.I1792V		Atlas-SNP	.											.	HMCN1	797	.	0			c.A5374G						.						157.0	154.0	155.0					1																	185987388		2203	4300	6503	SO:0001583	missense	83872	exon34			CTGGTTATTGCTC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5374A>G	chr1.hg19:g.185987388A>G	ENSP00000271588:p.Ile1792Val	123.0	0.0		240.0	26.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.549278	0.45383	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.77750	-1.12;-1.12	5.89	3.58	0.41010	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.103566	0.64402	N	0.000004	T	0.68174	0.2972	L	0.41079	1.255	0.43103	D	0.994796	B	0.30068	0.267	B	0.32090	0.14	T	0.60601	-0.7231	10	0.31617	T	0.26	.	10.3095	0.43699	0.8672:0.0:0.1328:0.0	.	1792	Q96RW7	HMCN1_HUMAN	V	1792	ENSP00000271588:I1792V;ENSP00000356462:I1792V	ENSP00000271588:I1792V	I	+	1	0	HMCN1	184254011	0.976000	0.34144	0.986000	0.45419	0.795000	0.44927	1.704000	0.37857	0.491000	0.27793	-0.360000	0.07572	ATT	.	.		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
LMOD1	25802	hgsc.bcm.edu	37	1	201915422	201915422	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:201915422T>A	ENST00000367288.4	-	1	293	c.47A>T	c.(46-48)gAc>gTc	p.D16V		NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	16					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCTGTCGATGTCGGGGTCTTC	0.617																																					p.D16V		Atlas-SNP	.											.	LMOD1	59	.	0			c.A47T						.						36.0	39.0	38.0					1																	201915422		1997	4165	6162	SO:0001583	missense	25802	exon1			TCGATGTCGGGGT	X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.47A>T	chr1.hg19:g.201915422T>A	ENSP00000356257:p.Asp16Val	112.0	0.0		252.0	25.0	NM_012134	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	ENST00000367288.4	hg19	CCDS53457.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.903171	0.92035	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	T	0.41758	0.99	5.93	5.93	0.95920	.	0.000000	0.41712	D	0.000828	T	0.69931	0.3166	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76263	-0.3023	10	0.87932	D	0	-50.1905	14.335	0.66584	0.0:0.0:0.0:1.0	.	16;16	B4E3S9;P29536	.;LMOD1_HUMAN	V	16	ENSP00000356257:D16V	ENSP00000356257:D16V	D	-	2	0	LMOD1	200182045	1.000000	0.71417	0.990000	0.47175	0.959000	0.62525	7.985000	0.88162	2.271000	0.75665	0.459000	0.35465	GAC	.	.		0.617	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087085.2		
LAX1	54900	hgsc.bcm.edu	37	1	203734781	203734781	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:203734781A>T	ENST00000442561.2	+	1	478	c.88A>T	c.(88-90)Aga>Tga	p.R30*	LAX1_ENST00000367217.5_Intron	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	30					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGCCTGGACAGGTGAGTGAC	0.562																																					p.R30X		Atlas-SNP	.											.	LAX1	48	.	0			c.A88T						.						74.0	58.0	63.0					1																	203734781		2203	4300	6503	SO:0001630	splice_region_variant	54900	exon1			CTGGACAGGTGAG	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.89+1A>T	chr1.hg19:g.203734781A>T		104.0	0.0		210.0	20.0	NM_017773	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Nonsense_Mutation	SNP	ENST00000442561.2	hg19	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	A	40	8.172012	0.98688	.	.	ENSG00000122188	ENST00000442561	.	.	.	4.17	-1.85	0.07784	.	0.741182	0.11919	N	0.516927	.	.	.	.	.	.	0.21020	N	0.999801	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-0.5129	9.6788	0.40056	0.2674:0.0:0.7326:0.0	.	.	.	.	X	30	.	ENSP00000406970:R30X	R	+	1	2	LAX1	202001404	0.107000	0.21998	0.100000	0.21137	0.730000	0.41778	0.141000	0.16076	-0.304000	0.08843	0.460000	0.39030	AGA	.	.		0.562	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773	Nonsense_Mutation
ACBD3	64746	hgsc.bcm.edu	37	1	226340311	226340311	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:226340311G>A	ENST00000366812.5	-	7	1154	c.1100C>T	c.(1099-1101)cCa>cTa	p.P367L	RP11-275I14.4_ENST00000440540.1_RNA|ACBD3_ENST00000464927.1_5'Flank	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	367					steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		TGCTATTACTGGAAGAGATTC	0.438																																					p.P367L		Atlas-SNP	.											.	ACBD3	38	.	0			c.C1100T						.						116.0	122.0	120.0					1																	226340311		2203	4300	6503	SO:0001583	missense	64746	exon7			ATTACTGGAAGAG	AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.1100C>T	chr1.hg19:g.226340311G>A	ENSP00000355777:p.Pro367Leu	77.0	0.0		175.0	106.0	NM_022735	B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Missense_Mutation	SNP	ENST00000366812.5	hg19	CCDS1551.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.164340	0.38217	.	.	ENSG00000182827	ENST00000366812	T	0.52057	0.68	5.29	5.29	0.74685	.	0.097704	0.64402	D	0.000001	T	0.56630	0.1998	M	0.80028	2.48	0.80722	D	1	B	0.24721	0.11	B	0.28638	0.092	T	0.60234	-0.7303	10	0.72032	D	0.01	-10.2805	18.9418	0.92608	0.0:0.0:1.0:0.0	.	367	Q9H3P7	GCP60_HUMAN	L	367	ENSP00000355777:P367L	ENSP00000355777:P367L	P	-	2	0	ACBD3	224406934	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	9.397000	0.97276	2.488000	0.83962	0.655000	0.94253	CCA	.	.		0.438	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091528.1	NM_022735	
NID1	4811	hgsc.bcm.edu	37	1	236205357	236205357	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:236205357T>A	ENST00000264187.6	-	4	1070	c.988A>T	c.(988-990)Agc>Tgc	p.S330C	NID1_ENST00000366595.3_Missense_Mutation_p.S330C	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	330					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GAGAGGACGCTGGGCACACTG	0.617																																					p.S330C		Atlas-SNP	.											.	NID1	196	.	0			c.A988T						.						88.0	83.0	85.0					1																	236205357		2203	4300	6503	SO:0001583	missense	4811	exon4			GGACGCTGGGCAC	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.988A>T	chr1.hg19:g.236205357T>A	ENSP00000264187:p.Ser330Cys	137.0	0.0		212.0	27.0	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	hg19	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.034920	0.35893	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.88664	-1.76;-2.41	5.57	-1.18	0.09617	.	1.392310	0.03689	N	0.246823	D	0.82674	0.5088	L	0.40543	1.245	0.09310	N	1	D;P	0.55800	0.973;0.556	B;B	0.42653	0.394;0.221	T	0.71715	-0.4509	10	0.52906	T	0.07	.	2.0473	0.03563	0.1302:0.1756:0.4018:0.2924	.	330;330	P14543-2;P14543	.;NID1_HUMAN	C	330	ENSP00000264187:S330C;ENSP00000355554:S330C	ENSP00000264187:S330C	S	-	1	0	NID1	234271980	0.011000	0.17503	0.002000	0.10522	0.008000	0.06430	0.847000	0.27696	-0.477000	0.06832	-0.376000	0.06991	AGC	.	.		0.617	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
RYR2	6262	hgsc.bcm.edu	37	1	237729922	237729922	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:237729922C>T	ENST00000366574.2	+	28	3587	c.3270C>T	c.(3268-3270)gcC>gcT	p.A1090A	RYR2_ENST00000542537.1_Silent_p.A1074A|RYR2_ENST00000360064.6_Silent_p.A1088A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1090	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTTCCGTGCCGAGAAGACCT	0.552																																					p.A1090A		Atlas-SNP	.											.	RYR2	1273	.	0			c.C3270T						.						98.0	98.0	98.0					1																	237729922		1926	4131	6057	SO:0001819	synonymous_variant	6262	exon28			CCGTGCCGAGAAG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3270C>T	chr1.hg19:g.237729922C>T		122.0	0.0		284.0	54.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.		0.552	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RYR2	6262	hgsc.bcm.edu	37	1	237972236	237972236	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:237972236A>T	ENST00000366574.2	+	100	14651	c.14334A>T	c.(14332-14334)gtA>gtT	p.V4778V	RYR2_ENST00000542537.1_Silent_p.V4762V|RYR2_ENST00000360064.6_Silent_p.V4784V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4778					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGTTGTTGTATACCTATACA	0.373																																					p.V4778V		Atlas-SNP	.											.	RYR2	1273	.	0			c.A14334T						.						335.0	325.0	328.0					1																	237972236		1898	4114	6012	SO:0001819	synonymous_variant	6262	exon100			TGTTGTATACCTA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14334A>T	chr1.hg19:g.237972236A>T		133.0	0.0		281.0	24.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.		0.373	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CHRM3	1131	hgsc.bcm.edu	37	1	240072372	240072372	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:240072372C>G	ENST00000255380.4	+	5	2400	c.1621C>G	c.(1621-1623)Ccc>Gcc	p.P541A		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	541					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CACCGTGAACCCCGTGTGCTA	0.483																																					p.P541A		Atlas-SNP	.											.	CHRM3	118	.	0			c.C1621G						.						96.0	83.0	87.0					1																	240072372		2203	4300	6503	SO:0001583	missense	1131	exon5			GTGAACCCCGTGT	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1621C>G	chr1.hg19:g.240072372C>G	ENSP00000255380:p.Pro541Ala	183.0	0.0		346.0	28.0	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	hg19	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962856	0.74016	.	.	ENSG00000133019	ENST00000255380	D	0.98807	-5.15	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99233	0.9733	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99616	1.0982	10	0.87932	D	0	-22.4672	19.5758	0.95444	0.0:1.0:0.0:0.0	.	541	P20309	ACM3_HUMAN	A	541	ENSP00000255380:P541A	ENSP00000255380:P541A	P	+	1	0	CHRM3	238138995	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.632000	0.89209	0.655000	0.94253	CCC	.	.		0.483	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
ZNF124	7678	hgsc.bcm.edu	37	1	247320351	247320351	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:247320351A>G	ENST00000543802.2	-	4	662	c.573T>C	c.(571-573)agT>agC	p.S191S	ZNF124_ENST00000491356.1_Intron|ZNF124_ENST00000472531.1_Intron|ZNF124_ENST00000491848.1_5'UTR|ZNF124_ENST00000340684.6_Silent_p.S129S			Q15973	ZN124_HUMAN	zinc finger protein 124	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(2)	14	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			CACGAAGGTGACTGGAACGAC	0.428																																					p.S129S		Atlas-SNP	.											.	ZNF124	39	.	0			c.T387C						.						87.0	81.0	83.0					1																	247320351		2203	4300	6503	SO:0001819	synonymous_variant	7678	exon4			AAGGTGACTGGAA	S54641	CCDS31089.1, CCDS58067.1, CCDS73057.1	1q44	2013-01-08	2006-06-13		ENSG00000196418	ENSG00000196418		"""Zinc fingers, C2H2-type"", ""-"""	12907	protein-coding gene	gene with protein product		194631	"""zinc finger protein 124 (HZF-16)"""			7916577	Standard	XM_005273256		Approved	HZF16, HZF-16	uc001icj.1	Q15973	OTTHUMG00000041112	ENST00000543802.2:c.573T>C	chr1.hg19:g.247320351A>G		100.0	0.0		213.0	15.0	NM_003431	B3KNP3|J3KSE1|Q15974|Q4VAJ7|Q5T2V4	Silent	SNP	ENST00000543802.2	hg19																																																																																				.	.		0.428	ZNF124-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000447393.1	NM_003431	
OR2AK2	391191	hgsc.bcm.edu	37	1	248128887	248128887	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:248128887A>C	ENST00000366480.3	+	1	353	c.254A>C	c.(253-255)gAc>gCc	p.D85A	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCCATCGTTGACCTCATGTAC	0.473																																					p.D85A	Melanoma(45;390 1181 23848 28461 41504)	Atlas-SNP	.											.	OR2AK2	90	.	0			c.A254C						.						201.0	177.0	185.0					1																	248128887		2203	4300	6503	SO:0001583	missense	391191	exon1			TCGTTGACCTCAT	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.254A>C	chr1.hg19:g.248128887A>C	ENSP00000355436:p.Asp85Ala	65.0	0.0		108.0	14.0	NM_001004491	B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	hg19	CCDS31102.1	.	.	.	.	.	.	.	.	.	.	.	13.82	2.349908	0.41599	.	.	ENSG00000187080	ENST00000366480	T	0.01172	5.23	3.15	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.10895	0.0266	H	0.98388	4.22	0.09310	N	1	D	0.64830	0.994	P	0.60415	0.874	T	0.13045	-1.0524	9	0.87932	D	0	.	10.7706	0.46321	1.0:0.0:0.0:0.0	.	85	Q8NG84	O2AK2_HUMAN	A	85	ENSP00000355436:D85A	ENSP00000355436:D85A	D	+	2	0	OR2AK2	246195510	0.996000	0.38824	0.002000	0.10522	0.001000	0.01503	4.198000	0.58419	1.421000	0.47157	0.374000	0.22700	GAC	.	.		0.473	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491	
OR2T12	127064	hgsc.bcm.edu	37	1	248458294	248458294	+	Missense_Mutation	SNP	G	G	T	rs536165632		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr1:248458294G>T	ENST00000317996.1	-	1	586	c.587C>A	c.(586-588)gCc>gAc	p.A196D		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GATGTACATGGCGTTTTCGAA	0.532																																					p.A196D		Atlas-SNP	.											.	OR2T12	113	.	0			c.C587A						.						74.0	58.0	63.0					1																	248458294		2201	4295	6496	SO:0001583	missense	127064	exon1			TACATGGCGTTTT	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.587C>A	chr1.hg19:g.248458294G>T	ENSP00000324583:p.Ala196Asp	527.0	0.0		952.0	81.0	NM_001004692		Missense_Mutation	SNP	ENST00000317996.1	hg19	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	g	13.21	2.169254	0.38315	.	.	ENSG00000177201	ENST00000317996	T	0.37752	1.18	1.55	-1.11	0.09840	GPCR, rhodopsin-like superfamily (1);	0.548063	0.13454	U	0.386692	T	0.47322	0.1439	M	0.71871	2.18	0.09310	N	1	D	0.58970	0.984	P	0.59643	0.861	T	0.36040	-0.9764	10	0.87932	D	0	.	5.5786	0.17236	0.6177:0.0:0.3823:0.0	.	196	Q8NG77	O2T12_HUMAN	D	196	ENSP00000324583:A196D	ENSP00000324583:A196D	A	-	2	0	OR2T12	246524917	0.000000	0.05858	0.002000	0.10522	0.213000	0.24496	-0.381000	0.07417	-0.207000	0.10187	0.175000	0.17021	GCC	.	.		0.532	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
SOX11	6664	hgsc.bcm.edu	37	2	5833868	5833868	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:5833868G>A	ENST00000322002.3	+	1	1070	c.1015G>A	c.(1015-1017)Gtg>Atg	p.V339M	AC010729.1_ENST00000455579.2_RNA|AC108025.2_ENST00000420221.1_RNA|AC108025.2_ENST00000453678.1_RNA|AC107057.2_ENST00000458264.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	339	Poly-Ser.				cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CTCGCGCTCGGTGTCCACCTC	0.677																																					p.V339M		Atlas-SNP	.											.	SOX11	69	.	0			c.G1015A						.						5.0	6.0	6.0					2																	5833868		2050	4019	6069	SO:0001583	missense	6664	exon1			CGCTCGGTGTCCA		CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.1015G>A	chr2.hg19:g.5833868G>A	ENSP00000322568:p.Val339Met	53.0	0.0		64.0	7.0	NM_003108	Q4ZFV8	Missense_Mutation	SNP	ENST00000322002.3	hg19	CCDS1654.1	.	.	.	.	.	.	.	.	.	.	G	7.791	0.711507	0.15306	.	.	ENSG00000176887	ENST00000322002	D	0.97906	-4.6	4.6	4.6	0.57074	.	12.374300	0.01040	U	0.004299	D	0.97451	0.9166	M	0.65975	2.015	0.33597	D	0.601824	P	0.45902	0.868	P	0.45506	0.483	D	0.91581	0.5279	10	0.34782	T	0.22	.	11.47	0.50264	0.0966:0.0:0.9034:0.0	.	339	P35716	SOX11_HUMAN	M	339	ENSP00000322568:V339M	ENSP00000322568:V339M	V	+	1	0	SOX11	5751319	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	3.308000	0.51896	2.110000	0.64415	0.561000	0.74099	GTG	.	.		0.677	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206698.1	NM_003108	
FAM179A	165186	hgsc.bcm.edu	37	2	29226472	29226472	+	Missense_Mutation	SNP	C	C	T	rs559495685		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:29226472C>T	ENST00000379558.4	+	6	1105	c.754C>T	c.(754-756)Cgt>Tgt	p.R252C	FAM179A_ENST00000403861.2_Missense_Mutation_p.R252C	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	252										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GACCCCCTCCCGTGTGCCTGG	0.627													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18665	0.0		0.0	False		,,,				2504	0.0				p.R252C		Atlas-SNP	.											.	FAM179A	106	.	0			c.C754T						.						31.0	36.0	35.0					2																	29226472		2025	4143	6168	SO:0001583	missense	165186	exon6			CCCTCCCGTGTGC	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.754C>T	chr2.hg19:g.29226472C>T	ENSP00000368876:p.Arg252Cys	251.0	0.0		279.0	38.0	NM_199280	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	hg19	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	C	5.783	0.328894	0.10956	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.09817	3.1;2.94	4.95	-9.91	0.00458	.	.	.	.	.	T	0.02970	0.0088	N	0.03608	-0.345	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.41378	-0.9512	9	0.46703	T	0.11	.	1.432	0.02336	0.2177:0.2439:0.3354:0.2029	.	252;252	F8W8E4;Q6ZUX3	.;F179A_HUMAN	C	252	ENSP00000368876:R252C;ENSP00000384699:R252C	ENSP00000368876:R252C	R	+	1	0	FAM179A	29079976	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.734000	0.00192	-4.333000	0.00056	-1.579000	0.00862	CGT	.	.		0.627	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
XPO1	7514	hgsc.bcm.edu	37	2	61711207	61711207	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:61711207A>C	ENST00000401558.2	-	21	3269	c.2542T>G	c.(2542-2544)Ttt>Gtt	p.F848V	XPO1_ENST00000404992.2_Missense_Mutation_p.F848V|RP11-355B11.2_ENST00000605437.1_RNA|RP11-355B11.2_ENST00000603652.1_RNA|RP11-355B11.2_ENST00000603028.1_RNA|XPO1_ENST00000406957.1_Missense_Mutation_p.F848V|RP11-355B11.2_ENST00000578974.2_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	848					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AGTAAGAAAAAGTTCGTTCTA	0.373			Mis		CLL																																p.F848V		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	.	0			c.T2542G						.						99.0	103.0	102.0					2																	61711207		2203	4300	6503	SO:0001583	missense	7514	exon21			AGAAAAAGTTCGT	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.2542T>G	chr2.hg19:g.61711207A>C	ENSP00000384863:p.Phe848Val	127.0	0.0		174.0	41.0	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	hg19	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.993189	0.93167	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.66638	-0.22;-0.22;-0.22	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86855	0.6033	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90550	0.4508	10	0.87932	D	0	-19.9212	16.1283	0.81408	1.0:0.0:0.0:0.0	.	495;848	B3KWD0;O14980	.;XPO1_HUMAN	V	848	ENSP00000384863:F848V;ENSP00000385942:F848V;ENSP00000385559:F848V	ENSP00000384863:F848V	F	-	1	0	XPO1	61564711	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.263000	0.75096	0.533000	0.62120	TTT	.	.		0.373	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
CCT7	10574	hgsc.bcm.edu	37	2	73477551	73477551	+	Silent	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:73477551C>A	ENST00000258091.5	+	10	1329	c.1188C>A	c.(1186-1188)gtC>gtA	p.V396V	CCT7_ENST00000538797.1_Silent_p.V268V|CCT7_ENST00000398422.2_Silent_p.V192V|CCT7_ENST00000539919.1_Silent_p.V352V|CCT7_ENST00000540468.1_Silent_p.V309V|CCT7_ENST00000537131.1_Silent_p.V296V	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	396					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						TCATGATCGTCAGGAGGGCCA	0.557																																					p.V396V		Atlas-SNP	.											.	CCT7	60	.	0			c.C1188A						.						95.0	105.0	102.0					2																	73477551		2084	4220	6304	SO:0001819	synonymous_variant	10574	exon10			GATCGTCAGGAGG	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.1188C>A	chr2.hg19:g.73477551C>A		108.0	0.0		98.0	5.0	NM_006429	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Silent	SNP	ENST00000258091.5	hg19	CCDS46336.1																																																																																			.	.		0.557	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613037	+	Missense_Mutation	DNP	GA	GA	CT	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:73613036_73613037GA>CT	ENST00000264448.6	+	1	151_152	c.40_41GA>CT	c.(40-42)GAg>CTg	p.E14L	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14L|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggaggag	0.693																																					p.E14Q|p.E14V		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C|c.A41T						.																																			SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG|TGGAGGAGGAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	Exception_encountered	chr2.hg19:g.73613036_73613037delinsCT	ENSP00000264448:p.Glu14Leu	195.0	0.0		317.0|321.0	17.0|23.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.693	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SLC4A5	57835	hgsc.bcm.edu	37	2	74475529	74475529	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:74475529T>G	ENST00000377634.4	-	18	2137	c.1738A>C	c.(1738-1740)Agc>Cgc	p.S580R	SLC4A5_ENST00000423644.1_Missense_Mutation_p.S580R|SLC4A5_ENST00000346834.4_Missense_Mutation_p.S580R|SLC4A5_ENST00000358683.4_Missense_Mutation_p.S516R|SLC4A5_ENST00000357822.5_Missense_Mutation_p.S580R|SLC4A5_ENST00000359484.4_Missense_Mutation_p.S516R|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000394019.2_Missense_Mutation_p.S580R|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.S580R					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GGCCCCGTGCTGCTGAGAATG	0.587																																					p.S580R		Atlas-SNP	.											.	SLC4A5	215	.	0			c.A1738C						.						93.0	90.0	91.0					2																	74475529		2203	4300	6503	SO:0001583	missense	57835	exon13			CCGTGCTGCTGAG	AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1738A>C	chr2.hg19:g.74475529T>G	ENSP00000366861:p.Ser580Arg	93.0	0.0		125.0	39.0	NM_021196		Missense_Mutation	SNP	ENST00000377634.4	hg19	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.145117	0.77888	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	4.85	4.85	0.62838	Bicarbonate transporter, C-terminal (1);	0.192108	0.56097	D	0.000035	D	0.91865	0.7425	H	0.94385	3.53	0.54753	D	0.999987	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;0.998	D	0.93646	0.6969	10	0.87932	D	0	.	12.7399	0.57246	0.0:0.0:0.0:1.0	.	580;580;516;580;580	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	R	580;580;580;516;580;516;580;580;580;580	ENSP00000377587:S580R;ENSP00000251768:S580R;ENSP00000352461:S516R;ENSP00000395804:S580R;ENSP00000351513:S516R;ENSP00000350475:S580R;ENSP00000366859:S580R;ENSP00000366861:S580R;ENSP00000405678:S580R	ENSP00000251768:S580R	S	-	1	0	SLC4A5	74329037	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.901000	0.63259	2.187000	0.69744	0.523000	0.50628	AGC	.	.		0.587	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		
PROM2	150696	hgsc.bcm.edu	37	2	95943753	95943753	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:95943753G>T	ENST00000317620.9	+	8	1183		c.e8+1		PROM2_ENST00000317668.4_Splice_Site|PROM2_ENST00000403131.2_Splice_Site|PROM2_ENST00000542147.1_Splice_Site	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2						negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GGTCCAGGAGGTGAGAGCCAC	0.567																																					.		Atlas-SNP	.											.	PROM2	78	.	0			c.1050+1G>T						.						71.0	54.0	60.0					2																	95943753		2203	4300	6503	SO:0001630	splice_region_variant	150696	exon8			CAGGAGGTGAGAG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1050+1G>T	chr2.hg19:g.95943753G>T		53.0	0.0		59.0	25.0	NM_144707	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Splice_Site	SNP	ENST00000317620.9	hg19	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710877	0.68730	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0525	0.64747	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PROM2	95307480	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.605000	0.61119	2.703000	0.92315	0.655000	0.94253	.	.	.		0.567	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	Intron
TBC1D8	11138	hgsc.bcm.edu	37	2	101666875	101666875	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:101666875T>G	ENST00000376840.4	-	5	814	c.815A>C	c.(814-816)cAg>cCg	p.Q272P	TBC1D8_ENST00000409318.1_Missense_Mutation_p.Q287P			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	272					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CTTGGTGATCTGGCTCGGCTC	0.557																																					p.Q272P		Atlas-SNP	.											.	TBC1D8	169	.	0			c.A815C						.						46.0	48.0	47.0					2																	101666875		1992	4165	6157	SO:0001583	missense	11138	exon5			GTGATCTGGCTCG	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.815A>C	chr2.hg19:g.101666875T>G	ENSP00000366036:p.Gln272Pro	60.0	0.0		66.0	14.0	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	hg19	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	T	16.82	3.227399	0.58668	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.03386	3.95;3.95	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000004	T	0.11281	0.0275	L	0.48642	1.525	0.41935	D	0.990581	B;D	0.65815	0.013;0.995	B;P	0.62649	0.017;0.905	T	0.22906	-1.0203	10	0.27785	T	0.31	-36.4977	15.3821	0.74664	0.0:0.0:0.0:1.0	.	287;272	B7Z6L4;O95759	.;TBCD8_HUMAN	P	272;287	ENSP00000366036:Q272P;ENSP00000386856:Q287P	ENSP00000366036:Q272P	Q	-	2	0	TBC1D8	101033307	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	3.892000	0.56235	2.032000	0.59987	0.459000	0.35465	CAG	.	.		0.557	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
IL1R1	3554	hgsc.bcm.edu	37	2	102789169	102789169	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:102789169A>G	ENST00000410023.1	+	9	1180	c.862A>G	c.(862-864)Aga>Gga	p.R288G	IL1R1_ENST00000424272.1_Missense_Mutation_p.R288G|AC007271.3_ENST00000428188.1_RNA|IL1R1_ENST00000409929.1_Missense_Mutation_p.R288G|IL1R1_ENST00000409329.1_Missense_Mutation_p.R288G|IL1R1_ENST00000409288.1_Missense_Mutation_p.R288G|IL1R1_ENST00000409589.1_Intron|IL1R1_ENST00000233946.3_Missense_Mutation_p.R288G			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I	288	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	TGCAAACAAAAGAAGGAGTAC	0.338																																					p.R288G		Atlas-SNP	.											.	IL1R1	52	.	0			c.A862G						.						109.0	100.0	103.0					2																	102789169		2203	4300	6503	SO:0001583	missense	3554	exon8			AACAAAAGAAGGA	M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.862A>G	chr2.hg19:g.102789169A>G	ENSP00000386380:p.Arg288Gly	170.0	0.0		208.0	35.0	NM_000877	Q587I7	Missense_Mutation	SNP	ENST00000410023.1	hg19	CCDS2055.1	.	.	.	.	.	.	.	.	.	.	A	9.381	1.072896	0.20147	.	.	ENSG00000115594	ENST00000409929;ENST00000424272;ENST00000409329;ENST00000428279;ENST00000409288;ENST00000410023;ENST00000233946	T;T;T;T;T;T;T	0.02709	4.19;4.19;4.19;4.19;4.19;4.19;4.19	4.87	3.72	0.42706	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.640031	0.17631	N	0.167371	T	0.03564	0.0102	L	0.59436	1.845	0.09310	N	1	B;B;B	0.13145	0.0;0.0;0.007	B;B;B	0.14023	0.003;0.003;0.01	T	0.42310	-0.9459	10	0.18710	T	0.47	.	7.1863	0.25801	0.9004:0.0:0.0996:0.0	.	288;288;288	B8ZZW4;P14778;B8ZZ73	.;IL1R1_HUMAN;.	G	288;288;288;144;288;288;288	ENSP00000386776:R288G;ENSP00000415366:R288G;ENSP00000387131:R288G;ENSP00000410461:R144G;ENSP00000386478:R288G;ENSP00000386380:R288G;ENSP00000233946:R288G	ENSP00000233946:R288G	R	+	1	2	IL1R1	102155601	0.000000	0.05858	0.003000	0.11579	0.099000	0.18886	0.688000	0.25422	1.000000	0.39049	0.482000	0.46254	AGA	.	.		0.338	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253299.1		
CCDC138	165055	hgsc.bcm.edu	37	2	109408129	109408129	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:109408129A>T	ENST00000295124.4	+	4	326		c.e4-1		CCDC138_ENST00000412964.2_Splice_Site|CCDC138_ENST00000470608.1_Intron	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138											endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						ATTTTTTTAAAGCCTAGATGA	0.279																																					.		Atlas-SNP	.											.	CCDC138	49	.	0			c.267-2A>T						.						82.0	98.0	93.0					2																	109408129		2197	4282	6479	SO:0001630	splice_region_variant	165055	exon4			TTTTAAAGCCTAG	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.267-1A>T	chr2.hg19:g.109408129A>T		92.0	0.0		85.0	15.0	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Splice_Site	SNP	ENST00000295124.4	hg19	CCDS2080.1	.	.	.	.	.	.	.	.	.	.	A	14.14	2.445713	0.43429	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6091	0.62065	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC138	108774561	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	5.587000	0.67510	2.198000	0.70561	0.533000	0.62120	.	.	.		0.279	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	Intron
CNTNAP5	129684	hgsc.bcm.edu	37	2	125204373	125204373	+	Silent	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:125204373C>G	ENST00000431078.1	+	6	1141	c.777C>G	c.(775-777)acC>acG	p.T259T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	259	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCTCTGCCACCCTGGGCAGCC	0.602																																					p.T259T		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.C777G						.						54.0	58.0	57.0					2																	125204373		2152	4271	6423	SO:0001819	synonymous_variant	129684	exon6			TGCCACCCTGGGC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.777C>G	chr2.hg19:g.125204373C>G		165.0	0.0		152.0	53.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	hg19	CCDS46401.1																																																																																			.	.		0.602	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CNTNAP5	129684	hgsc.bcm.edu	37	2	125504881	125504881	+	Missense_Mutation	SNP	T	T	G	rs35085748	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:125504881T>G	ENST00000431078.1	+	14	2514	c.2150T>G	c.(2149-2151)gTc>gGc	p.V717G		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	717	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCTCCTGGGGTCCAGCAGTGT	0.517																																					p.V717G		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.T2150G						.						121.0	120.0	120.0					2																	125504881		2056	4213	6269	SO:0001583	missense	129684	exon14			CTGGGGTCCAGCA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2150T>G	chr2.hg19:g.125504881T>G	ENSP00000399013:p.Val717Gly	158.0	0.0		167.0	20.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	8.458	0.854649	0.17106	.	.	ENSG00000155052	ENST00000431078	T	0.18810	2.19	6.04	2.41	0.29592	.	0.465395	0.17848	N	0.159955	T	0.26304	0.0642	M	0.84846	2.72	0.80722	D	1	B	0.24258	0.1	B	0.21708	0.036	T	0.03060	-1.1077	10	0.23302	T	0.38	.	9.3168	0.37939	0.0:0.202:0.0:0.798	.	717	Q8WYK1	CNTP5_HUMAN	G	717	ENSP00000399013:V717G	ENSP00000399013:V717G	V	+	2	0	CNTNAP5	125221351	1.000000	0.71417	0.061000	0.19648	0.004000	0.04260	5.193000	0.65120	0.184000	0.20083	-0.256000	0.11100	GTC	.	T|0.993;C|0.007		0.517	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CYP27C1	339761	hgsc.bcm.edu	37	2	127960995	127960995	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:127960995T>C	ENST00000335247.7	-	2	261	c.131A>G	c.(130-132)gAa>gGa	p.E44G	CYP27C1_ENST00000409327.1_Missense_Mutation_p.E44G	NM_001001665.3	NP_001001665.3	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C, polypeptide 1	44						membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	16	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		GGTCACGGTTTCTCCATCTTC	0.428																																					p.E44G		Atlas-SNP	.											.	CYP27C1	52	.	0			c.A131G						.						181.0	171.0	175.0					2																	127960995		2203	4300	6503	SO:0001583	missense	339761	exon2			ACGGTTTCTCCAT	AC027142	CCDS33285.1	2q14.3	2008-05-14	2007-05-18		ENSG00000186684	ENSG00000186684		"""Cytochrome P450s"""	33480	protein-coding gene	gene with protein product							Standard	NM_001001665		Approved	FLJ16008	uc002tod.2	Q4G0S4	OTTHUMG00000153400	ENST00000335247.7:c.131A>G	chr2.hg19:g.127960995T>C	ENSP00000334128:p.Glu44Gly	94.0	0.0		95.0	14.0	NM_001001665	Q6ZNI7	Missense_Mutation	SNP	ENST00000335247.7	hg19	CCDS33285.1	.	.	.	.	.	.	.	.	.	.	T	7.457	0.643869	0.14451	.	.	ENSG00000186684	ENST00000335247;ENST00000409327	T;T	0.35421	1.31;1.31	4.23	4.23	0.50019	.	0.371485	0.27349	N	0.019767	T	0.22360	0.0539	N	0.24115	0.695	0.30804	N	0.739587	B	0.02656	0.0	B	0.06405	0.002	T	0.12167	-1.0558	10	0.26408	T	0.33	-1.0388	8.862	0.35263	0.1672:0.0:0.0:0.8328	.	44	Q4G0S4	C27C1_HUMAN	G	44	ENSP00000334128:E44G;ENSP00000387198:E44G	ENSP00000334128:E44G	E	-	2	0	CYP27C1	127677465	0.987000	0.35691	0.982000	0.44146	0.422000	0.31414	2.106000	0.41835	1.564000	0.49628	0.402000	0.26972	GAA	.	.		0.428	CYP27C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331046.1	NM_001001665	
LIMS2	55679	hgsc.bcm.edu	37	2	128412026	128412026	+	Missense_Mutation	SNP	C	C	A	rs371008915		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:128412026C>A	ENST00000355119.4	-	4	496	c.331G>T	c.(331-333)Gac>Tac	p.D111Y	LIMS2_ENST00000324938.5_Missense_Mutation_p.D135Y|LIMS2_ENST00000410011.1_Missense_Mutation_p.D106Y|LIMS2_ENST00000409455.1_Missense_Mutation_p.D106Y|LIMS2_ENST00000409808.2_Missense_Mutation_p.D106Y|LIMS2_ENST00000545738.2_Missense_Mutation_p.D133Y	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	111	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.			D -> G (in Ref. 5; BAG60013). {ECO:0000305}.	cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		AAGCCCAGGTCAGCCAGCTCC	0.612																																					p.D135Y		Atlas-SNP	.											.	LIMS2	33	.	0			c.G403T						.						120.0	115.0	117.0					2																	128412026		2203	4300	6503	SO:0001583	missense	55679	exon4			CCAGGTCAGCCAG	AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.331G>T	chr2.hg19:g.128412026C>A	ENSP00000347240:p.Asp111Tyr	207.0	0.0		193.0	76.0	NM_017980	A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	Missense_Mutation	SNP	ENST00000355119.4	hg19	CCDS54395.1	.	.	.	.	.	.	.	.	.	.	.	31	5.091942	0.94149	.	.	ENSG00000072163	ENST00000545738;ENST00000355119;ENST00000324938;ENST00000409455;ENST00000410109;ENST00000409808;ENST00000410011;ENST00000544917;ENST00000422034	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	5.37	5.37	0.77165	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.95959	0.8684	H	0.95917	3.74	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.85130	0.967;0.996;0.997	D	0.97165	0.9840	10	0.87932	D	0	.	19.0997	0.93269	0.0:1.0:0.0:0.0	.	133;111;135	F5H6E6;Q7Z4I7;Q7Z4I7-2	.;LIMS2_HUMAN;.	Y	133;111;135;106;106;106;106;133;106	ENSP00000443794:D133Y;ENSP00000347240:D111Y;ENSP00000326888:D135Y;ENSP00000386383:D106Y;ENSP00000386637:D106Y;ENSP00000387002:D106Y	ENSP00000326888:D135Y	D	-	1	0	LIMS2	128128496	1.000000	0.71417	0.993000	0.49108	0.954000	0.61252	7.707000	0.84623	2.523000	0.85059	0.609000	0.83330	GAC	.	.		0.612	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331133.2	NM_017980	
TMEM163	81615	hgsc.bcm.edu	37	2	135308172	135308172	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:135308172C>A	ENST00000281924.6	-	4	491	c.427G>T	c.(427-429)Gcc>Tcc	p.A143S		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	143						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		TGCACAGCGGCCGCGTTGCTG	0.537																																					p.A143S		Atlas-SNP	.											.	TMEM163	34	.	0			c.G427T						.						115.0	110.0	112.0					2																	135308172		2203	4300	6503	SO:0001583	missense	81615	exon4			CAGCGGCCGCGTT		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.427G>T	chr2.hg19:g.135308172C>A	ENSP00000281924:p.Ala143Ser	80.0	0.0		98.0	18.0	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Missense_Mutation	SNP	ENST00000281924.6	hg19	CCDS2172.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098331	0.56183	.	.	ENSG00000152128	ENST00000281924;ENST00000537539	T	0.62941	-0.01	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.73102	0.3544	L	0.51422	1.61	0.54753	D	0.999988	D	0.71674	0.998	D	0.80764	0.994	T	0.65598	-0.6129	10	0.13108	T	0.6	.	18.3542	0.90351	0.0:1.0:0.0:0.0	.	143	Q8TC26	TM163_HUMAN	S	143;82	ENSP00000281924:A143S	ENSP00000281924:A143S	A	-	1	0	TMEM163	135024642	1.000000	0.71417	0.138000	0.22173	0.168000	0.22595	7.115000	0.77110	2.640000	0.89533	0.563000	0.77884	GCC	.	.		0.537	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
ZEB2	9839	hgsc.bcm.edu	37	2	145156008	145156008	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:145156008T>A	ENST00000558170.2	-	8	3930	c.2746A>T	c.(2746-2748)Agt>Tgt	p.S916C	ZEB2_ENST00000303660.4_Missense_Mutation_p.S916C|ZEB2_ENST00000539609.3_Missense_Mutation_p.S892C|ZEB2_ENST00000409487.3_Missense_Mutation_p.S916C	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	916					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCAGGAATACTGGTCTGGACT	0.493																																					p.S916C	Melanoma(33;1235 1264 5755 16332)	Atlas-SNP	.											.	ZEB2	218	.	0			c.A2746T						.						171.0	167.0	168.0					2																	145156008		2203	4300	6503	SO:0001583	missense	9839	exon8			GAATACTGGTCTG	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2746A>T	chr2.hg19:g.145156008T>A	ENSP00000454157:p.Ser916Cys	152.0	0.0		180.0	42.0	NM_014795	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	hg19	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	T	14.86	2.662434	0.47572	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.15603	2.42;2.41;2.41	5.83	4.69	0.59074	.	0.075006	0.85682	D	0.000000	T	0.31327	0.0793	L	0.54323	1.7	0.58432	D	0.999998	D;D;P;P	0.76494	0.999;0.975;0.876;0.876	D;P;B;B	0.65987	0.94;0.671;0.417;0.417	T	0.02087	-1.1216	10	0.59425	D	0.04	-9.8811	8.5945	0.33707	0.0:0.1429:0.0:0.8571	.	892;781;915;916	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	C	892;916;916	ENSP00000443792:S892C;ENSP00000302501:S916C;ENSP00000386854:S916C	ENSP00000302501:S916C	S	-	1	0	ZEB2	144872478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.615000	0.46368	2.231000	0.72958	0.460000	0.39030	AGT	.	.		0.493	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
KIF5C	3800	hgsc.bcm.edu	37	2	149633278	149633279	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:149633278_149633279CC>AG	ENST00000435030.1	+	1	460_461	c.92_93CC>AG	c.(91-93)cCC>cAG	p.P31Q	AC105402.4_ENST00000601658.1_RNA|AC105402.4_ENST00000446781.2_RNA			O60282	KIF5C_HUMAN	kinesin family member 5C	31	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		AAATTCATCCCCAAATTTAAAG	0.644																																					p.P31H|p.P31P		Atlas-SNP	.											.	KIF5C	166	.	0			c.C92A|c.C93G						.																																			SO:0001583	missense	3800	exon1			TCATCCCCAAATT|CATCCCCAAATTT	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	Exception_encountered	chr2.hg19:g.149633278_149633279delinsAG	ENSP00000393379:p.Pro31Gln	277.0|275.0	0.0		282.0	84.0|85.0	NM_004522	O95079|Q2YDC5	Missense_Mutation|Silent	SNP	ENST00000435030.1	hg19																																																																																				.	.		0.644	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
XIRP2	129446	hgsc.bcm.edu	37	2	167992512	167992512	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:167992512G>T	ENST00000409728.1	+	3	591	c.502G>T	c.(502-504)Ggc>Tgc	p.G168C	XIRP2_ENST00000295237.9_Missense_Mutation_p.G168C|XIRP2_ENST00000409195.1_Missense_Mutation_p.G168C|XIRP2_ENST00000420519.1_Missense_Mutation_p.G168C|XIRP2-AS1_ENST00000525330.1_RNA|XIRP2_ENST00000409043.1_Missense_Mutation_p.G168C|XIRP2_ENST00000409756.2_Missense_Mutation_p.G168C	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGACAAGAAAGGCAAGGAAAC	0.438																																					p.G168C		Atlas-SNP	.											.	XIRP2	914	.	0			c.G502T						.						98.0	97.0	98.0					2																	167992512		1904	4129	6033	SO:0001583	missense	129446	exon3			AAGAAAGGCAAGG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.502G>T	chr2.hg19:g.167992512G>T	ENSP00000386619:p.Gly168Cys	61.0	0.0		75.0	5.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	hg19	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076034	0.36662	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	T;T;T;T;T;T	0.78924	-1.13;-1.22;4.21;-1.13;-1.22;4.21	5.51	-0.0527	0.13821	.	.	.	.	.	T	0.79776	0.4504	.	.	.	0.09310	N	0.999998	D;D	0.60575	0.988;0.988	P;P	0.56514	0.8;0.8	T	0.67669	-0.5611	8	0.56958	D	0.05	-0.563	6.0957	0.20019	0.4423:0.1261:0.4316:0.0	.	168;168	A4UGR9-4;A4UGR9-6	.;.	C	168	ENSP00000386454:G168C;ENSP00000386619:G168C;ENSP00000386840:G168C;ENSP00000386724:G168C;ENSP00000415541:G168C;ENSP00000295237:G168C	ENSP00000295237:G168C	G	+	1	0	XIRP2	167700758	0.042000	0.20092	0.067000	0.19924	0.664000	0.39144	0.103000	0.15292	-0.066000	0.12998	-0.226000	0.12346	GGC	.	.		0.438	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
LRP2	4036	hgsc.bcm.edu	37	2	170136923	170136923	+	Silent	SNP	G	G	T	rs373521676		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:170136923G>T	ENST00000263816.3	-	11	1563	c.1278C>A	c.(1276-1278)gcC>gcA	p.A426A	LRP2_ENST00000443831.1_Silent_p.A426A	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	426					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCACACCCACGGCCACTCCAC	0.458																																					p.A426A		Atlas-SNP	.											.	LRP2	751	.	0			c.C1278A						.						75.0	77.0	76.0					2																	170136923		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon11			ACCCACGGCCACT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1278C>A	chr2.hg19:g.170136923G>T		118.0	0.0		115.0	5.0	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
PPIG	9360	hgsc.bcm.edu	37	2	170488352	170488352	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:170488352A>G	ENST00000260970.3	+	11	1058	c.838A>G	c.(838-840)Ata>Gta	p.I280V	PPIG_ENST00000462903.1_Missense_Mutation_p.I280V|PPIG_ENST00000409714.3_Missense_Mutation_p.I265V|PPIG_ENST00000482772.1_3'UTR|PPIG_ENST00000448752.2_Missense_Mutation_p.I280V	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	280					protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	GATCCCTCCTATACCTGAAAA	0.413																																					p.I280V		Atlas-SNP	.											.	PPIG	100	.	0			c.A838G						.						120.0	108.0	112.0					2																	170488352		2203	4300	6503	SO:0001583	missense	9360	exon11			CCTCCTATACCTG	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.838A>G	chr2.hg19:g.170488352A>G	ENSP00000260970:p.Ile280Val	78.0	0.0		80.0	4.0	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	hg19	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.493290	0.44352	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000433207;ENST00000409714;ENST00000462903;ENST00000448752	T;T;T;T;T	0.21361	2.72;2.26;2.76;2.01;2.72	5.3	4.11	0.48088	.	0.051438	0.85682	D	0.000000	T	0.08802	0.0218	N	0.12569	0.235	0.45554	D	0.998509	B;B;B;B;B	0.26483	0.011;0.001;0.15;0.001;0.001	B;B;B;B;B	0.23419	0.008;0.002;0.046;0.005;0.002	T	0.15292	-1.0442	10	0.02654	T	1	-18.2541	7.4588	0.27283	0.781:0.1445:0.0745:0.0	.	273;265;265;280;280	C9JM79;E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;.;PPIG_HUMAN	V	280;280;273;265;280;280	ENSP00000260970:I280V;ENSP00000408683:I273V;ENSP00000386245:I265V;ENSP00000435987:I280V;ENSP00000407083:I280V	ENSP00000260970:I280V	I	+	1	0	PPIG	170196598	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.327000	0.52045	0.806000	0.34183	0.383000	0.25322	ATA	.	.		0.413	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
CIR1	9541	hgsc.bcm.edu	37	2	175213317	175213317	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:175213317T>A	ENST00000342016.3	-	10	1353	c.1261A>T	c.(1261-1263)Agc>Tgc	p.S421C	CIR1_ENST00000362053.5_3'UTR	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	421	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						TGGCTTCTGCTGTCATTTCTT	0.478																																					p.S421C		Atlas-SNP	.											.	CIR1	38	.	0			c.A1261T						.						221.0	213.0	216.0					2																	175213317		2203	4300	6503	SO:0001583	missense	9541	exon10			TTCTGCTGTCATT	AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.1261A>T	chr2.hg19:g.175213317T>A	ENSP00000339723:p.Ser421Cys	78.0	0.0		95.0	14.0	NM_004882	A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Missense_Mutation	SNP	ENST00000342016.3	hg19	CCDS2256.1	.	.	.	.	.	.	.	.	.	.	T	8.179	0.793354	0.16327	.	.	ENSG00000138433	ENST00000342016	.	.	.	5.82	-3.21	0.05140	.	0.997396	0.08125	N	0.994164	T	0.15522	0.0374	N	0.14661	0.345	0.09310	N	1	B	0.30709	0.291	B	0.27262	0.078	T	0.21655	-1.0239	9	0.44086	T	0.13	.	0.8178	0.01105	0.2397:0.2274:0.1109:0.422	.	421	Q86X95	CIR1_HUMAN	C	421	.	ENSP00000339723:S421C	S	-	1	0	CIR1	174921563	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-0.692000	0.05127	-0.123000	0.11745	0.455000	0.32223	AGC	.	.		0.478	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255460.1	NM_004882	
HOXD12	3238	hgsc.bcm.edu	37	2	176965409	176965409	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:176965409A>T	ENST00000406506.2	+	2	806	c.734A>T	c.(733-735)cAa>cTa	p.Q245L	HOXD12_ENST00000404162.2_3'UTR			P35452	HXD12_HUMAN	homeobox D12	245					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		AGCGACCAGCAAGTCAAAATC	0.562																																					p.Q245L		Atlas-SNP	.											.	HOXD12	25	.	0			c.A734T						.						41.0	43.0	43.0					2																	176965409		1992	4201	6193	SO:0001583	missense	3238	exon2			ACCAGCAAGTCAA		CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.734A>T	chr2.hg19:g.176965409A>T	ENSP00000385586:p.Gln245Leu	320.0	0.0		345.0	53.0	NM_021193	B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Missense_Mutation	SNP	ENST00000406506.2	hg19	CCDS46456.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.848979	0.91277	.	.	ENSG00000170178	ENST00000406506	D	0.97114	-4.25	5.81	5.81	0.92471	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99193	0.9720	H	0.98901	4.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98816	1.0745	10	0.87932	D	0	.	16.1699	0.81801	1.0:0.0:0.0:0.0	.	245	P35452	HXD12_HUMAN	L	245	ENSP00000385586:Q245L	ENSP00000385586:Q245L	Q	+	2	0	HOXD12	176673655	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.339000	0.96797	2.217000	0.71921	0.533000	0.62120	CAA	.	.		0.562	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193	
TTN	7273	hgsc.bcm.edu	37	2	179424917	179424917	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:179424917G>T	ENST00000591111.1	-	276	81243	c.81019C>A	c.(81019-81021)Cca>Aca	p.P27007T	TTN_ENST00000342992.6_Missense_Mutation_p.P26080T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P19775T|TTN_ENST00000460472.2_Missense_Mutation_p.P19583T|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P19708T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P28648T			Q8WZ42	TITIN_HUMAN	titin	27007	Fibronectin type-III 96. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGAACACTGGATCTTCTGCC	0.458																																					p.P28648T		Atlas-SNP	.											.	TTN	18412	.	0			c.C85942A						.						111.0	109.0	110.0					2																	179424917		1917	4118	6035	SO:0001583	missense	7273	exon326			ACACTGGATCTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81019C>A	chr2.hg19:g.179424917G>T	ENSP00000465570:p.Pro27007Thr	147.0	0.0		161.0	46.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.38	2.815275	0.50527	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	6.08	6.08	0.98989	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71324	0.3326	L	0.55834	1.745	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.997;0.997	T	0.70710	-0.4797	9	0.87932	D	0	.	20.6647	0.99678	0.0:0.0:1.0:0.0	.	19583;19708;19775;27007	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	26080;19583;19775;19708;19580	ENSP00000343764:P26080T;ENSP00000434586:P19583T;ENSP00000340554:P19775T;ENSP00000352154:P19708T	ENSP00000340554:P19775T	P	-	1	0	TTN	179133163	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.903000	0.87398	2.890000	0.99128	0.655000	0.94253	CCA	.	.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZSWIM2	151112	hgsc.bcm.edu	37	2	187713768	187713768	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:187713768G>C	ENST00000295131.2	-	1	129	c.90C>G	c.(88-90)agC>agG	p.S30R		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	30					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			GGAGGTAGATGCTGCTACTCA	0.607																																					p.S30R		Atlas-SNP	.											.	ZSWIM2	119	.	0			c.C90G						.						58.0	53.0	55.0					2																	187713768		2203	4300	6503	SO:0001583	missense	151112	exon1			GTAGATGCTGCTA	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.90C>G	chr2.hg19:g.187713768G>C	ENSP00000295131:p.Ser30Arg	136.0	0.0		168.0	48.0	NM_182521	B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	hg19	CCDS33348.1	.	.	.	.	.	.	.	.	.	.	G	7.128	0.579348	0.13686	.	.	ENSG00000163012	ENST00000295131	T	0.19532	2.14	4.91	3.12	0.35913	.	0.341983	0.25820	N	0.028086	T	0.12475	0.0303	L	0.27053	0.805	0.34231	D	0.676501	B	0.26400	0.148	B	0.29440	0.102	T	0.21793	-1.0235	10	0.11794	T	0.64	-7.0701	7.5742	0.27926	0.1933:0.0:0.8067:0.0	.	30	Q8NEG5	ZSWM2_HUMAN	R	30	ENSP00000295131:S30R	ENSP00000295131:S30R	S	-	3	2	ZSWIM2	187422013	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	1.126000	0.31344	0.786000	0.33708	-0.142000	0.14014	AGC	.	.		0.607	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521	
TMEFF2	23671	hgsc.bcm.edu	37	2	192862989	192862989	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:192862989T>A	ENST00000272771.5	-	7	1928	c.744A>T	c.(742-744)gcA>gcT	p.A248A	TMEFF2_ENST00000392314.1_Splice_Site_p.A248A|TMEFF2_ENST00000487771.1_5'UTR|AC098617.1_ENST00000424116.2_RNA|AC098617.1_ENST00000428980.2_RNA	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	248						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			ATTATGTACCTGCATAATCTG	0.323																																					p.A248A	Pancreas(50;1277 1381 28487 47072)	Atlas-SNP	.											.	TMEFF2	54	.	0			c.A744T						.						92.0	96.0	95.0					2																	192862989		2203	4298	6501	SO:0001630	splice_region_variant	23671	exon7			TGTACCTGCATAA	AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.745+1A>T	chr2.hg19:g.192862989T>A		47.0	0.0		52.0	9.0	NM_016192	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Silent	SNP	ENST00000272771.5	hg19	CCDS2314.1																																																																																			.	.		0.323	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256065.2	NM_016192	Silent
NRP2	8828	hgsc.bcm.edu	37	2	206641001	206641001	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:206641001A>T	ENST00000357118.4	+	16	2488	c.2457A>T	c.(2455-2457)acA>acT	p.T819T	NRP2_ENST00000540841.1_Intron|NRP2_ENST00000540178.1_Intron|NRP2_ENST00000357785.5_Intron|NRP2_ENST00000360409.3_Intron|NRP2_ENST00000272849.3_Silent_p.T824T|NRP2_ENST00000412873.2_Intron	NM_201267.1	NP_957719	Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CCGAGCCCACAGTGGACACGG	0.607											OREG0015157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T824T		Atlas-SNP	.											.	NRP2	179	.	0			c.A2472T						.						81.0	85.0	84.0					2																	206641001		2203	4300	6503	SO:0001819	synonymous_variant	8828	exon16			GCCCACAGTGGAC	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357118.4:c.2457A>T	chr2.hg19:g.206641001A>T		54.0	0.0	2161	53.0	9.0	NM_018534	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000357118.4	hg19	CCDS46498.1																																																																																			.	.		0.607	NRP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336465.1		
PTPRN	5798	hgsc.bcm.edu	37	2	220156208	220156208	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:220156208T>A	ENST00000295718.2	-	20	2953	c.2713A>T	c.(2713-2715)Atc>Ttc	p.I905F	PTPRN_ENST00000423636.2_Missense_Mutation_p.I815F|PTPRN_ENST00000409251.3_Missense_Mutation_p.I876F|PTPRN_ENST00000497977.1_5'UTR|MIR153-1_ENST00000384914.1_RNA	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	905	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TGCACGATGATGGGGCAGGAG	0.592																																					p.I905F		Atlas-SNP	.											.	PTPRN	138	.	0			c.A2713T						.						87.0	70.0	76.0					2																	220156208		2203	4300	6503	SO:0001583	missense	5798	exon20			CGATGATGGGGCA		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2713A>T	chr2.hg19:g.220156208T>A	ENSP00000295718:p.Ile905Phe	240.0	0.0		246.0	40.0	NM_002846	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	hg19	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.197849	0.79015	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.18960	2.18;2.18;2.18	4.86	3.7	0.42460	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.057258	0.64402	D	0.000002	T	0.51176	0.1659	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.57248	-0.7844	10	0.87932	D	0	.	9.5145	0.39098	0.0:0.085:0.0:0.915	.	876;905	Q6NSL1;Q16849	.;PTPRN_HUMAN	F	876;905;876;815	ENSP00000386638:I876F;ENSP00000295718:I905F;ENSP00000444244:I815F	ENSP00000295718:I905F	I	-	1	0	PTPRN	219864452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.650000	0.54424	0.878000	0.35920	0.459000	0.35465	ATC	.	.		0.592	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
ACSL3	2181	hgsc.bcm.edu	37	2	223795465	223795465	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:223795465G>T	ENST00000357430.3	+	14	2198	c.1667G>T	c.(1666-1668)gGa>gTa	p.G556V	AC013476.1_ENST00000582868.1_RNA|ACSL3_ENST00000392066.3_Missense_Mutation_p.G556V	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	556					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	GATGAAAATGGACAAAGGTGG	0.378			T	ETV1	prostate																																p.G556V		Atlas-SNP	.		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	.	ACSL3	107	.	0			c.G1667T						.						102.0	106.0	104.0					2																	223795465		2203	4300	6503	SO:0001583	missense	2181	exon13			AAAATGGACAAAG	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1667G>T	chr2.hg19:g.223795465G>T	ENSP00000350012:p.Gly556Val	149.0	0.0		152.0	50.0	NM_203372	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	hg19	CCDS2455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.9|26.9	4.778557|4.778557	0.90195|0.90195	.|.	.|.	ENSG00000123983|ENSG00000123983	ENST00000407441|ENST00000357430;ENST00000392066	.|T;T	.|0.21361	.|2.01;2.01	5.74|5.74	5.74|5.74	0.90152|0.90152	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68550|0.68550	0.3013|0.3013	H|H	0.99238|0.99238	4.48|4.48	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.82774|0.82774	-0.0291|-0.0291	5|10	.|0.87932	.|D	.|0	-19.7837|-19.7837	19.9187|19.9187	0.97077|0.97077	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|556	.|O95573	.|ACSL3_HUMAN	Y|V	57|556	.|ENSP00000350012:G556V;ENSP00000375918:G556V	.|ENSP00000350012:G556V	D|G	+|+	1|2	0|0	ACSL3|ACSL3	223503709|223503709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.876000|7.876000	0.87215|0.87215	2.702000|2.702000	0.92279|0.92279	0.591000|0.591000	0.81541|0.81541	GAC|GGA	.	.		0.378	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457	
SP140	11262	hgsc.bcm.edu	37	2	231109739	231109739	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:231109739C>T	ENST00000392045.3	+	6	722	c.608C>T	c.(607-609)cCa>cTa	p.P203L	SP140_ENST00000420434.3_Missense_Mutation_p.P203L|SP140_ENST00000486687.2_Missense_Mutation_p.P203L|SP140_ENST00000343805.6_Missense_Mutation_p.P203L|SP140_ENST00000417495.3_Missense_Mutation_p.P203L|SP140_ENST00000350136.5_Missense_Mutation_p.P183L	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	203					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TTAGCTCTCCCAAAGGCTGGT	0.463																																					p.P203L		Atlas-SNP	.											.	SP140	121	.	0			c.C608T						.						137.0	127.0	130.0					2																	231109739		1927	4149	6076	SO:0001583	missense	11262	exon6			CTCTCCCAAAGGC	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.608C>T	chr2.hg19:g.231109739C>T	ENSP00000375899:p.Pro203Leu	64.0	0.0		70.0	25.0	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	hg19	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	C	9.108	1.005734	0.19199	.	.	ENSG00000079263	ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.58940	0.66;0.94;0.66;0.3;0.69	2.46	0.00307	0.14053	.	.	.	.	.	T	0.47893	0.1470	N	0.24115	0.695	0.09310	N	1	D;B;B;B;B	0.65815	0.995;0.183;0.278;0.242;0.183	P;B;B;B;B	0.54889	0.763;0.021;0.079;0.075;0.036	T	0.32745	-0.9895	9	0.41790	T	0.15	-0.4126	2.9781	0.05945	0.5557:0.284:0.1603:0.0	.	203;203;203;203;203	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75	.;.;.;LY10_HUMAN;.	L	203;203;183;203;203;203;203	ENSP00000440107:P203L;ENSP00000345846:P183L;ENSP00000375899:P203L;ENSP00000342096:P203L;ENSP00000398210:P203L	ENSP00000342096:P203L	P	+	2	0	SP140	230817983	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.048000	0.14078	-0.004000	0.14419	-0.493000	0.04662	CCA	.	.		0.463	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
TRPM8	79054	hgsc.bcm.edu	37	2	234854632	234854632	+	Missense_Mutation	SNP	C	C	T	rs200066478		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr2:234854632C>T	ENST00000324695.4	+	7	872	c.832C>T	c.(832-834)Cgg>Tgg	p.R278W	AC005538.5_ENST00000455991.1_RNA|TRPM8_ENST00000433712.2_5'UTR	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	278					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AGCAAAGCTCCGGAATCAGCT	0.478																																					p.R278W		Atlas-SNP	.											.	TRPM8	146	.	0			c.C832T						.						104.0	90.0	95.0					2																	234854632		2203	4300	6503	SO:0001583	missense	79054	exon7			AAGCTCCGGAATC	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.832C>T	chr2.hg19:g.234854632C>T	ENSP00000323926:p.Arg278Trp	120.0	0.0		119.0	13.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	hg19	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663770	0.67700	.	.	ENSG00000144481	ENST00000324695	T	0.68903	-0.36	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000007	D	0.84929	0.5581	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	D	0.87538	0.2457	10	0.87932	D	0	-22.1091	18.5163	0.90936	0.0:1.0:0.0:0.0	.	278	Q7Z2W7	TRPM8_HUMAN	W	278	ENSP00000323926:R278W	ENSP00000323926:R278W	R	+	1	2	TRPM8	234519371	0.993000	0.37304	0.823000	0.32752	0.020000	0.10135	3.009000	0.49552	2.719000	0.93026	0.655000	0.94253	CGG	.	.		0.478	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
FBLN2	2199	hgsc.bcm.edu	37	3	13659731	13659731	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:13659731T>A	ENST00000295760.7	+	6	1954	c.1885T>A	c.(1885-1887)Tgt>Agt	p.C629S	FBLN2_ENST00000492059.1_Missense_Mutation_p.C629S|FBLN2_ENST00000535798.1_Missense_Mutation_p.C655S|FBLN2_ENST00000404922.3_Missense_Mutation_p.C629S	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	629	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TTCTTACCACTGTGCCTGCTT	0.622																																					p.C629S		Atlas-SNP	.											.	FBLN2	137	.	0			c.T1885A						.						95.0	100.0	98.0					3																	13659731		2083	4208	6291	SO:0001583	missense	2199	exon6			TACCACTGTGCCT	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1885T>A	chr3.hg19:g.13659731T>A	ENSP00000295760:p.Cys629Ser	97.0	0.0		79.0	17.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	hg19	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	t	18.21	3.574379	0.65878	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.99966	-10.09;-10.09;-10.09;-10.09	5.2	5.2	0.72013	EGF-like calcium-binding, conserved site (1);EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99984	0.9995	H	0.99777	4.77	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.98948	1.0793	10	0.87932	D	0	.	13.3197	0.60426	0.0:0.0:0.0:1.0	.	629;629;655	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	S	655;629;629;629	ENSP00000445705:C655S;ENSP00000384169:C629S;ENSP00000295760:C629S;ENSP00000420042:C629S	ENSP00000295760:C629S	C	+	1	0	FBLN2	13634732	1.000000	0.71417	0.748000	0.31131	0.346000	0.29079	6.174000	0.71943	1.976000	0.57569	0.520000	0.50463	TGT	.	.		0.622	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
BTD	686	hgsc.bcm.edu	37	3	15686472	15686472	+	Missense_Mutation	SNP	A	A	G	rs148193489		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:15686472A>G	ENST00000303498.5	+	4	1218	c.1109A>G	c.(1108-1110)tAc>tGc	p.Y370C	BTD_ENST00000449107.1_Missense_Mutation_p.Y372C|BTD_ENST00000383778.4_Missense_Mutation_p.Y350C|BTD_ENST00000437172.1_Missense_Mutation_p.Y372C	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	370					biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						GGCGATCCGTACTGTGAGAAG	0.463																																					p.Y370C		Atlas-SNP	.											.	BTD	49	.	0			c.A1109G						.	A	CYS/TYR	0,4406		0,0,2203	115.0	113.0	114.0		1109	-3.2	0.0	3	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	missense	BTD	NM_000060.2	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	370/544	15686472	1,13005	2203	4300	6503	SO:0001583	missense	686	exon4			ATCCGTACTGTGA	AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.1109A>G	chr3.hg19:g.15686472A>G	ENSP00000306477:p.Tyr370Cys	124.0	0.0		132.0	24.0	NM_000060	A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	ENST00000303498.5	hg19	CCDS2628.1	.	.	.	.	.	.	.	.	.	.	A	9.875	1.200039	0.22121	0.0	1.16E-4	ENSG00000169814	ENST00000449107;ENST00000303498;ENST00000437172;ENST00000383778	D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54	5.58	-3.24	0.05094	.	1.897250	0.01784	N	0.031925	D	0.86830	0.6027	M	0.77103	2.36	0.18873	N	0.999989	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.10450	0.005;0.005;0.005	T	0.65627	-0.6122	10	0.44086	T	0.13	-44.1713	3.1763	0.06570	0.1927:0.4041:0.0731:0.33	.	372;372;370	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	C	372;370;372;350	ENSP00000388212:Y372C;ENSP00000306477:Y370C;ENSP00000400995:Y372C;ENSP00000373288:Y350C	ENSP00000306477:Y370C	Y	+	2	0	BTD	15661476	0.000000	0.05858	0.045000	0.18777	0.720000	0.41350	-0.692000	0.05127	-0.176000	0.10707	0.459000	0.35465	TAC	.	A|1.000;G|0.000		0.463	BTD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252103.2	NM_000060	
KCNH8	131096	hgsc.bcm.edu	37	3	19575195	19575195	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:19575195T>C	ENST00000328405.2	+	16	3194	c.2928T>C	c.(2926-2928)caT>caC	p.H976H		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	976	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTGGAGCTCATGAGCAAAATC	0.453																																					p.H976H	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											.	KCNH8	189	.	0			c.T2928C						.						119.0	119.0	119.0					3																	19575195		2203	4300	6503	SO:0001819	synonymous_variant	131096	exon16			AGCTCATGAGCAA	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2928T>C	chr3.hg19:g.19575195T>C		94.0	0.0		90.0	15.0	NM_144633	B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	hg19	CCDS2632.1																																																																																			.	.		0.453	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
DCLK3	85443	hgsc.bcm.edu	37	3	36778744	36778744	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:36778744G>A	ENST00000416516.2	-	2	1897	c.1407C>T	c.(1405-1407)caC>caT	p.H469H		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	469	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						TGCTCTTGTCGTGCATGTGGA	0.483																																					p.H469H		Atlas-SNP	.											.	DCLK3	95	.	0			c.C1407T						.						80.0	77.0	78.0					3																	36778744		1983	4168	6151	SO:0001819	synonymous_variant	85443	exon2			CTTGTCGTGCATG	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1407C>T	chr3.hg19:g.36778744G>A		152.0	0.0		155.0	32.0	NM_033403		Silent	SNP	ENST00000416516.2	hg19	CCDS43064.1																																																																																			.	.		0.483	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355	
LRRFIP2	9209	hgsc.bcm.edu	37	3	37133031	37133031	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:37133031T>C	ENST00000336686.4	-	18	1116		c.e18-2		LRRFIP2_ENST00000396428.2_Intron|LRRFIP2_ENST00000440230.1_Splice_Site|LRRFIP2_ENST00000354379.4_Intron|Y_RNA_ENST00000383918.1_RNA|LRRFIP2_ENST00000421307.1_Splice_Site|LRRFIP2_ENST00000421276.2_Splice_Site			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2						Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						ATAGATATCCTGCAGGACATA	0.418																																					.		Atlas-SNP	.											.	LRRFIP2	71	.	1	Whole gene deletion(1)	ovary(1)	c.1036-2A>G						.						151.0	131.0	138.0					3																	37133031		2203	4300	6503	SO:0001630	splice_region_variant	9209	exon20			ATATCCTGCAGGA	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1036-2A>G	chr3.hg19:g.37133031T>C		98.0	0.0		92.0	8.0	NM_006309	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Splice_Site	SNP	ENST00000336686.4	hg19	CCDS2664.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.584811	0.86748	.	.	ENSG00000093167	ENST00000421307;ENST00000336686;ENST00000421276;ENST00000440230;ENST00000416425	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9672	0.79984	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRRFIP2	37108035	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.674000	0.83992	2.181000	0.69327	0.460000	0.39030	.	.	.		0.418	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	NM_006309	Intron
CXCR6	10663	hgsc.bcm.edu	37	3	45988540	45988540	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:45988540T>A	ENST00000458629.1	+	1	2030	c.567T>A	c.(565-567)acT>acA	p.T189T	CXCR6_ENST00000438735.1_Silent_p.T189T|CXCR6_ENST00000304552.4_Silent_p.T189T|FYCO1_ENST00000535325.1_Intron|CXCR6_ENST00000457814.1_Silent_p.T189T|FYCO1_ENST00000438446.1_Intron|FYCO1_ENST00000296137.2_Intron			O00574	CXCR6_HUMAN	chemokine (C-X-C motif) receptor 6	189					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|viral genome replication (GO:0019079)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(3)|lung(1)|prostate(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CAATTTCCACTGTGGTTCTTG	0.463																																					p.T189T	Esophageal Squamous(63;1005 1117 15521 45762 47089)	Atlas-SNP	.											.	CXCR6	17	.	0			c.T567A						.						127.0	127.0	127.0					3																	45988540		2203	4300	6503	SO:0001819	synonymous_variant	10663	exon2			TTCCACTGTGGTT	AF007545	CCDS2735.1	3p21	2012-08-08			ENSG00000172215	ENSG00000172215		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	16647	protein-coding gene	gene with protein product		605163				9166430, 9230441	Standard	XM_005264809		Approved	TYMSTR, STRL33, BONZO, CD186	uc003cpc.1	O00574	OTTHUMG00000133448	ENST00000458629.1:c.567T>A	chr3.hg19:g.45988540T>A		79.0	0.0		86.0	16.0	NM_006564	O00575|Q9HCA5	Silent	SNP	ENST00000458629.1	hg19	CCDS2735.1																																																																																			.	.		0.463	CXCR6-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344395.1		
MST1R	4486	hgsc.bcm.edu	37	3	49928638	49928638	+	Silent	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:49928638C>A	ENST00000296474.3	-	17	3663	c.3636G>T	c.(3634-3636)cgG>cgT	p.R1212R	MST1R_ENST00000344206.4_Silent_p.R1163R	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1212	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		ACATGCAGTTCCGCGCAGCCA	0.617																																					p.R1212R		Atlas-SNP	.											.	MST1R	205	.	0			c.G3636T						.						66.0	58.0	61.0					3																	49928638		2203	4300	6503	SO:0001819	synonymous_variant	4486	exon17			GCAGTTCCGCGCA	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.3636G>T	chr3.hg19:g.49928638C>A		58.0	0.0		51.0	9.0	NM_002447	B5A944|B5A945|B5A946|B5A947	Silent	SNP	ENST00000296474.3	hg19	CCDS2807.1	.	.	.	.	.	.	.	.	.	.	.	7.962	0.747232	0.15710	.	.	ENSG00000164078	ENST00000434765;ENST00000440292	.	.	.	5.37	3.56	0.40772	.	.	.	.	.	T	0.57961	0.2089	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50110	-0.8866	4	.	.	.	-25.672	8.172	0.31260	0.0:0.6754:0.1175:0.207	.	.	.	.	V	190;233	.	.	G	-	2	0	MST1R	49903642	0.997000	0.39634	1.000000	0.80357	0.901000	0.52897	0.467000	0.22035	0.258000	0.21686	-0.829000	0.03081	GGA	.	.		0.617	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
DOCK3	1795	hgsc.bcm.edu	37	3	51266174	51266174	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:51266174A>G	ENST00000266037.9	+	18	1753	c.1730A>G	c.(1729-1731)aAt>aGt	p.N577S		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	577	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GGCTGCCCTAATATTCCTTCT	0.478																																					p.N577S		Atlas-SNP	.											.	DOCK3	397	.	0			c.A1730G						.						114.0	114.0	114.0					3																	51266174		1965	4158	6123	SO:0001583	missense	1795	exon18			GCCCTAATATTCC	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1730A>G	chr3.hg19:g.51266174A>G	ENSP00000266037:p.Asn577Ser	133.0	0.0		134.0	29.0	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	hg19	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	A	9.742	1.165175	0.21538	.	.	ENSG00000088538	ENST00000266037	T	0.04758	3.56	5.45	5.45	0.79879	.	0.134765	0.64402	D	0.000003	T	0.05502	0.0145	L	0.41824	1.3	0.45427	D	0.998405	B	0.29552	0.248	B	0.30179	0.112	T	0.38001	-0.9681	10	0.10111	T	0.7	.	15.5099	0.75772	1.0:0.0:0.0:0.0	.	577	Q8IZD9	DOCK3_HUMAN	S	577	ENSP00000266037:N577S	ENSP00000266037:N577S	N	+	2	0	DOCK3	51241214	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	4.103000	0.57783	2.060000	0.61445	0.533000	0.62120	AAT	.	.		0.478	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
GRM2	2912	hgsc.bcm.edu	37	3	51746843	51746843	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:51746843T>A	ENST00000395052.3	+	3	1039	c.805T>A	c.(805-807)Ttc>Atc	p.F269I	GRM2_ENST00000442933.2_Missense_Mutation_p.F269I|GRM2_ENST00000475478.1_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	269					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCTGTCCTGTTCACCCGTTC	0.677																																					p.F269I		Atlas-SNP	.											.	GRM2	91	.	0			c.T805A						.						28.0	29.0	28.0					3																	51746843		2202	4298	6500	SO:0001583	missense	2912	exon3			GTCCTGTTCACCC	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.805T>A	chr3.hg19:g.51746843T>A	ENSP00000378492:p.Phe269Ile	75.0	0.0		75.0	20.0	NM_000839	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	hg19	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	t	27.3	4.821056	0.90873	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.84370	-1.84;-1.84	5.23	5.23	0.72850	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93331	0.7874	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94572	0.7772	10	0.87932	D	0	.	15.4555	0.75311	0.0:0.0:0.0:1.0	.	269	Q14416	GRM2_HUMAN	I	269	ENSP00000378492:F269I;ENSP00000408906:F269I	ENSP00000296479:F269I	F	+	1	0	GRM2	51721883	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	8.026000	0.88783	2.128000	0.65567	0.524000	0.50904	TTC	.	.		0.677	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
OR5H1	26341	hgsc.bcm.edu	37	3	97852435	97852435	+	Silent	SNP	A	A	T	rs376802329		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:97852435A>T	ENST00000354565.2	+	1	894	c.894A>T	c.(892-894)acA>acT	p.T298T	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						AGCAAGTCACAGTTTCATTCA	0.323																																					p.T298T		Atlas-SNP	.											.	OR5H1	71	.	0			c.A894T						.	A		0,4404		0,0,2202	73.0	78.0	77.0		894	2.1	0.0	3		77	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	OR5H1	NM_001005338.1		0,1,6498	TT,TA,AA		0.0116,0.0,0.0077		298/314	97852435	1,12997	2202	4297	6499	SO:0001819	synonymous_variant	26341	exon1			AGTCACAGTTTCA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.894A>T	chr3.hg19:g.97852435A>T		66.0	0.0		68.0	10.0	NM_001005338		Silent	SNP	ENST00000354565.2	hg19	CCDS33797.1																																																																																			.	.		0.323	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
KCNAB1	7881	hgsc.bcm.edu	37	3	156009781	156009781	+	Intron	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr3:156009781G>A	ENST00000490337.1	+	2	339				KCNAB1_ENST00000389634.5_Missense_Mutation_p.A29T|KCNAB1_ENST00000389636.5_Intron|KCNAB1_ENST00000302490.8_Missense_Mutation_p.A29T|KCNAB1_ENST00000471742.1_Intron	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GAGCTCCACCGCCCCCAATGT	0.582																																					p.A29T		Atlas-SNP	.											.	KCNAB1	176	.	0			c.G85A						.						68.0	64.0	65.0					3																	156009781		2203	4300	6503	SO:0001627	intron_variant	7881	exon1			TCCACCGCCCCCA	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.276-129624G>A	chr3.hg19:g.156009781G>A		253.0	0.0		226.0	25.0	NM_172159	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	hg19	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824992	0.50739	.	.	ENSG00000169282	ENST00000302490;ENST00000389634	T;T	0.10288	3.23;2.89	5.04	4.15	0.48705	.	0.172150	0.40385	N	0.001116	T	0.04861	0.0131	N	0.03608	-0.345	0.37360	D	0.911163	B;B	0.14012	0.009;0.006	B;B	0.06405	0.002;0.002	T	0.33369	-0.9871	10	0.38643	T	0.18	.	10.0896	0.42439	0.1573:0.0:0.8427:0.0	.	29;29	F8W6W4;B3KPZ4	.;.	T	29	ENSP00000305858:A29T;ENSP00000374285:A29T	ENSP00000305858:A29T	A	+	1	0	KCNAB1	157492475	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.339000	0.59322	2.349000	0.79799	0.460000	0.39030	GCC	.	.		0.582	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
PDE6B	5158	hgsc.bcm.edu	37	4	656887	656887	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:656887A>T	ENST00000496514.1	+	15	1853		c.e15-1		RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000255622.6_Splice_Site|PDE6B_ENST00000429163.2_Splice_Site			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta						cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CCTGTGTAACAGGTCCCAGAA	0.602																																					.	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.1833-2A>T						.						97.0	91.0	93.0					4																	656887		2203	4300	6503	SO:0001630	splice_region_variant	5158	exon15			TGTAACAGGTCCC	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1833-1A>T	chr4.hg19:g.656887A>T		101.0	0.0		114.0	11.0	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Splice_Site	SNP	ENST00000496514.1	hg19	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.610525	0.28712	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8803	0.46935	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE6B	646887	1.000000	0.71417	0.493000	0.27502	0.098000	0.18820	8.533000	0.90617	1.453000	0.47775	0.449000	0.29647	.	.	.		0.602	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	Intron
SLC2A9	56606	hgsc.bcm.edu	37	4	9828041	9828041	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:9828041T>C	ENST00000264784.3	-	12	1656	c.1603A>G	c.(1603-1605)Aag>Gag	p.K535E	SLC2A9_ENST00000506583.1_Missense_Mutation_p.K506E|SLC2A9_ENST00000309065.3_Missense_Mutation_p.K506E	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	535					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	CCATTTATCTTACCATCAGTG	0.408																																					p.K535E		Atlas-SNP	.											.	SLC2A9	158	.	0			c.A1603G						.						179.0	156.0	164.0					4																	9828041		2203	4300	6503	SO:0001583	missense	56606	exon12			TTATCTTACCATC	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.1603A>G	chr4.hg19:g.9828041T>C	ENSP00000264784:p.Lys535Glu	117.0	0.0		146.0	23.0	NM_020041	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	ENST00000264784.3	hg19	CCDS3407.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.299674	0.40694	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065	D;D;D	0.82255	-1.59;-1.52;-1.59	5.96	4.74	0.60224	.	2.528880	0.01133	N	0.006032	T	0.78000	0.4215	L	0.27053	0.805	0.09310	N	1	B;B	0.29862	0.216;0.259	B;B	0.34242	0.178;0.118	T	0.64740	-0.6336	10	0.46703	T	0.11	.	6.9308	0.24439	0.0:0.0836:0.163:0.7534	.	506;535	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	E	506;535;506	ENSP00000422209:K506E;ENSP00000264784:K535E;ENSP00000311383:K506E	ENSP00000264784:K535E	K	-	1	0	SLC2A9	9437139	0.115000	0.22152	0.008000	0.14137	0.013000	0.08279	1.969000	0.40510	2.284000	0.76573	0.528000	0.53228	AAG	.	.		0.408	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1		
PPARGC1A	10891	hgsc.bcm.edu	37	4	23826123	23826123	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:23826123T>C	ENST00000264867.2	-	6	885	c.766A>G	c.(766-768)Aca>Gca	p.T256A	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	256					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GATAAAGTTGTTGGTTTGGCT	0.343																																					p.T256A	Esophageal Squamous(29;694 744 13796 34866 44181)	Atlas-SNP	.											.	PPARGC1A	129	.	0			c.A766G						.						154.0	167.0	163.0					4																	23826123		2203	4300	6503	SO:0001583	missense	10891	exon6			AAGTTGTTGGTTT	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.766A>G	chr4.hg19:g.23826123T>C	ENSP00000264867:p.Thr256Ala	47.0	0.0		44.0	7.0	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	hg19	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	T	11.09	1.536981	0.27475	.	.	ENSG00000109819	ENST00000264867	T	0.24538	1.85	5.71	4.53	0.55603	.	0.048621	0.85682	D	0.000000	T	0.30759	0.0775	M	0.77820	2.39	0.80722	D	1	B	0.26483	0.15	B	0.26310	0.068	T	0.05225	-1.0898	10	0.32370	T	0.25	-6.752	11.7914	0.52072	0.0:0.0687:0.0:0.9313	.	256	Q9UBK2	PRGC1_HUMAN	A	256	ENSP00000264867:T256A	ENSP00000264867:T256A	T	-	1	0	PPARGC1A	23435221	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.981000	0.70524	0.998000	0.38996	-0.589000	0.04120	ACA	.	.		0.343	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
SEL1L3	23231	hgsc.bcm.edu	37	4	25836852	25836852	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:25836852T>A	ENST00000399878.3	-	3	949	c.827A>T	c.(826-828)gAg>gTg	p.E276V	SEL1L3_ENST00000264868.5_Missense_Mutation_p.E241V|SEL1L3_ENST00000502949.1_Missense_Mutation_p.E123V|SEL1L3_ENST00000513364.1_5'UTR	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	276						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TCGAGTGGCCTCCAGCTCTCG	0.537																																					p.E276V		Atlas-SNP	.											.	SEL1L3	62	.	0			c.A827T						.						123.0	126.0	125.0					4																	25836852		1979	4144	6123	SO:0001583	missense	23231	exon3			GTGGCCTCCAGCT	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.827A>T	chr4.hg19:g.25836852T>A	ENSP00000382767:p.Glu276Val	87.0	0.0		99.0	21.0	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	hg19	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.329476	0.81690	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.14766	2.48;2.48;2.48	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	M	0.68952	2.095	0.43073	D	0.99471	D	0.89917	1.0	D	0.81914	0.995	T	0.08638	-1.0712	10	0.87932	D	0	-27.0413	14.0679	0.64841	0.0:0.0:0.0:1.0	.	276	Q68CR1	SE1L3_HUMAN	V	276;241;123	ENSP00000382767:E276V;ENSP00000264868:E241V;ENSP00000425438:E123V	ENSP00000264868:E241V	E	-	2	0	SEL1L3	25445950	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	4.438000	0.59961	2.311000	0.77944	0.533000	0.62120	GAG	.	.		0.537	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
RFC1	5981	hgsc.bcm.edu	37	4	39304373	39304373	+	Missense_Mutation	SNP	C	C	T	rs199688793		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:39304373C>T	ENST00000381897.1	-	17	2460	c.2327G>A	c.(2326-2328)cGg>cAg	p.R776Q	RFC1_ENST00000349703.2_Missense_Mutation_p.R775Q	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	776					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTGTTCAACCCGAGGTCTTTG	0.303																																					p.R776Q	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	Atlas-SNP	.											.	RFC1	114	.	0			c.G2327A						.						44.0	45.0	45.0					4																	39304373		2203	4299	6502	SO:0001583	missense	5981	exon17			TCAACCCGAGGTC	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.2327G>A	chr4.hg19:g.39304373C>T	ENSP00000371321:p.Arg776Gln	256.0	0.0		281.0	60.0	NM_001204747	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	ENST00000381897.1	hg19	CCDS56329.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033828	0.93575	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	T;T	0.16597	2.33;2.33	6.02	5.18	0.71444	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	L	0.31526	0.94	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.97110	0.932;1.0	T	0.05225	-1.0898	10	0.59425	D	0.04	-9.9506	15.146	0.72653	0.0:0.9328:0.0:0.0672	.	776;775	P35251;P35251-2	RFC1_HUMAN;.	Q	776;775	ENSP00000371321:R776Q;ENSP00000261424:R775Q	ENSP00000261424:R775Q	R	-	2	0	RFC1	38980768	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	7.786000	0.85741	1.567000	0.49668	0.655000	0.94253	CGG	.	.		0.303	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
NFXL1	152518	hgsc.bcm.edu	37	4	47900865	47900865	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:47900865T>A	ENST00000507489.1	-	8	1174	c.998A>T	c.(997-999)cAg>cTg	p.Q333L	NFXL1_ENST00000329043.3_Missense_Mutation_p.Q333L|NFXL1_ENST00000381538.3_Missense_Mutation_p.Q333L	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	333						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TGGACAAGGCTGACAGCTTCC	0.358																																					p.Q333L		Atlas-SNP	.											.	NFXL1	79	.	0			c.A998T						.						142.0	138.0	139.0					4																	47900865		2203	4300	6503	SO:0001583	missense	152518	exon8			CAAGGCTGACAGC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.998A>T	chr4.hg19:g.47900865T>A	ENSP00000422037:p.Gln333Leu	175.0	0.0		221.0	51.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	T	6.309	0.425150	0.11987	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.60040	0.22;0.22;0.22	5.15	-0.334	0.12666	Zinc finger, NF-X1-type (2);	0.836379	0.10770	N	0.636150	T	0.41351	0.1155	N	0.25144	0.715	0.19775	N	0.999959	B	0.02656	0.0	B	0.04013	0.001	T	0.21827	-1.0234	10	0.29301	T	0.29	0.0826	12.0732	0.53628	0.1023:0.0:0.628:0.2697	.	333	Q6ZNB6	NFXL1_HUMAN	L	333	ENSP00000370949:Q333L;ENSP00000422037:Q333L;ENSP00000333113:Q333L	ENSP00000333113:Q333L	Q	-	2	0	NFXL1	47595622	0.002000	0.14202	0.400000	0.26346	0.828000	0.46876	-0.149000	0.10204	-0.276000	0.09206	-0.320000	0.08662	CAG	.	.		0.358	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
YTHDC1	91746	hgsc.bcm.edu	37	4	69198561	69198561	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:69198561T>C	ENST00000344157.4	-	6	1313	c.978A>G	c.(976-978)tcA>tcG	p.S326S	YTHDC1_ENST00000355665.3_Intron|YTHDC1_ENST00000579690.1_Silent_p.S326S	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	326					mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						GCTTCTTTTCTGAACCTGTAT	0.318																																					p.S326S		Atlas-SNP	.											.	YTHDC1	81	.	0			c.A978G						.						88.0	79.0	82.0					4																	69198561		2202	4299	6501	SO:0001819	synonymous_variant	91746	exon6			CTTTTCTGAACCT	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.978A>G	chr4.hg19:g.69198561T>C		62.0	0.0		59.0	15.0	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	hg19	CCDS33992.1																																																																																			.	.		0.318	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
DSPP	1834	hgsc.bcm.edu	37	4	88534079	88534079	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:88534079T>G	ENST00000282478.7	+	3	774	c.741T>G	c.(739-741)agT>agG	p.S247R	DSPP_ENST00000399271.1_Missense_Mutation_p.S247R|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	247					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GGAGTCCTAGTGGGAATGGAG	0.493																																					p.S247R		Atlas-SNP	.											.	DSPP	174	.	0			c.T741G						.						109.0	121.0	117.0					4																	88534079		2057	4195	6252	SO:0001583	missense	1834	exon4			TCCTAGTGGGAAT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.741T>G	chr4.hg19:g.88534079T>G	ENSP00000282478:p.Ser247Arg	242.0	0.0		287.0	130.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.287097	0.40494	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.96745	-4.11;-4.11	4.59	-0.459	0.12179	.	.	.	.	.	D	0.96355	0.8811	L	0.59436	1.845	0.28904	N	0.893098	D	0.76494	0.999	D	0.74674	0.984	D	0.90345	0.4362	9	0.62326	D	0.03	-7.9015	4.4745	0.11729	0.1524:0.3763:0.0:0.4713	.	247	Q9NZW4	DSPP_HUMAN	R	247	ENSP00000382213:S247R;ENSP00000282478:S247R	ENSP00000282478:S247R	S	+	3	2	DSPP	88753103	0.998000	0.40836	0.996000	0.52242	0.936000	0.57629	0.114000	0.15520	-0.214000	0.10078	-0.385000	0.06624	AGT	.	.		0.493	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	hgsc.bcm.edu	37	4	88534092	88534092	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:88534092G>C	ENST00000282478.7	+	3	787	c.754G>C	c.(754-756)Gat>Cat	p.D252H	DSPP_ENST00000399271.1_Missense_Mutation_p.D252H|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	252					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GAATGGAGCAGATGAGGATGA	0.507																																					p.D252H		Atlas-SNP	.											.	DSPP	174	.	0			c.G754C						.						117.0	129.0	125.0					4																	88534092		2061	4194	6255	SO:0001583	missense	1834	exon4			GGAGCAGATGAGG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.754G>C	chr4.hg19:g.88534092G>C	ENSP00000282478:p.Asp252His	243.0	0.0		272.0	119.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318612	0.40996	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.92595	-3.07;-3.07	4.4	4.4	0.53042	.	.	.	.	.	D	0.94085	0.8104	L	0.55481	1.735	0.25521	N	0.987364	D	0.89917	1.0	D	0.74023	0.982	D	0.86844	0.2019	9	0.66056	D	0.02	-3.0903	10.2175	0.43177	0.0966:0.0:0.9034:0.0	.	252	Q9NZW4	DSPP_HUMAN	H	252	ENSP00000382213:D252H;ENSP00000282478:D252H	ENSP00000282478:D252H	D	+	1	0	DSPP	88753116	0.995000	0.38212	0.897000	0.35233	0.933000	0.57130	2.576000	0.46033	2.284000	0.76573	0.557000	0.71058	GAT	.	.		0.507	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
CENPE	1062	hgsc.bcm.edu	37	4	104066278	104066278	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:104066278T>A	ENST00000265148.3	-	32	4875	c.4786A>T	c.(4786-4788)Aaa>Taa	p.K1596*	CENPE_ENST00000380026.3_Nonsense_Mutation_p.K1571*	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1596					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGTACTCTTTTCATTTCCTCT	0.328																																					p.K1596X		Atlas-SNP	.											.	CENPE	253	.	0			c.A4786T						.						139.0	131.0	134.0					4																	104066278		2203	4298	6501	SO:0001587	stop_gained	1062	exon32			CTCTTTTCATTTC	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4786A>T	chr4.hg19:g.104066278T>A	ENSP00000265148:p.Lys1596*	55.0	0.0		56.0	9.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Nonsense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	41	8.815695	0.98964	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	.	.	.	4.06	2.79	0.32731	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.9088	0.24323	0.0:0.1189:0.0:0.8811	.	.	.	.	X	1596;1596;1571	.	ENSP00000265148:K1596X	K	-	1	0	CENPE	104285727	0.039000	0.19947	0.805000	0.32314	0.317000	0.28152	0.227000	0.17795	0.538000	0.28769	0.368000	0.22195	AAA	.	.		0.328	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TET2	54790	hgsc.bcm.edu	37	4	106157691	106157691	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:106157691C>T	ENST00000540549.1	+	3	3452	c.2592C>T	c.(2590-2592)caC>caT	p.H864H	TET2_ENST00000513237.1_Silent_p.H885H|TET2_ENST00000545826.1_Silent_p.H864H|TET2_ENST00000380013.4_Silent_p.H864H|TET2_ENST00000394764.1_Silent_p.H864H|TET2_ENST00000305737.2_Silent_p.H864H|TET2_ENST00000413648.2_Silent_p.H864H			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	864	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		ACTTGCATCACATGCAATATT	0.388			"""Mis N, F"""		MDS																																p.H864H		Atlas-SNP	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	0			c.C2592T						.						71.0	68.0	69.0					4																	106157691		2203	4300	6503	SO:0001819	synonymous_variant	54790	exon3			GCATCACATGCAA	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2592C>T	chr4.hg19:g.106157691C>T		259.0	0.0		252.0	62.0	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Silent	SNP	ENST00000540549.1	hg19	CCDS47120.1																																																																																			.	.		0.388	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
BBS12	166379	hgsc.bcm.edu	37	4	123663523	123663523	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:123663523C>T	ENST00000314218.3	+	2	669	c.476C>T	c.(475-477)cCt>cTt	p.P159L	BBS12_ENST00000542236.1_Missense_Mutation_p.P159L	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	159			P -> L (in BBS12; pathogenicity uncertain; significantly reduces the interaction with MKKS; the interaction with BBS10 is not affected by this mutation). {ECO:0000269|PubMed:17160889}.		cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						AGTTTGTGTCCTTTTCTACAG	0.383									Bardet-Biedl syndrome																												p.P159L		Atlas-SNP	.											.	BBS12	63	.	0			c.C476T	GRCh37	CM070034	BBS12	M		.						110.0	98.0	102.0					4																	123663523		2203	4300	6503	SO:0001583	missense	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TGTGTCCTTTTCT	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.476C>T	chr4.hg19:g.123663523C>T	ENSP00000319062:p.Pro159Leu	157.0	0.0		160.0	37.0	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	ENST00000314218.3	hg19	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.480328	0.26598	.	.	ENSG00000181004	ENST00000314218;ENST00000542236;ENST00000433287	T;T;T	0.72835	-0.69;-0.69;-0.66	5.2	3.41	0.39046	.	0.268407	0.29466	N	0.012067	T	0.52533	0.1740	L	0.34521	1.04	0.09310	N	0.999999	B	0.15473	0.013	B	0.15052	0.012	T	0.43245	-0.9403	10	0.51188	T	0.08	-23.6558	1.8051	0.03079	0.3112:0.3989:0.1539:0.136	.	159	Q6ZW61	BBS12_HUMAN	L	159	ENSP00000319062:P159L;ENSP00000438273:P159L;ENSP00000398912:P159L	ENSP00000319062:P159L	P	+	2	0	BBS12	123882973	0.493000	0.26035	0.015000	0.15790	0.290000	0.27261	0.846000	0.27682	1.287000	0.44583	0.650000	0.86243	CCT	.	.		0.383	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
ZNF827	152485	hgsc.bcm.edu	37	4	146770559	146770559	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:146770559T>C	ENST00000508784.1	-	6	2363	c.2136A>G	c.(2134-2136)ccA>ccG	p.P712P	ZNF827_ENST00000379448.4_Silent_p.P712P|ZNF827_ENST00000511534.1_5'UTR|ZNF827_ENST00000513320.1_Silent_p.P362P			Q17R98	ZN827_HUMAN	zinc finger protein 827	712					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					CTCTGCCCTCTGGCATCTTCT	0.493																																					p.P712P		Atlas-SNP	.											.	ZNF827	102	.	0			c.A2136G						.						108.0	117.0	114.0					4																	146770559		2203	4300	6503	SO:0001819	synonymous_variant	152485	exon6			GCCCTCTGGCATC	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.2136A>G	chr4.hg19:g.146770559T>C		121.0	0.0		144.0	40.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Silent	SNP	ENST00000508784.1	hg19																																																																																				.	.		0.493	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
ZNF827	152485	hgsc.bcm.edu	37	4	146770637	146770637	+	Silent	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:146770637G>C	ENST00000508784.1	-	6	2285	c.2058C>G	c.(2056-2058)gtC>gtG	p.V686V	ZNF827_ENST00000379448.4_Silent_p.V686V|ZNF827_ENST00000511534.1_5'UTR|ZNF827_ENST00000513320.1_Silent_p.V336V			Q17R98	ZN827_HUMAN	zinc finger protein 827	686					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					GTGATATCGAGACATGGGAGT	0.498																																					p.V686V		Atlas-SNP	.											.	ZNF827	102	.	0			c.C2058G						.						147.0	142.0	144.0					4																	146770637		2203	4300	6503	SO:0001819	synonymous_variant	152485	exon6			TATCGAGACATGG	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.2058C>G	chr4.hg19:g.146770637G>C		83.0	0.0		122.0	47.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Silent	SNP	ENST00000508784.1	hg19																																																																																				.	.		0.498	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
MAP9	79884	hgsc.bcm.edu	37	4	156289851	156289851	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:156289851T>A	ENST00000311277.4	-	5	858	c.595A>T	c.(595-597)Act>Tct	p.T199S	MAP9_ENST00000379248.2_Missense_Mutation_p.T126S|AC097467.2_ENST00000598890.1_RNA|AC097467.2_ENST00000596165.1_RNA|AC097467.2_ENST00000600928.1_RNA|MAP9_ENST00000515654.1_Missense_Mutation_p.T199S|AC097467.2_ENST00000597831.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	199					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		CTGAGGGCAGTTTCTTTATCT	0.418																																					p.T199S		Atlas-SNP	.											.	MAP9	79	.	0			c.A595T						.						204.0	190.0	195.0					4																	156289851		2203	4300	6503	SO:0001583	missense	79884	exon5			GGGCAGTTTCTTT	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.595A>T	chr4.hg19:g.156289851T>A	ENSP00000310593:p.Thr199Ser	118.0	0.0		141.0	34.0	NM_001039580	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	hg19	CCDS35493.1	.	.	.	.	.	.	.	.	.	.	T	9.785	1.176486	0.21704	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024;ENST00000393836;ENST00000379248	T;T;T;T	0.30981	2.27;2.29;1.51;3.24	4.8	-9.6	0.00553	.	1.302380	0.05401	N	0.540762	T	0.12561	0.0305	L	0.28274	0.84	0.09310	N	1	B;P;B;B	0.43938	0.058;0.822;0.137;0.137	B;B;B;B	0.41510	0.059;0.359;0.037;0.037	T	0.32824	-0.9892	10	0.06891	T	0.86	1.6013	0.5456	0.00653	0.2886:0.2134:0.2926:0.2054	.	198;126;199;199	B4DVG9;A8MSM7;B9EJB6;Q49MG5	.;.;.;MAP9_HUMAN	S	199;199;198;199;126	ENSP00000310593:T199S;ENSP00000427402:T199S;ENSP00000394048:T198S;ENSP00000368550:T126S	ENSP00000310593:T199S	T	-	1	0	MAP9	156509301	0.000000	0.05858	0.000000	0.03702	0.785000	0.44390	-0.871000	0.04223	-2.213000	0.00735	-0.456000	0.05471	ACT	.	.		0.418	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
CDH18	1016	hgsc.bcm.edu	37	5	19591188	19591188	+	Missense_Mutation	SNP	T	T	C	rs528650652		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:19591188T>C	ENST00000507958.1	-	9	1967	c.977A>G	c.(976-978)gAa>gGa	p.E326G	CDH18_ENST00000511273.1_Missense_Mutation_p.E326G|CDH18_ENST00000274170.4_Missense_Mutation_p.E326G|CDH18_ENST00000502796.1_Missense_Mutation_p.E326G|CDH18_ENST00000506372.1_Missense_Mutation_p.E326G|CDH18_ENST00000382275.1_Missense_Mutation_p.E326G			Q13634	CAD18_HUMAN	cadherin 18, type 2	326	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AAGGATTCCTTCTCTGGTCTC	0.393																																					p.E326G		Atlas-SNP	.											.	CDH18	561	.	0			c.A977G						.						110.0	96.0	100.0					5																	19591188		2203	4300	6503	SO:0001583	missense	1016	exon7			ATTCCTTCTCTGG	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.977A>G	chr5.hg19:g.19591188T>C	ENSP00000425093:p.Glu326Gly	63.0	0.0		78.0	10.0	NM_001167667	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411282	0.83340	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.24	5.24	0.73138	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.69584	0.3127	H	0.94734	3.575	0.54753	D	0.999989	D;D	0.76494	0.999;0.996	D;D	0.80764	0.994;0.955	T	0.79235	-0.1887	9	.	.	.	.	13.9607	0.64177	0.0:0.0:0.0:1.0	.	326;326	B4DHG6;Q13634	.;CAD18_HUMAN	G	326;326;326;326;326;326;272;326	ENSP00000371710:E326G;ENSP00000425093:E326G;ENSP00000274170:E326G;ENSP00000424931:E326G;ENSP00000422138:E326G;ENSP00000427383:E272G;ENSP00000425854:E326G	.	E	-	2	0	CDH18	19626945	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.556000	0.82233	1.966000	0.57179	0.528000	0.53228	GAA	.	.		0.393	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
NPR3	4883	hgsc.bcm.edu	37	5	32712409	32712409	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:32712409G>A	ENST00000265074.8	+	1	870	c.527G>A	c.(526-528)cGc>cAc	p.R176H	NPR3_ENST00000415685.2_Intron|NPR3_ENST00000434067.2_Intron|NPR3_ENST00000415167.2_Missense_Mutation_p.R176H	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	176					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	CACCTCACGCGCGTGGCGCCC	0.677																																					p.R176H		Atlas-SNP	.											.	NPR3	65	.	0			c.G527A						.						37.0	44.0	42.0					5																	32712409		2068	4192	6260	SO:0001583	missense	4883	exon1			TCACGCGCGTGGC		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.527G>A	chr5.hg19:g.32712409G>A	ENSP00000265074:p.Arg176His	106.0	0.0		141.0	25.0	NM_000908	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	hg19	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931256	0.92389	.	.	ENSG00000113389	ENST00000265074;ENST00000415167	D;D	0.91295	-2.82;-2.82	4.89	4.89	0.63831	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.96253	0.8778	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96990	0.9721	10	0.87932	D	0	-26.0128	18.2354	0.89948	0.0:0.0:1.0:0.0	.	176;176	P17342;Q60I31	ANPRC_HUMAN;.	H	176	ENSP00000265074:R176H;ENSP00000398028:R176H	ENSP00000265074:R176H	R	+	2	0	NPR3	32748166	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.429000	0.97481	2.551000	0.86045	0.561000	0.74099	CGC	.	.		0.677	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908	
NUP155	9631	hgsc.bcm.edu	37	5	37370982	37370982	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:37370982T>C	ENST00000231498.3	-	1	301	c.98A>G	c.(97-99)cAg>cGg	p.Q33R	NUP155_ENST00000513532.1_Missense_Mutation_p.Q33R|NUP155_ENST00000381843.2_5'Flank	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	33					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTCTTGCAACTGACGGTCGAT	0.572																																					p.Q33R		Atlas-SNP	.											.	NUP155	116	.	0			c.A98G						.						104.0	100.0	102.0					5																	37370982		2203	4300	6503	SO:0001583	missense	9631	exon1			TGCAACTGACGGT	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.98A>G	chr5.hg19:g.37370982T>C	ENSP00000231498:p.Gln33Arg	70.0	0.0		97.0	12.0	NM_153485	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	hg19	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.302556	0.60195	.	.	ENSG00000113569	ENST00000231498;ENST00000513532	T;T	0.77489	-1.09;-1.1	4.28	4.28	0.50868	.	0.116985	0.64402	D	0.000014	T	0.62636	0.2444	L	0.43152	1.355	0.31353	N	0.682312	P;B	0.34562	0.457;0.432	B;B	0.27887	0.084;0.048	T	0.61038	-0.7143	10	0.10377	T	0.69	.	9.1292	0.36835	0.1627:0.0:0.0:0.8373	.	33;33	E9PF10;O75694	.;NU155_HUMAN	R	33	ENSP00000231498:Q33R;ENSP00000422019:Q33R	ENSP00000231498:Q33R	Q	-	2	0	NUP155	37406739	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.254000	0.58798	1.810000	0.52873	0.529000	0.55759	CAG	.	.		0.572	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
C9	735	hgsc.bcm.edu	37	5	39341729	39341729	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:39341729C>T	ENST00000263408.4	-	3	352	c.257G>A	c.(256-258)cGa>cAa	p.R86Q	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	86	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			CACACACTGTCGTCTGTCTCC	0.453																																					p.R86Q		Atlas-SNP	.											C9,right_upper_lobe,carcinoma,0,1	C9	116	.	0			c.G257A						.						118.0	109.0	112.0					5																	39341729		2203	4300	6503	SO:0001583	missense	735	exon3			CACTGTCGTCTGT		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.257G>A	chr5.hg19:g.39341729C>T	ENSP00000263408:p.Arg86Gln	146.0	0.0		173.0	26.0	NM_001737		Missense_Mutation	SNP	ENST00000263408.4	hg19	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.313980	0.23908	.	.	ENSG00000113600	ENST00000263408	T	0.49720	0.77	5.51	-1.46	0.08800	.	1.143940	0.06279	N	0.697008	T	0.25680	0.0625	N	0.11106	0.095	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.29305	-1.0016	10	0.02654	T	1	-0.6749	12.6649	0.56835	0.0:0.2587:0.0:0.7413	.	86	P02748	CO9_HUMAN	Q	86	ENSP00000263408:R86Q	ENSP00000263408:R86Q	R	-	2	0	C9	39377486	0.000000	0.05858	0.000000	0.03702	0.372000	0.29890	-0.171000	0.09883	-0.692000	0.05128	-0.291000	0.09656	CGA	.	.		0.453	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3		
C5orf28	64417	hgsc.bcm.edu	37	5	43446346	43446346	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:43446346T>A	ENST00000500337.2	-	5	957	c.626A>T	c.(625-627)cAt>cTt	p.H209L	C5orf28_ENST00000537319.1_Missense_Mutation_p.H78L|C5orf28_ENST00000397080.3_Missense_Mutation_p.H209L|C5orf28_ENST00000510130.1_Missense_Mutation_p.H107L|C5orf28_ENST00000511525.1_5'UTR|C5orf28_ENST00000512085.1_Missense_Mutation_p.H209L			Q0VDI3	CE028_HUMAN	chromosome 5 open reading frame 28	209						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(5)	9	Lung NSC(6;2.07e-05)					ACGAACTCCATGTTTTGAAGA	0.348																																					p.H209L		Atlas-SNP	.											.	C5orf28	25	.	0			c.A626T						.						102.0	100.0	100.0					5																	43446346		2203	4300	6503	SO:0001583	missense	64417	exon3			ACTCCATGTTTTG	AK025310	CCDS3945.1	5p12	2011-01-25			ENSG00000151881	ENSG00000151881			26139	protein-coding gene	gene with protein product						12477932	Standard	NM_022483		Approved	FLJ21657	uc003jny.3	Q0VDI3	OTTHUMG00000131150	ENST00000500337.2:c.626A>T	chr5.hg19:g.43446346T>A	ENSP00000426067:p.His209Leu	87.0	0.0		100.0	13.0	NM_022483	B2RDA6|Q9H6Z2	Missense_Mutation	SNP	ENST00000500337.2	hg19	CCDS3945.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463696	0.84425	.	.	ENSG00000151881	ENST00000500337;ENST00000537319;ENST00000397080;ENST00000512085;ENST00000510130	.	.	.	6.06	6.06	0.98353	.	0.174023	0.64402	D	0.000007	T	0.65238	0.2672	M	0.73962	2.25	0.58432	D	0.999998	B	0.31548	0.328	B	0.31101	0.124	T	0.67389	-0.5683	9	0.72032	D	0.01	-13.3332	16.6093	0.84858	0.0:0.0:0.0:1.0	.	209	Q0VDI3	CE028_HUMAN	L	209;78;209;209;107	.	ENSP00000380270:H209L	H	-	2	0	C5orf28	43482103	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.985000	0.70556	2.324000	0.78689	0.533000	0.62120	CAT	.	.		0.348	C5orf28-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368003.1	NM_022483	
PTCD2	79810	hgsc.bcm.edu	37	5	71618053	71618053	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:71618053A>G	ENST00000380639.5	+	2	198	c.182A>G	c.(181-183)aAg>aGg	p.K61R	MRPS27_ENST00000513900.1_5'Flank|PTCD2_ENST00000536805.1_5'UTR|PTCD2_ENST00000503868.1_Missense_Mutation_p.K61R|MRPS27_ENST00000261413.5_5'Flank|MRPS27_ENST00000515404.1_5'Flank|PTCD2_ENST00000543322.1_Missense_Mutation_p.K61R|MRPS27_ENST00000457646.4_5'Flank|MRPS27_ENST00000522095.1_5'Flank	NM_024754.3	NP_079030.3	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	61					kidney development (GO:0001822)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|muscle fiber development (GO:0048747)|regulation of mRNA processing (GO:0050684)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(1)|skin(1)	11		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TTTCAACAAAAGAAAGTGGCT	0.279																																					p.K61R		Atlas-SNP	.											.	PTCD2	31	.	0			c.A182G						.						119.0	129.0	126.0					5																	71618053		1808	4070	5878	SO:0001583	missense	79810	exon2			AACAAAAGAAAGT	BC018720	CCDS4014.2, CCDS68891.1, CCDS68892.1, CCDS75258.1	5q13.2	2008-02-05			ENSG00000049883	ENSG00000049883			25734	protein-coding gene	gene with protein product		615484				12477932	Standard	XM_005248601		Approved	FLJ12598	uc003kcb.3	Q8WV60	OTTHUMG00000100953	ENST00000380639.5:c.182A>G	chr5.hg19:g.71618053A>G	ENSP00000370013:p.Lys61Arg	99.0	0.0		107.0	11.0	NM_024754	B7Z5D0|B7Z8L7|E9PFV7|Q6IA65|Q9H9R0	Missense_Mutation	SNP	ENST00000380639.5	hg19	CCDS4014.2	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165411	0.38217	.	.	ENSG00000049883	ENST00000380639;ENST00000543322;ENST00000503868	T;T	0.48522	0.81;0.81	5.85	3.36	0.38483	.	0.413624	0.29028	N	0.013377	T	0.42810	0.1219	M	0.73598	2.24	0.80722	D	1	P;P	0.43231	0.763;0.801	B;B	0.41374	0.311;0.355	T	0.36601	-0.9741	10	0.08599	T	0.76	.	9.2507	0.37554	0.756:0.1241:0.0:0.1199	.	61;61	E9PFV7;Q8WV60	.;PTCD2_HUMAN	R	61	ENSP00000370013:K61R;ENSP00000438810:K61R	ENSP00000308948:K61R	K	+	2	0	PTCD2	71653809	0.982000	0.34865	0.999000	0.59377	0.283000	0.27025	0.839000	0.27586	2.238000	0.73509	0.533000	0.62120	AAG	.	.		0.279	PTCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218562.6	NM_024754	
CMYA5	202333	hgsc.bcm.edu	37	5	79025753	79025753	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:79025753A>G	ENST00000446378.2	+	2	1196	c.1165A>G	c.(1165-1167)Atg>Gtg	p.M389V		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	389					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACCTGCAACTATGTTCCTGAG	0.473																																					p.M389V		Atlas-SNP	.											.	CMYA5	643	.	0			c.A1165G						.						79.0	80.0	79.0					5																	79025753		2165	4279	6444	SO:0001583	missense	202333	exon2			GCAACTATGTTCC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.1165A>G	chr5.hg19:g.79025753A>G	ENSP00000394770:p.Met389Val	192.0	0.0		187.0	25.0	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	hg19	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	A	7.494	0.651254	0.14516	.	.	ENSG00000164309	ENST00000446378	T	0.35605	1.3	5.93	0.0595	0.14332	.	2.769760	0.01243	N	0.008670	T	0.21186	0.0510	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11767	-1.0574	10	0.15066	T	0.55	.	5.6339	0.17526	0.4814:0.0:0.3873:0.1313	.	389	Q8N3K9	CMYA5_HUMAN	V	389	ENSP00000394770:M389V	ENSP00000394770:M389V	M	+	1	0	CMYA5	79061509	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.537000	0.23144	0.138000	0.18790	-0.230000	0.12252	ATG	.	.		0.473	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
LIX1	167410	hgsc.bcm.edu	37	5	96478229	96478229	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:96478229G>A	ENST00000274382.4	-	1	347	c.52C>T	c.(52-54)Cac>Tac	p.H18Y	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	18										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		GGATCTCTGTGAGGCAAGACT	0.453																																					p.H18Y		Atlas-SNP	.											.	LIX1	41	.	0			c.C52T						.						178.0	150.0	159.0					5																	96478229		2203	4300	6503	SO:0001583	missense	167410	exon1			CTCTGTGAGGCAA		CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.52C>T	chr5.hg19:g.96478229G>A	ENSP00000274382:p.His18Tyr	109.0	0.0		114.0	19.0	NM_153234	A8K4R9|Q8N7I2	Missense_Mutation	SNP	ENST00000274382.4	hg19	CCDS4088.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823534	0.32237	.	.	ENSG00000145721	ENST00000274382	T	0.43294	0.95	5.86	4.99	0.66335	.	0.521381	0.24136	N	0.041209	T	0.33760	0.0874	N	0.22421	0.69	0.38721	D	0.953451	B	0.25105	0.118	B	0.25140	0.058	T	0.27773	-1.0064	10	0.87932	D	0	-12.7766	16.4499	0.83976	0.0:0.0:0.8675:0.1325	.	18	Q8N485	LIX1_HUMAN	Y	18	ENSP00000274382:H18Y	ENSP00000274382:H18Y	H	-	1	0	LIX1	96503985	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.283000	0.72646	1.611000	0.50210	-0.175000	0.13238	CAC	.	.		0.453	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250625.1	NM_153234	
PAM	5066	hgsc.bcm.edu	37	5	102326046	102326046	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:102326046T>C	ENST00000438793.3	+	15	2024	c.1554T>C	c.(1552-1554)gcT>gcC	p.A518A	PAM_ENST00000348126.2_Silent_p.A411A|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000304400.7_Silent_p.A518A|PAM_ENST00000455264.2_Silent_p.A518A|PAM_ENST00000274392.9_Silent_p.A421A|PAM_ENST00000346918.2_Silent_p.A518A	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	518	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CTGGGGTGGCTCTAGACCCTA	0.393																																					p.A518A		Atlas-SNP	.											.	PAM	180	.	0			c.T1554C						.						64.0	62.0	63.0					5																	102326046		2203	4300	6503	SO:0001819	synonymous_variant	5066	exon15			GGTGGCTCTAGAC	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.1554T>C	chr5.hg19:g.102326046T>C		131.0	0.0		152.0	17.0	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Silent	SNP	ENST00000438793.3	hg19	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336513	0.24253	.	.	ENSG00000145730	ENST00000379799	.	.	.	5.45	0.274	0.15654	.	.	.	.	.	T	0.50171	0.1600	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35176	-0.9799	4	.	.	.	-20.6332	4.6454	0.12570	0.1581:0.4453:0.0:0.3966	.	.	.	.	P	291	.	.	S	+	1	0	PAM	102353945	0.132000	0.22450	0.998000	0.56505	0.917000	0.54804	-0.534000	0.06150	0.059000	0.16252	0.454000	0.30748	TCT	.	.		0.393	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
GIN1	54826	hgsc.bcm.edu	37	5	102432263	102432263	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:102432263T>A	ENST00000399004.2	-	7	1370	c.1276A>T	c.(1276-1278)Aga>Tga	p.R426*	GIN1_ENST00000508629.1_Intron	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	426					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		CTGGATTCTCTTATGTAGGGC	0.378																																					p.R426X		Atlas-SNP	.											.	GIN1	53	.	0			c.A1276T						.						175.0	164.0	168.0					5																	102432263		1862	4095	5957	SO:0001587	stop_gained	54826	exon7			ATTCTCTTATGTA	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1276A>T	chr5.hg19:g.102432263T>A	ENSP00000381970:p.Arg426*	97.0	0.0		123.0	20.0	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Nonsense_Mutation	SNP	ENST00000399004.2	hg19	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	T	35	5.592189	0.96590	.	.	ENSG00000145723	ENST00000399004	.	.	.	5.77	4.6	0.57074	.	0.000000	0.46758	U	0.000265	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	7.6812	11.9118	0.52743	0.0:0.0:0.1453:0.8547	.	.	.	.	X	426	.	ENSP00000381970:R426X	R	-	1	2	GIN1	102460162	1.000000	0.71417	0.777000	0.31699	0.434000	0.31775	4.896000	0.63222	0.996000	0.38943	0.533000	0.62120	AGA	.	.		0.378	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
TMEM232	642987	hgsc.bcm.edu	37	5	109954157	109954157	+	Missense_Mutation	SNP	T	T	A	rs557269788	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:109954157T>A	ENST00000455884.2	-	8	925	c.875A>T	c.(874-876)cAt>cTt	p.H292L	TMEM232_ENST00000429839.2_Missense_Mutation_p.H292L|TMEM232_ENST00000515518.2_5'UTR			C9JQI7	TM232_HUMAN	transmembrane protein 232	292						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CTGTGTCTTATGGAAGACGAG	0.383																																					p.H292L		Atlas-SNP	.											.	TMEM232	57	.	0			c.A875T						.						132.0	104.0	113.0					5																	109954157		692	1591	2283	SO:0001583	missense	642987	exon8			GTCTTATGGAAGA	AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.875A>T	chr5.hg19:g.109954157T>A	ENSP00000401477:p.His292Leu	86.0	0.0		99.0	21.0	NM_001039763	B4DKF4	Missense_Mutation	SNP	ENST00000455884.2	hg19	CCDS47253.2	.	.	.	.	.	.	.	.	.	.	T	4.356	0.065548	0.08388	.	.	ENSG00000186952	ENST00000429839;ENST00000455884	.	.	.	5.97	2.29	0.28610	.	1.127080	0.06528	N	0.740824	T	0.32466	0.0830	L	0.39633	1.23	0.09310	N	1	P;P;P	0.46142	0.873;0.617;0.775	B;B;B	0.42282	0.382;0.173;0.382	T	0.19778	-1.0295	8	.	.	.	-0.0126	8.4896	0.33093	0.0:0.2169:0.0:0.7831	.	292;292;174	C9JQI7;C9JQI7-2;E9PFK0	TM232_HUMAN;.;.	L	292	.	.	H	-	2	0	TMEM232	109982056	0.889000	0.30405	0.002000	0.10522	0.629000	0.37895	1.497000	0.35649	0.166000	0.19597	0.482000	0.46254	CAT	.	.		0.383	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372488.2	NM_001039763	
APC	324	hgsc.bcm.edu	37	5	112179022	112179022	+	Silent	SNP	A	A	T	rs537187449		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:112179022A>T	ENST00000457016.1	+	16	8111	c.7731A>T	c.(7729-7731)tcA>tcT	p.S2577S	APC_ENST00000257430.4_Silent_p.S2577S|APC_ENST00000508376.2_Silent_p.S2577S|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	2577	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTCTGCTTCATCAGAATCCA	0.398		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S2577S	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	1	Unknown(1)	skin(1)	c.A7731T						.						69.0	72.0	71.0					5																	112179022		2202	4300	6502	SO:0001819	synonymous_variant	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TGCTTCATCAGAA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.7731A>T	chr5.hg19:g.112179022A>T		111.0	0.0		122.0	14.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	ENST00000457016.1	hg19	CCDS4107.1																																																																																			.	.		0.398	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
MCC	4163	hgsc.bcm.edu	37	5	112363149	112363149	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:112363149C>G	ENST00000302475.4	-	17	2903	c.2340G>C	c.(2338-2340)aaG>aaC	p.K780N	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.K717N|MCC_ENST00000408903.3_Missense_Mutation_p.K970N	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	780					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GATGCTTTTTCTTTGCTTTCT	0.453																																					p.K970N		Atlas-SNP	.											.	MCC	234	.	0			c.G2910C						.						206.0	177.0	187.0					5																	112363149		2202	4300	6502	SO:0001583	missense	4163	exon19			CTTTTTCTTTGCT		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.2340G>C	chr5.hg19:g.112363149C>G	ENSP00000305617:p.Lys780Asn	60.0	0.0		75.0	31.0	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	hg19	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782453	0.90282	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.51071	0.72;0.72;0.72	5.83	5.83	0.93111	Usher syndrome type-1C protein-binding protein 1, PDZ domain (1);	0.000000	0.56097	U	0.000032	T	0.66208	0.2766	L	0.52759	1.655	0.80722	D	1	D;D	0.67145	0.996;0.991	D;D	0.77557	0.99;0.987	T	0.65977	-0.6037	10	0.72032	D	0.01	-33.4093	20.1374	0.98035	0.0:1.0:0.0:0.0	.	970;780	P23508-2;P23508	.;CRCM_HUMAN	N	780;717;970	ENSP00000305617:K780N;ENSP00000421615:K717N;ENSP00000386227:K970N	ENSP00000305617:K780N	K	-	3	2	MCC	112391048	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.206000	0.58473	2.763000	0.94921	0.563000	0.77884	AAG	.	.		0.453	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
SNCAIP	9627	hgsc.bcm.edu	37	5	121786551	121786551	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:121786551T>G	ENST00000261368.8	+	10	2271	c.2009T>G	c.(2008-2010)cTg>cGg	p.L670R	SNCAIP_ENST00000379536.2_Missense_Mutation_p.L610R|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000261367.7_Missense_Mutation_p.L717R|SNCAIP_ENST00000379538.3_Missense_Mutation_p.L304R|SNCAIP_ENST00000504884.2_3'UTR|CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000414317.2_Missense_Mutation_p.L272R|SNCAIP_ENST00000379533.2_Missense_Mutation_p.L717R|SNCAIP_ENST00000542191.1_Missense_Mutation_p.L228R|CTC-210G5.1_ENST00000509993.1_RNA|CTC-210G5.1_ENST00000505546.1_RNA	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	670					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		CTGAGACAGCTGATGCAGAGG	0.527																																					p.L670R		Atlas-SNP	.											.	SNCAIP	308	.	0			c.T2009G						.						44.0	46.0	45.0					5																	121786551		2203	4300	6503	SO:0001583	missense	9627	exon10			GACAGCTGATGCA	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.2009T>G	chr5.hg19:g.121786551T>G	ENSP00000261368:p.Leu670Arg	88.0	0.0		121.0	10.0	NM_005460	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	hg19	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	T	19.19	3.780473	0.70222	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854	T;T;T;T;T;T;T;T	0.20598	3.9;4.45;2.14;2.06;4.45;4.35;2.06;4.11	6.06	6.06	0.98353	.	0.067299	0.64402	D	0.000012	T	0.48960	0.1529	M	0.76574	2.34	0.48288	D	0.99962	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;1.0;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.91635	0.998;0.996;0.993;0.974;0.999;0.974;0.996;0.942	T	0.50381	-0.8835	10	0.87932	D	0	-12.8429	16.6093	0.84858	0.0:0.0:0.0:1.0	.	610;298;272;610;304;304;717;670	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;SNCAP_HUMAN	R	228;610;670;717;610;304;717;272;310	ENSP00000441681:L228R;ENSP00000422106:L610R;ENSP00000261368:L670R;ENSP00000368848:L717R;ENSP00000368851:L610R;ENSP00000368854:L304R;ENSP00000261367:L717R;ENSP00000394392:L272R	ENSP00000261367:L717R	L	+	2	0	SNCAIP	121814450	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.812000	0.69194	2.324000	0.78689	0.533000	0.62120	CTG	.	.		0.527	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
ALDH7A1	501	hgsc.bcm.edu	37	5	125903957	125903957	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:125903957T>A	ENST00000409134.3	-	9	1084	c.865A>T	c.(865-867)Agg>Tgg	p.R289W	ALDH7A1_ENST00000447989.2_Missense_Mutation_p.R316W|ALDH7A1_ENST00000413020.1_5'UTR|ALDH7A1_ENST00000553117.1_Missense_Mutation_p.R289W	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	289					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		TTACCAAACCTCTCCTGCACC	0.458																																					p.R316W		Atlas-SNP	.											.	ALDH7A1	57	.	0			c.A946T						.						161.0	146.0	151.0					5																	125903957		2203	4300	6503	SO:0001583	missense	501	exon9			CAAACCTCTCCTG	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.865A>T	chr5.hg19:g.125903957T>A	ENSP00000387123:p.Arg289Trp	63.0	0.0		83.0	10.0	NM_001202404	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	ENST00000409134.3	hg19	CCDS4137.2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.977848	0.74360	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000437170	D;D;D	0.91521	-2.86;-2.86;-2.86	5.16	3.97	0.46021	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.96688	0.8919	H	0.97214	3.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96625	0.9462	10	0.87932	D	0	.	10.886	0.46968	0.0:0.0:0.1576:0.8424	.	316;316;289	E7EPT3;B4DMA0;P49419	.;.;AL7A1_HUMAN	W	289;289;316;97	ENSP00000387123:R289W;ENSP00000448593:R289W;ENSP00000414132:R316W	ENSP00000387123:R289W	R	-	1	2	ALDH7A1	125931856	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.815000	0.38981	1.050000	0.40346	0.533000	0.62120	AGG	.	.		0.458	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182	
LMNB1	4001	hgsc.bcm.edu	37	5	126141268	126141268	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:126141268A>G	ENST00000261366.5	+	3	883	c.522A>G	c.(520-522)gaA>gaG	p.E174E	LMNB1_ENST00000460265.1_3'UTR|LMNB1_ENST00000395354.1_Silent_p.E174E	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	174	Coil 1B.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		AATAGTTGGAAGCCTCCTTAG	0.328																																					p.E174E		Atlas-SNP	.											.	LMNB1	49	.	0			c.A522G						.						73.0	75.0	74.0					5																	126141268		2203	4300	6503	SO:0001819	synonymous_variant	4001	exon3			GTTGGAAGCCTCC	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.522A>G	chr5.hg19:g.126141268A>G		58.0	0.0		75.0	5.0	NM_005573	B2R6J6|Q3SYN7|Q96EI6	Silent	SNP	ENST00000261366.5	hg19	CCDS4140.1																																																																																			.	.		0.328	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
ADAMTS19	171019	hgsc.bcm.edu	37	5	129019947	129019947	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:129019947C>T	ENST00000274487.4	+	18	2926	c.2781C>T	c.(2779-2781)tgC>tgT	p.C927C	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	927	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGGAAGATTGCGATGCCACTT	0.403																																					p.C927C		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.C2781T						.						80.0	77.0	78.0					5																	129019947		2203	4300	6503	SO:0001819	synonymous_variant	171019	exon18			AGATTGCGATGCC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2781C>T	chr5.hg19:g.129019947C>T		123.0	0.0		120.0	12.0	NM_133638		Silent	SNP	ENST00000274487.4	hg19	CCDS4146.1																																																																																			.	.		0.403	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
IL5	3567	hgsc.bcm.edu	37	5	131879078	131879078	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:131879078T>A	ENST00000231454.1	-	1	136	c.93A>T	c.(91-93)aaA>aaT	p.K31N		NM_000879.2	NP_000870.1	P05113	IL5_HUMAN	interleukin 5	31					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of eosinophil differentiation (GO:0045645)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of podosome assembly (GO:0071803)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-5 receptor binding (GO:0005137)			endometrium(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Pranlukast(DB01411)	CCAAGGTCTCTTTCACCAATG	0.443																																					p.K31N		Atlas-SNP	.											.	IL5	7	.	0			c.A93T						.						183.0	163.0	170.0					5																	131879078		2203	4300	6503	SO:0001583	missense	3567	exon1			GGTCTCTTTCACC	X04688	CCDS4156.1	5q23-q31	2014-04-04	2014-04-04		ENSG00000113525	ENSG00000113525		"""Interleukins and interleukin receptors"""	6016	protein-coding gene	gene with protein product	"""interleukin-5"", ""T-cell replacing factor"", ""B cell differentiation factor I"", ""eosinophil differentiation factor"", ""colony-stimulating factor, eosinophil"""	147850	"""interleukin 5 (colony-stimulating factor, eosinophil)"""			3498940	Standard	NM_000879		Approved	IL-5, EDF, TRF	uc003kxe.1	P05113	OTTHUMG00000059496	ENST00000231454.1:c.93A>T	chr5.hg19:g.131879078T>A	ENSP00000231454:p.Lys31Asn	116.0	0.0		142.0	20.0	NM_000879	Q13840	Missense_Mutation	SNP	ENST00000231454.1	hg19	CCDS4156.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560203	0.45590	.	.	ENSG00000113525	ENST00000231454	.	.	.	5.8	4.62	0.57501	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.773340	0.11636	N	0.544332	T	0.50820	0.1638	L	0.44542	1.39	0.36384	D	0.862085	B	0.29936	0.262	B	0.32762	0.152	T	0.50600	-0.8809	9	0.34782	T	0.22	-1.5035	9.8389	0.40987	0.0:0.0:0.1726:0.8274	.	31	P05113	IL5_HUMAN	N	31	.	ENSP00000231454:K31N	K	-	3	2	IL5	131906977	0.940000	0.31905	0.986000	0.45419	0.457000	0.32468	0.936000	0.28938	0.990000	0.38787	0.533000	0.62120	AAA	.	.		0.443	IL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132339.1	NM_000879	
C5orf15	56951	hgsc.bcm.edu	37	5	133292672	133292672	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:133292672G>C	ENST00000231512.3	-	3	878	c.676C>G	c.(676-678)Ctg>Gtg	p.L226V	C5orf15_ENST00000507191.1_5'Flank	NM_020199.2	NP_064584.1	Q8NC54	KCT2_HUMAN	chromosome 5 open reading frame 15	226						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)			CTTTGAACCAGAAGAAAAATC	0.353																																					p.L226V		Atlas-SNP	.											.	C5orf15	20	.	0			c.C676G						.						84.0	83.0	83.0					5																	133292672		2203	4300	6503	SO:0001583	missense	56951	exon3			GAACCAGAAGAAA	AF226055	CCDS4167.1	5q31.1	2012-02-22			ENSG00000113583	ENSG00000113583			20656	protein-coding gene	gene with protein product	"""keratinocytes associated transmembrane protein 2"""						Standard	NM_020199		Approved	KCT2, HTGN29	uc003kyo.3	Q8NC54	OTTHUMG00000129125	ENST00000231512.3:c.676C>G	chr5.hg19:g.133292672G>C	ENSP00000231512:p.Leu226Val	188.0	0.0		230.0	36.0	NM_020199	B2RD10|D3DQ92|Q9NRG2	Missense_Mutation	SNP	ENST00000231512.3	hg19	CCDS4167.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026892	0.35797	.	.	ENSG00000113583	ENST00000231512;ENST00000451255	.	.	.	5.34	1.05	0.20165	.	0.131815	0.33572	N	0.004780	T	0.43478	0.1249	L	0.59436	1.845	0.42936	D	0.994339	P	0.44946	0.846	B	0.39531	0.302	T	0.39292	-0.9621	9	0.72032	D	0.01	-9.0093	7.4695	0.27340	0.2859:0.0:0.5965:0.1175	.	226	Q8NC54	KCT2_HUMAN	V	226;126	.	ENSP00000231512:L226V	L	-	1	2	C5orf15	133320571	0.960000	0.32886	0.997000	0.53966	0.986000	0.74619	0.923000	0.28757	0.265000	0.21872	-0.145000	0.13849	CTG	.	.		0.353	C5orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251175.1	NM_020199	
TXNDC15	79770	hgsc.bcm.edu	37	5	134210212	134210212	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:134210212G>T	ENST00000358387.4	+	1	720	c.95G>T	c.(94-96)gGc>gTc	p.G32V	TXNDC15_ENST00000546290.1_5'Flank	NM_024715.3	NP_078991.3	Q96J42	TXD15_HUMAN	thioredoxin domain containing 15	32					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCCGTCCGCGGCGTGGAGGGT	0.716																																					p.G32V		Atlas-SNP	.											.	TXNDC15	37	.	0			c.G95T						.						51.0	57.0	55.0					5																	134210212		2201	4298	6499	SO:0001583	missense	79770	exon1			TCCGCGGCGTGGA	AK026278	CCDS4180.1	5q31.1	2008-02-05	2007-08-16	2007-08-16	ENSG00000113621	ENSG00000113621			20652	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 14"""	C5orf14			Standard	NM_024715		Approved	2310047H23Rik, FLJ22625	uc003lac.1	Q96J42	OTTHUMG00000129115	ENST00000358387.4:c.95G>T	chr5.hg19:g.134210212G>T	ENSP00000351157:p.Gly32Val	86.0	0.0		80.0	24.0	NM_024715	D3DQA9|Q96MT2|Q9H639	Missense_Mutation	SNP	ENST00000358387.4	hg19	CCDS4180.1	.	.	.	.	.	.	.	.	.	.	G	8.738	0.918243	0.17982	.	.	ENSG00000113621	ENST00000441965;ENST00000358387;ENST00000506916	T	0.59083	0.29	4.7	3.82	0.43975	.	0.477014	0.19837	N	0.104956	T	0.50086	0.1595	N	0.24115	0.695	0.80722	D	1	P	0.52463	0.953	P	0.48795	0.59	T	0.54423	-0.8296	10	0.72032	D	0.01	0.2974	11.4885	0.50367	0.0:0.1824:0.8175:0.0	.	32	Q96J42	TXD15_HUMAN	V	32	ENSP00000351157:G32V	ENSP00000351157:G32V	G	+	2	0	TXNDC15	134238111	1.000000	0.71417	1.000000	0.80357	0.088000	0.18126	1.772000	0.38552	1.276000	0.44395	0.563000	0.77884	GGC	.	.		0.716	TXNDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251160.1	NM_024715	
PCDHA12	56137	hgsc.bcm.edu	37	5	140257026	140257026	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:140257026C>T	ENST00000398631.2	+	1	1969	c.1969C>T	c.(1969-1971)Ccc>Tcc	p.P657S	PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	657	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACGGTGAGCCCGCGCTGAC	0.692																																					p.P657S	Pancreas(113;759 1672 13322 24104 50104)	Atlas-SNP	.											.	PCDHA12	196	.	0			c.C1969T						.						83.0	84.0	84.0					5																	140257026		2203	4299	6502	SO:0001583	missense	56137	exon1			GGTGAGCCCGCGC	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1969C>T	chr5.hg19:g.140257026C>T	ENSP00000381628:p.Pro657Ser	158.0	0.0		194.0	14.0	NM_018903	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	hg19	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352664	0.41700	.	.	ENSG00000251664	ENST00000398631	T	0.56776	0.44	4.81	3.94	0.45596	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.79879	0.4522	H	0.95470	3.675	0.37860	D	0.929683	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.87319	0.2317	9	0.72032	D	0.01	.	14.1944	0.65659	0.1509:0.8491:0.0:0.0	.	657;657	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	S	657	ENSP00000381628:P657S	ENSP00000381628:P657S	P	+	1	0	PCDHA12	140237210	0.001000	0.12720	0.949000	0.38748	0.013000	0.08279	1.250000	0.32850	1.027000	0.39758	-0.226000	0.12346	CCC	.	.		0.692	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PCDHB16	57717	hgsc.bcm.edu	37	5	140562781	140562781	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:140562781A>T	ENST00000361016.2	+	1	1802	c.647A>T	c.(646-648)gAt>gTt	p.D216V		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	216	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAGCGCTGGATGGTGGCTCT	0.507																																					p.D216V		Atlas-SNP	.											.	PCDHB16	159	.	0			c.A647T						.						65.0	65.0	65.0					5																	140562781		2203	4300	6503	SO:0001583	missense	57717	exon1			CGCTGGATGGTGG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.647A>T	chr5.hg19:g.140562781A>T	ENSP00000354293:p.Asp216Val	68.0	0.0		68.0	9.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	A	16.76	3.211812	0.58452	.	.	ENSG00000196963	ENST00000361016	T	0.68624	-0.34	4.69	4.69	0.59074	Cadherin (4);Cadherin-like (1);	0.000000	0.35555	N	0.003123	D	0.89829	0.6828	H	0.99764	4.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94000	0.7274	10	0.87932	D	0	.	14.1404	0.65316	1.0:0.0:0.0:0.0	.	216	Q9NRJ7	PCDBG_HUMAN	V	216	ENSP00000354293:D216V	ENSP00000354293:D216V	D	+	2	0	PCDHB16	140542965	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	7.433000	0.80362	1.737000	0.51674	0.533000	0.62120	GAT	.	.		0.507	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB12	56124	hgsc.bcm.edu	37	5	140589743	140589743	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:140589743A>G	ENST00000239450.2	+	1	1453	c.1264A>G	c.(1264-1266)Acc>Gcc	p.T422A	PCDHB12_ENST00000541609.1_Missense_Mutation_p.T85A	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	422	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATCACCATCACCGTCACCGA	0.517																																					p.T422A		Atlas-SNP	.											.	PCDHB12	179	.	0			c.A1264G						.						98.0	95.0	96.0					5																	140589743		2203	4300	6503	SO:0001583	missense	56124	exon1			ACCATCACCGTCA	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1264A>G	chr5.hg19:g.140589743A>G	ENSP00000239450:p.Thr422Ala	131.0	0.0		144.0	28.0	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	hg19	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.507041	0.27036	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.03181	4.02;4.02	3.83	2.6	0.31112	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.16981	0.0408	M	0.94101	3.495	0.09310	N	1	P	0.49559	0.925	P	0.56648	0.803	T	0.08106	-1.0738	9	0.66056	D	0.02	.	5.5298	0.16978	0.5311:0.3052:0.0:0.1637	.	422	Q9Y5F1	PCDBC_HUMAN	A	85;422;42	ENSP00000440199:T85A;ENSP00000239450:T422A	ENSP00000239450:T422A	T	+	1	0	PCDHB12	140569927	0.000000	0.05858	0.846000	0.33378	0.369000	0.29798	0.660000	0.25009	0.427000	0.26145	0.397000	0.26171	ACC	.	.		0.517	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
SYNPO	11346	hgsc.bcm.edu	37	5	149997966	149997966	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:149997966C>G	ENST00000394243.1	+	2	411	c.37C>G	c.(37-39)Ccc>Gcc	p.P13A	SYNPO_ENST00000522122.1_Missense_Mutation_p.P13A	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	13					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCCCTTGCACCCAGCGAAGG	0.667																																					p.P13A		Atlas-SNP	.											.	SYNPO	147	.	0			c.C37G						.						21.0	27.0	25.0					5																	149997966		692	1591	2283	SO:0001583	missense	11346	exon2			CTTGCACCCAGCG	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.37C>G	chr5.hg19:g.149997966C>G	ENSP00000377789:p.Pro13Ala	189.0	0.0		178.0	30.0	NM_001166209	A5PKZ8|D3DQG8|O15271|Q9UPX1	Missense_Mutation	SNP	ENST00000394243.1	hg19	CCDS54937.1	.	.	.	.	.	.	.	.	.	.	C	2.838	-0.241060	0.05906	.	.	ENSG00000171992	ENST00000394243;ENST00000522122	T;T	0.25250	1.81;1.81	4.91	1.95	0.26073	.	0.666403	0.12477	N	0.465511	T	0.11580	0.0282	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.25117	-1.0141	10	0.02654	T	1	-2.8157	13.0666	0.59036	0.0:0.5346:0.4654:0.0	.	13	Q8N3V7	SYNPO_HUMAN	A	13	ENSP00000377789:P13A;ENSP00000428378:P13A	ENSP00000377789:P13A	P	+	1	0	SYNPO	149978159	0.064000	0.20934	0.007000	0.13788	0.497000	0.33675	0.034000	0.13776	0.439000	0.26476	-0.304000	0.09214	CCC	.	.		0.667	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286	
SYNPO	11346	hgsc.bcm.edu	37	5	149997969	149997969	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:149997969A>T	ENST00000394243.1	+	2	414	c.40A>T	c.(40-42)Agc>Tgc	p.S14C	SYNPO_ENST00000522122.1_Missense_Mutation_p.S14C	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	14					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTTGCACCCAGCGAAGGGAG	0.667																																					p.S14C		Atlas-SNP	.											.	SYNPO	147	.	0			c.A40T						.						21.0	26.0	24.0					5																	149997969		692	1591	2283	SO:0001583	missense	11346	exon2			GCACCCAGCGAAG	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.40A>T	chr5.hg19:g.149997969A>T	ENSP00000377789:p.Ser14Cys	193.0	0.0		183.0	30.0	NM_001166209	A5PKZ8|D3DQG8|O15271|Q9UPX1	Missense_Mutation	SNP	ENST00000394243.1	hg19	CCDS54937.1	.	.	.	.	.	.	.	.	.	.	A	12.87	2.067358	0.36470	.	.	ENSG00000171992	ENST00000394243;ENST00000522122	T;T	0.33216	1.42;1.42	5.12	1.38	0.22167	.	0.912783	0.09141	N	0.842883	T	0.23572	0.0570	L	0.44542	1.39	0.09310	N	0.999999	B	0.22683	0.073	B	0.19148	0.024	T	0.33214	-0.9877	10	0.87932	D	0	-0.134	3.2873	0.06936	0.6409:0.0:0.1883:0.1708	.	14	Q8N3V7	SYNPO_HUMAN	C	14	ENSP00000377789:S14C;ENSP00000428378:S14C	ENSP00000377789:S14C	S	+	1	0	SYNPO	149978162	0.057000	0.20700	0.001000	0.08648	0.659000	0.38960	0.957000	0.29215	-0.001000	0.14495	0.459000	0.35465	AGC	.	.		0.667	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286	
FAT2	2196	hgsc.bcm.edu	37	5	150925156	150925156	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:150925156G>T	ENST00000261800.5	-	9	5544	c.5532C>A	c.(5530-5532)gaC>gaA	p.D1844E		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1844	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCTTCCTTGGTCATGGACAT	0.433																																					p.D1844E		Atlas-SNP	.											.	FAT2	465	.	0			c.C5532A						.						73.0	79.0	77.0					5																	150925156		2203	4300	6503	SO:0001583	missense	2196	exon9			TCCTTGGTCATGG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.5532C>A	chr5.hg19:g.150925156G>T	ENSP00000261800:p.Asp1844Glu	189.0	0.0		173.0	53.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901133	0.52227	.	.	ENSG00000086570	ENST00000261800	T	0.67865	-0.29	5.25	2.5	0.30297	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000010	D	0.85261	0.5656	H	0.97131	3.945	0.48341	D	0.999632	D	0.89917	1.0	D	0.87578	0.998	D	0.85276	0.1059	10	0.87932	D	0	.	8.2442	0.31677	0.3022:0.0:0.6978:0.0	.	1844	Q9NYQ8	FAT2_HUMAN	E	1844	ENSP00000261800:D1844E	ENSP00000261800:D1844E	D	-	3	2	FAT2	150905349	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.390000	0.44416	0.607000	0.29982	0.467000	0.42956	GAC	.	.		0.433	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
CPEB4	80315	hgsc.bcm.edu	37	5	173372134	173372134	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:173372134A>G	ENST00000265085.5	+	5	2901	c.1447A>G	c.(1447-1449)Att>Gtt	p.I483V	CPEB4_ENST00000517880.1_Missense_Mutation_p.I76V|CPEB4_ENST00000334035.5_Missense_Mutation_p.I466V|CPEB4_ENST00000519467.1_3'UTR|CPEB4_ENST00000522336.1_Missense_Mutation_p.I93V|CPEB4_ENST00000520867.1_Missense_Mutation_p.I458V|CPEB4_ENST00000519835.1_Missense_Mutation_p.I458V	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	483	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCCTCCAGACATTGATGAAGG	0.458																																					p.I483V		Atlas-SNP	.											.	CPEB4	54	.	0			c.A1447G						.						124.0	114.0	117.0					5																	173372134		2203	4300	6503	SO:0001583	missense	80315	exon5			CCAGACATTGATG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1447A>G	chr5.hg19:g.173372134A>G	ENSP00000265085:p.Ile483Val	140.0	0.0		136.0	22.0	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	hg19	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.076398	0.76415	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835;ENST00000522336;ENST00000517880	T;T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47;2.47	5.37	5.37	0.77165	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	N	0.20401	0.57	0.58432	D	0.999995	B;B;B;B;B	0.30851	0.297;0.159;0.048;0.082;0.297	P;P;P;P;P	0.57548	0.7;0.475;0.61;0.482;0.823	T	0.35599	-0.9782	10	0.44086	T	0.13	-11.2425	15.6695	0.77262	1.0:0.0:0.0:0.0	.	458;466;458;93;483	B7ZLQ8;Q17RY0-2;E5RJM0;E5RFP2;Q17RY0	.;.;.;.;CPEB4_HUMAN	V	483;458;466;458;93;76	ENSP00000265085:I483V;ENSP00000429092:I458V;ENSP00000334533:I466V;ENSP00000429048:I458V;ENSP00000430345:I93V;ENSP00000427990:I76V	ENSP00000265085:I483V	I	+	1	0	CPEB4	173304740	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.213000	0.95133	2.178000	0.69098	0.533000	0.62120	ATT	.	.		0.458	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
TRIM7	81786	hgsc.bcm.edu	37	5	180626894	180626894	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr5:180626894T>A	ENST00000274773.7	-	3	867	c.806A>T	c.(805-807)cAg>cTg	p.Q269L	CTC-338M12.6_ENST00000502812.2_RNA|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000422067.2_Missense_Mutation_p.Q61L|TRIM7_ENST00000393319.3_Missense_Mutation_p.Q87L|CTC-338M12.6_ENST00000419707.2_RNA|TRIM7_ENST00000393315.1_Missense_Mutation_p.Q61L|CTC-338M12.6_ENST00000514784.1_RNA|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000504241.1_5'Flank|TRIM7_ENST00000361809.3_Missense_Mutation_p.Q61L|CTC-338M12.6_ENST00000511517.1_RNA	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	269						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		CTCCTGGATCTGGCTGCTGAG	0.582																																					p.Q269L	Esophageal Squamous(128;2258 2308 35507 48647)	Atlas-SNP	.											.	TRIM7	56	.	0			c.A806T						.						63.0	54.0	57.0					5																	180626894		2203	4300	6503	SO:0001583	missense	81786	exon3			TGGATCTGGCTGC	AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.806A>T	chr5.hg19:g.180626894T>A	ENSP00000274773:p.Gln269Leu	73.0	0.0		80.0	8.0	NM_203293	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Missense_Mutation	SNP	ENST00000274773.7	hg19	CCDS4462.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.064513	0.55432	.	.	ENSG00000146054	ENST00000274773;ENST00000393315;ENST00000361809;ENST00000393319;ENST00000422067	T;T;T;T;T	0.04758	3.56;3.56;3.56;3.56;3.56	5.34	5.34	0.76211	.	0.108661	0.40064	N	0.001193	T	0.05960	0.0155	L	0.50333	1.59	0.31710	N	0.639627	B;P	0.37276	0.003;0.589	B;B	0.32677	0.002;0.15	T	0.05649	-1.0872	10	0.52906	T	0.07	.	11.7196	0.51675	0.0:0.0:0.0:1.0	.	269;87	Q9C029;Q9C029-4	TRIM7_HUMAN;.	L	269;61;61;87;61	ENSP00000274773:Q269L;ENSP00000376991:Q61L;ENSP00000355059:Q61L;ENSP00000376994:Q87L;ENSP00000391458:Q61L	ENSP00000274773:Q269L	Q	-	2	0	TRIM7	180559500	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.317000	0.51968	2.018000	0.59344	0.379000	0.24179	CAG	.	.		0.582	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253569.3	NM_203296	
SSR1	6745	hgsc.bcm.edu	37	6	7301679	7301679	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:7301679T>G	ENST00000244763.4	-	4	493	c.407A>C	c.(406-408)aAt>aCt	p.N136T	SSR1_ENST00000479365.1_Missense_Mutation_p.N136T|SSR1_ENST00000488834.1_5'UTR|SSR1_ENST00000534851.1_Missense_Mutation_p.N109T|SSR1_ENST00000474597.1_Missense_Mutation_p.N136T|RP11-69L16.4_ENST00000379928.4_RNA|SSR1_ENST00000397511.2_Missense_Mutation_p.N136T|SSR1_ENST00000489567.1_Intron|SSR1_ENST00000462112.1_Missense_Mutation_p.N136T	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	136					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					AGCTGTGAAATTCTGGATATA	0.453																																					p.N136T		Atlas-SNP	.											.	SSR1	21	.	0			c.A407C						.						95.0	101.0	99.0					6																	7301679		2203	4300	6503	SO:0001583	missense	6745	exon4			GTGAAATTCTGGA		CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.407A>C	chr6.hg19:g.7301679T>G	ENSP00000244763:p.Asn136Thr	130.0	0.0		177.0	23.0	NM_003144	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Missense_Mutation	SNP	ENST00000244763.4	hg19	CCDS4499.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.939404	0.92526	.	.	ENSG00000124783	ENST00000474597;ENST00000244763;ENST00000397511;ENST00000534851;ENST00000479365;ENST00000462112	T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73575	0.3604	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.80313	-0.1435	10	0.87932	D	0	.	15.5577	0.76213	0.0:0.0:0.0:1.0	.	136;136	C9J5W0;P43307	.;SSRA_HUMAN	T	136;136;136;109;136;136	ENSP00000418617:N136T;ENSP00000244763:N136T;ENSP00000380647:N136T;ENSP00000443020:N109T;ENSP00000417911:N136T;ENSP00000417290:N136T	ENSP00000244763:N136T	N	-	2	0	SSR1	7246678	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.859000	0.86982	2.263000	0.75096	0.533000	0.62120	AAT	.	.		0.453	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039775.2		
NKAPL	222698	hgsc.bcm.edu	37	6	28227649	28227649	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:28227649G>T	ENST00000343684.3	+	1	552	c.500G>T	c.(499-501)aGt>aTt	p.S167I	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	167										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						AAAAGCAGCAGTTCAGATTCC	0.428																																					p.S167I		Atlas-SNP	.											.	NKAPL	72	.	0			c.G500T						.						57.0	65.0	62.0					6																	28227649		2203	4300	6503	SO:0001583	missense	222698	exon1			GCAGCAGTTCAGA	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.500G>T	chr6.hg19:g.28227649G>T	ENSP00000345716:p.Ser167Ile	129.0	0.0		142.0	18.0	NM_001007531	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	hg19	CCDS34353.1	.	.	.	.	.	.	.	.	.	.	G	4.091	0.014799	0.07959	.	.	ENSG00000189134	ENST00000343684	T	0.14391	2.51	4.5	0.348	0.16026	.	0.423784	0.30277	N	0.009997	T	0.02610	0.0079	L	0.34521	1.04	0.19300	N	0.999972	B	0.06786	0.001	B	0.11329	0.006	T	0.38824	-0.9643	10	0.49607	T	0.09	-0.1449	3.076	0.06247	0.0968:0.3346:0.3966:0.1719	.	167	Q5M9Q1	NKAPL_HUMAN	I	167	ENSP00000345716:S167I	ENSP00000345716:S167I	S	+	2	0	NKAPL	28335628	0.905000	0.30787	0.001000	0.08648	0.003000	0.03518	0.921000	0.28718	0.242000	0.21303	0.655000	0.94253	AGT	.	.		0.428	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1		
OR2J2	26707	hgsc.bcm.edu	37	6	29141609	29141609	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:29141609A>C	ENST00000377167.2	+	1	299	c.197A>C	c.(196-198)aAc>aCc	p.N66T		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						TTCCTTTCAAACCTCTCATTT	0.488																																					p.N66T		Atlas-SNP	.											.	OR2J2	51	.	0			c.A197C						.						155.0	146.0	149.0					6																	29141609		2026	4226	6252	SO:0001583	missense	26707	exon1			TTTCAAACCTCTC		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.197A>C	chr6.hg19:g.29141609A>C	ENSP00000366372:p.Asn66Thr	101.0	0.0		144.0	22.0	NM_030905	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	hg19	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.266755	0.40095	.	.	ENSG00000204700	ENST00000377167	T	0.12984	2.63	2.3	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17408	0.0418	M	0.88775	2.98	0.39205	D	0.963211	P	0.46142	0.873	P	0.48627	0.584	T	0.03829	-1.1000	9	0.87932	D	0	.	9.0762	0.36522	1.0:0.0:0.0:0.0	.	66	O76002	OR2J2_HUMAN	T	66	ENSP00000366372:N66T	ENSP00000366372:N66T	N	+	2	0	OR2J2	29249588	0.009000	0.17119	1.000000	0.80357	0.383000	0.30230	2.263000	0.43293	1.039000	0.40074	0.172000	0.16884	AAC	.	.		0.488	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2		
PPP1R10	5514	hgsc.bcm.edu	37	6	30570416	30570416	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:30570416T>A	ENST00000376511.2	-	19	2562	c.2010A>T	c.(2008-2010)ccA>ccT	p.P670P		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	670	Gly-rich.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						GGGGAGGGGGTGGAGGACCCA	0.652																																					p.P670P		Atlas-SNP	.											.	PPP1R10	60	.	0			c.A2010T						.						10.0	14.0	13.0					6																	30570416		1455	2617	4072	SO:0001819	synonymous_variant	5514	exon19			AGGGGGTGGAGGA	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.2010A>T	chr6.hg19:g.30570416T>A		35.0	0.0		46.0	8.0	NM_002714	O00405	Silent	SNP	ENST00000376511.2	hg19	CCDS4681.1																																																																																			.	.		0.652	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714	
COL11A2	1302	hgsc.bcm.edu	37	6	33144072	33144072	+	Silent	SNP	G	G	A	rs138650682		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:33144072G>A	ENST00000374708.4	-	26	2178	c.1920C>T	c.(1918-1920)gaC>gaT	p.D640D	COL11A2_ENST00000361917.1_Silent_p.D619D|COL11A2_ENST00000357486.1_Silent_p.D705D|COL11A2_ENST00000374714.1_Silent_p.D700D|COL11A2_ENST00000341947.2_Silent_p.D726D|COL11A2_ENST00000374712.1_Silent_p.D645D|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374713.1_Silent_p.D679D|COL11A2_ENST00000395197.1_Silent_p.D666D	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	726	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.D726D(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CCCGAATTCCGTCCACACCCT	0.552																																					p.D726D	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											COL11A2,NS,carcinoma,0,1	COL11A2	124	.	1	Substitution - coding silent(1)	prostate(1)	c.C2178T						.	G	,,	0,3022		0,0,1511	63.0	39.0	47.0		1857,2178,1920	-0.1	1.0	6	dbSNP_134	47	1,5417		0,1,2708	no	coding-synonymous,coding-synonymous,coding-synonymous	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	,,	0,1,4219	AA,AG,GG		0.0185,0.0,0.0118	,,	619/1630,726/1737,640/1651	33144072	1,8439	1511	2709	4220	SO:0001819	synonymous_variant	1302	exon28			AATTCCGTCCACA	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1920C>T	chr6.hg19:g.33144072G>A		112.0	0.0		153.0	17.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	hg19	CCDS43452.1																																																																																			.	G|1.000;A|0.000		0.552	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
ANKS1A	23294	hgsc.bcm.edu	37	6	35051203	35051203	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:35051203G>C	ENST00000360359.3	+	20	3055	c.2917G>C	c.(2917-2919)Gag>Cag	p.E973Q	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	973	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GAAATCTACGGAGCACATGAA	0.527																																					p.E973Q		Atlas-SNP	.											.	ANKS1A	123	.	0			c.G2917C						.						195.0	162.0	173.0					6																	35051203		2203	4300	6503	SO:0001583	missense	23294	exon20			TCTACGGAGCACA	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2917G>C	chr6.hg19:g.35051203G>C	ENSP00000353518:p.Glu973Gln	96.0	0.0		128.0	15.0	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	hg19	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599708	0.87055	.	.	ENSG00000064999	ENST00000360359;ENST00000373990	T	0.13778	2.56	4.76	4.76	0.60689	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.46758	D	0.000277	T	0.24851	0.0603	L	0.51914	1.62	0.80722	D	1	D;P;D	0.89917	0.996;0.87;1.0	D;P;D	0.87578	0.983;0.81;0.998	T	0.02683	-1.1124	10	0.72032	D	0.01	-22.0481	17.7722	0.88496	0.0:0.0:1.0:0.0	.	299;299;973	Q49AR9;E7EM84;Q92625	.;.;ANS1A_HUMAN	Q	973;299	ENSP00000353518:E973Q	ENSP00000353518:E973Q	E	+	1	0	ANKS1A	35159181	1.000000	0.71417	0.981000	0.43875	0.799000	0.45148	9.842000	0.99487	2.194000	0.70268	0.655000	0.94253	GAG	.	.		0.527	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
CUL9	23113	hgsc.bcm.edu	37	6	43160940	43160940	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:43160940G>A	ENST00000252050.4	+	9	2466	c.2382G>A	c.(2380-2382)ggG>ggA	p.G794G	CUL9_ENST00000372647.2_Silent_p.G794G|CUL9_ENST00000354495.3_Silent_p.G684G	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	794					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AGCAGGCTGGGCTGGCGGTGA	0.567																																					p.G794G		Atlas-SNP	.											.	CUL9	248	.	0			c.G2382A						.						89.0	89.0	89.0					6																	43160940		2202	4299	6501	SO:0001819	synonymous_variant	23113	exon9			GGCTGGGCTGGCG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2382G>A	chr6.hg19:g.43160940G>A		67.0	0.0		85.0	33.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	hg19	CCDS4890.1																																																																																			.	.		0.567	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
CUL9	23113	hgsc.bcm.edu	37	6	43182826	43182827	+	Missense_Mutation	DNP	GC	GC	TT	rs146106470		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:43182826_43182827GC>TT	ENST00000252050.4	+	30	5782_5783	c.5698_5699GC>TT	c.(5698-5700)GCc>TTc	p.A1900F	CUL9_ENST00000372647.2_Missense_Mutation_p.A1872F|CUL9_ENST00000354495.3_Missense_Mutation_p.A1790F|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1900					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GGTGCTGGAGGCCTGGCAGAAG	0.559																																					p.A1900S|p.A1900V		Atlas-SNP	.											.	CUL9	248	.	0			c.G5698T|c.C5699T						.																																			SO:0001583	missense	23113	exon30			CTGGAGGCCTGGC|TGGAGGCCTGGCA	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	Exception_encountered	chr6.hg19:g.43182826_43182827delinsTT	ENSP00000252050:p.Ala1900Phe	76.0|78.0	0.0		84.0|83.0	4.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	hg19	CCDS4890.1																																																																																			.	.|C|1.000;T|0.000		0.559	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
SLC22A7	10864	hgsc.bcm.edu	37	6	43269998	43269998	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:43269998C>T	ENST00000372585.5	+	8	1217	c.1122C>T	c.(1120-1122)aaC>aaT	p.N374N	SLC22A7_ENST00000372589.3_Silent_p.N372N|SLC22A7_ENST00000372574.3_Silent_p.N372N	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	374					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	TGGGGCTGAACGTGTACCAGA	0.602																																					p.N374N		Atlas-SNP	.											.	SLC22A7	69	.	0			c.C1122T						.						121.0	105.0	110.0					6																	43269998		2203	4300	6503	SO:0001819	synonymous_variant	10864	exon7			GCTGAACGTGTAC	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1122C>T	chr6.hg19:g.43269998C>T		106.0	0.0		149.0	19.0	NM_153320	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Silent	SNP	ENST00000372585.5	hg19	CCDS4893.2																																																																																			.	.		0.602	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
DST	667	hgsc.bcm.edu	37	6	56380255	56380255	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:56380255T>C	ENST00000361203.3	-	67	17616	c.17609A>G	c.(17608-17610)gAa>gGa	p.E5870G	DST_ENST00000370769.4_Missense_Mutation_p.E5981G|DST_ENST00000421834.2_Missense_Mutation_p.E3893G|DST_ENST00000370754.5_Missense_Mutation_p.E6159G|DST_ENST00000370788.2_Missense_Mutation_p.E3784G|DST_ENST00000244364.6_Missense_Mutation_p.E3567G|DST_ENST00000340834.4_5'UTR|DST_ENST00000446842.2_Missense_Mutation_p.E5655G|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5870					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TACCCGATGTTCTTCCTGCTG	0.408																																					p.E3567G		Atlas-SNP	.											.	DST	1427	.	0			c.A10700G						.						99.0	95.0	97.0					6																	56380255		1885	4133	6018	SO:0001583	missense	667	exon53			CGATGTTCTTCCT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17609A>G	chr6.hg19:g.56380255T>C	ENSP00000354508:p.Glu5870Gly	57.0	0.0		69.0	9.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	T	19.89	3.910763	0.72983	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.8	5.8	0.92144	.	0.000000	0.52532	D	0.000065	T	0.54983	0.1892	L	0.50333	1.59	0.33373	D	0.573864	P;D;D;P;P	0.76494	0.931;0.999;0.998;0.939;0.935	P;D;D;P;P	0.73380	0.761;0.98;0.949;0.739;0.811	T	0.57659	-0.7773	9	0.49607	T	0.09	.	16.1508	0.81622	0.0:0.0:0.0:1.0	.	3893;5981;6159;5979;3567	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	G	3567;6159;5981;3893;5655;3784;5870	ENSP00000244364:E3567G;ENSP00000359790:E6159G;ENSP00000359805:E5981G;ENSP00000400883:E3893G;ENSP00000393645:E5655G;ENSP00000359824:E3784G;ENSP00000354508:E5870G	ENSP00000244364:E3567G	E	-	2	0	DST	56488214	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	8.040000	0.89188	2.207000	0.71202	0.528000	0.53228	GAA	.	.		0.408	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DST	667	hgsc.bcm.edu	37	6	56380272	56380272	+	Silent	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:56380272T>G	ENST00000361203.3	-	67	17599	c.17592A>C	c.(17590-17592)ctA>ctC	p.L5864L	DST_ENST00000370769.4_Silent_p.L5975L|DST_ENST00000421834.2_Silent_p.L3887L|DST_ENST00000370754.5_Silent_p.L6153L|DST_ENST00000370788.2_Silent_p.L3778L|DST_ENST00000244364.6_Silent_p.L3561L|DST_ENST00000340834.4_5'UTR|DST_ENST00000446842.2_Silent_p.L5649L|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5864					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTGCTGCCTTAGAGTTTCAT	0.418																																					p.L3561L		Atlas-SNP	.											.	DST	1427	.	0			c.A10683C						.						109.0	105.0	107.0					6																	56380272		1883	4139	6022	SO:0001819	synonymous_variant	667	exon53			CTGCCTTAGAGTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17592A>C	chr6.hg19:g.56380272T>G		72.0	0.0		83.0	9.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	hg19																																																																																				.	.		0.418	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
EYS	346007	hgsc.bcm.edu	37	6	65300985	65300985	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:65300985A>T	ENST00000370621.3	-	26	5301	c.4775T>A	c.(4774-4776)aTa>aAa	p.I1592K	EYS_ENST00000370616.2_Missense_Mutation_p.I1592K|EYS_ENST00000503581.1_Missense_Mutation_p.I1592K			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1592					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GCTGGCTAATATCGCTGAGTT	0.398																																					p.I1592K		Atlas-SNP	.											.	EYS	527	.	0			c.T4775A						.						25.0	22.0	23.0					6																	65300985		692	1590	2282	SO:0001583	missense	346007	exon26			GCTAATATCGCTG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4775T>A	chr6.hg19:g.65300985A>T	ENSP00000359655:p.Ile1592Lys	75.0	0.0		66.0	14.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	A	14.18	2.458146	0.43634	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84589	-1.87;-1.85;-1.85	5.84	3.41	0.39046	.	.	.	.	.	T	0.61060	0.2317	N	0.08118	0	0.80722	D	1	P;P	0.49358	0.923;0.875	P;B	0.46110	0.504;0.307	T	0.66767	-0.5840	9	0.87932	D	0	.	7.18	0.25768	0.7787:0.1469:0.0744:0.0	.	1592;1592	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	K	1592	ENSP00000424243:I1592K;ENSP00000359655:I1592K;ENSP00000359650:I1592K	ENSP00000359650:I1592K	I	-	2	0	EYS	65357706	1.000000	0.71417	0.945000	0.38365	0.998000	0.95712	4.186000	0.58337	0.460000	0.27045	0.482000	0.46254	ATA	.	.		0.398	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
OOEP	441161	hgsc.bcm.edu	37	6	74079023	74079023	+	Silent	SNP	G	G	A	rs372105159	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:74079023G>A	ENST00000370359.5	-	2	275	c.276C>T	c.(274-276)gtC>gtT	p.V92V	OOEP_ENST00000370363.1_Silent_p.V37V|OOEP-AS1_ENST00000445350.2_RNA	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	92	KH; atypical.		V -> A (in dbSNP:rs496530). {ECO:0000269|Ref.1}.		cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)			large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						CGGTGATTTCGACTAGGTTCC	0.557													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19368	0.0		0.0	False		,,,				2504	0.0				p.V92V		Atlas-SNP	.											.	OOEP	18	.	0			c.C276T						.	G		2,3928		0,2,1963	50.0	49.0	49.0		276	-7.4	0.0	6		49	0,8278		0,0,4139	no	coding-synonymous	OOEP	NM_001080507.2		0,2,6102	AA,AG,GG		0.0,0.0509,0.0164		92/150	74079023	2,12206	1965	4139	6104	SO:0001819	synonymous_variant	441161	exon2			GATTTCGACTAGG	BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.276C>T	chr6.hg19:g.74079023G>A		130.0	0.0		133.0	65.0	NM_001080507	A6NIN5|A9UIB7	Silent	SNP	ENST00000370359.5	hg19	CCDS47451.1																																																																																			.	.		0.557	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108414.2	NM_001080507	
COL12A1	1303	hgsc.bcm.edu	37	6	75875410	75875410	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:75875410A>G	ENST00000322507.8	-	14	3105	c.2796T>C	c.(2794-2796)gtT>gtC	p.V932V	COL12A1_ENST00000483888.2_Silent_p.V932V|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Silent_p.V932V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	932	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGTAACCGCGAACCATTCCTG	0.403																																					p.V932V		Atlas-SNP	.											.	COL12A1	385	.	0			c.T2796C						.						121.0	113.0	115.0					6																	75875410		1878	4108	5986	SO:0001819	synonymous_variant	1303	exon14			ACCGCGAACCATT	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2796T>C	chr6.hg19:g.75875410A>G		145.0	0.0		103.0	18.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.403	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
PNISR	25957	hgsc.bcm.edu	37	6	99851737	99851737	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:99851737T>A	ENST00000369239.5	-	10	1328	c.1124A>T	c.(1123-1125)cAg>cTg	p.Q375L	PNISR_ENST00000438806.1_Missense_Mutation_p.Q375L	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	375						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TGCACTGGACTGTGCCAGCTG	0.438																																					p.Q375L		Atlas-SNP	.											.	PNISR	74	.	0			c.A1124T						.						82.0	70.0	74.0					6																	99851737		2203	4300	6503	SO:0001583	missense	25957	exon9			CTGGACTGTGCCA	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1124A>T	chr6.hg19:g.99851737T>A	ENSP00000358242:p.Gln375Leu	210.0	0.0		178.0	46.0	NM_015491	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	hg19	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.342148	0.61073	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.7	5.7	0.88788	.	0.104260	0.64402	D	0.000002	T	0.67998	0.2953	L	0.59436	1.845	0.80722	D	1	D	0.61080	0.989	D	0.72625	0.978	T	0.64537	-0.6384	9	0.24483	T	0.36	.	16.2651	0.82574	0.0:0.0:0.0:1.0	.	375	Q8TF01	PNISR_HUMAN	L	375	.	ENSP00000358242:Q375L	Q	-	2	0	PNISR	99958458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.556000	0.82233	2.304000	0.77564	0.523000	0.50628	CAG	.	.		0.438	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
PNISR	25957	hgsc.bcm.edu	37	6	99854007	99854007	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:99854007T>C	ENST00000369239.5	-	8	1106	c.902A>G	c.(901-903)gAg>gGg	p.E301G	PNISR_ENST00000438806.1_Missense_Mutation_p.E301G	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	301						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						ACTTGCAGCCTCAACATTTTC	0.393																																					p.E301G		Atlas-SNP	.											.	PNISR	74	.	0			c.A902G						.						207.0	185.0	193.0					6																	99854007		2203	4300	6503	SO:0001583	missense	25957	exon7			GCAGCCTCAACAT	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.902A>G	chr6.hg19:g.99854007T>C	ENSP00000358242:p.Glu301Gly	104.0	0.0		79.0	22.0	NM_015491	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	hg19	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849913	0.91277	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.54071	0.59;0.59	5.57	5.57	0.84162	.	0.046027	0.85682	D	0.000000	T	0.53658	0.1810	L	0.51422	1.61	0.80722	D	1	D	0.63046	0.992	P	0.57620	0.824	T	0.54655	-0.8261	10	0.45353	T	0.12	.	16.0108	0.80402	0.0:0.0:0.0:1.0	.	301	Q8TF01	PNISR_HUMAN	G	301	ENSP00000358242:E301G;ENSP00000387997:E301G	ENSP00000358242:E301G	E	-	2	0	PNISR	99960728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.302000	0.72788	2.242000	0.73789	0.482000	0.46254	GAG	.	.		0.393	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
MAN1A1	4121	hgsc.bcm.edu	37	6	119669665	119669665	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:119669665T>A	ENST00000368468.3	-	2	1007	c.566A>T	c.(565-567)gAc>gTc	p.D189V	MAN1A1_ENST00000368466.2_Missense_Mutation_p.D189V	NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	189					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		GATGGCGGCGTCGGCGGGCTC	0.662																																					p.D189V	Ovarian(136;8 1825 12608 33541 47587)	Atlas-SNP	.											.	MAN1A1	77	.	0			c.A566T						.						22.0	29.0	26.0					6																	119669665		2194	4289	6483	SO:0001583	missense	4121	exon2			GCGGCGTCGGCGG	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.566A>T	chr6.hg19:g.119669665T>A	ENSP00000357453:p.Asp189Val	111.0	0.0		89.0	21.0	NM_005907	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	hg19	CCDS5122.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843243	0.51057	.	.	ENSG00000111885	ENST00000368468;ENST00000368466	T;D	0.81996	-0.84;-1.56	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.83922	0.5359	M	0.65975	2.015	0.80722	D	1	D;B	0.61080	0.989;0.222	P;B	0.55615	0.78;0.13	D	0.84467	0.0597	9	.	.	.	-10.026	14.7849	0.69796	0.0:0.0:0.0:1.0	.	189;189	Q6P052;P33908	.;MA1A1_HUMAN	V	189	ENSP00000357453:D189V;ENSP00000357451:D189V	.	D	-	2	0	MAN1A1	119711364	1.000000	0.71417	0.170000	0.22879	0.232000	0.25224	7.131000	0.77243	1.985000	0.57927	0.374000	0.22700	GAC	.	.		0.662	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907	
ENPP1	5167	hgsc.bcm.edu	37	6	132189188	132189188	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:132189188A>T	ENST00000360971.2	+	12	1215	c.1195A>T	c.(1195-1197)Atg>Ttg	p.M399L		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	399	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	GGTTGATGGTATGGTTGGTAT	0.403																																					p.M399L	Colon(104;336 1535 5856 11019 33782)	Atlas-SNP	.											.	ENPP1	108	.	0			c.A1195T						.						243.0	217.0	226.0					6																	132189188		2203	4300	6503	SO:0001583	missense	5167	exon12			GATGGTATGGTTG	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1195A>T	chr6.hg19:g.132189188A>T	ENSP00000354238:p.Met399Leu	93.0	0.0		80.0	19.0	NM_006208	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	hg19	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	A	10.55	1.380504	0.24944	.	.	ENSG00000197594	ENST00000360971	T	0.73469	-0.75	5.76	3.33	0.38152	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.280341	0.43579	N	0.000552	T	0.31040	0.0784	N	0.16307	0.4	0.30384	N	0.781628	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.004	T	0.10941	-1.0608	10	0.15066	T	0.55	-7.5435	6.9604	0.24593	0.7411:0.1264:0.1325:0.0	.	399;29	P22413;Q7Z3P5	ENPP1_HUMAN;.	L	399	ENSP00000354238:M399L	ENSP00000354238:M399L	M	+	1	0	ENPP1	132230881	0.998000	0.40836	0.709000	0.30452	0.416000	0.31233	3.853000	0.55941	0.509000	0.28195	0.533000	0.62120	ATG	.	.		0.403	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2		
EYA4	2070	hgsc.bcm.edu	37	6	133767789	133767789	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:133767789A>T	ENST00000367895.5	+	4	569	c.105A>T	c.(103-105)ctA>ctT	p.L35L	EYA4_ENST00000355167.3_Silent_p.L35L|EYA4_ENST00000531901.1_Silent_p.L35L|EYA4_ENST00000430974.2_Silent_p.L35L|EYA4_ENST00000525849.1_Silent_p.L35L|EYA4_ENST00000355286.6_Silent_p.L35L|EYA4_ENST00000431403.2_Silent_p.L35L|EYA4_ENST00000452339.2_Silent_p.L35L	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	35					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TGCAGGACCTAGCAAGTCCTC	0.393																																					p.L35L	Melanoma(57;398 1237 3528 4702 7415)	Atlas-SNP	.											.	EYA4	196	.	0			c.A105T						.						116.0	110.0	112.0					6																	133767789		2203	4300	6503	SO:0001819	synonymous_variant	2070	exon4			GGACCTAGCAAGT	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.105A>T	chr6.hg19:g.133767789A>T		137.0	0.0		93.0	18.0	NM_172105	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Silent	SNP	ENST00000367895.5	hg19	CCDS5165.1																																																																																			.	.		0.393	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
BCLAF1	9774	hgsc.bcm.edu	37	6	136597258	136597258	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:136597258C>A	ENST00000531224.1	-	5	1657	c.1405G>T	c.(1405-1407)Gaa>Taa	p.E469*	BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000353331.4_Nonsense_Mutation_p.E467*|BCLAF1_ENST00000527536.1_Nonsense_Mutation_p.E469*|BCLAF1_ENST00000527759.1_Nonsense_Mutation_p.E467*|BCLAF1_ENST00000392348.2_Nonsense_Mutation_p.E467*	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	469					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.E469fs*20(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTAGGCCTTTCCACTACATAT	0.343																																					p.E469X	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.,1	BCLAF1	203	.	1	Deletion - Frameshift(1)	lung(1)	c.G1405T						.						133.0	138.0	136.0					6																	136597258		2203	4300	6503	SO:0001587	stop_gained	9774	exon5			GCCTTTCCACTAC	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1405G>T	chr6.hg19:g.136597258C>A	ENSP00000435210:p.Glu469*	102.0	0.0		107.0	17.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Nonsense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	37	6.531036	0.97641	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	.	.	.	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-11.3047	12.5417	0.56174	0.0:0.9237:0.0:0.0763	.	.	.	.	X	469;467;469;467;467;469	.	ENSP00000229446:E467X	E	-	1	0	BCLAF1	136638951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.938000	0.70170	2.611000	0.88343	0.644000	0.83932	GAA	.	.		0.343	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
MAP7	9053	hgsc.bcm.edu	37	6	136693743	136693743	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:136693743T>C	ENST00000354570.3	-	8	1182	c.772A>G	c.(772-774)Atg>Gtg	p.M258V	MAP7_ENST00000544465.1_Missense_Mutation_p.M243V|MAP7_ENST00000454590.1_Missense_Mutation_p.M280V|MAP7_ENST00000438100.2_Missense_Mutation_p.M243V|MAP7_ENST00000432797.2_Missense_Mutation_p.M112V	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	258					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		TTGTAGGGCATGATGATGGGG	0.488																																					p.M288V		Atlas-SNP	.											.	MAP7	63	.	0			c.A862G						.						193.0	168.0	177.0					6																	136693743		2203	4300	6503	SO:0001583	missense	9053	exon8			AGGGCATGATGAT	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.772A>G	chr6.hg19:g.136693743T>C	ENSP00000346581:p.Met258Val	138.0	0.0		102.0	56.0	NM_001198609	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	hg19	CCDS5178.1	.	.	.	.	.	.	.	.	.	.	T	9.679	1.148811	0.21288	.	.	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81	5.67	5.67	0.87782	.	0.193905	0.35970	N	0.002870	T	0.04770	0.0129	L	0.53249	1.67	0.29112	N	0.880792	B;B;B;B;B;B;B;B	0.17667	0.013;0.013;0.023;0.013;0.002;0.023;0.023;0.013	B;B;B;B;B;B;B;B	0.18561	0.01;0.01;0.022;0.01;0.001;0.022;0.022;0.01	T	0.21245	-1.0251	10	0.28530	T	0.3	-11.9308	11.4179	0.49962	0.0:0.0:0.2728:0.7272	.	243;280;243;280;280;164;221;258	B7Z290;B7ZB64;F5H1E2;E9PCP3;B7Z400;F8W783;Q14244-2;Q14244	.;.;.;.;.;.;.;MAP7_HUMAN	V	258;280;243;243;112;164	ENSP00000346581:M258V;ENSP00000414712:M280V;ENSP00000445737:M243V;ENSP00000400790:M243V;ENSP00000414879:M112V	ENSP00000344217:M164V	M	-	1	0	MAP7	136735436	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.153000	0.42282	2.163000	0.67991	0.482000	0.46254	ATG	.	.		0.488	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
ESR1	2099	hgsc.bcm.edu	37	6	152415601	152415601	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:152415601A>G	ENST00000206249.3	+	7	1813	c.1451A>G	c.(1450-1452)gAc>gGc	p.D484G	ESR1_ENST00000406599.1_Missense_Mutation_p.D223G|ESR1_ENST00000440973.1_Missense_Mutation_p.D484G|ESR1_ENST00000427531.2_Intron|ESR1_ENST00000338799.5_Missense_Mutation_p.D484G|ESR1_ENST00000456483.2_Missense_Mutation_p.D372G|ESR1_ENST00000443427.1_Missense_Mutation_p.D484G	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	484	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	AAGATCACAGACACTTTGATC	0.567																																					p.D484G		Atlas-SNP	.											.	ESR1	94	.	0			c.A1451G						.						101.0	90.0	94.0					6																	152415601		2203	4300	6503	SO:0001583	missense	2099	exon7			TCACAGACACTTT	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1451A>G	chr6.hg19:g.152415601A>G	ENSP00000206249:p.Asp484Gly	101.0	0.0		65.0	16.0	NM_000125	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	ENST00000206249.3	hg19	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.840954	0.91197	.	.	ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000456483;ENST00000443427;ENST00000206249;ENST00000406599;ENST00000431590	D;D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17;-4.17	5.43	5.43	0.79202	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97993	0.9339	M	0.85197	2.74	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.986;0.997;0.997;0.997	D;D;D;P;D;D;D	0.91635	0.999;0.998;0.999;0.861;0.99;0.976;0.986	D	0.99232	1.0882	10	0.87932	D	0	.	15.4875	0.75578	1.0:0.0:0.0:0.0	.	49;179;223;411;483;484;484	B5LY05;C8CJL6;Q9H2M1;B4E3R5;A8KAF4;G4XH65;P03372	.;.;.;.;.;.;ESR1_HUMAN	G	484;484;372;484;484;223;412	ENSP00000405330:D484G;ENSP00000342630:D484G;ENSP00000415934:D372G;ENSP00000387500:D484G;ENSP00000206249:D484G;ENSP00000384064:D223G	ENSP00000206249:D484G	D	+	2	0	ESR1	152457294	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.962000	0.93254	2.066000	0.61787	0.454000	0.30748	GAC	.	.		0.567	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
EIF2AK1	27102	hgsc.bcm.edu	37	7	6080784	6080784	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:6080784T>A	ENST00000199389.6	-	9	1004	c.858A>T	c.(856-858)ccA>ccT	p.P286P	EIF2AK1_ENST00000495565.1_5'UTR|EIF2AK1_ENST00000536084.1_Silent_p.P162P	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	286	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TTTCTTTTTCTGGGGTGGGCT	0.358																																					p.P286P		Atlas-SNP	.											.	EIF2AK1	76	.	0			c.A858T						.						97.0	103.0	101.0					7																	6080784		2203	4300	6503	SO:0001819	synonymous_variant	27102	exon9			TTTTTCTGGGGTG	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.858A>T	chr7.hg19:g.6080784T>A		108.0	0.0		144.0	19.0	NM_014413	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Silent	SNP	ENST00000199389.6	hg19	CCDS5345.1																																																																																			.	.		0.358	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
INHBA	3624	hgsc.bcm.edu	37	7	41729994	41729994	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:41729994G>C	ENST00000242208.4	-	3	781	c.535C>G	c.(535-537)Cag>Gag	p.Q179E	INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.Q179E|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	179					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GGGTGCTTCTGCTGCTGGAAG	0.562										TSP Lung(11;0.080)																											p.Q179E		Atlas-SNP	.											.	INHBA	118	.	0			c.C535G						.						101.0	94.0	97.0					7																	41729994		2203	4300	6503	SO:0001583	missense	3624	exon3			GCTTCTGCTGCTG		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.535C>G	chr7.hg19:g.41729994G>C	ENSP00000242208:p.Gln179Glu	67.0	0.0		93.0	11.0	NM_002192	Q14599	Missense_Mutation	SNP	ENST00000242208.4	hg19	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	15.04	2.714918	0.48622	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.63580	-0.05;-0.05	5.81	5.81	0.92471	Transforming growth factor-beta, N-terminal (1);	0.554170	0.20607	N	0.089047	T	0.54159	0.1841	L	0.42245	1.32	0.46521	D	0.999082	B	0.02656	0.0	B	0.14023	0.01	T	0.53872	-0.8377	10	0.02654	T	1	-18.9698	20.0699	0.97718	0.0:0.0:1.0:0.0	.	179	P08476	INHBA_HUMAN	E	179	ENSP00000242208:Q179E;ENSP00000397197:Q179E	ENSP00000242208:Q179E	Q	-	1	0	INHBA	41696519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.018000	0.70811	2.741000	0.93983	0.655000	0.94253	CAG	.	.		0.562	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
INHBA	3624	hgsc.bcm.edu	37	7	41730010	41730010	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:41730010G>A	ENST00000242208.4	-	3	765	c.519C>T	c.(517-519)atC>atT	p.I173I	INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Silent_p.I173I|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	173					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.I173I(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GGAAGAGGCGGATGGTGACTT	0.577										TSP Lung(11;0.080)																											p.I173I		Atlas-SNP	.											INHBA,NS,carcinoma,0,1	INHBA	118	.	1	Substitution - coding silent(1)	lung(1)	c.C519T						.						107.0	99.0	102.0					7																	41730010		2203	4300	6503	SO:0001819	synonymous_variant	3624	exon3			GAGGCGGATGGTG		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.519C>T	chr7.hg19:g.41730010G>A		56.0	0.0		79.0	9.0	NM_002192	Q14599	Silent	SNP	ENST00000242208.4	hg19	CCDS5464.1																																																																																			.	.		0.577	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
DDC	1644	hgsc.bcm.edu	37	7	50563117	50563117	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:50563117T>A	ENST00000444124.2	-	9	1077		c.e9-2		DDC_ENST00000426377.1_Splice_Site|DDC_ENST00000380984.4_Splice_Site|DDC_ENST00000431062.1_Splice_Site|DDC_ENST00000357936.5_Splice_Site	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)						catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.?(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	ATCTGCAAACTGCCAAAGAAC	0.338																																					.		Atlas-SNP	.											DDC_ENST00000380984,NS,carcinoma,0,2	DDC	100	.	2	Unknown(2)	lung(2)	c.598-2A>T						.						64.0	61.0	62.0					7																	50563117		2203	4300	6503	SO:0001630	splice_region_variant	1644	exon8			GCAAACTGCCAAA		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.877-2A>T	chr7.hg19:g.50563117T>A		59.0	0.0		111.0	17.0	NM_001242889	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Splice_Site	SNP	ENST00000444124.2	hg19	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449805	0.63290	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124;ENST00000430300;ENST00000380984	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3483	0.66682	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DDC	50530611	1.000000	0.71417	0.996000	0.52242	0.697000	0.40408	7.001000	0.76297	2.085000	0.62840	0.533000	0.62120	.	.	.		0.338	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		Intron
ZNF679	168417	hgsc.bcm.edu	37	7	63726363	63726363	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:63726363A>T	ENST00000421025.1	+	5	621	c.352A>T	c.(352-354)Agt>Tgt	p.S118C	ZNF679_ENST00000255746.4_Missense_Mutation_p.S118C	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						ATATGGAAAAAGTGGACATGA	0.373																																					p.S118C		Atlas-SNP	.											.	ZNF679	80	.	0			c.A352T						.						162.0	138.0	145.0					7																	63726363		692	1591	2283	SO:0001583	missense	168417	exon5			GGAAAAAGTGGAC	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.352A>T	chr7.hg19:g.63726363A>T	ENSP00000416809:p.Ser118Cys	142.0	0.0		227.0	31.0	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.423716	0.00186	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.06608	3.28;3.28	0.819	-1.64	0.08318	.	.	.	.	.	T	0.01320	0.0043	N	0.00855	-1.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38265	-0.9669	9	0.02654	T	1	.	1.5151	0.02504	0.3311:0.0:0.3295:0.3394	.	118	Q8IYX0	ZN679_HUMAN	C	118	ENSP00000416809:S118C;ENSP00000255746:S118C	ENSP00000255746:S118C	S	+	1	0	ZNF679	63363798	0.000000	0.05858	0.019000	0.16419	0.019000	0.09904	-1.587000	0.02108	-1.207000	0.02637	-1.236000	0.01555	AGT	.	.		0.373	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
PCLO	27445	hgsc.bcm.edu	37	7	82582621	82582621	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:82582621C>A	ENST00000333891.9	-	5	7985	c.7648G>T	c.(7648-7650)Gca>Tca	p.A2550S	PCLO_ENST00000423517.2_Missense_Mutation_p.A2550S|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTATAATCTGCTGAAGTCACT	0.403																																					p.A2550S		Atlas-SNP	.											.	PCLO	1506	.	0			c.G7648T						.						92.0	90.0	91.0					7																	82582621		1878	4108	5986	SO:0001583	missense	27445	exon5			AATCTGCTGAAGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7648G>T	chr7.hg19:g.82582621C>A	ENSP00000334319:p.Ala2550Ser	132.0	0.0		139.0	16.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	7.338	0.620407	0.14193	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17528	2.28;2.27	4.66	2.81	0.32909	.	.	.	.	.	T	0.14700	0.0355	L	0.43152	1.355	0.28256	N	0.92507	B;B	0.32829	0.103;0.386	B;B	0.31101	0.085;0.124	T	0.13282	-1.0515	9	0.87932	D	0	.	8.4034	0.32601	0.0:0.7532:0.0:0.2468	.	2550;2550	Q9Y6V0-5;Q9Y6V0-6	.;.	S	2481;2550;2550	ENSP00000334319:A2550S;ENSP00000388393:A2550S	ENSP00000334319:A2550S	A	-	1	0	PCLO	82420557	0.801000	0.28930	0.988000	0.46212	0.908000	0.53690	0.019000	0.13444	0.961000	0.38030	0.484000	0.47621	GCA	.	.		0.403	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu	37	7	82595525	82595525	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:82595525T>A	ENST00000333891.9	-	4	3916	c.3579A>T	c.(3577-3579)caA>caT	p.Q1193H	PCLO_ENST00000423517.2_Missense_Mutation_p.Q1193H	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTTCTTGTTTTTGATCTGTGG	0.343																																					p.Q1193H		Atlas-SNP	.											.	PCLO	1506	.	0			c.A3579T						.						135.0	126.0	129.0					7																	82595525		1801	4082	5883	SO:0001583	missense	27445	exon4			TTGTTTTTGATCT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3579A>T	chr7.hg19:g.82595525T>A	ENSP00000334319:p.Gln1193His	89.0	0.0		121.0	35.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.451591	0.26074	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.89	-1.98	0.07480	.	.	.	.	.	T	0.12433	0.0302	L	0.32530	0.975	0.24335	N	0.994987	B;B	0.14438	0.01;0.01	B;B	0.17433	0.018;0.01	T	0.32666	-0.9898	9	0.87932	D	0	.	8.1693	0.31245	0.0:0.396:0.1112:0.4928	.	1193;1193	Q9Y6V0-5;Q9Y6V0-6	.;.	H	1132;1193;1193	ENSP00000334319:Q1193H;ENSP00000388393:Q1193H	ENSP00000334319:Q1193H	Q	-	3	2	PCLO	82433461	0.016000	0.18221	0.413000	0.26509	0.802000	0.45316	0.085000	0.14912	-0.341000	0.08376	-0.256000	0.11100	CAA	.	.		0.343	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu	37	7	82764329	82764329	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:82764329A>T	ENST00000333891.9	-	3	2874	c.2537T>A	c.(2536-2538)gTt>gAt	p.V846D	PCLO_ENST00000423517.2_Missense_Mutation_p.V846D	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TACGGGGTCAACTTGTTTTTG	0.448																																					p.V846D		Atlas-SNP	.											.	PCLO	1506	.	0			c.T2537A						.						153.0	155.0	154.0					7																	82764329		1913	4129	6042	SO:0001583	missense	27445	exon3			GGGTCAACTTGTT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2537T>A	chr7.hg19:g.82764329A>T	ENSP00000334319:p.Val846Asp	161.0	0.0		191.0	17.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	5.689	0.311765	0.10789	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15952	2.39;2.38	5.98	0.758	0.18432	.	.	.	.	.	T	0.07369	0.0186	N	0.08118	0	0.09310	N	0.999995	B;B	0.13145	0.007;0.007	B;B	0.09377	0.004;0.004	T	0.33523	-0.9865	9	0.87932	D	0	.	2.0716	0.03614	0.5152:0.121:0.2471:0.1167	.	846;846	Q9Y6V0-5;Q9Y6V0-6	.;.	D	792;846;846	ENSP00000334319:V846D;ENSP00000388393:V846D	ENSP00000334319:V846D	V	-	2	0	PCLO	82602265	0.000000	0.05858	0.041000	0.18516	0.860000	0.49131	-0.197000	0.09518	-0.091000	0.12440	-0.313000	0.08912	GTT	.	.		0.448	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
SEMA3A	10371	hgsc.bcm.edu	37	7	83610729	83610729	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:83610729G>A	ENST00000265362.4	-	14	1874	c.1560C>T	c.(1558-1560)taC>taT	p.Y520Y	SEMA3A_ENST00000436949.1_Silent_p.Y520Y	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	520					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ACGCTTTCCCGTAAATATCAC	0.483																																					p.Y520Y		Atlas-SNP	.											.	SEMA3A	121	.	0			c.C1560T						.						76.0	70.0	72.0					7																	83610729		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon14			TTTCCCGTAAATA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1560C>T	chr7.hg19:g.83610729G>A		172.0	0.0		213.0	10.0	NM_006080		Silent	SNP	ENST00000265362.4	hg19	CCDS5599.1																																																																																			.	.		0.483	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SAMD9	54809	hgsc.bcm.edu	37	7	92731091	92731091	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:92731091C>G	ENST00000379958.2	-	3	4589	c.4320G>C	c.(4318-4320)tgG>tgC	p.W1440C		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1440						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GATTTTCTGGCCAGAATAAGA	0.358																																					p.W1440C		Atlas-SNP	.											.	SAMD9	239	.	0			c.G4320C						.						108.0	108.0	108.0					7																	92731091		2203	4300	6503	SO:0001583	missense	54809	exon2			TTCTGGCCAGAAT	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.4320G>C	chr7.hg19:g.92731091C>G	ENSP00000369292:p.Trp1440Cys	142.0	0.0		171.0	33.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	hg19	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062126	0.55432	.	.	ENSG00000205413	ENST00000379958	T	0.53640	0.61	4.35	4.35	0.52113	.	0.000000	0.64402	U	0.000003	T	0.63663	0.2530	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.67620	-0.5624	10	0.87932	D	0	.	15.9323	0.79672	0.0:1.0:0.0:0.0	.	1440	Q5K651	SAMD9_HUMAN	C	1440	ENSP00000369292:W1440C	ENSP00000369292:W1440C	W	-	3	0	SAMD9	92569027	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.220000	0.78008	2.411000	0.81874	0.603000	0.83216	TGG	.	.		0.358	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
DLX5	1749	hgsc.bcm.edu	37	7	96650106	96650106	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:96650106A>T	ENST00000222598.4	-	3	1285	c.812T>A	c.(811-813)cTg>cAg	p.L271Q	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	271					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CGGCGGCGGCAGGTGGGAATT	0.592																																					p.L271Q		Atlas-SNP	.											.	DLX5	52	.	0			c.T812A						.						50.0	55.0	54.0					7																	96650106		2203	4300	6503	SO:0001583	missense	1749	exon3			GGCGGCAGGTGGG		CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.812T>A	chr7.hg19:g.96650106A>T	ENSP00000222598:p.Leu271Gln	115.0	0.0		117.0	12.0	NM_005221	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	ENST00000222598.4	hg19	CCDS5647.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163084	0.57476	.	.	ENSG00000105880	ENST00000222598	D	0.91011	-2.77	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.93164	0.7823	M	0.70275	2.135	0.58432	D	0.999995	D	0.67145	0.996	P	0.59703	0.862	D	0.91501	0.5219	10	0.22109	T	0.4	-11.4203	15.1094	0.72343	1.0:0.0:0.0:0.0	.	271	P56178	DLX5_HUMAN	Q	271	ENSP00000222598:L271Q	ENSP00000222598:L271Q	L	-	2	0	DLX5	96488042	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	6.270000	0.72563	2.217000	0.71921	0.533000	0.62120	CTG	.	.		0.592	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2		
MUC17	140453	hgsc.bcm.edu	37	7	100680019	100680019	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:100680019T>C	ENST00000306151.4	+	3	5386	c.5322T>C	c.(5320-5322)atT>atC	p.I1774I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1774	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACTCCTATTGACACCAGCA	0.498																																					p.I1774I		Atlas-SNP	.											.	MUC17	804	.	0			c.T5322C						.						275.0	288.0	283.0					7																	100680019		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			TCCTATTGACACC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5322T>C	chr7.hg19:g.100680019T>C		86.0	0.0		103.0	23.0	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	hgsc.bcm.edu	37	7	100680551	100680551	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:100680551G>A	ENST00000306151.4	+	3	5918	c.5854G>A	c.(5854-5856)Gac>Aac	p.D1952N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1952	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTCTTGCTGACACCAGGAC	0.488																																					p.D1952N		Atlas-SNP	.											.	MUC17	804	.	0			c.G5854A						.						249.0	245.0	246.0					7																	100680551		2203	4300	6503	SO:0001583	missense	140453	exon3			CTTGCTGACACCA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5854G>A	chr7.hg19:g.100680551G>A	ENSP00000302716:p.Asp1952Asn	81.0	0.0		94.0	24.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	6.997	0.554014	0.13374	.	.	ENSG00000169876	ENST00000306151	T	0.02890	4.12	0.932	0.932	0.19466	.	.	.	.	.	T	0.03220	0.0094	N	0.24115	0.695	0.09310	N	1	P	0.51933	0.949	P	0.51297	0.665	T	0.45425	-0.9262	9	0.12103	T	0.63	.	7.8581	0.29493	0.0:0.0:1.0:0.0	.	1952	Q685J3	MUC17_HUMAN	N	1952	ENSP00000302716:D1952N	ENSP00000302716:D1952N	D	+	1	0	MUC17	100467271	0.000000	0.05858	0.004000	0.12327	0.018000	0.09664	-0.182000	0.09726	0.857000	0.35407	0.134000	0.15878	GAC	.	.		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
PMPCB	9512	hgsc.bcm.edu	37	7	102944347	102944347	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:102944347A>T	ENST00000249269.4	+	5	554	c.516A>T	c.(514-516)gaA>gaT	p.E172D	PMPCB_ENST00000428154.1_Missense_Mutation_p.E172D|PMPCB_ENST00000420236.2_Missense_Mutation_p.E67D	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	172					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CAGAGATTGAACGTGAGCGTG	0.348																																					p.E172D		Atlas-SNP	.											.	PMPCB	35	.	0			c.A516T						.						101.0	97.0	98.0					7																	102944347		2203	4300	6503	SO:0001583	missense	9512	exon5			GATTGAACGTGAG	AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.516A>T	chr7.hg19:g.102944347A>T	ENSP00000249269:p.Glu172Asp	127.0	0.0		165.0	17.0	NM_004279	O60416|Q96FV4	Missense_Mutation	SNP	ENST00000249269.4	hg19	CCDS5730.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.051710	0.55218	.	.	ENSG00000105819	ENST00000249269;ENST00000428154;ENST00000420236	T;T;T	0.18810	2.19;2.19;2.19	5.2	1.43	0.22495	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.17492	0.0420	L	0.48218	1.51	0.47621	D	0.999476	B;B;B;B;B;B;B	0.21821	0.002;0.028;0.037;0.037;0.061;0.061;0.007	B;B;B;B;B;B;B	0.23018	0.037;0.027;0.025;0.043;0.043;0.043;0.028	T	0.05402	-1.0887	10	0.46703	T	0.11	.	8.8961	0.35465	0.6893:0.0:0.3107:0.0	.	67;67;172;172;163;172;172	E7ERZ4;B4DM90;A8K1E9;B3KM34;Q96CP5;O75439;G3V0E4	.;.;.;.;.;MPPB_HUMAN;.	D	172;172;67	ENSP00000249269:E172D;ENSP00000390035:E172D;ENSP00000410393:E67D	ENSP00000249269:E172D	E	+	3	2	PMPCB	102731583	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.778000	0.26732	0.269000	0.21961	0.528000	0.53228	GAA	.	.		0.348	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347913.1	NM_004279	
SYPL1	6856	hgsc.bcm.edu	37	7	105752947	105752947	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:105752947T>A	ENST00000011473.2	-	1	75	c.29A>T	c.(28-30)cAg>cTg	p.Q10L	SYPL1_ENST00000455385.2_5'Flank|SYPL1_ENST00000470347.1_5'Flank	NM_006754.3	NP_006745.1	Q16563	SYPL1_HUMAN	synaptophysin-like 1	10					synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|integral component of synaptic vesicle membrane (GO:0030285)|secretory granule (GO:0030141)	transporter activity (GO:0005215)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	7						actgatccgctGGCGAACCAA	0.716																																					p.Q10L		Atlas-SNP	.											.	SYPL1	20	.	0			c.A29T						.						17.0	14.0	15.0					7																	105752947		2184	4268	6452	SO:0001583	missense	6856	exon1			ATCCGCTGGCGAA		CCDS5736.1, CCDS47685.1	7q22.2	2005-05-24	2005-05-24	2005-05-24	ENSG00000008282	ENSG00000008282			11507	protein-coding gene	gene with protein product			"""synaptophysin-like protein"""	SYPL			Standard	NM_006754		Approved		uc003vdp.4	Q16563	OTTHUMG00000157587	ENST00000011473.2:c.29A>T	chr7.hg19:g.105752947T>A	ENSP00000011473:p.Gln10Leu	65.0	0.0		94.0	21.0	NM_006754	A4D0R2|Q96AR8	Missense_Mutation	SNP	ENST00000011473.2	hg19	CCDS5736.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.286968	0.40494	.	.	ENSG00000008282	ENST00000011473	T	0.30182	1.54	3.26	3.26	0.37387	.	0.277566	0.29730	N	0.011348	T	0.38852	0.1056	L	0.40543	1.245	0.80722	D	1	D	0.54601	0.967	P	0.62382	0.901	T	0.16988	-1.0384	10	0.59425	D	0.04	.	8.2466	0.31693	0.0:0.0:0.0:1.0	.	10	Q16563	SYPL1_HUMAN	L	10	ENSP00000011473:Q10L	ENSP00000011473:Q10L	Q	-	2	0	SYPL1	105540183	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	2.836000	0.48183	1.702000	0.51228	0.402000	0.26972	CAG	.	.		0.716	SYPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349221.1		
ST7	7982	hgsc.bcm.edu	37	7	116862960	116862960	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:116862960A>T	ENST00000265437.5	+	16	1898	c.1684A>T	c.(1684-1686)Aag>Tag	p.K562*	ST7_ENST00000393444.3_Intron|ST7_ENST00000422922.1_Intron|ST7_ENST00000393446.2_Intron|ST7_ENST00000323984.3_Intron|ST7_ENST00000393449.1_Intron|ST7_ENST00000393443.1_Intron|ST7_ENST00000393451.3_Intron|ST7_ENST00000393447.4_Intron|ST7_ENST00000432298.1_Intron	NM_021908.2	NP_068708.1	Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CTGGAATTGCAAGAGTATTTT	0.448																																					p.K562X		Atlas-SNP	.											.	ST7	64	.	0			c.A1684T						.						146.0	141.0	143.0					7																	116862960		2203	4300	6503	SO:0001587	stop_gained	7982	exon16			AATTGCAAGAGTA	AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000265437.5:c.1684A>T	chr7.hg19:g.116862960A>T	ENSP00000265437:p.Lys562*	92.0	0.0		91.0	11.0	NM_021908	A8K137|B4DRQ2	Nonsense_Mutation	SNP	ENST00000265437.5	hg19	CCDS5770.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.460773	0.84317	.	.	ENSG00000004866	ENST00000265437	.	.	.	4.5	-8.99	0.00751	.	1.592400	0.03719	N	0.251483	.	.	.	.	.	.	0.31265	N	0.692463	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	0.5236	2.8234	0.05478	0.2072:0.3556:0.3208:0.1165	.	.	.	.	X	562	.	ENSP00000265437:K562X	K	+	1	0	ST7	116650196	0.977000	0.34250	0.724000	0.30704	0.469000	0.32828	-0.107000	0.10873	-1.562000	0.01682	-0.250000	0.11733	AAG	.	.		0.448	ST7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141622.1	NM_021908	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117361141	117361141	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:117361141A>G	ENST00000160373.3	-	20	4582	c.4491T>C	c.(4489-4491)aaT>aaC	p.N1497N		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1497					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ACAGAGAAGCATTCCTGTTAC	0.308																																					p.N1497N		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.T4491C						.						165.0	163.0	164.0					7																	117361141		2202	4299	6501	SO:0001819	synonymous_variant	83992	exon20			AGAAGCATTCCTG		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4491T>C	chr7.hg19:g.117361141A>G		78.0	0.0		91.0	30.0	NM_033427	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	hg19	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	A	1.185	-0.637094	0.03557	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.39	0.707	0.18139	.	.	.	.	.	T	0.21227	0.0511	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22034	-1.0228	4	.	.	.	-9.3533	1.8968	0.03259	0.2797:0.139:0.427:0.1544	.	.	.	.	R	985	.	.	C	-	1	0	CTTNBP2	117148377	0.000000	0.05858	0.079000	0.20413	0.498000	0.33706	0.109000	0.15417	0.155000	0.19261	-0.911000	0.02809	TGC	.	.		0.308	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
FLNC	2318	hgsc.bcm.edu	37	7	128486380	128486380	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:128486380T>A	ENST00000325888.8	+	23	4251	c.3990T>A	c.(3988-3990)taT>taA	p.Y1330*	FLNC_ENST00000346177.6_Nonsense_Mutation_p.Y1330*	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1330					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGGTCCTGTATGATGAGGTCG	0.667																																					p.Y1330X		Atlas-SNP	.											.	FLNC	339	.	0			c.T3990A						.						45.0	57.0	53.0					7																	128486380		2131	4219	6350	SO:0001587	stop_gained	2318	exon23			CCTGTATGATGAG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3990T>A	chr7.hg19:g.128486380T>A	ENSP00000327145:p.Tyr1330*	78.0	0.0		82.0	12.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Nonsense_Mutation	SNP	ENST00000325888.8	hg19	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	T	44	10.785616	0.99467	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	.	.	.	5.07	-4.36	0.03645	.	0.133902	0.51477	D	0.000086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.461	0.67450	0.0:0.5351:0.0:0.4649	.	.	.	.	X	1330	.	ENSP00000327145:Y1330X	Y	+	3	2	FLNC	128273616	0.000000	0.05858	0.948000	0.38648	0.868000	0.49771	-1.914000	0.01579	-0.905000	0.03871	0.454000	0.30748	TAT	.	.		0.667	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
FLNC	2318	hgsc.bcm.edu	37	7	128497184	128497184	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:128497184A>T	ENST00000325888.8	+	46	7835	c.7574A>T	c.(7573-7575)gAg>gTg	p.E2525V	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.E2492V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2525	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GTGTCATCAGAGTTCATCGTG	0.637																																					p.E2525V		Atlas-SNP	.											.	FLNC	339	.	0			c.A7574T						.						125.0	130.0	128.0					7																	128497184		1961	4135	6096	SO:0001583	missense	2318	exon46			CATCAGAGTTCAT	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7574A>T	chr7.hg19:g.128497184A>T	ENSP00000327145:p.Glu2525Val	57.0	0.0		72.0	9.0	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	hg19	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	a	15.91	2.973378	0.53614	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84944	-1.92;-1.92	5.41	5.41	0.78517	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.113585	0.64402	D	0.000018	D	0.90300	0.6966	M	0.69823	2.125	0.58432	D	0.999997	D;P	0.53312	0.959;0.784	P;P	0.58520	0.84;0.603	D	0.91301	0.5067	10	0.66056	D	0.02	.	15.4618	0.75363	1.0:0.0:0.0:0.0	.	2492;2525	Q14315-2;Q14315	.;FLNC_HUMAN	V	2525;2492	ENSP00000327145:E2525V;ENSP00000344002:E2492V	ENSP00000327145:E2525V	E	+	2	0	FLNC	128284420	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	9.307000	0.96226	2.059000	0.61396	0.528000	0.53228	GAG	.	.		0.637	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
KIAA1549	57670	hgsc.bcm.edu	37	7	138566238	138566238	+	Silent	SNP	C	C	T	rs377023001		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:138566238C>T	ENST00000422774.1	-	11	4173	c.4125G>A	c.(4123-4125)gcG>gcA	p.A1375A	KIAA1549_ENST00000440172.1_Silent_p.A1375A|KIAA1549_ENST00000242365.4_Silent_p.A1325A			Q9HCM3	K1549_HUMAN	KIAA1549	1375						integral component of membrane (GO:0016021)		p.A1375A(1)|p.A1325A(1)	KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CTGGCAGTGGCGCTGGCTCAT	0.507			O	BRAF	pilocytic astrocytoma																																p.A1375A	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	KIAA1549_ENST00000422774,rectum,carcinoma,0,2	KIAA1549	314	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G4125A						.	C	,	1,4167		0,1,2083	116.0	121.0	119.0		4125,4125	-11.5	0.0	7		119	0,8434		0,0,4217	no	coding-synonymous,coding-synonymous	KIAA1549	NM_001164665.1,NM_020910.2	,	0,1,6300	TT,TC,CC		0.0,0.024,0.0079	,	1375/1951,1375/1935	138566238	1,12601	2084	4217	6301	SO:0001819	synonymous_variant	57670	exon11			CAGTGGCGCTGGC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4125G>A	chr7.hg19:g.138566238C>T		135.0	0.0		143.0	35.0	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	hg19	CCDS56513.1																																																																																			.	.		0.507	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
WEE2	494551	hgsc.bcm.edu	37	7	141424074	141424074	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:141424074A>T	ENST00000397541.2	+	8	1626	c.1220A>T	c.(1219-1221)gAg>gTg	p.E407V	WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000471512.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	407	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					ATTTTGCAAGAGGTATAGATT	0.363																																					p.E407V		Atlas-SNP	.											.	WEE2	59	.	0			c.A1220T						.						109.0	108.0	108.0					7																	141424074		1833	4079	5912	SO:0001630	splice_region_variant	494551	exon8			TGCAAGAGGTATA	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.1221+1A>T	chr7.hg19:g.141424074A>T		194.0	0.0		248.0	49.0	NM_001105558		Missense_Mutation	SNP	ENST00000397541.2	hg19	CCDS43660.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.995772	0.93167	.	.	ENSG00000214102	ENST00000397541;ENST00000493845	T;T	0.66099	1.01;-0.19	5.93	5.93	0.95920	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	D	0.85405	0.5689	H	0.95816	3.725	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.89753	0.3941	10	0.87932	D	0	.	16.3871	0.83514	1.0:0.0:0.0:0.0	.	407	P0C1S8	WEE2_HUMAN	V	407;182	ENSP00000380675:E407V;ENSP00000420388:E182V	ENSP00000380675:E407V	E	+	2	0	WEE2	141070543	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.433000	0.90291	2.270000	0.75569	0.482000	0.46254	GAG	.	.		0.363	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	Missense_Mutation
MGAM	8972	hgsc.bcm.edu	37	7	141736006	141736006	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:141736006C>A	ENST00000549489.2	+	17	2092	c.1997C>A	c.(1996-1998)cCt>cAt	p.P666H	MGAM_ENST00000475668.2_Missense_Mutation_p.P666H	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	666	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTGGACACCCCTGAGGAGCTC	0.498																																					p.P666H		Atlas-SNP	.											.	MGAM	767	.	0			c.C1997A						.						127.0	124.0	125.0					7																	141736006		1966	4160	6126	SO:0001583	missense	8972	exon17			ACACCCCTGAGGA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1997C>A	chr7.hg19:g.141736006C>A	ENSP00000447378:p.Pro666His	133.0	0.0		187.0	56.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239019	0.79800	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.92911	-3.13	5.34	4.43	0.53597	Glycoside hydrolase, superfamily (1);	1.387040	0.04708	N	0.417019	D	0.89287	0.6672	N	0.14661	0.345	0.09310	N	1	P	0.40731	0.728	B	0.43754	0.43	T	0.81084	-0.1093	10	0.87932	D	0	.	13.9752	0.64268	0.1578:0.8422:0.0:0.0	.	666	O43451	MGA_HUMAN	H	666;666;543	ENSP00000447378:P666H	ENSP00000316431:P543H	P	+	2	0	MGAM	141382475	0.027000	0.19231	0.168000	0.22838	0.804000	0.45430	2.414000	0.44627	1.422000	0.47177	0.650000	0.86243	CCT	.	.		0.498	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
GIMAP6	474344	hgsc.bcm.edu	37	7	150325135	150325135	+	Missense_Mutation	SNP	G	G	T	rs368001704		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:150325135G>T	ENST00000328902.5	-	3	767	c.551C>A	c.(550-552)gCc>gAc	p.A184D	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	184	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCAGGCAAGGGCCTGGTTGTT	0.627																																					p.A254D		Atlas-SNP	.											.	GIMAP6	60	.	0			c.C761A						.						119.0	123.0	121.0					7																	150325135		2203	4300	6503	SO:0001583	missense	474344	exon3			GCAAGGGCCTGGT	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.551C>A	chr7.hg19:g.150325135G>T	ENSP00000330374:p.Ala184Asp	72.0	0.0		95.0	14.0	NM_001244072	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	hg19	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732380	0.30684	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.33654	1.4	4.29	-8.58	0.00897	AIG1 (1);	2.089860	0.02501	N	0.090478	T	0.17066	0.0410	N	0.16602	0.42	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.17722	0.019;0.0	T	0.16808	-1.0390	10	0.10902	T	0.67	.	5.075	0.14626	0.1002:0.2639:0.4873:0.1486	.	184;104	Q6P9H5;Q6P9H5-2	GIMA6_HUMAN;.	D	184;245	ENSP00000330374:A184D	ENSP00000330374:A184D	A	-	2	0	GIMAP6	149956068	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.672000	0.01952	-2.714000	0.00392	-0.305000	0.09177	GCC	.	.		0.627	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711	
GIMAP2	26157	hgsc.bcm.edu	37	7	150389814	150389814	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:150389814A>T	ENST00000223293.5	+	3	534	c.440A>T	c.(439-441)cAc>cTc	p.H147L		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	147	AIG1-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCTTTACCCACAAGGAAGAC	0.537																																					p.H147L		Atlas-SNP	.											.	GIMAP2	39	.	0			c.A440T						.						75.0	53.0	60.0					7																	150389814		2203	4300	6503	SO:0001583	missense	26157	exon3			TTACCCACAAGGA	AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.440A>T	chr7.hg19:g.150389814A>T	ENSP00000223293:p.His147Leu	120.0	0.0		163.0	42.0	NM_015660	Q96L25	Missense_Mutation	SNP	ENST00000223293.5	hg19	CCDS5905.1	.	.	.	.	.	.	.	.	.	.	A	13.10	2.135994	0.37728	.	.	ENSG00000106560	ENST00000223293	T	0.61040	0.14	3.9	-3.16	0.05217	AIG1 (1);	0.269330	0.28098	N	0.016602	T	0.52256	0.1723	M	0.78456	2.415	0.09310	N	0.999999	P	0.37781	0.608	B	0.36534	0.227	T	0.54768	-0.8244	10	0.66056	D	0.02	.	10.511	0.44862	0.3262:0.0:0.6737:0.0	.	147	Q9UG22	GIMA2_HUMAN	L	147	ENSP00000223293:H147L	ENSP00000223293:H147L	H	+	2	0	GIMAP2	150020747	0.000000	0.05858	0.975000	0.42487	0.880000	0.50808	-0.059000	0.11731	-0.451000	0.07097	-0.314000	0.08810	CAC	.	.		0.537	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348948.1	NM_015660	
GBX1	2636	hgsc.bcm.edu	37	7	150864157	150864157	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:150864157A>G	ENST00000297537.4	-	1	478	c.479T>C	c.(478-480)gTg>gCg	p.V160A	GBX1_ENST00000475831.1_5'UTR	NM_001098834.1	NP_001092304.1	Q14549	GBX1_HUMAN	gastrulation brain homeobox 1	160	Pro-rich.				adult walking behavior (GO:0007628)|neuron fate commitment (GO:0048663)|proprioception (GO:0019230)|regulation of transcription, DNA-templated (GO:0006355)|sensory neuron axon guidance (GO:0097374)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(5)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGCTCTGCCACTTTCTCCCG	0.701																																					p.V160A		Atlas-SNP	.											.	GBX1	21	.	0			c.T479C						.						24.0	31.0	29.0					7																	150864157		1874	4103	5977	SO:0001583	missense	2636	exon1			TCTGCCACTTTCT	L11239	CCDS43682.1	7q36.1	2012-03-09	2005-12-22		ENSG00000164900	ENSG00000164900		"""Homeoboxes / ANTP class : HOXL subclass"""	4185	protein-coding gene	gene with protein product		603354	"""gastrulation brain homeo box 1"""			7903253	Standard	NM_001098834		Approved		uc011kvg.2	Q14549	OTTHUMG00000158751	ENST00000297537.4:c.479T>C	chr7.hg19:g.150864157A>G	ENSP00000297537:p.Val160Ala	156.0	0.0		183.0	22.0	NM_001098834		Missense_Mutation	SNP	ENST00000297537.4	hg19	CCDS43682.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.488|8.488	0.861437|0.861437	0.17178|0.17178	.|.	.|.	ENSG00000164900|ENSG00000164900	ENST00000297537|ENST00000475831	D|.	0.91631|.	-2.88|.	4.15|4.15	1.81|1.81	0.25067|0.25067	.|.	0.233514|.	0.27912|.	U|.	0.017349|.	T|T	0.18635|0.18635	0.0447|0.0447	N|N	0.14661|0.14661	0.345|0.345	0.19945|0.19945	N|N	0.999945|0.999945	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.24404|0.24404	-1.0161|-1.0161	10|5	0.19147|.	T|.	0.46|.	-4.4166|-4.4166	4.1043|4.1043	0.10030|0.10030	0.6243:0.2548:0.1209:0.0|0.6243:0.2548:0.1209:0.0	.|.	160|.	Q14549|.	GBX1_HUMAN|.	A|R	160|10	ENSP00000297537:V160A|.	ENSP00000297537:V160A|.	V|W	-|-	2|1	0|0	GBX1|GBX1	150495090|150495090	0.049000|0.049000	0.20398|0.20398	0.881000|0.881000	0.34555|0.34555	0.962000|0.962000	0.63368|0.63368	-0.335000|-0.335000	0.07873|0.07873	0.194000|0.194000	0.20326|0.20326	0.391000|0.391000	0.25812|0.25812	GTG|TGG	.	.		0.701	GBX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352029.1		
DNAJB6	10049	hgsc.bcm.edu	37	7	157160104	157160104	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:157160104C>T	ENST00000262177.4	+	5	478	c.273C>T	c.(271-273)ttC>ttT	p.F91F	DNAJB6_ENST00000452797.2_Silent_p.F42F|DNAJB6_ENST00000429029.2_Silent_p.F91F|DNAJB6_ENST00000443280.1_Silent_p.F91F	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	91	Gly/Phe-rich.|Interaction with HSP70.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AATTTGGCTTCACATTCCGTA	0.388																																					p.F91F	Esophageal Squamous(46;195 967 1350 20350 43814)	Atlas-SNP	.											.	DNAJB6	39	.	0			c.C273T						.						160.0	149.0	153.0					7																	157160104		2203	4299	6502	SO:0001819	synonymous_variant	10049	exon5			TGGCTTCACATTC	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.273C>T	chr7.hg19:g.157160104C>T		86.0	0.0		139.0	30.0	NM_058246	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Silent	SNP	ENST00000262177.4	hg19	CCDS5946.1																																																																																			.	.		0.388	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
ADAMDEC1	27299	hgsc.bcm.edu	37	8	24259501	24259501	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:24259501A>G	ENST00000256412.4	+	12	1436	c.1216A>G	c.(1216-1218)Aag>Gag	p.K406E	ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.K327E|RP11-624C23.1_ENST00000519689.1_RNA|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.K327E|RP11-624C23.1_ENST00000523578.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	406	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		TCAGAAACCAAAGTGCCTGCT	0.403																																					p.K406E	Ovarian(147;687 1849 3699 25981 31337)	Atlas-SNP	.											.	ADAMDEC1	69	.	0			c.A1216G						.						107.0	106.0	107.0					8																	24259501		2203	4300	6503	SO:0001583	missense	27299	exon12			AAACCAAAGTGCC	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.1216A>G	chr8.hg19:g.24259501A>G	ENSP00000256412:p.Lys406Glu	78.0	0.0		79.0	10.0	NM_014479	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	hg19	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.321703	0.23994	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.63417	-0.04;-0.04;-0.04	6.16	6.16	0.99307	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.610934	0.17160	N	0.184723	T	0.55049	0.1896	L	0.31294	0.92	0.25588	N	0.986727	B	0.26512	0.151	B	0.34038	0.174	T	0.53315	-0.8456	10	0.45353	T	0.12	-6.6935	13.1979	0.59749	1.0:0.0:0.0:0.0	.	406	O15204	ADEC1_HUMAN	E	406;327;327	ENSP00000256412:K406E;ENSP00000442592:K327E;ENSP00000428993:K327E	ENSP00000256412:K406E	K	+	1	0	ADAMDEC1	24315446	0.024000	0.19004	0.974000	0.42286	0.209000	0.24338	1.300000	0.33436	2.367000	0.80283	0.528000	0.53228	AAG	.	.		0.403	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2	NM_014479	
KCNU1	157855	hgsc.bcm.edu	37	8	36642022	36642022	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:36642022T>C	ENST00000399881.3	+	1	131	c.94T>C	c.(94-96)Ttt>Ctt	p.F32L		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	32					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TCTCTCTTCCTTTGTGACCTT	0.413																																					p.F32L		Atlas-SNP	.											.	KCNU1	359	.	0			c.T94C						.						168.0	155.0	159.0					8																	36642022		1954	4147	6101	SO:0001583	missense	157855	exon1			TCTTCCTTTGTGA	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.94T>C	chr8.hg19:g.36642022T>C	ENSP00000382770:p.Phe32Leu	92.0	0.0		145.0	28.0	NM_001031836		Missense_Mutation	SNP	ENST00000399881.3	hg19	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	T	1.844	-0.466694	0.04476	.	.	ENSG00000215262	ENST00000523973;ENST00000399881	T;T	0.24350	1.86;1.9	5.49	-0.268	0.12934	.	.	.	.	.	T	0.08802	0.0218	N	0.11427	0.14	0.46564	D	0.9991	B	0.12013	0.005	B	0.09377	0.004	T	0.29058	-1.0024	9	0.10111	T	0.7	.	1.8418	0.03151	0.273:0.0814:0.1408:0.5048	.	32	A8MYU2	KCNU1_HUMAN	L	32	ENSP00000429951:F32L;ENSP00000382770:F32L	ENSP00000382770:F32L	F	+	1	0	KCNU1	36761180	0.069000	0.21087	0.836000	0.33094	0.081000	0.17604	-0.280000	0.08468	0.088000	0.17205	0.528000	0.53228	TTT	.	.		0.413	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
LSM1	27257	hgsc.bcm.edu	37	8	38029501	38029501	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:38029501T>C	ENST00000311351.4	-	2	492	c.97A>G	c.(97-99)Aga>Gga	p.R33G	LSM1_ENST00000520755.1_Missense_Mutation_p.R33G|LSM1_ENST00000522515.1_5'UTR	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1, U6 small nuclear RNA associated	33					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)					TCAATGCTTCTTAAAAAGCCT	0.333											OREG0018720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R33G		Atlas-SNP	.											.	LSM1	14	.	0			c.A97G						.						96.0	100.0	99.0					8																	38029501		2203	4300	6503	SO:0001583	missense	27257	exon2			TGCTTCTTAAAAA	AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324			20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""			12515382, 11953827	Standard	NM_014462		Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.97A>G	chr8.hg19:g.38029501T>C	ENSP00000310596:p.Arg33Gly	89.0	0.0	875	141.0	17.0	NM_014462	B2R5E6	Missense_Mutation	SNP	ENST00000311351.4	hg19	CCDS6103.1	.	.	.	.	.	.	.	.	.	.	T	18.37	3.608888	0.66558	.	.	ENSG00000175324	ENST00000311351;ENST00000520755	T;T	0.46063	0.88;0.88	5.93	4.73	0.59995	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.088985	0.85682	D	0.000000	T	0.77343	0.4116	H	0.99026	4.405	0.80722	D	1	D	0.62365	0.991	D	0.72075	0.976	D	0.85921	0.1446	10	0.87932	D	0	-29.3368	13.0482	0.58939	0.0:0.0:0.1762:0.8238	.	33	O15116	LSM1_HUMAN	G	33	ENSP00000310596:R33G;ENSP00000430021:R33G	ENSP00000310596:R33G	R	-	1	2	LSM1	38148658	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	1.752000	0.38349	2.273000	0.75805	0.482000	0.46254	AGA	.	.		0.333	LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376965.1	NM_014462	
CNBD1	168975	hgsc.bcm.edu	37	8	88365869	88365869	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:88365869A>G	ENST00000518476.1	+	10	1209	c.1158A>G	c.(1156-1158)agA>agG	p.R386R		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	386										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AACAGAAAAGATCTCAAAAAC	0.318																																					p.R386R		Atlas-SNP	.											.	CNBD1	206	.	0			c.A1158G						.						56.0	56.0	56.0					8																	88365869		1798	4061	5859	SO:0001819	synonymous_variant	168975	exon10			GAAAAGATCTCAA	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1158A>G	chr8.hg19:g.88365869A>G		352.0	0.0		552.0	31.0	NM_173538		Silent	SNP	ENST00000518476.1	hg19	CCDS55259.1	.	.	.	.	.	.	.	.	.	.	A	0.218	-1.031014	0.02029	.	.	ENSG00000176571	ENST00000523299;ENST00000521593	.	.	.	4.98	2.61	0.31194	.	.	.	.	.	T	0.54029	0.1833	.	.	.	0.44275	D	0.997137	.	.	.	.	.	.	T	0.46386	-0.9195	4	.	.	.	-21.8253	5.8986	0.18953	0.7926:0.0:0.2074:0.0	.	.	.	.	G	78;23	.	.	D	+	2	0	CNBD1	88434985	0.833000	0.29383	0.584000	0.28653	0.023000	0.10783	1.390000	0.34464	0.755000	0.32990	0.454000	0.30748	GAT	.	.		0.318	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538	
MATN2	4147	hgsc.bcm.edu	37	8	99033508	99033508	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:99033508A>C	ENST00000520016.1	+	12	2019	c.1895A>C	c.(1894-1896)aAa>aCa	p.K632T	MATN2_ENST00000521689.1_Missense_Mutation_p.K632T|MATN2_ENST00000524308.1_Missense_Mutation_p.K591T|MATN2_ENST00000254898.5_Missense_Mutation_p.K632T|MATN2_ENST00000522025.2_Missense_Mutation_p.K348T			O00339	MATN2_HUMAN	matrilin 2	632	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TACATCTGCAAATGCTCAGAG	0.443																																					p.K632T		Atlas-SNP	.											.	MATN2	165	.	0			c.A1895C						.						134.0	130.0	131.0					8																	99033508		1890	4121	6011	SO:0001583	missense	4147	exon13			TCTGCAAATGCTC	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1895A>C	chr8.hg19:g.99033508A>C	ENSP00000430487:p.Lys632Thr	116.0	0.0		184.0	21.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	hg19	CCDS55264.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.844|8.844	0.942875|0.942875	0.18281|0.18281	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016|ENST00000518154	D;D;D;D;D|.	0.96232|.	-3.95;-3.95;-3.95;-3.95;-3.95|.	5.58|5.58	2.48|2.48	0.30137|0.30137	Epidermal growth factor-like (1);EGF-like region, conserved site (1);|.	0.181219|.	0.38720|.	N|.	0.001582|.	T|T	0.13243|0.13243	0.0321|0.0321	N|N	0.02412|0.02412	-0.56|-0.56	0.28643|0.28643	N|N	0.907045|0.907045	B;P;P;P|.	0.42078|.	0.418;0.77;0.726;0.77|.	B;B;B;B|.	0.43052|.	0.145;0.316;0.406;0.316|.	T|T	0.28586|0.28586	-1.0039|-1.0039	10|5	0.13853|.	T|.	0.58|.	-14.3116|-14.3116	7.643|7.643	0.28305|0.28305	0.782:0.0:0.218:0.0|0.782:0.0:0.218:0.0	.|.	591;632;632;632|.	C9JH87;E9PF03;O00339-2;O00339|.	.;.;.;MATN2_HUMAN|.	T|H	632;632;591;591;348;632|414	ENSP00000429977:K632T;ENSP00000254898:K632T;ENSP00000430221:K591T;ENSP00000429010:K348T;ENSP00000430487:K632T|.	ENSP00000254898:K632T|.	K|Q	+|+	2|3	0|2	MATN2|MATN2	99102684|99102684	0.036000|0.036000	0.19791|0.19791	0.998000|0.998000	0.56505|0.56505	0.598000|0.598000	0.36846|0.36846	0.892000|0.892000	0.28322|0.28322	0.191000|0.191000	0.20236|0.20236	0.533000|0.533000	0.62120|0.62120	AAA|CAA	.	.		0.443	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
SPAG1	6674	hgsc.bcm.edu	37	8	101178179	101178179	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:101178179A>G	ENST00000388798.2	+	3	469	c.278A>G	c.(277-279)gAa>gGa	p.E93G	SPAG1_ENST00000251809.3_Missense_Mutation_p.E93G|SPAG1_ENST00000520643.1_Missense_Mutation_p.E93G|SPAG1_ENST00000520508.1_Missense_Mutation_p.E93G	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	93					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		GAAGAATGGGAAAAAATTGAT	0.363																																					p.E93G		Atlas-SNP	.											.	SPAG1	80	.	0			c.A278G						.						62.0	63.0	63.0					8																	101178179		2203	4300	6503	SO:0001583	missense	6674	exon3			AATGGGAAAAAAT	AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.278A>G	chr8.hg19:g.101178179A>G	ENSP00000373450:p.Glu93Gly	164.0	0.0		261.0	33.0	NM_003114	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	hg19	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.654484	0.67472	.	.	ENSG00000104450	ENST00000520643;ENST00000251809;ENST00000520508;ENST00000388798	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	5.81	4.66	0.58398	.	0.585351	0.19443	N	0.114132	T	0.20251	0.0487	M	0.72894	2.215	0.33026	D	0.529559	P;P	0.50272	0.933;0.804	P;P	0.46479	0.518;0.462	T	0.36089	-0.9762	10	0.72032	D	0.01	-15.938	6.9829	0.24713	0.7739:0.1495:0.0766:0.0	.	93;93	Q07617;G3XAM3	SPAG1_HUMAN;.	G	93	ENSP00000427716:E93G;ENSP00000251809:E93G;ENSP00000428070:E93G;ENSP00000373450:E93G	ENSP00000251809:E93G	E	+	2	0	SPAG1	101247355	0.976000	0.34144	0.911000	0.35937	0.995000	0.86356	2.111000	0.41883	1.037000	0.40024	0.533000	0.62120	GAA	.	.		0.363	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218	
PABPC1	26986	hgsc.bcm.edu	37	8	101733713	101733713	+	Silent	SNP	C	C	G	rs148248545		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:101733713C>G	ENST00000318607.5	-	1	1227	c.99G>C	c.(97-99)ccG>ccC	p.P33P	PABPC1_ENST00000519004.1_Intron|PABPC1_ENST00000522387.1_Silent_p.P33P	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	33	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TGGGCCCGGCCGGGCTGAACT	0.662																																					p.P33P		Atlas-SNP	.											.	PABPC1	76	.	0			c.G99C						.						26.0	30.0	29.0					8																	101733713		2203	4299	6502	SO:0001819	synonymous_variant	26986	exon1			CCCGGCCGGGCTG	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.99G>C	chr8.hg19:g.101733713C>G		233.0	0.0		387.0	162.0	NM_002568	Q15097|Q93004	Silent	SNP	ENST00000318607.5	hg19	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	C	8.417	0.845519	0.16963	.	.	ENSG00000070756	ENST00000523555	.	.	.	3.45	1.55	0.23275	.	.	.	.	.	T	0.44095	0.1277	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21143	-1.0254	4	.	.	.	.	2.8039	0.05422	0.3151:0.4362:0.1542:0.0945	.	.	.	.	R	28	.	.	G	-	1	0	PABPC1	101802889	0.934000	0.31675	0.999000	0.59377	0.914000	0.54420	-0.032000	0.12266	0.099000	0.17552	-0.321000	0.08615	GGC	.	C|1.000;T|0.000		0.662	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
EXT1	2131	hgsc.bcm.edu	37	8	118834756	118834756	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:118834756T>A	ENST00000378204.2	-	5	2171	c.1365A>T	c.(1363-1365)ctA>ctT	p.L455L		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	455					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			AATACTGTGGTAGTACGAACA	0.363			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.L455L		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	EXT1	98	.	0			c.A1365T						.						133.0	129.0	130.0					8																	118834756		2203	4300	6503	SO:0001819	synonymous_variant	2131	exon5	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	CTGTGGTAGTACG	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1365A>T	chr8.hg19:g.118834756T>A		85.0	0.0		116.0	9.0	NM_000127	B2R7V2|Q9BVI9	Silent	SNP	ENST00000378204.2	hg19	CCDS6324.1																																																																																			.	.		0.363	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
ADCY8	114	hgsc.bcm.edu	37	8	131916177	131916177	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:131916177A>G	ENST00000286355.5	-	7	3844	c.1752T>C	c.(1750-1752)acT>acC	p.T584T	ADCY8_ENST00000377928.3_Silent_p.T584T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	584					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.T584T(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAATTAAGTAAGTTTCGATAT	0.483										HNSCC(32;0.087)																											p.T584T		Atlas-SNP	.											ADCY8,colon,carcinoma,0,2	ADCY8	291	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1752C						.						151.0	138.0	142.0					8																	131916177		2203	4300	6503	SO:0001819	synonymous_variant	114	exon7			TAAGTAAGTTTCG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1752T>C	chr8.hg19:g.131916177A>G		103.0	0.0		184.0	39.0	NM_001115		Silent	SNP	ENST00000286355.5	hg19	CCDS6363.1																																																																																			.	.		0.483	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
TG	7038	hgsc.bcm.edu	37	8	133894143	133894143	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:133894143A>C	ENST00000220616.4	+	6	714	c.674A>C	c.(673-675)cAg>cCg	p.Q225P	TG_ENST00000377869.1_Missense_Mutation_p.Q225P	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	225	Thyroglobulin type-1 3. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGTTCCTTCCAGAGGAGGTTC	0.498																																					p.Q225P		Atlas-SNP	.											.	TG	416	.	0			c.A674C						.						126.0	109.0	115.0					8																	133894143		2203	4300	6503	SO:0001583	missense	7038	exon6			CCTTCCAGAGGAG	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.674A>C	chr8.hg19:g.133894143A>C	ENSP00000220616:p.Gln225Pro	87.0	0.0		128.0	14.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057174	0.36277	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.63913	-0.07;-0.07	5.36	1.52	0.23074	Thyroglobulin type-1 (2);	0.466052	0.19105	N	0.122600	T	0.33411	0.0862	N	0.08118	0	0.23464	N	0.997621	P	0.38335	0.627	B	0.25759	0.063	T	0.17379	-1.0371	10	0.87932	D	0	.	9.204	0.37278	0.3058:0.0:0.6942:0.0	.	225	P01266	THYG_HUMAN	P	225	ENSP00000367100:Q225P;ENSP00000220616:Q225P	ENSP00000220616:Q225P	Q	+	2	0	TG	133963325	1.000000	0.71417	0.979000	0.43373	0.423000	0.31445	2.780000	0.47742	-0.001000	0.14495	-0.468000	0.05107	CAG	.	.		0.498	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
COL22A1	169044	hgsc.bcm.edu	37	8	139727943	139727943	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:139727943T>C	ENST00000303045.6	-	30	2945	c.2499A>G	c.(2497-2499)aaA>aaG	p.K833K	COL22A1_ENST00000435777.1_Silent_p.K833K|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	833	Collagen-like 6.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTCGGTCACCTTTCAGTCCTG	0.373										HNSCC(7;0.00092)																											p.K833K		Atlas-SNP	.											.	COL22A1	390	.	0			c.A2499G						.						92.0	99.0	96.0					8																	139727943		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon30			GTCACCTTTCAGT	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2499A>G	chr8.hg19:g.139727943T>C		64.0	0.0		126.0	8.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.		0.373	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
DENND3	22898	hgsc.bcm.edu	37	8	142160957	142160957	+	Missense_Mutation	SNP	A	A	G	rs531863353		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:142160957A>G	ENST00000262585.2	+	6	798	c.520A>G	c.(520-522)Att>Gtt	p.I174V	DENND3_ENST00000519811.1_Missense_Mutation_p.I254V|DENND3_ENST00000424248.1_Missense_Mutation_p.I174V	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	174	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GTCGCTCCAGATTGTGTTACC	0.547													A|||	1	0.000199681	0.0	0.0	5008	,	,		16755	0.0		0.0	False		,,,				2504	0.001				p.I174V		Atlas-SNP	.											.	DENND3	127	.	0			c.A520G						.						150.0	143.0	145.0					8																	142160957		2203	4300	6503	SO:0001583	missense	22898	exon6			CTCCAGATTGTGT	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.520A>G	chr8.hg19:g.142160957A>G	ENSP00000262585:p.Ile174Val	74.0	0.0		130.0	53.0	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	hg19	CCDS34947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.593|2.593	-0.294721|-0.294721	0.05568|0.05568	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000518668|ENST00000262585;ENST00000424248;ENST00000519811;ENST00000520986;ENST00000523058	.|T;T;T;T;T	.|0.46819	.|2.72;2.72;2.72;2.72;0.86	5.4|5.4	-1.02|-1.02	0.10135|0.10135	.|DENN (3);	.|0.270871	.|0.40144	.|N	.|0.001163	T|T	0.31358|0.31358	0.0794|0.0794	L|L	0.29908|0.29908	0.895|0.895	0.35351|0.35351	D|D	0.78735|0.78735	.|B;B	.|0.25772	.|0.134;0.031	.|B;B	.|0.28465	.|0.09;0.058	T|T	0.25433|0.25433	-1.0132|-1.0132	5|10	.|0.22706	.|T	.|0.39	-4.0707|-4.0707	11.2567|11.2567	0.49058|0.49058	0.7414:0.0:0.2586:0.0|0.7414:0.0:0.2586:0.0	.|.	.|254;174	.|E9PF32;A2RUS2	.|.;DEND3_HUMAN	G|V	230|174;174;254;176;275	.|ENSP00000262585:I174V;ENSP00000410594:I174V;ENSP00000428714:I254V;ENSP00000429780:I176V;ENSP00000430786:I275V	.|ENSP00000262585:I174V	D|I	+|+	2|1	0|0	DENND3|DENND3	142230139|142230139	0.954000|0.954000	0.32549|0.32549	0.691000|0.691000	0.30163|0.30163	0.006000|0.006000	0.05464|0.05464	0.419000|0.419000	0.21247|0.21247	-0.018000|-0.018000	0.14079|0.14079	-0.441000|-0.441000	0.05720|0.05720	GAT|ATT	.	.		0.547	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
COMMD5	28991	hgsc.bcm.edu	37	8	146076399	146076399	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:146076399A>C	ENST00000305103.3	-	2	577	c.325T>G	c.(325-327)Ttc>Gtc	p.F109V	COMMD5_ENST00000450361.2_Missense_Mutation_p.F109V|COMMD5_ENST00000402718.3_Missense_Mutation_p.F109V|AF235103.1_ENST00000578937.1_RNA	NM_014066.3	NP_054785.2	Q9GZQ3	COMD5_HUMAN	COMM domain containing 5	109						nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|ovary(1)|pancreas(1)	11	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			TGGTCCCTGAAGGTGTCAGGC	0.662																																					p.F109V		Atlas-SNP	.											.	COMMD5	18	.	0			c.T325G						.						13.0	15.0	14.0					8																	146076399		2188	4275	6463	SO:0001583	missense	28991	exon2			CCCTGAAGGTGTC	AK023070	CCDS6436.1	8q24.3	2006-11-06				ENSG00000170619			17902	protein-coding gene	gene with protein product		608216				15799966, 10918053	Standard	NM_014066		Approved	HT002, FLJ13008, HCaRG	uc003zem.3	Q9GZQ3		ENST00000305103.3:c.325T>G	chr8.hg19:g.146076399A>C	ENSP00000304544:p.Phe109Val	76.0	0.0		166.0	34.0	NM_001081004	D3DWN7|Q9NVN6|Q9UHX5	Missense_Mutation	SNP	ENST00000305103.3	hg19	CCDS6436.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.673715	0.29693	.	.	ENSG00000170619	ENST00000402718;ENST00000450361;ENST00000305103;ENST00000529143;ENST00000533270	T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92	4.32	3.14	0.36123	.	0.000000	0.85682	D	0.000000	T	0.21307	0.0513	M	0.76838	2.35	0.22185	N	0.999304	D	0.56746	0.977	P	0.52672	0.706	T	0.05419	-1.0886	10	0.51188	T	0.08	-0.7699	7.9679	0.30111	0.7914:0.2086:0.0:0.0	.	109	Q9GZQ3	COMD5_HUMAN	V	109	ENSP00000385793:F109V;ENSP00000394331:F109V;ENSP00000304544:F109V;ENSP00000435552:F109V;ENSP00000433758:F109V	ENSP00000304544:F109V	F	-	1	0	COMMD5	146047203	0.009000	0.17119	0.517000	0.27799	0.009000	0.06853	1.236000	0.32683	0.794000	0.33899	-0.472000	0.04984	TTC	.	.		0.662	COMMD5-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382962.1	NM_014066	
JAK2	3717	hgsc.bcm.edu	37	9	5069060	5069060	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:5069060A>G	ENST00000381652.3	+	11	1859	c.1365A>G	c.(1363-1365)acA>acG	p.T455T	JAK2_ENST00000544510.1_Silent_p.T306T|JAK2_ENST00000539801.1_Silent_p.T455T	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	455	SH2; atypical. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GTTTGATTACAAAAAATGAGA	0.343		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.T455T		Atlas-SNP	.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	35466	.	0			c.A1365G						.						71.0	73.0	72.0					9																	5069060		2203	4299	6502	SO:0001819	synonymous_variant	3717	exon11	Familial Cancer Database		GATTACAAAAAAT		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1365A>G	chr9.hg19:g.5069060A>G		169.0	0.0		169.0	30.0	NM_004972	O14636|O75297	Silent	SNP	ENST00000381652.3	hg19	CCDS6457.1																																																																																			.	.		0.343	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
PTPRD	5789	hgsc.bcm.edu	37	9	8404601	8404601	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:8404601T>A	ENST00000381196.4	-	33	4689	c.4146A>T	c.(4144-4146)ccA>ccT	p.P1382P	PTPRD_ENST00000397611.3_Silent_p.P972P|PTPRD_ENST00000397606.3_Silent_p.P975P|PTPRD_ENST00000360074.4_Silent_p.P1369P|PTPRD_ENST00000486161.1_Silent_p.P975P|PTPRD_ENST00000540109.1_Silent_p.P1382P|PTPRD_ENST00000356435.5_Silent_p.P1382P|PTPRD_ENST00000537002.1_Silent_p.P972P|PTPRD_ENST00000355233.5_Silent_p.P976P|PTPRD_ENST00000397617.3_Silent_p.P975P|PTPRD_ENST00000358503.5_Silent_p.P1360P	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1382	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATCTATTCTTTGGTTTGTTTA	0.373										TSP Lung(15;0.13)																											p.P1382P		Atlas-SNP	.											.	PTPRD	1348	.	0			c.A4146T						.						186.0	159.0	168.0					9																	8404601		2203	4300	6503	SO:0001819	synonymous_variant	5789	exon36			ATTCTTTGGTTTG	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4146A>T	chr9.hg19:g.8404601T>A		114.0	0.0		81.0	18.0	NM_002839	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	hg19	CCDS43786.1																																																																																			.	.		0.373	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
IFNA16	3449	hgsc.bcm.edu	37	9	21217203	21217203	+	Silent	SNP	A	A	G	rs372911133		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:21217203A>G	ENST00000380216.1	-	1	107	c.102T>C	c.(100-102)aaT>aaC	p.N34N		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	34					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		AGGCCCTCCTATTACCCAGGC	0.507																																					p.N34N		Atlas-SNP	.											.	IFNA16	27	.	0			c.T102C						.						92.0	93.0	93.0					9																	21217203		2203	4298	6501	SO:0001819	synonymous_variant	3449	exon1			CCTCCTATTACCC		CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.102T>C	chr9.hg19:g.21217203A>G		209.0	0.0		195.0	40.0	NM_002173	Q5VV12	Silent	SNP	ENST00000380216.1	hg19	CCDS34996.1																																																																																			.	.		0.507	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051892.1	NM_002173	
KIF24	347240	hgsc.bcm.edu	37	9	34311028	34311028	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:34311028T>A	ENST00000402558.2	-	1	341	c.317A>T	c.(316-318)aAt>aTt	p.N106I	KIF24_ENST00000379166.2_Missense_Mutation_p.N106I|KIF24_ENST00000379174.3_Missense_Mutation_p.N106I|KIF24_ENST00000345050.2_Missense_Mutation_p.N106I			Q5T7B8	KIF24_HUMAN	kinesin family member 24	106					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			TCTGTCTTTATTGTCAGCAGG	0.433																																					p.N106I		Atlas-SNP	.											.	KIF24	64	.	0			c.A317T						.						93.0	85.0	87.0					9																	34311028		1893	4127	6020	SO:0001583	missense	347240	exon2			TCTTTATTGTCAG	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.317A>T	chr9.hg19:g.34311028T>A	ENSP00000384433:p.Asn106Ile	123.0	0.0		121.0	23.0	NM_194313	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	hg19	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	T	8.982	0.975524	0.18736	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.71698	-0.4;-0.59;-0.4;-0.59	5.33	-4.14	0.03892	.	0.754197	0.11456	N	0.562281	T	0.55689	0.1936	L	0.44542	1.39	0.09310	N	1	B;B	0.20671	0.047;0.028	B;B	0.21360	0.034;0.015	T	0.41858	-0.9485	10	0.36615	T	0.2	.	7.6252	0.28208	0.0:0.4459:0.1312:0.4229	.	106;106	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	I	106	ENSP00000384433:N106I;ENSP00000368472:N106I;ENSP00000368464:N106I;ENSP00000340179:N106I	ENSP00000340179:N106I	N	-	2	0	KIF24	34301028	0.006000	0.16342	0.068000	0.19968	0.266000	0.26442	0.032000	0.13732	-0.841000	0.04200	-0.280000	0.10049	AAT	.	.		0.433	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
KIAA1045	23349	hgsc.bcm.edu	37	9	34977626	34977626	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:34977626A>T	ENST00000242315.3	+	7	1176	c.1094A>T	c.(1093-1095)gAg>gTg	p.E365V	KIAA1045_ENST00000544237.1_Missense_Mutation_p.E365V|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	365							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CTGCCCACAGAGCAGGAGTCC	0.582																																					p.E365V		Atlas-SNP	.											.	KIAA1045	60	.	0			c.A1094T						.						28.0	33.0	31.0					9																	34977626		2145	4245	6390	SO:0001583	missense	23349	exon7			CCACAGAGCAGGA	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.1094A>T	chr9.hg19:g.34977626A>T	ENSP00000242315:p.Glu365Val	166.0	0.0		177.0	33.0	NM_015297	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	hg19	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.526022	0.64860	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.43	5.43	0.79202	.	0.798454	0.11351	N	0.572965	T	0.48978	0.1530	N	0.24115	0.695	0.47621	D	0.999472	B	0.24043	0.096	B	0.30943	0.122	T	0.41963	-0.9479	9	0.52906	T	0.07	0.353	12.8631	0.57924	1.0:0.0:0.0:0.0	.	365	Q9UPV7	K1045_HUMAN	V	365	.	ENSP00000242315:E365V	E	+	2	0	KIAA1045	34967626	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	4.767000	0.62286	2.069000	0.61940	0.533000	0.62120	GAG	.	.		0.582	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592	
C9orf131	138724	hgsc.bcm.edu	37	9	35043491	35043491	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:35043491A>T	ENST00000312292.5	+	2	912	c.865A>T	c.(865-867)Agg>Tgg	p.R289W	FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000421362.2_Missense_Mutation_p.R241W|C9orf131_ENST00000354479.5_Missense_Mutation_p.R216W	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	289										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CCTCCATCTGAGGCCCTTCCC	0.562																																					p.R289W		Atlas-SNP	.											.	C9orf131	71	.	0			c.A865T						.						124.0	116.0	119.0					9																	35043491		2203	4300	6503	SO:0001583	missense	138724	exon2			CATCTGAGGCCCT	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.865A>T	chr9.hg19:g.35043491A>T	ENSP00000308279:p.Arg289Trp	91.0	0.0		98.0	22.0	NM_203299	A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	ENST00000312292.5	hg19	CCDS6572.2	.	.	.	.	.	.	.	.	.	.	A	17.01	3.278764	0.59758	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292;ENST00000378745	T;T;T;T	0.33865	2.38;2.38;2.38;1.39	4.84	2.33	0.28932	.	0.903341	0.09370	N	0.811445	T	0.39279	0.1072	L	0.44542	1.39	0.09310	N	1	P;P;P	0.50443	0.935;0.935;0.935	P;P;P	0.49528	0.614;0.614;0.614	T	0.22800	-1.0206	10	0.87932	D	0	-0.6903	8.7327	0.34510	0.6228:0.3772:0.0:0.0	.	289;216;241	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	W	241;216;289;254	ENSP00000393683:R241W;ENSP00000346472:R216W;ENSP00000308279:R289W;ENSP00000368019:R254W	ENSP00000308279:R289W	R	+	1	2	C9orf131	35033491	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	0.554000	0.23407	0.287000	0.22375	0.533000	0.62120	AGG	.	.		0.562	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299	
PRUNE2	158471	hgsc.bcm.edu	37	9	79320733	79320733	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:79320733A>G	ENST00000376718.3	-	8	6580	c.6457T>C	c.(6457-6459)Ttt>Ctt	p.F2153L	PRUNE2_ENST00000428286.1_Missense_Mutation_p.F1794L	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2153					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GATGGGACAAACTCCCGTCCA	0.512																																					p.F2153L		Atlas-SNP	.											.	PRUNE2	331	.	0			c.T6457C						.						124.0	114.0	117.0					9																	79320733		1568	3582	5150	SO:0001583	missense	158471	exon8			GGACAAACTCCCG	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6457T>C	chr9.hg19:g.79320733A>G	ENSP00000365908:p.Phe2153Leu	67.0	0.0		42.0	11.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.125|2.125	-0.400496|-0.400496	0.04865|0.04865	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.39787|.	1.06;1.06|.	5.25|5.25	2.81|2.81	0.32909|0.32909	.|.	1.041720|.	0.07533|.	N|.	0.912570|.	T|T	0.37404|0.37404	0.1002|0.1002	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.24693|0.24693	-1.0153|-1.0153	10|5	0.02654|.	T|.	1|.	0.136|0.136	4.9378|4.9378	0.13950|0.13950	0.7173:0.0:0.1426:0.1401|0.7173:0.0:0.1426:0.1401	.|.	2153|.	Q8WUY3|.	PRUN2_HUMAN|.	L|A	2153;1794;2152|1474	ENSP00000365908:F2153L;ENSP00000397425:F1794L|.	ENSP00000365908:F2153L|.	F|V	-|-	1|2	0|0	PRUNE2|PRUNE2	78510553|78510553	0.000000|0.000000	0.05858|0.05858	0.017000|0.017000	0.16124|0.16124	0.011000|0.011000	0.07611|0.07611	0.839000|0.839000	0.27586|0.27586	0.972000|0.972000	0.38314|0.38314	0.533000|0.533000	0.62120|0.62120	TTT|GTT	.	.		0.512	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
WNK2	65268	hgsc.bcm.edu	37	9	95992093	95992093	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:95992093A>T	ENST00000297954.4	+	2	797	c.797A>T	c.(796-798)aAg>aTg	p.K266M	WNK2_ENST00000349097.3_De_novo_Start_OutOfFrame|WNK2_ENST00000427277.2_De_novo_Start_OutOfFrame|WNK2_ENST00000395475.2_Missense_Mutation_p.K252M|WNK2_ENST00000356055.3_De_novo_Start_OutOfFrame|WNK2_ENST00000395477.2_Missense_Mutation_p.K266M	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TCCAGCGCCAAGGGCAAGCGG	0.622																																					p.K266M		Atlas-SNP	.											.	WNK2	277	.	0			c.A797T						.						70.0	55.0	60.0					9																	95992093		2203	4300	6503	SO:0001583	missense	65268	exon2			GCGCCAAGGGCAA	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.797A>T	chr9.hg19:g.95992093A>T	ENSP00000297954:p.Lys266Met	64.0	0.0		64.0	11.0	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.55|17.55	3.418189|3.418189	0.62622|0.62622	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000448039;ENST00000297954;ENST00000395477;ENST00000395475|ENST00000432730	T;T;T;T|.	0.73363|.	-0.74;-0.66;-0.65;-0.74|.	5.43|5.43	2.97|2.97	0.34412|0.34412	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.109140|.	0.64402|.	D|.	0.000010|.	T|T	0.56077|0.56077	0.1961|0.1961	L|L	0.43757|0.43757	1.38|1.38	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.71674|.	0.998;0.996;0.998;0.998|.	P;P;P;D|.	0.65684|.	0.854;0.854;0.854;0.937|.	T|T	0.46582|0.46582	-0.9181|-0.9181	10|5	0.87932|.	D|.	0|.	.|.	11.5841|11.5841	0.50908|0.50908	0.9182:0.0:0.0818:0.0|0.9182:0.0:0.0818:0.0	.|.	266;266;266;266|.	Q9Y3S1-2;Q9Y3S1-4;F8W9F9;Q9Y3S1|.	.;.;.;WNK2_HUMAN|.	M|W	266;266;266;252|262	ENSP00000412465:K266M;ENSP00000297954:K266M;ENSP00000378860:K266M;ENSP00000378858:K252M|.	ENSP00000297954:K266M|.	K|R	+|+	2|1	0|2	WNK2|WNK2	95031914|95031914	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.995000|0.995000	0.86356|0.86356	3.918000|3.918000	0.56432|0.56432	0.325000|0.325000	0.23359|0.23359	0.533000|0.533000	0.62120|0.62120	AAG|AGG	.	.		0.622	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
OR13C5	138799	hgsc.bcm.edu	37	9	107360745	107360745	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:107360745T>A	ENST00000374779.2	-	1	1043	c.950A>T	c.(949-951)aAc>aTc	p.N317I		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						CATTTACTTGTTAAAATTTTT	0.343																																					p.N317I		Atlas-SNP	.											.	OR13C5	60	.	0			c.A950T						.						75.0	84.0	81.0					9																	107360745		2203	4300	6503	SO:0001583	missense	138799	exon1			TACTTGTTAAAAT		CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.950A>T	chr9.hg19:g.107360745T>A	ENSP00000363911:p.Asn317Ile	58.0	0.0		61.0	12.0	NM_001004482	B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	ENST00000374779.2	hg19	CCDS35091.1	.	.	.	.	.	.	.	.	.	.	T	6.960	0.547096	0.13312	.	.	ENSG00000255800	ENST00000374779	T	0.09163	3.01	2.83	-1.12	0.09808	.	1.248280	0.06317	U	0.703833	T	0.04770	0.0129	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.42548	-0.9445	10	0.27082	T	0.32	.	2.8935	0.05684	0.1955:0.2601:0.0:0.5444	.	317	Q8NGS8	O13C5_HUMAN	I	317	ENSP00000363911:N317I	ENSP00000363911:N317I	N	-	2	0	OR13C5	106400566	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-1.732000	0.01851	-0.083000	0.12618	0.528000	0.53228	AAC	.	.		0.343	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053479.2	NM_001004482	
C5	727	hgsc.bcm.edu	37	9	123789473	123789473	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:123789473T>A	ENST00000223642.1	-	8	867	c.838A>T	c.(838-840)Aaa>Taa	p.K280*		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	280					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	ATCATTTCTTTTTGATCATCT	0.343																																					p.K280X		Atlas-SNP	.											.	C5	124	.	0			c.A838T						.						283.0	207.0	233.0					9																	123789473		2202	4299	6501	SO:0001587	stop_gained	727	exon8			TTTCTTTTTGATC	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.838A>T	chr9.hg19:g.123789473T>A	ENSP00000223642:p.Lys280*	42.0	0.0		39.0	6.0	NM_001735	Q14CJ0|Q27I61	Nonsense_Mutation	SNP	ENST00000223642.1	hg19	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	T	35	5.548472	0.96488	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	.	.	.	5.75	4.62	0.57501	.	0.000000	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4505	0.38723	0.0:0.0794:0.0:0.9206	.	.	.	.	X	280;351	.	ENSP00000223642:K280X	K	-	1	0	C5	122829294	0.997000	0.39634	0.795000	0.32087	0.984000	0.73092	3.255000	0.51484	1.020000	0.39573	0.533000	0.62120	AAA	.	.		0.343	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
OR1N2	138882	hgsc.bcm.edu	37	9	125316382	125316382	+	Silent	SNP	A	A	C	rs369499080		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:125316382A>C	ENST00000373688.2	+	1	992	c.934A>C	c.(934-936)Aga>Cga	p.R312R		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						CTTGAGGAACAGAGACATGAA	0.403																																					p.R312R		Atlas-SNP	.											.	OR1N2	51	.	0			c.A934C						.						109.0	109.0	109.0					9																	125316382		2203	4300	6503	SO:0001819	synonymous_variant	138882	exon1			AGGAACAGAGACA		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.934A>C	chr9.hg19:g.125316382A>C		61.0	0.0		59.0	5.0	NM_001004457	A3KFM2|B2RNY4|Q6IF17|Q96RA3	Silent	SNP	ENST00000373688.2	hg19	CCDS35123.1																																																																																			.	.		0.403	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2		
NR5A1	2516	hgsc.bcm.edu	37	9	127262932	127262932	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:127262932G>A	ENST00000373588.4	-	4	503	c.307C>T	c.(307-309)Cgg>Tgg	p.R103W		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	103					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						TTCAGGGCCCGGTCCCGCTTG	0.667																																					p.R103W		Atlas-SNP	.											.	NR5A1	32	.	0			c.C307T						.						40.0	45.0	43.0					9																	127262932		2137	4088	6225	SO:0001583	missense	2516	exon4			GGGCCCGGTCCCG	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.307C>T	chr9.hg19:g.127262932G>A	ENSP00000362690:p.Arg103Trp	70.0	0.0		74.0	14.0	NM_004959	O15196|Q5T6F5	Missense_Mutation	SNP	ENST00000373588.4	hg19	CCDS6856.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709003	0.68615	.	.	ENSG00000136931	ENST00000373588;ENST00000455734	D;D	0.94862	-3.54;-3.47	4.54	2.64	0.31445	Zinc finger, NHR/GATA-type (1);Nuclear hormone receptor, ligand-binding (1);	0.056932	0.64402	D	0.000001	D	0.96673	0.8914	M	0.80982	2.52	0.50632	D	0.999885	D	0.76494	0.999	D	0.70716	0.97	D	0.96120	0.9084	10	0.87932	D	0	.	12.7537	0.57321	0.0:0.0:0.7408:0.2592	.	103	Q13285	STF1_HUMAN	W	103	ENSP00000362690:R103W;ENSP00000393245:R103W	ENSP00000362690:R103W	R	-	1	2	NR5A1	126302753	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	2.600000	0.46240	0.335000	0.23614	0.561000	0.74099	CGG	.	.		0.667	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
NUP214	8021	hgsc.bcm.edu	37	9	134026017	134026017	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:134026017G>T	ENST00000359428.5	+	16	2286	c.2142G>T	c.(2140-2142)caG>caT	p.Q714H	NUP214_ENST00000451030.1_Missense_Mutation_p.Q715H|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.Q704H|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	714	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.Q714H(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CACACTTTCAGAAGGAGTTGG	0.458			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.Q714H	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	NUP214,bladder,carcinoma,0,1	NUP214	166	.	1	Substitution - Missense(1)	urinary_tract(1)	c.G2142T						.						95.0	99.0	98.0					9																	134026017		2203	4300	6503	SO:0001583	missense	8021	exon16			CTTTCAGAAGGAG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.2142G>T	chr9.hg19:g.134026017G>T	ENSP00000352400:p.Gln714His	126.0	0.0		137.0	18.0	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.904419	0.72868	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	T;T;T	0.36878	1.25;1.23;1.23	5.84	2.44	0.29823	.	0.000000	0.41712	D	0.000825	T	0.33673	0.0871	N	0.08118	0	0.54753	D	0.999988	D;D;D;D	0.89917	0.996;1.0;0.994;1.0	D;D;D;D	0.91635	0.989;0.999;0.943;0.999	T	0.25187	-1.0139	10	0.87932	D	0	-13.6507	6.2748	0.20975	0.5255:0.0:0.4745:0.0	.	703;308;704;714	P35658-2;Q5JUP9;P35658-4;P35658	.;.;.;NU214_HUMAN	H	714;704;715;703;308;143	ENSP00000352400:Q714H;ENSP00000396576:Q704H;ENSP00000405014:Q715H	ENSP00000352400:Q714H	Q	+	3	2	NUP214	133015838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.883000	0.39658	0.400000	0.25396	0.655000	0.94253	CAG	.	.		0.458	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
WDR5	11091	hgsc.bcm.edu	37	9	137023062	137023062	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:137023062T>C	ENST00000358625.3	+	14	1123	c.952T>C	c.(952-954)Tct>Cct	p.S318P	WDR5_ENST00000425041.1_Missense_Mutation_p.S318P	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	318					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		CATCATCGCCTCTGCTGCGCT	0.517																																					p.S318P		Atlas-SNP	.											.	WDR5	29	.	0			c.T952C						.						155.0	129.0	138.0					9																	137023062		2203	4300	6503	SO:0001583	missense	11091	exon13			ATCGCCTCTGCTG	AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.952T>C	chr9.hg19:g.137023062T>C	ENSP00000351446:p.Ser318Pro	101.0	0.0		89.0	18.0	NM_052821	Q91VA5|Q9NWX7|Q9UGP9	Missense_Mutation	SNP	ENST00000358625.3	hg19	CCDS6981.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.866752	0.72065	.	.	ENSG00000196363	ENST00000358625;ENST00000425041	T;T	0.72725	-0.68;-0.68	4.19	4.19	0.49359	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.245923	0.35040	N	0.003496	D	0.84705	0.5531	H	0.95402	3.665	0.80722	D	1	D	0.56746	0.977	P	0.54372	0.75	D	0.89180	0.3543	10	0.87932	D	0	.	12.7294	0.57189	0.0:0.0:0.0:1.0	.	318	P61964	WDR5_HUMAN	P	318	ENSP00000351446:S318P;ENSP00000401889:S318P	ENSP00000351446:S318P	S	+	1	0	WDR5	136012883	1.000000	0.71417	0.987000	0.45799	0.600000	0.36913	7.202000	0.77856	1.677000	0.50941	0.459000	0.35465	TCT	.	.		0.517	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254621.1	NM_052821	
INPP5E	56623	hgsc.bcm.edu	37	9	139324161	139324161	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr9:139324161C>G	ENST00000371712.3	-	10	2303	c.1901G>C	c.(1900-1902)aGt>aCt	p.S634T		NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		GGAGTTCTGACTCTGTAGTGC	0.463																																					p.S634T		Atlas-SNP	.											.	INPP5E	18	.	0			c.G1901C						.						249.0	232.0	238.0					9																	139324161		2203	4300	6503	SO:0001583	missense	56623	exon10			TTCTGACTCTGTA	AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.1901G>C	chr9.hg19:g.139324161C>G	ENSP00000360777:p.Ser634Thr	76.0	0.0		69.0	7.0	NM_019892	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371712.3	hg19	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	C	5.899	0.350029	0.11182	.	.	ENSG00000148384	ENST00000371712	D	0.97505	-4.41	5.27	-6.52	0.01872	.	0.692933	0.14651	N	0.306610	D	0.89908	0.6851	N	0.22421	0.69	0.09310	N	1	B;B	0.18166	0.007;0.026	B;B	0.11329	0.006;0.005	T	0.79624	-0.1726	10	0.30078	T	0.28	-7.7169	6.3837	0.21550	0.0:0.3211:0.3875:0.2914	.	600;634	Q9NRR6-2;Q9NRR6	.;INP5E_HUMAN	T	634	ENSP00000360777:S634T	ENSP00000360777:S634T	S	-	2	0	INPP5E	138443982	0.260000	0.24053	0.000000	0.03702	0.002000	0.02628	-0.214000	0.09292	-1.509000	0.01798	-1.290000	0.01357	AGT	.	.		0.463	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1	NM_019892	
NEBL	10529	hgsc.bcm.edu	37	10	21169807	21169807	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:21169807A>T	ENST00000377122.4	-	5	792	c.396T>A	c.(394-396)gcT>gcA	p.A132A	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000377119.1_Silent_p.A132A|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	132				KHDAAKGFSD -> NMMLPRILS (in Ref. 2; AAF24858). {ECO:0000305}.	cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ATCCTTTGGCAGCATCATGTT	0.413																																					p.A132A		Atlas-SNP	.											.	NEBL	199	.	0			c.T396A						.						131.0	132.0	132.0					10																	21169807		2203	4300	6503	SO:0001819	synonymous_variant	10529	exon5			TTTGGCAGCATCA	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.396T>A	chr10.hg19:g.21169807A>T		78.0	0.0		70.0	11.0	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	hg19	CCDS7134.1																																																																																			.	.		0.413	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
FAM13C	220965	hgsc.bcm.edu	37	10	61043201	61043201	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:61043201C>T	ENST00000373868.2	-	6	601	c.514G>A	c.(514-516)Gct>Act	p.A172T	FAM13C_ENST00000442566.3_Missense_Mutation_p.A193T|FAM13C_ENST00000277705.6_Missense_Mutation_p.A193T|RP11-443O13.3_ENST00000433249.1_RNA|FAM13C_ENST00000422313.2_Missense_Mutation_p.A172T|FAM13C_ENST00000373867.3_Missense_Mutation_p.A89T|FAM13C_ENST00000419214.2_Missense_Mutation_p.A172T|FAM13C_ENST00000435852.2_Missense_Mutation_p.A172T|FAM13C_ENST00000468840.2_Missense_Mutation_p.A89T	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	172										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACCTGAGCAGCTTCTTCCTGG	0.537																																					p.A172T		Atlas-SNP	.											.	FAM13C	124	.	0			c.G514A						.						132.0	130.0	131.0					10																	61043201		2203	4300	6503	SO:0001583	missense	220965	exon6			GAGCAGCTTCTTC	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.514G>A	chr10.hg19:g.61043201C>T	ENSP00000362975:p.Ala172Thr	50.0	0.0		65.0	9.0	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	hg19	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.737195	0.30774	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T;T	0.77358	-1.08;0.97;-1.09;-1.09;0.95;-1.08;0.97;0.97	4.85	3.93	0.45458	.	0.365106	0.26227	N	0.025594	T	0.62060	0.2397	L	0.35414	1.06	0.26536	N	0.974178	B;B;B;B;B	0.21147	0.023;0.007;0.052;0.005;0.007	B;B;B;B;B	0.17433	0.018;0.006;0.018;0.007;0.01	T	0.42310	-0.9459	10	0.14252	T	0.57	-4.4575	7.8516	0.29457	0.0:0.8044:0.0:0.1956	.	172;89;172;172;172	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	T	89;172;193;193;172;89;172;172	ENSP00000362974:A89T;ENSP00000362975:A172T;ENSP00000395661:A193T;ENSP00000277705:A193T;ENSP00000391993:A172T;ENSP00000423896:A89T;ENSP00000392302:A172T;ENSP00000400241:A172T	ENSP00000277705:A193T	A	-	1	0	FAM13C	60713207	0.990000	0.36364	0.998000	0.56505	0.963000	0.63663	1.946000	0.40283	2.388000	0.81334	0.563000	0.77884	GCT	.	.		0.537	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
FAM13C	220965	hgsc.bcm.edu	37	10	61112104	61112104	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:61112104T>C	ENST00000373868.2	-	3	337	c.250A>G	c.(250-252)Atg>Gtg	p.M84V	FAM13C_ENST00000442566.3_Missense_Mutation_p.M84V|FAM13C_ENST00000277705.6_Missense_Mutation_p.M84V|FAM13C_ENST00000422313.2_Missense_Mutation_p.M84V|FAM13C_ENST00000373867.3_Start_Codon_SNP_p.M1V|FAM13C_ENST00000419214.2_Missense_Mutation_p.M84V|FAM13C_ENST00000435852.2_Missense_Mutation_p.M84V|FAM13C_ENST00000468840.2_Start_Codon_SNP_p.M1V	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	84										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						AAGTTGCCCATGCTGGGTCGC	0.602																																					p.M84V		Atlas-SNP	.											.	FAM13C	124	.	0			c.A250G						.						79.0	78.0	78.0					10																	61112104		2203	4300	6503	SO:0001583	missense	220965	exon3			TGCCCATGCTGGG	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.250A>G	chr10.hg19:g.61112104T>C	ENSP00000362975:p.Met84Val	57.0	0.0		69.0	20.0	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	hg19	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.357715	0.61403	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000512919;ENST00000503444	T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	5.93	5.93	0.95920	.	0.142968	0.50627	D	0.000108	T	0.74951	0.3784	L	0.56769	1.78	0.80722	D	1	B;D;B;D;B	0.58268	0.264;0.982;0.264;0.982;0.167	B;D;B;D;B	0.68943	0.085;0.961;0.085;0.961;0.053	T	0.77067	-0.2725	10	0.72032	D	0.01	.	13.8054	0.63227	0.0:0.0:0.0:1.0	.	84;1;84;84;84	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	V	1;84;84;84;84;1;84;84;1;1	ENSP00000362975:M84V;ENSP00000395661:M84V;ENSP00000277705:M84V;ENSP00000391993:M84V;ENSP00000392302:M84V;ENSP00000400241:M84V	ENSP00000277705:M84V	M	-	1	0	FAM13C	60782110	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.258000	0.58822	2.281000	0.76405	0.529000	0.55759	ATG	.	.		0.602	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
PTEN	5728	hgsc.bcm.edu	37	10	89720791	89720791	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:89720791A>G	ENST00000371953.3	+	8	2299	c.942A>G	c.(940-942)gaA>gaG	p.E314E	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	314	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.E314fs*3(2)|p.G165_*404del(1)|p.W274_F341del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ATGACAAGGAATATCTAGTAC	0.338		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.E314E		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,other,+2,2	PTEN	3652	.	52	Whole gene deletion(37)|Deletion - Frameshift(11)|Deletion - In frame(2)|Unknown(2)	prostate(16)|central_nervous_system(13)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)|endometrium(1)	c.A942G						.						103.0	101.0	101.0					10																	89720791		2203	4299	6502	SO:0001819	synonymous_variant	5728	exon8	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	CAAGGAATATCTA	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.942A>G	chr10.hg19:g.89720791A>G		389.0	0.0		313.0	50.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Silent	SNP	ENST00000371953.3	hg19	CCDS31238.1																																																																																			.	.		0.338	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
IFIT2	3433	hgsc.bcm.edu	37	10	91066479	91066479	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:91066479T>A	ENST00000371826.3	+	2	935	c.766T>A	c.(766-768)Ttt>Att	p.F256I	LIPA_ENST00000487618.1_Intron|LIPA_ENST00000371837.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	256					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				TGCAGCCAAGTTTTATCGAAG	0.443																																					p.F256I		Atlas-SNP	.											.	IFIT2	39	.	0			c.T766A						.						91.0	90.0	91.0					10																	91066479		1972	4182	6154	SO:0001583	missense	3433	exon2			GCCAAGTTTTATC	M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.766T>A	chr10.hg19:g.91066479T>A	ENSP00000360891:p.Phe256Ile	118.0	0.0		187.0	20.0	NM_001547	Q5T767	Missense_Mutation	SNP	ENST00000371826.3	hg19	CCDS41548.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.740146	0.49045	.	.	ENSG00000119922	ENST00000371826	T	0.35048	1.33	4.58	-0.607	0.11615	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.230914	0.35646	U	0.003076	T	0.43634	0.1256	M	0.86651	2.83	0.31969	N	0.607455	P	0.43392	0.805	B	0.44224	0.444	T	0.57596	-0.7784	10	0.87932	D	0	-0.9185	9.019	0.36188	0.0:0.262:0.0:0.738	.	256	P09913	IFIT2_HUMAN	I	256	ENSP00000360891:F256I	ENSP00000360891:F256I	F	+	1	0	IFIT2	91056459	0.980000	0.34600	0.013000	0.15412	0.208000	0.24298	1.896000	0.39789	-0.085000	0.12573	-0.242000	0.12053	TTT	.	.		0.443	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049293.1	NM_001547	
SFRP5	6425	hgsc.bcm.edu	37	10	99527306	99527306	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:99527306A>T	ENST00000266066.3	-	3	1037	c.919T>A	c.(919-921)Tac>Aac	p.Y307N		NM_003015.3	NP_003006.2	Q5T4F7	SFRP5_HUMAN	secreted frizzled-related protein 5	307					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cell differentiation (GO:0030154)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|establishment or maintenance of cell polarity (GO:0007163)|gonad development (GO:0008406)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of Wnt signaling pathway involved in digestive tract morphogenesis (GO:2000057)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|post-anal tail morphogenesis (GO:0036342)|signal transduction (GO:0007165)|vasculature development (GO:0001944)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			large_intestine(1)|lung(4)	5		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)		AAGAAAGGGTAGTAGAGGGAG	0.582																																					p.Y307N		Atlas-SNP	.											.	SFRP5	32	.	0			c.T919A						.						56.0	44.0	48.0					10																	99527306		2200	4299	6499	SO:0001583	missense	6425	exon3			AAGGGTAGTAGAG	AF017988	CCDS7472.1	10q24	2008-07-10			ENSG00000120057	ENSG00000120057		"""Secreted frizzled-related proteins"""	10779	protein-coding gene	gene with protein product	"""secreted apoptosis related protein 3"""	604158				9391078	Standard	NM_003015		Approved	SARP3	uc001kor.4	Q5T4F7	OTTHUMG00000018866	ENST00000266066.3:c.919T>A	chr10.hg19:g.99527306A>T	ENSP00000266066:p.Tyr307Asn	104.0	0.0		99.0	27.0	NM_003015	O14780|Q86TH7	Missense_Mutation	SNP	ENST00000266066.3	hg19	CCDS7472.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159064	0.38119	.	.	ENSG00000120057	ENST00000266066	T	0.29142	1.58	5.74	5.74	0.90152	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.194860	0.44483	D	0.000451	T	0.19005	0.0456	N	0.22421	0.69	0.34179	D	0.670694	B	0.29253	0.239	B	0.26517	0.07	T	0.25363	-1.0134	10	0.46703	T	0.11	.	6.8138	0.23819	0.7651:0.1534:0.0815:0.0	.	307	Q5T4F7	SFRP5_HUMAN	N	307	ENSP00000266066:Y307N	ENSP00000266066:Y307N	Y	-	1	0	SFRP5	99517296	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.258000	0.58822	2.189000	0.69895	0.459000	0.35465	TAC	.	.		0.582	SFRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049742.1	NM_003015	
SORCS3	22986	hgsc.bcm.edu	37	10	106865232	106865232	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:106865232A>C	ENST00000369701.3	+	7	1398	c.1171A>C	c.(1171-1173)Atc>Ctc	p.I391L		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	391					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CTCCATTGACATCAGTTCCCT	0.502																																					p.I391L	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.A1171C						.						182.0	153.0	163.0					10																	106865232		2203	4300	6503	SO:0001583	missense	22986	exon7			ATTGACATCAGTT	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1171A>C	chr10.hg19:g.106865232A>C	ENSP00000358715:p.Ile391Leu	94.0	0.0		75.0	16.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	A	9.222	1.033532	0.19590	.	.	ENSG00000156395	ENST00000369701	T	0.29655	1.56	5.43	1.85	0.25348	VPS10 (1);	0.294151	0.37715	N	0.001979	T	0.15739	0.0379	L	0.34521	1.04	0.34961	D	0.752204	B	0.24618	0.107	B	0.19391	0.025	T	0.15636	-1.0430	10	0.11182	T	0.66	.	3.1378	0.06444	0.638:0.0:0.1865:0.1754	.	391	Q9UPU3	SORC3_HUMAN	L	391	ENSP00000358715:I391L	ENSP00000358715:I391L	I	+	1	0	SORCS3	106855222	0.989000	0.36119	1.000000	0.80357	0.994000	0.84299	0.273000	0.18662	0.354000	0.24105	0.379000	0.24179	ATC	.	.		0.502	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
FAM160B1	57700	hgsc.bcm.edu	37	10	116608453	116608453	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:116608453A>G	ENST00000369248.4	+	13	2095	c.1760A>G	c.(1759-1761)gAg>gGg	p.E587G	FAM160B1_ENST00000369250.3_Missense_Mutation_p.E587G	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	587										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						TACCATGTTGAGGGCACAGGA	0.423																																					p.E587G		Atlas-SNP	.											.	FAM160B1	107	.	0			c.A1760G						.						127.0	98.0	108.0					10																	116608453		2203	4300	6503	SO:0001583	missense	57700	exon13			ATGTTGAGGGCAC	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1760A>G	chr10.hg19:g.116608453A>G	ENSP00000358251:p.Glu587Gly	64.0	0.0		92.0	15.0	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	hg19	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.368553	0.61624	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.16897	2.33;2.31	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.18299	0.0439	L	0.40543	1.245	0.80722	D	1	B;B	0.24043	0.096;0.018	B;B	0.29862	0.108;0.018	T	0.03641	-1.1017	10	0.30078	T	0.28	-23.6696	16.0529	0.80775	1.0:0.0:0.0:0.0	.	587;587	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	G	587	ENSP00000358251:E587G;ENSP00000358253:E587G	ENSP00000358251:E587G	E	+	2	0	FAM160B1	116598443	1.000000	0.71417	0.998000	0.56505	0.670000	0.39368	8.971000	0.93419	2.257000	0.74773	0.459000	0.35465	GAG	.	.		0.423	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
C10orf90	118611	hgsc.bcm.edu	37	10	128150126	128150126	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:128150126T>A	ENST00000284694.7	-	5	1683	c.1563A>T	c.(1561-1563)gtA>gtT	p.V521V	C10orf90_ENST00000544758.1_Silent_p.V618V|C10orf90_ENST00000454341.1_Silent_p.V424V|C10orf90_ENST00000480379.1_5'UTR|C10orf90_ENST00000356858.3_Silent_p.V474V	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	521					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CCTTTATTTTTACAACCAAGT	0.522																																					p.V521V		Atlas-SNP	.											.	C10orf90	121	.	0			c.A1563T						.						70.0	69.0	69.0					10																	128150126		2203	4300	6503	SO:0001819	synonymous_variant	118611	exon5			TATTTTTACAACC	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1563A>T	chr10.hg19:g.128150126T>A		103.0	0.0		80.0	7.0	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	ENST00000284694.7	hg19	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	T	1.076	-0.668350	0.03428	.	.	ENSG00000154493	ENST00000424927	.	.	.	4.81	-9.63	0.00544	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.982	4.56	0.12156	0.1801:0.3712:0.344:0.1046	.	.	.	.	L	64	.	.	X	-	2	2	C10orf90	128140116	0.010000	0.17322	0.002000	0.10522	0.268000	0.26511	-0.977000	0.03782	-2.852000	0.00330	-1.288000	0.01363	TAA	.	.		0.522	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
C10orf90	118611	hgsc.bcm.edu	37	10	128193605	128193605	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr10:128193605G>A	ENST00000284694.7	-	3	284	c.164C>T	c.(163-165)tCc>tTc	p.S55F	C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000544758.1_Missense_Mutation_p.S152F|C10orf90_ENST00000454341.1_Missense_Mutation_p.S55F|C10orf90_ENST00000392694.1_Missense_Mutation_p.S8F|C10orf90_ENST00000356858.3_Missense_Mutation_p.S8F	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	55					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		AATCATCTGGGAGATGACTAT	0.433																																					p.S55F		Atlas-SNP	.											.	C10orf90	121	.	0			c.C164T						.						117.0	110.0	112.0					10																	128193605		2203	4300	6503	SO:0001583	missense	118611	exon3			ATCTGGGAGATGA	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.164C>T	chr10.hg19:g.128193605G>A	ENSP00000284694:p.Ser55Phe	59.0	0.0		71.0	17.0	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	hg19	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489742	0.44249	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.51325	0.99;0.94;1.12;1.01;0.71	4.76	4.76	0.60689	.	0.137327	0.34088	N	0.004277	T	0.67316	0.2880	M	0.65498	2.005	0.35554	D	0.804104	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.76575	0.988;0.988;0.983;0.977;0.961	T	0.77032	-0.2738	10	0.87932	D	0	-11.8858	16.9636	0.86279	0.0:0.0:1.0:0.0	.	152;152;8;55;55	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	F	8;55;55;152;55;8;8	ENSP00000284694:S55F;ENSP00000398786:S55F;ENSP00000444369:S152F;ENSP00000405995:S55F;ENSP00000376459:S8F	ENSP00000284694:S55F	S	-	2	0	C10orf90	128183595	1.000000	0.71417	0.150000	0.22450	0.043000	0.13939	6.002000	0.70693	2.473000	0.83533	0.561000	0.74099	TCC	.	.		0.433	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
CD151	977	hgsc.bcm.edu	37	11	836089	836089	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:836089A>G	ENST00000397420.3	+	3	269	c.20A>G	c.(19-21)aAg>aGg	p.K7R	CD151_ENST00000397421.1_Missense_Mutation_p.K7R|CD151_ENST00000322008.4_Missense_Mutation_p.K7R|CD151_ENST00000528011.1_Missense_Mutation_p.K7R			P48509	CD151_HUMAN	CD151 molecule (Raph blood group)	7					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|T cell proliferation (GO:0042098)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCAACGAGAAGAAGACAACA	0.632																																					p.K7R	Esophageal Squamous(14;501 559 15826 37823 38305)	Atlas-SNP	.											.	CD151	7	.	0			c.A20G						.						100.0	80.0	87.0					11																	836089		2198	4295	6493	SO:0001583	missense	977	exon2			ACGAGAAGAAGAC	AL161965, BC013302, D29963	CCDS7719.1	11p15.5	2014-07-18	2006-03-28		ENSG00000177697	ENSG00000177697		"""CD molecules"", ""Blood group antigens"", ""Tetraspanins"""	1630	protein-coding gene	gene with protein product		602243	"""CD151 antigen"", ""CD151 antigen (Raph blood group)"""			9070943	Standard	NM_004357		Approved	SFA-1, PETA-3, TSPAN24, RAPH	uc001lsb.3	P48509	OTTHUMG00000133311	ENST00000397420.3:c.20A>G	chr11.hg19:g.836089A>G	ENSP00000380565:p.Lys7Arg	97.0	0.0		99.0	16.0	NM_139030	A8KAK8|E9PI15|Q14826|Q86U54|Q96TE3	Missense_Mutation	SNP	ENST00000397420.3	hg19	CCDS7719.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.650800	0.29336	.	.	ENSG00000177697	ENST00000397420;ENST00000525718;ENST00000322008;ENST00000397421;ENST00000529810;ENST00000528143;ENST00000526693;ENST00000525333;ENST00000524748;ENST00000527341;ENST00000528867;ENST00000530320;ENST00000526439;ENST00000528011	T;T;T;T;T;T;T;T;T;T;T;T;T	0.37411	1.2;1.92;1.2;1.2;1.44;2.01;1.9;2.07;2.07;1.92;2.01;1.44;1.2	4.72	4.72	0.59763	.	0.484709	0.24267	N	0.040030	T	0.30572	0.0769	L	0.36672	1.1	0.43947	D	0.996618	B	0.25772	0.134	B	0.23419	0.046	T	0.08848	-1.0702	10	0.44086	T	0.13	.	14.343	0.66641	1.0:0.0:0.0:0.0	.	7	P48509	CD151_HUMAN	R	7	ENSP00000380565:K7R;ENSP00000435854:K7R;ENSP00000324101:K7R;ENSP00000380566:K7R;ENSP00000432258:K7R;ENSP00000435054:K7R;ENSP00000431671:K7R;ENSP00000431403:K7R;ENSP00000436591:K7R;ENSP00000433752:K7R;ENSP00000433787:K7R;ENSP00000434663:K7R;ENSP00000432990:K7R	ENSP00000324101:K7R	K	+	2	0	CD151	826089	1.000000	0.71417	0.944000	0.38274	0.081000	0.17604	6.344000	0.72991	1.989000	0.58080	0.459000	0.35465	AAG	.	.		0.632	CD151-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257108.1	NM_004357	
MUC6	4588	hgsc.bcm.edu	37	11	1030299	1030299	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:1030299T>A	ENST00000421673.2	-	8	979	c.929A>T	c.(928-930)gAg>gTg	p.E310V		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	310	TIL.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGAGCCGCACTCCTGGTACAC	0.706																																					p.E310V		Atlas-SNP	.											.	MUC6	408	.	0			c.A929T						.						10.0	14.0	13.0					11																	1030299		1953	3805	5758	SO:0001583	missense	4588	exon8			CCGCACTCCTGGT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.929A>T	chr11.hg19:g.1030299T>A	ENSP00000406861:p.Glu310Val	136.0	0.0		121.0	20.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	t	13.85	2.361108	0.41801	.	.	ENSG00000184956	ENST00000421673	D	0.91521	-2.86	4.33	3.16	0.36331	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.94032	0.8088	M	0.75150	2.29	0.37776	D	0.926849	D	0.89917	1.0	D	0.83275	0.996	D	0.94082	0.7345	9	0.87932	D	0	.	10.1612	0.42853	0.0:0.0819:0.0:0.9181	.	310	Q6W4X9	MUC6_HUMAN	V	310	ENSP00000406861:E310V	ENSP00000406861:E310V	E	-	2	0	MUC6	1020299	1.000000	0.71417	0.416000	0.26546	0.500000	0.33767	4.308000	0.59129	0.606000	0.29965	0.409000	0.27619	GAG	.	.		0.706	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
TSSC4	10078	hgsc.bcm.edu	37	11	2424234	2424234	+	Missense_Mutation	SNP	G	G	T	rs1008265	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:2424234G>T	ENST00000333256.6	+	3	814	c.371G>T	c.(370-372)cGg>cTg	p.R124L	TSSC4_ENST00000451491.2_Missense_Mutation_p.R124L|AC124057.5_ENST00000433035.1_RNA|TSSC4_ENST00000380992.1_Missense_Mutation_p.R60L|TSSC4_ENST00000380996.5_Missense_Mutation_p.R60L			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	124			R -> Q (in dbSNP:rs1008265).							endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCTTCAAGCGGCCCCTAGCG	0.682																																					p.R124L		Atlas-SNP	.											.	TSSC4	19	.	0			c.G371T						.						16.0	18.0	17.0					11																	2424234		2196	4292	6488	SO:0001583	missense	10078	exon2			TCAAGCGGCCCCT	AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.371G>T	chr11.hg19:g.2424234G>T	ENSP00000331087:p.Arg124Leu	156.0	0.0		135.0	22.0	NM_005706	C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	ENST00000333256.6	hg19	CCDS7735.1	.	.	.	.	.	.	.	.	.	.	G	4.270	0.049272	0.08243	.	.	ENSG00000184281	ENST00000380996;ENST00000333256;ENST00000380992;ENST00000437110;ENST00000440813;ENST00000496468;ENST00000451491	T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66	3.52	-3.56	0.04626	.	0.407543	0.21227	U	0.078048	T	0.32615	0.0835	L	0.52266	1.64	0.20196	N	0.999926	B;B	0.24768	0.111;0.111	B;B	0.23275	0.045;0.045	T	0.14783	-1.0460	10	0.26408	T	0.33	-0.1386	7.1129	0.25401	0.4049:0.0:0.4887:0.1064	.	124;60	Q9Y5U2;Q9Y5U2-2	TSSC4_HUMAN;.	L	60;124;60;124;60;124;124	ENSP00000370384:R60L;ENSP00000331087:R124L;ENSP00000370380:R60L;ENSP00000396925:R124L;ENSP00000416937:R60L;ENSP00000435013:R124L;ENSP00000411224:R124L	ENSP00000331087:R124L	R	+	2	0	TSSC4	2380810	0.017000	0.18338	0.000000	0.03702	0.005000	0.04900	0.245000	0.18142	-1.474000	0.01879	-1.587000	0.00848	CGG	.	G|0.988;A|0.012		0.682	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027369.3	NM_005706	
OR56B1	387748	hgsc.bcm.edu	37	11	5757966	5757966	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:5757966A>T	ENST00000317121.3	+	1	286	c.220A>T	c.(220-222)Atc>Ttc	p.I74F	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		TTTCCTTGGCATCCTCTGTAT	0.483																																					p.I74F		Atlas-SNP	.											.	OR56B1	38	.	0			c.A220T						.						197.0	174.0	181.0					11																	5757966		2201	4297	6498	SO:0001583	missense	387748	exon1			CTTGGCATCCTCT	BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.220A>T	chr11.hg19:g.5757966A>T	ENSP00000322939:p.Ile74Phe	117.0	0.0		98.0	19.0	NM_001005180	B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	ENST00000317121.3	hg19	CCDS31395.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.049610	0.36181	.	.	ENSG00000181023	ENST00000317121	T	0.02974	4.09	5.91	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.366108	0.19923	U	0.103057	T	0.02970	0.0088	L	0.35249	1.045	0.32892	D	0.512035	B	0.26775	0.159	B	0.30105	0.111	T	0.12116	-1.0560	10	0.72032	D	0.01	-3.4468	6.3772	0.21513	0.7459:0.0:0.2541:0.0	.	74	Q8NGI3	O56B1_HUMAN	F	74	ENSP00000322939:I74F	ENSP00000322939:I74F	I	+	1	0	OR56B1	5714542	0.017000	0.18338	0.976000	0.42696	0.736000	0.42039	2.819000	0.48049	1.074000	0.40909	0.533000	0.62120	ATC	.	.		0.483	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143354.1	NM_001005180	
USP47	55031	hgsc.bcm.edu	37	11	11944273	11944273	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:11944273A>G	ENST00000399455.2	+	12	1401	c.1281A>G	c.(1279-1281)aaA>aaG	p.K427K	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Silent_p.K407K|USP47_ENST00000339865.5_Silent_p.K339K	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	427	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TTATTAAGAAATCTCCTCAGA	0.333																																					p.K339K		Atlas-SNP	.											.	USP47	91	.	0			c.A1017G						.						64.0	59.0	61.0					11																	11944273		1837	4094	5931	SO:0001819	synonymous_variant	55031	exon10			TAAGAAATCTCCT	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.1281A>G	chr11.hg19:g.11944273A>G		126.0	0.0		109.0	18.0	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Silent	SNP	ENST00000399455.2	hg19																																																																																				.	.		0.333	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
LUZP2	338645	hgsc.bcm.edu	37	11	24936037	24936037	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:24936037G>T	ENST00000336930.6	+	7	541	c.475G>T	c.(475-477)Gcc>Tcc	p.A159S	LUZP2_ENST00000533227.1_Missense_Mutation_p.A73S			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	159						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						AAAAATCCAAGCCCAGCTGAA	0.338																																					p.A159S		Atlas-SNP	.											.	LUZP2	90	.	0			c.G475T						.						89.0	90.0	89.0					11																	24936037		2203	4300	6503	SO:0001583	missense	338645	exon7			ATCCAAGCCCAGC	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.475G>T	chr11.hg19:g.24936037G>T	ENSP00000336817:p.Ala159Ser	286.0	0.0		322.0	39.0	NM_001009909	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	hg19	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436867	0.43224	.	.	ENSG00000187398	ENST00000336930;ENST00000533227	T;T	0.24151	1.87;1.87	5.54	2.61	0.31194	.	0.226555	0.37577	N	0.002031	T	0.13798	0.0334	N	0.20986	0.625	0.34678	D	0.724451	B	0.30709	0.291	B	0.29598	0.104	T	0.27365	-1.0076	10	0.15066	T	0.55	-5.5054	7.9728	0.30138	0.0763:0.0:0.6397:0.284	.	159	Q86TE4	LUZP2_HUMAN	S	159;73	ENSP00000336817:A159S;ENSP00000432952:A73S	ENSP00000336817:A159S	A	+	1	0	LUZP2	24892613	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	4.184000	0.58323	0.280000	0.22209	0.467000	0.42956	GCC	.	.		0.338	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	
LUZP2	338645	hgsc.bcm.edu	37	11	24936045	24936045	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:24936045G>A	ENST00000336930.6	+	7	549	c.483G>A	c.(481-483)ctG>ctA	p.L161L	LUZP2_ENST00000533227.1_Silent_p.L75L			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	161						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						AAGCCCAGCTGAAGGAGCTTC	0.323																																					p.L161L		Atlas-SNP	.											.	LUZP2	90	.	0			c.G483A						.						90.0	92.0	91.0					11																	24936045		2203	4300	6503	SO:0001819	synonymous_variant	338645	exon7			CCAGCTGAAGGAG	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.483G>A	chr11.hg19:g.24936045G>A		280.0	0.0		325.0	41.0	NM_001009909	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Silent	SNP	ENST00000336930.6	hg19	CCDS31446.1																																																																																			.	.		0.323	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	
WT1	7490	hgsc.bcm.edu	37	11	32413561	32413561	+	Silent	SNP	G	G	T	rs374799820		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:32413561G>T	ENST00000379079.2	-	9	1026	c.753C>A	c.(751-753)tcC>tcA	p.S251S	WT1_ENST00000530998.1_Silent_p.S234S|WT1_ENST00000332351.3_Silent_p.S463S|WT1_ENST00000448076.3_Silent_p.S463S	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	395					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V380_S410del(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TCAGGTGGTCGGACCGGGAGA	0.423			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.S463S		Atlas-SNP	.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	744	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1389A						.						194.0	190.0	191.0					11																	32413561		2202	4299	6501	SO:0001819	synonymous_variant	7490	exon9	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	GTGGTCGGACCGG		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.753C>A	chr11.hg19:g.32413561G>T		109.0	0.0		129.0	24.0	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000379079.2	hg19	CCDS55751.1																																																																																			.	.		0.423	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
PTPRJ	5795	hgsc.bcm.edu	37	11	48188835	48188835	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:48188835A>G	ENST00000418331.2	+	25	4287	c.3935A>G	c.(3934-3936)cAg>cGg	p.Q1312R		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1312					contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CTTATCTACCAGAACACAACT	0.393																																					p.Q1312R		Atlas-SNP	.											.	PTPRJ	225	.	0			c.A3935G						.						174.0	159.0	164.0					11																	48188835		2201	4298	6499	SO:0001583	missense	5795	exon25			TCTACCAGAACAC	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3935A>G	chr11.hg19:g.48188835A>G	ENSP00000400010:p.Gln1312Arg	116.0	0.0		96.0	19.0	NM_002843	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	hg19	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	A	19.10	3.761987	0.69763	.	.	ENSG00000149177	ENST00000418331	T	0.15834	2.39	5.19	5.19	0.71726	.	.	.	.	.	T	0.29914	0.0748	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.02208	-1.1195	9	0.51188	T	0.08	.	12.9886	0.58606	1.0:0.0:0.0:0.0	.	1312	Q12913	PTPRJ_HUMAN	R	1312	ENSP00000400010:Q1312R	ENSP00000400010:Q1312R	Q	+	2	0	PTPRJ	48145411	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	8.561000	0.90715	1.968000	0.57251	0.377000	0.23210	CAG	.	.		0.393	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
TRIM49B	283116	hgsc.bcm.edu	37	11	49059297	49059297	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:49059297G>T	ENST00000332682.7	+	7	1155	c.1127G>T	c.(1126-1128)gGa>gTa	p.G376V		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	376	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						GGAGAGGATGGACTCTTTCTT	0.453																																					p.G376V		Atlas-SNP	.											.	TRIM49B	27	.	0			c.G1127T						.																																			SO:0001583	missense	283116	exon6			AGGATGGACTCTT		CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.1127G>T	chr11.hg19:g.49059297G>T	ENSP00000330216:p.Gly376Val	125.0	0.0		119.0	36.0	NM_001206626		Missense_Mutation	SNP	ENST00000332682.7	hg19	CCDS55762.1	.	.	.	.	.	.	.	.	.	.	G	8.862	0.947107	0.18356	.	.	ENSG00000182053	ENST00000332682	T	0.71698	-0.59	0.689	-1.23	0.09465	.	.	.	.	.	T	0.67515	0.2901	L	0.59436	1.845	0.09310	N	0.999999	.	.	.	.	.	.	T	0.61667	-0.7016	6	0.87932	D	0	.	.	.	.	.	.	.	.	V	376	ENSP00000330216:G376V	ENSP00000330216:G376V	G	+	2	0	AC084851.1	49015873	0.949000	0.32298	0.001000	0.08648	0.038000	0.13279	2.773000	0.47686	-0.403000	0.07622	0.184000	0.17185	GGA	.	.		0.453	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
OR5B21	219968	hgsc.bcm.edu	37	11	58275100	58275100	+	Missense_Mutation	SNP	C	C	T	rs376076638		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:58275100C>T	ENST00000360374.2	-	1	478	c.479G>A	c.(478-480)gGc>gAc	p.G160D		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TCTGAAGGTGCCTGCTGCATG	0.507																																					p.G160D		Atlas-SNP	.											.	OR5B21	59	.	0			c.G479A						.	C	ASP/GLY	1,4401	2.1+/-5.4	0,1,2200	86.0	73.0	77.0		479	2.7	0.4	11		77	0,8590		0,0,4295	no	missense	OR5B21	NM_001005218.1	94	0,1,6495	TT,TC,CC		0.0,0.0227,0.0077	benign	160/310	58275100	1,12991	2201	4295	6496	SO:0001583	missense	219968	exon1			AAGGTGCCTGCTG		CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283		"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product							Standard	NM_001005218		Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.479G>A	chr11.hg19:g.58275100C>T	ENSP00000353537:p.Gly160Asp	88.0	0.0		102.0	6.0	NM_001005218		Missense_Mutation	SNP	ENST00000360374.2	hg19	CCDS31552.1	.	.	.	.	.	.	.	.	.	.	C	3.171	-0.169907	0.06461	2.27E-4	0.0	ENSG00000198283	ENST00000360374	T	0.00091	8.74	5.04	2.74	0.32292	GPCR, rhodopsin-like superfamily (1);	0.425169	0.16326	N	0.219324	T	0.00073	0.0002	N	0.12422	0.21	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.05989	-1.0852	10	0.33940	T	0.23	-2.1452	6.9943	0.24774	0.0:0.2707:0.0:0.7293	.	160	A6NL26	OR5BL_HUMAN	D	160	ENSP00000353537:G160D	ENSP00000353537:G160D	G	-	2	0	OR5B21	58031676	0.000000	0.05858	0.376000	0.26042	0.474000	0.32979	-0.971000	0.03806	0.410000	0.25675	-0.302000	0.09304	GGC	.	.		0.507	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394891.1	NM_001005218	
OOSP2	219990	hgsc.bcm.edu	37	11	59814496	59814496	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:59814496A>G	ENST00000278855.2	+	4	612	c.427A>G	c.(427-429)Aca>Gca	p.T143A		NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		143						extracellular region (GO:0005576)				breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						TGACTTTCAGACAACAGCAGA	0.368																																					p.T143A		Atlas-SNP	.											.	PLAC1L	36	.	0			c.A427G						.						123.0	122.0	122.0					11																	59814496		2201	4295	6496	SO:0001583	missense	219990	exon4			TTTCAGACAACAG																												ENST00000278855.2:c.427A>G	chr11.hg19:g.59814496A>G	ENSP00000278855:p.Thr143Ala	113.0	0.0		123.0	47.0	NM_173801	E9PJA4|Q8N9U6	Missense_Mutation	SNP	ENST00000278855.2	hg19	CCDS7979.1	.	.	.	.	.	.	.	.	.	.	A	0.119	-1.127778	0.01770	.	.	ENSG00000149507	ENST00000278855	.	.	.	3.28	-2.03	0.07365	.	0.524017	0.14407	N	0.321537	T	0.19846	0.0477	N	0.10874	0.06	0.35961	D	0.834628	B	0.11235	0.004	B	0.09377	0.004	T	0.16512	-1.0400	9	0.15952	T	0.53	-2.1544	4.1675	0.10313	0.3359:0.4144:0.2497:0.0	.	143	Q86WS3	PLACL_HUMAN	A	143	.	ENSP00000278855:T143A	T	+	1	0	PLAC1L	59571072	0.000000	0.05858	0.240000	0.24138	0.885000	0.51271	-0.214000	0.09292	-0.433000	0.07286	-0.410000	0.06199	ACA	.	.		0.368	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1		
MS4A12	54860	hgsc.bcm.edu	37	11	60264908	60264908	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:60264908A>T	ENST00000016913.4	+	2	174	c.117A>T	c.(115-117)ttA>ttT	p.L39F	MS4A12_ENST00000537076.1_Missense_Mutation_p.L39F|MS4A12_ENST00000525951.1_3'UTR	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	39						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						CAATCAACTTAGAAAACCAAG	0.483																																					p.L39F		Atlas-SNP	.											.	MS4A12	44	.	0			c.A117T						.						91.0	88.0	89.0					11																	60264908		2203	4300	6503	SO:0001583	missense	54860	exon2			CAACTTAGAAAAC	AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.117A>T	chr11.hg19:g.60264908A>T	ENSP00000016913:p.Leu39Phe	188.0	0.0		166.0	12.0	NM_017716	F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	hg19	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.362249	0.24684	.	.	ENSG00000071203	ENST00000537076;ENST00000526784;ENST00000016913;ENST00000530007	T;T;T;T	0.48836	1.87;0.87;3.36;0.8	4.22	-3.93	0.04143	.	7739.210000	0.00166	N	0.000000	T	0.29190	0.0726	N	0.19112	0.55	0.09310	N	1	P;P	0.43094	0.799;0.697	B;B	0.41764	0.366;0.154	T	0.18241	-1.0343	10	0.09084	T	0.74	.	5.4813	0.16725	0.2853:0.3225:0.3922:0.0	.	39;39	E9PNI3;Q9NXJ0	.;M4A12_HUMAN	F	39	ENSP00000440424:L39F;ENSP00000431959:L39F;ENSP00000016913:L39F;ENSP00000434783:L39F	ENSP00000016913:L39F	L	+	3	2	MS4A12	60021484	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.492000	0.06467	-0.660000	0.05352	0.460000	0.39030	TTA	.	.		0.483	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1		
STX5	6811	hgsc.bcm.edu	37	11	62594819	62594819	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:62594819T>C	ENST00000294179.3	-	4	501	c.348A>G	c.(346-348)acA>acG	p.T116T	STX5_ENST00000541317.1_Silent_p.T20T|STX5_ENST00000394690.1_Silent_p.T62T|STX5_ENST00000377897.4_Silent_p.T116T	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	116					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)			breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						ACTCACAGATTGTCAGCTTCT	0.493																																					p.T116T		Atlas-SNP	.											.	STX5	42	.	0			c.A348G						.						179.0	161.0	167.0					11																	62594819		2201	4299	6500	SO:0001819	synonymous_variant	6811	exon4			ACAGATTGTCAGC	U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.348A>G	chr11.hg19:g.62594819T>C		102.0	0.0		111.0	12.0	NM_003164	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Silent	SNP	ENST00000294179.3	hg19	CCDS8038.2																																																																																			.	.		0.493	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290113.1	NM_003164	
SLC3A2	6520	hgsc.bcm.edu	37	11	62648792	62648792	+	Silent	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:62648792C>A	ENST00000377890.2	+	4	768	c.600C>A	c.(598-600)gcC>gcA	p.A200A	SLC3A2_ENST00000377889.2_Silent_p.A138A|SLC3A2_ENST00000536981.1_5'Flank|SLC3A2_ENST00000338663.7_Silent_p.A99A|SLC3A2_ENST00000535296.1_Silent_p.A169A|SLC3A2_ENST00000377891.2_Silent_p.A201A|SLC3A2_ENST00000377892.1_Silent_p.A231A	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	200					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						TTGCTGGTGCCGTGGTCATAA	0.682											OREG0021031	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A201A		Atlas-SNP	.											.	SLC3A2	55	.	0			c.C603A						.						12.0	12.0	12.0					11																	62648792		2188	4283	6471	SO:0001819	synonymous_variant	6520	exon4			TGGTGCCGTGGTC		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.600C>A	chr11.hg19:g.62648792C>A		79.0	0.0	1062	71.0	17.0	NM_001012662	Q13543	Silent	SNP	ENST00000377890.2	hg19	CCDS8039.2	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123616	0.37436	.	.	ENSG00000168003	ENST00000538084	.	.	.	5.04	-0.591	0.11675	.	.	.	.	.	T	0.54822	0.1882	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48714	-0.9011	4	.	.	.	-22.1282	8.835	0.35107	0.0:0.2947:0.5591:0.1462	.	.	.	.	Q	171	.	.	P	+	2	0	SLC3A2	62405368	0.985000	0.35326	0.998000	0.56505	0.941000	0.58515	0.137000	0.15995	-0.004000	0.14419	0.561000	0.74099	CCG	.	.		0.682	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661	
NPAS4	266743	hgsc.bcm.edu	37	11	66189687	66189687	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:66189687A>G	ENST00000311034.2	+	2	448	c.272A>G	c.(271-273)gAg>gGg	p.E91G		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	91	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TTCACAGCCGAGGGGAAATTG	0.597																																					p.E91G		Atlas-SNP	.											.	NPAS4	133	.	0			c.A272G						.						89.0	81.0	84.0					11																	66189687		2200	4295	6495	SO:0001583	missense	266743	exon2			CAGCCGAGGGGAA	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.272A>G	chr11.hg19:g.66189687A>G	ENSP00000311196:p.Glu91Gly	72.0	0.0		60.0	10.0	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	hg19	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	A	18.97	3.735815	0.69189	.	.	ENSG00000174576	ENST00000311034	T	0.19105	2.17	4.8	4.8	0.61643	PAS (2);	0.000000	0.56097	D	0.000026	T	0.25195	0.0612	M	0.63169	1.94	0.80722	D	1	B	0.25955	0.138	B	0.28638	0.092	T	0.06770	-1.0808	10	0.72032	D	0.01	-12.1785	12.6089	0.56540	1.0:0.0:0.0:0.0	.	91	Q8IUM7	NPAS4_HUMAN	G	91	ENSP00000311196:E91G	ENSP00000311196:E91G	E	+	2	0	NPAS4	65946263	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	5.525000	0.67110	2.142000	0.66516	0.460000	0.39030	GAG	.	.		0.597	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751320	76751320	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:76751320G>A	ENST00000533140.1	+	2	863	c.725G>A	c.(724-726)gGc>gAc	p.G242D	B3GNT6_ENST00000354301.5_Missense_Mutation_p.G242D|B3GNT6_ENST00000421061.1_Missense_Mutation_p.G153D			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						CAGCCACCCGGCCGCCACCTG	0.697																																					p.G242D		Atlas-SNP	.											.	B3GNT6	27	.	0			c.G725A						.						12.0	16.0	15.0					11																	76751320		2165	4256	6421	SO:0001583	missense	192134	exon2			CACCCGGCCGCCA	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.725G>A	chr11.hg19:g.76751320G>A	ENSP00000435352:p.Gly242Asp	33.0	0.0		29.0	10.0	NM_138706	Q4TTN0	Missense_Mutation	SNP	ENST00000533140.1	hg19	CCDS53681.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.124239	0.00342	.	.	ENSG00000198488	ENST00000533140;ENST00000354301;ENST00000421061	T;T;T	0.39997	1.05;1.05;1.05	2.71	-1.1	0.09872	.	0.533626	0.20401	N	0.093046	T	0.08537	0.0212	N	0.00317	-1.655	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.38672	-0.9650	10	0.06757	T	0.87	.	6.7572	0.23520	0.5492:0.0:0.4508:0.0	.	242	Q6ZMB0	B3GN6_HUMAN	D	242;242;153	ENSP00000435352:G242D;ENSP00000346256:G242D;ENSP00000403463:G153D	ENSP00000346256:G242D	G	+	2	0	B3GNT6	76428968	0.001000	0.12720	0.012000	0.15200	0.014000	0.08584	0.286000	0.18902	-0.257000	0.09459	-0.379000	0.06801	GGC	.	.		0.697	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
GRM5	2915	hgsc.bcm.edu	37	11	88780420	88780420	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:88780420C>A	ENST00000305447.4	-	1	770	c.621G>T	c.(619-621)aaG>aaT	p.K207N	GRM5_ENST00000418177.2_Missense_Mutation_p.K207N|GRM5_ENST00000305432.5_Missense_Mutation_p.K207N|GRM5_ENST00000393294.3_Missense_Mutation_p.K207N|GRM5_ENST00000393297.1_Missense_Mutation_p.K207N|GRM5_ENST00000455756.2_Missense_Mutation_p.K207N	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	207					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	AGTTGTACCTCTTCACTATGT	0.433																																					p.K207N		Atlas-SNP	.											.	GRM5	414	.	0			c.G621T						.						105.0	96.0	99.0					11																	88780420		2201	4299	6500	SO:0001583	missense	2915	exon2			GTACCTCTTCACT	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.621G>T	chr11.hg19:g.88780420C>A	ENSP00000306138:p.Lys207Asn	120.0	0.0		113.0	15.0	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	hg19	CCDS44694.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.92|16.92	3.255355|3.255355	0.59321|0.59321	.|.	.|.	ENSG00000168959|ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297;ENST00000393294|ENST00000449371	D;D;D;D;D;D|.	0.84370|.	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84|.	5.41|5.41	0.874|0.874	0.19124|0.19124	Extracellular ligand-binding receptor (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73536|0.73536	0.3599|0.3599	M|M	0.84082|0.84082	2.675|2.675	0.49130|0.49130	D|D	0.999754|0.999754	D;D;D|.	0.89917|.	0.968;1.0;1.0|.	P;D;D|.	0.83275|.	0.773;0.995;0.996|.	T|T	0.74206|0.74206	-0.3740|-0.3740	9|5	.|.	.|.	.|.	.|.	12.0599|12.0599	0.53557|0.53557	0.0:0.6557:0.0:0.3443|0.0:0.6557:0.0:0.3443	.|.	207;207;207|.	A8MT20;P41594-2;P41594|.	.;.;GRM5_HUMAN|.	N|I	207|40	ENSP00000402912:K207N;ENSP00000405690:K207N;ENSP00000305905:K207N;ENSP00000306138:K207N;ENSP00000376975:K207N;ENSP00000376972:K207N|.	.|.	K|R	-|-	3|2	2|0	GRM5|GRM5	88420068|88420068	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.985000|0.985000	0.73830|0.73830	0.782000|0.782000	0.26788|0.26788	0.254000|0.254000	0.21573|0.21573	-0.251000|-0.251000	0.11542|0.11542	AAG|AGA	.	.		0.433	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110451149	110451149	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:110451149T>C	ENST00000260283.4	-	16	2805	c.2521A>G	c.(2521-2523)Aca>Gca	p.T841A	ARHGAP20_ENST00000529591.1_Missense_Mutation_p.T384A|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.T815A|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.T805A|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.T815A|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.T805A|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.T818A	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	841					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CGCCGATGTGTCCTTGGACCC	0.488																																					p.T841A		Atlas-SNP	.											.	ARHGAP20	150	.	0			c.A2521G						.						118.0	112.0	114.0					11																	110451149		2201	4298	6499	SO:0001583	missense	57569	exon16			GATGTGTCCTTGG	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2521A>G	chr11.hg19:g.110451149T>C	ENSP00000260283:p.Thr841Ala	126.0	0.0		102.0	26.0	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	hg19	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	T	9.603	1.129115	0.21041	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.08282	3.11;3.11;3.16;3.11;3.11;3.11;3.11	4.65	2.31	0.28768	.	0.616334	0.15563	N	0.255846	T	0.02970	0.0088	N	0.02011	-0.69	0.20703	N	0.999869	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.0;0.001	T	0.41998	-0.9477	10	0.40728	T	0.16	.	5.8693	0.18795	0.1476:0.0816:0.0:0.7709	.	815;841;818	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	A	841;815;384;818;805;815;805	ENSP00000260283:T841A;ENSP00000349660:T815A;ENSP00000437905:T384A;ENSP00000432076:T818A;ENSP00000436319:T805A;ENSP00000436522:T815A;ENSP00000431399:T805A	ENSP00000260283:T841A	T	-	1	0	ARHGAP20	109956359	0.336000	0.24757	0.030000	0.17652	0.618000	0.37518	2.000000	0.40816	0.308000	0.22923	0.533000	0.62120	ACA	.	.		0.488	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
KMT2A	4297	hgsc.bcm.edu	37	11	118359362	118359362	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:118359362C>T	ENST00000389506.5	+	11	4366	c.4366C>T	c.(4366-4368)Cac>Tac	p.H1456Y	KMT2A_ENST00000534358.1_Missense_Mutation_p.H1456Y|KMT2A_ENST00000354520.4_Missense_Mutation_p.H1418Y			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1456					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TGAGCCCTTCCACAAGTTTTG	0.413																																					p.H1456Y		Atlas-SNP	.											.	MLL	548	.	0			c.C4366T						.						141.0	130.0	134.0					11																	118359362		2200	4296	6496	SO:0001583	missense	4297	exon11			CCCTTCCACAAGT	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4366C>T	chr11.hg19:g.118359362C>T	ENSP00000374157:p.His1456Tyr	124.0	0.0		83.0	18.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132936	0.77662	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000392873	D;D;D;D	0.99329	-5.01;-4.95;-4.81;-5.75	5.52	5.52	0.82312	Zinc finger, PHD-finger (1);Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.99450	0.9805	M	0.83012	2.62	0.80722	D	1	D;D	0.69078	0.978;0.997	D;D	0.75484	0.969;0.986	D	0.99047	1.0826	10	0.87932	D	0	.	19.8024	0.96513	0.0:1.0:0.0:0.0	.	1456;1456	E9PQG7;Q03164	.;MLL1_HUMAN	Y	1456;1456;1418;366;168	ENSP00000436786:H1456Y;ENSP00000374157:H1456Y;ENSP00000346516:H1418Y;ENSP00000376612:H168Y	ENSP00000346516:H1418Y	H	+	1	0	MLL	117864572	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.442000	0.80503	2.752000	0.94435	0.655000	0.94253	CAC	.	.		0.413	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
NTM	50863	hgsc.bcm.edu	37	11	132081914	132081914	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr11:132081914A>T	ENST00000374786.1	+	3	879		c.e3-1		NTM_ENST00000427481.2_Splice_Site|NTM_ENST00000374791.3_Splice_Site|NTM_ENST00000539799.1_Splice_Site|NTM_ENST00000374784.1_Splice_Site|NTM_ENST00000474900.1_Splice_Site|NTM_ENST00000425719.2_Splice_Site	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.?(2)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TTGTTTCCACAGTATCTCCCA	0.383																																					.		Atlas-SNP	.											NTM_ENST00000374791,NS,carcinoma,0,2	NTM	253	.	2	Unknown(2)	prostate(2)	c.401-2A>T						.						59.0	60.0	60.0					11																	132081914		2201	4297	6498	SO:0001630	splice_region_variant	50863	exon4			TTCCACAGTATCT	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.401-1A>T	chr11.hg19:g.132081914A>T		82.0	0.0		70.0	22.0	NM_001048209	A0MTT2|Q6UXJ3|Q86VJ9	Splice_Site	SNP	ENST00000374786.1	hg19	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062881	0.76187	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5764	0.84681	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NTM	131587124	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.420000	0.90256	2.371000	0.80710	0.533000	0.62120	.	.	.		0.383	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	Intron
B4GALNT3	283358	hgsc.bcm.edu	37	12	667798	667798	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:667798A>T	ENST00000266383.5	+	18	2745	c.2732A>T	c.(2731-2733)cAt>cTt	p.H911L		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	911					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			ATGAGGCTGCATTGTGGGGCC	0.582																																					p.H911L		Atlas-SNP	.											.	B4GALNT3	64	.	0			c.A2732T						.						106.0	87.0	93.0					12																	667798		2203	4300	6503	SO:0001583	missense	283358	exon18			GGCTGCATTGTGG	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2732A>T	chr12.hg19:g.667798A>T	ENSP00000266383:p.His911Leu	87.0	0.0		132.0	31.0	NM_173593	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	hg19	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.898015	0.52227	.	.	ENSG00000139044	ENST00000266383	T	0.33865	1.39	4.84	4.84	0.62591	.	0.309743	0.34067	N	0.004298	T	0.39937	0.1097	L	0.53249	1.67	0.36045	D	0.840368	B	0.33345	0.409	B	0.38755	0.281	T	0.53865	-0.8378	10	0.52906	T	0.07	-26.7237	14.7232	0.69323	1.0:0.0:0.0:0.0	.	911	Q6L9W6	B4GN3_HUMAN	L	911	ENSP00000266383:H911L	ENSP00000266383:H911L	H	+	2	0	B4GALNT3	538059	1.000000	0.71417	0.972000	0.41901	0.993000	0.82548	5.271000	0.65553	1.929000	0.55896	0.374000	0.22700	CAT	.	.		0.582	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
EPS8	2059	hgsc.bcm.edu	37	12	15777209	15777209	+	Missense_Mutation	SNP	G	G	T	rs150904526	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:15777209G>T	ENST00000281172.5	-	19	2613	c.2177C>A	c.(2176-2178)aCa>aAa	p.T726K	EPS8_ENST00000540613.1_Missense_Mutation_p.T466K|EPS8_ENST00000543523.1_Missense_Mutation_p.T726K|EPS8_ENST00000543612.1_Missense_Mutation_p.T726K|EPS8_ENST00000542903.1_Missense_Mutation_p.T466K	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	726	Effector region. {ECO:0000250}.|Helix bundle 1. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		ATCCTCTGGTGTGGAGTCGTA	0.468																																					p.T726K		Atlas-SNP	.											.	EPS8	70	.	0			c.C2177A						.						185.0	148.0	161.0					12																	15777209		2203	4300	6503	SO:0001583	missense	2059	exon19			TCTGGTGTGGAGT	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2177C>A	chr12.hg19:g.15777209G>T	ENSP00000281172:p.Thr726Lys	147.0	0.0		210.0	66.0	NM_004447	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	ENST00000281172.5	hg19	CCDS31753.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093235	0.36952	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	5.43	5.43	0.79202	.	0.405817	0.26700	N	0.022952	T	0.19248	0.0462	L	0.32530	0.975	0.41863	D	0.990237	B	0.12013	0.005	B	0.10450	0.005	T	0.05886	-1.0858	10	0.19590	T	0.45	-11.2335	19.4372	0.94801	0.0:0.0:1.0:0.0	.	726	Q12929	EPS8_HUMAN	K	726;726;726;466;466	ENSP00000441867:T726K;ENSP00000281172:T726K;ENSP00000442388:T726K;ENSP00000441888:T466K;ENSP00000437806:T466K	ENSP00000281172:T726K	T	-	2	0	EPS8	15668476	0.997000	0.39634	0.733000	0.30861	0.007000	0.05969	5.815000	0.69215	2.827000	0.97445	0.650000	0.86243	ACA	.	G|0.999;A|0.001		0.468	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
PIK3C2G	5288	hgsc.bcm.edu	37	12	18435472	18435472	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:18435472A>G	ENST00000266497.5	+	1	495	c.457A>G	c.(457-459)Aaa>Gaa	p.K153E	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.K153E|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.K153E|PIK3C2G_ENST00000535651.1_Missense_Mutation_p.K153E|RERGL_ENST00000541632.1_Intron			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	153					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AAGTTTGGATAAAATTAATCT	0.348																																					p.K153E		Atlas-SNP	.											.	PIK3C2G	315	.	0			c.A457G						.						53.0	54.0	54.0					12																	18435472		1809	4063	5872	SO:0001583	missense	5288	exon2			TTGGATAAAATTA	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.457A>G	chr12.hg19:g.18435472A>G	ENSP00000266497:p.Lys153Glu	69.0	0.0		101.0	15.0	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	hg19	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.818037	0.32145	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.62105	1.36;0.06;0.06;0.05	4.68	-6.98	0.01611	.	10.947600	0.00166	N	0.000000	T	0.41073	0.1143	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.23940	-1.0174	10	0.22109	T	0.4	-0.7851	9.4284	0.38595	0.345:0.1253:0.5298:0.0	.	153;153	F5H369;O75747	.;P3C2G_HUMAN	E	153	ENSP00000443850:K153E;ENSP00000404845:K153E;ENSP00000266497:K153E;ENSP00000445381:K153E	ENSP00000266497:K153E	K	+	1	0	PIK3C2G	18326739	0.001000	0.12720	0.000000	0.03702	0.412000	0.31113	-0.346000	0.07760	-1.465000	0.01899	0.533000	0.62120	AAA	.	.		0.348	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
GYS2	2998	hgsc.bcm.edu	37	12	21695505	21695505	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:21695505T>C	ENST00000261195.2	-	13	1824	c.1570A>G	c.(1570-1572)Atc>Gtc	p.I524V		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	524					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACACTGGGGATACCCATCACA	0.517																																					p.I524V	Colon(149;9 1820 3690 10544 50424)	Atlas-SNP	.											.	GYS2	110	.	0			c.A1570G						.						92.0	74.0	80.0					12																	21695505		2203	4300	6503	SO:0001583	missense	2998	exon13			TGGGGATACCCAT		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1570A>G	chr12.hg19:g.21695505T>C	ENSP00000261195:p.Ile524Val	282.0	0.0		313.0	58.0	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	hg19	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.089348	0.55968	.	.	ENSG00000111713	ENST00000261195	T	0.62498	0.02	5.34	5.34	0.76211	.	0.055179	0.64402	N	0.000001	T	0.63827	0.2544	N	0.20304	0.555	0.80722	D	1	P	0.50819	0.939	D	0.68943	0.961	T	0.58014	-0.7711	10	0.11794	T	0.64	-15.5221	15.4691	0.75426	0.0:0.0:0.0:1.0	.	524	P54840	GYS2_HUMAN	V	524	ENSP00000261195:I524V	ENSP00000261195:I524V	I	-	1	0	GYS2	21586772	1.000000	0.71417	0.929000	0.37066	0.981000	0.71138	7.854000	0.86942	2.240000	0.73641	0.528000	0.53228	ATC	.	.		0.517	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
PPHLN1	51535	hgsc.bcm.edu	37	12	42835193	42835193	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:42835193C>G	ENST00000395568.2	+	10	1070	c.986C>G	c.(985-987)tCt>tGt	p.S329C	PPHLN1_ENST00000256678.8_Missense_Mutation_p.S209C|PPHLN1_ENST00000337898.6_Missense_Mutation_p.S274C|PPHLN1_ENST00000395580.3_Missense_Mutation_p.S336C|PPHLN1_ENST00000317560.9_Missense_Mutation_p.S262C|PPHLN1_ENST00000432191.2_Missense_Mutation_p.S274C|PPHLN1_ENST00000358314.7_Missense_Mutation_p.S329C|PPHLN1_ENST00000552761.1_Missense_Mutation_p.S281C|PPHLN1_ENST00000549190.1_Missense_Mutation_p.S347C|PPHLN1_ENST00000449194.2_Missense_Mutation_p.S310C	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	329					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		TTAGAAAAGTCTATACAGTTT	0.378																																					p.S336C		Atlas-SNP	.											.	PPHLN1	101	.	0			c.C1007G						.						157.0	154.0	155.0					12																	42835193		2203	4300	6503	SO:0001583	missense	51535	exon11			AAAAGTCTATACA	AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.986C>G	chr12.hg19:g.42835193C>G	ENSP00000378935:p.Ser329Cys	76.0	0.0		110.0	11.0	NM_201515	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Missense_Mutation	SNP	ENST00000395568.2	hg19	CCDS31777.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612481	0.46631	.	.	ENSG00000134283	ENST00000549190;ENST00000395580;ENST00000337898;ENST00000358314;ENST00000395568;ENST00000256678;ENST00000449194;ENST00000552761;ENST00000317560;ENST00000432191	.	.	.	5.72	4.77	0.60923	.	0.488214	0.25148	N	0.032767	T	0.55401	0.1918	M	0.65975	2.015	0.32020	N	0.600909	B;B;B;B;B;B;B;B;B;B;B;B	0.31625	0.072;0.311;0.209;0.332;0.089;0.311;0.209;0.044;0.089;0.148;0.148;0.044	B;B;B;B;B;B;B;B;B;B;B;B	0.38954	0.066;0.187;0.161;0.286;0.109;0.134;0.161;0.081;0.103;0.222;0.178;0.099	T	0.65861	-0.6065	9	0.59425	D	0.04	-4.7703	11.5942	0.50964	0.1385:0.7278:0.1336:0.0	.	262;209;255;274;262;274;329;310;329;281;336;347	F8WF16;F8W6A0;B7Z695;B7Z8L1;B7Z615;Q8NEY8-3;Q8NEY8;E9PAX8;Q8NEY8-8;Q8NEY8-6;Q8NEY8-2;F8W0Q9	.;.;.;.;.;.;PPHLN_HUMAN;.;.;.;.;.	C	347;336;274;329;329;209;310;281;262;274	.	ENSP00000256678:S209C	S	+	2	0	PPHLN1	41121460	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.085000	0.50151	2.878000	0.98634	0.650000	0.86243	TCT	.	.		0.378	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404047.1	NM_201515	
KRT76	51350	hgsc.bcm.edu	37	12	53163335	53163335	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:53163335A>G	ENST00000332411.2	-	8	1570	c.1517T>C	c.(1516-1518)aTt>aCt	p.I506T		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	506	Tail.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTACTTACAAATGCACACGGC	0.453																																					p.I506T		Atlas-SNP	.											.	KRT76	72	.	0			c.T1517C						.						126.0	118.0	121.0					12																	53163335		2203	4300	6503	SO:0001583	missense	51350	exon8			TTACAAATGCACA	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1517T>C	chr12.hg19:g.53163335A>G	ENSP00000330101:p.Ile506Thr	66.0	0.0		95.0	13.0	NM_015848	B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	hg19	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.948659	0.73787	.	.	ENSG00000185069	ENST00000332411	D	0.83075	-1.68	4.83	4.83	0.62350	.	0.000000	0.46758	D	0.000262	T	0.82061	0.4955	N	0.08118	0	0.49213	D	0.999763	D	0.76494	0.999	D	0.79108	0.992	D	0.86398	0.1740	10	0.87932	D	0	.	14.7779	0.69743	1.0:0.0:0.0:0.0	.	506	Q01546	K22O_HUMAN	T	506	ENSP00000330101:I506T	ENSP00000330101:I506T	I	-	2	0	KRT76	51449602	0.993000	0.37304	0.997000	0.53966	0.942000	0.58702	3.091000	0.50199	2.100000	0.63781	0.533000	0.62120	ATT	.	.		0.453	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
KRT18	3875	hgsc.bcm.edu	37	12	53343284	53343284	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:53343284G>A	ENST00000388835.3	+	1	537	c.327G>A	c.(325-327)gaG>gaA	p.E109E	AC107016.2_ENST00000581256.1_RNA|KRT8_ENST00000552551.1_5'UTR|KRT8_ENST00000546897.1_Intron|KRT18_ENST00000388837.2_Silent_p.E109E|KRT18_ENST00000550600.1_Silent_p.E109E|KRT8_ENST00000549198.1_5'UTR	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	109	Coil 1A.|Interaction with TRADD.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						GGAGGCTGGAGAGCAAAATCC	0.572																																					p.E109E		Atlas-SNP	.											.	KRT18	31	.	0			c.G327A						.						29.0	35.0	33.0					12																	53343284		2203	4294	6497	SO:0001819	synonymous_variant	3875	exon1			GCTGGAGAGCAAA		CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.327G>A	chr12.hg19:g.53343284G>A		81.0	0.0		106.0	14.0	NM_000224	Q53G38|Q5U0N8|Q9BW26	Silent	SNP	ENST00000388835.3	hg19	CCDS31809.1																																																																																			.	.		0.572	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406405.1	NM_199187	
CAND1	55832	hgsc.bcm.edu	37	12	67692842	67692842	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:67692842A>G	ENST00000545606.1	+	7	1404	c.967A>G	c.(967-969)Atg>Gtg	p.M323V		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	323	Asp-rich.				cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		tgaaaatgcaatggatgctga	0.294																																					p.M323V		Atlas-SNP	.											.	CAND1	100	.	0			c.A967G						.						48.0	45.0	46.0					12																	67692842		2199	4297	6496	SO:0001583	missense	55832	exon7			AATGCAATGGATG		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.967A>G	chr12.hg19:g.67692842A>G	ENSP00000442318:p.Met323Val	36.0	0.0		50.0	11.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.012736	0.35511	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047;ENST00000544619	T;T	0.30448	1.53;1.53	5.57	5.57	0.84162	Armadillo-type fold (1);	0.078727	0.85682	N	0.000000	T	0.43787	0.1263	L	0.58969	1.84	0.80722	D	1	B;B	0.28667	0.219;0.005	P;B	0.44623	0.455;0.006	T	0.31138	-0.9954	9	.	.	.	-4.4344	15.3948	0.74784	1.0:0.0:0.0:0.0	.	323;323	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	V	323;323;165;31	ENSP00000442318:M323V;ENSP00000444089:M31V	.	M	+	1	0	CAND1	65979109	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.951000	0.93025	2.102000	0.63906	0.533000	0.62120	ATG	.	.		0.294	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72037930	72037930	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:72037930T>C	ENST00000378743.3	-	5	1806	c.1448A>G	c.(1447-1449)gAa>gGa	p.E483G		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	483					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATTGTACTGTTCTTCCTGATT	0.358																																					p.E483G		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.A1448G						.						176.0	160.0	165.0					12																	72037930		1854	4103	5957	SO:0001583	missense	196441	exon5			TACTGTTCTTCCT	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.1448A>G	chr12.hg19:g.72037930T>C	ENSP00000368017:p.Glu483Gly	122.0	0.0		121.0	15.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	hg19	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.663776	0.88251	.	.	ENSG00000133858	ENST00000378743	T	0.58652	0.32	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000001	T	0.63721	0.2535	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.68522	-0.5386	10	0.66056	D	0.02	.	14.7156	0.69265	0.0:0.0:0.0:1.0	.	483	O60293	ZC3H1_HUMAN	G	483	ENSP00000368017:E483G	ENSP00000368017:E483G	E	-	2	0	ZFC3H1	70324197	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.134000	0.77268	1.876000	0.54355	0.533000	0.62120	GAA	.	.		0.358	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
E2F7	144455	hgsc.bcm.edu	37	12	77426865	77426865	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:77426865T>A	ENST00000322886.7	-	9	1582	c.1347A>T	c.(1345-1347)gcA>gcT	p.A449A	E2F7_ENST00000416496.2_Silent_p.A449A	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	449					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						TATAGACAGCTGCCAGGCTTC	0.348																																					p.A449A		Atlas-SNP	.											.	E2F7	201	.	0			c.A1347T						.						80.0	85.0	83.0					12																	77426865		2203	4300	6503	SO:0001819	synonymous_variant	144455	exon9			GACAGCTGCCAGG	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1347A>T	chr12.hg19:g.77426865T>A		73.0	0.0		77.0	14.0	NM_203394	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	ENST00000322886.7	hg19	CCDS9016.1																																																																																			.	.		0.348	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871	
ACSS3	79611	hgsc.bcm.edu	37	12	81647343	81647343	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:81647343T>A	ENST00000548058.1	+	15	2799	c.1889T>A	c.(1888-1890)gTg>gAg	p.V630E	ACSS3_ENST00000261206.3_Missense_Mutation_p.V629E|ACSS3_ENST00000548324.1_Missense_Mutation_p.V312E			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	630						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						ATTGGCCCTGTGGCTGCTTTT	0.438																																					p.V630E		Atlas-SNP	.											.	ACSS3	118	.	0			c.T1889A						.						101.0	103.0	102.0					12																	81647343		2203	4300	6503	SO:0001583	missense	79611	exon15			GCCCTGTGGCTGC		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1889T>A	chr12.hg19:g.81647343T>A	ENSP00000449535:p.Val630Glu	188.0	0.0		191.0	33.0	NM_024560	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	hg19	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.890877	0.91889	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.59083	0.29;0.29;0.29	6.03	6.03	0.97812	.	0.117511	0.56097	D	0.000023	T	0.77864	0.4194	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.977	T	0.80852	-0.1197	10	0.87932	D	0	-12.8112	16.5724	0.84622	0.0:0.0:0.0:1.0	.	312;630	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	E	630;629;312	ENSP00000449535:V630E;ENSP00000261206:V629E;ENSP00000448965:V312E	ENSP00000261206:V629E	V	+	2	0	ACSS3	80171474	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	7.665000	0.83852	2.313000	0.78055	0.455000	0.32223	GTG	.	.		0.438	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
TMTC2	160335	hgsc.bcm.edu	37	12	83251361	83251361	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:83251361T>A	ENST00000321196.3	+	2	1361		c.e2+2		TMTC2_ENST00000548305.1_Splice_Site|TMTC2_ENST00000549919.1_Splice_Site	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2						calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						ATTTACAAAGTAAGTGATTGT	0.373																																					.		Atlas-SNP	.											.	TMTC2	100	.	0			c.654+2T>A						.						58.0	53.0	55.0					12																	83251361		2203	4300	6503	SO:0001630	splice_region_variant	160335	exon2			ACAAAGTAAGTGA	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.654+2T>A	chr12.hg19:g.83251361T>A		82.0	0.0		94.0	14.0	NM_152588	B2RCU7|Q8N2K8	Splice_Site	SNP	ENST00000321196.3	hg19	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032002	0.75504	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6569	0.68838	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMTC2	81775492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.377000	0.79668	2.251000	0.74343	0.528000	0.53228	.	.	.		0.373	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	Intron
TMTC3	160418	hgsc.bcm.edu	37	12	88542128	88542128	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:88542128A>T	ENST00000266712.6	+	2	256	c.36A>T	c.(34-36)atA>atT	p.I12I		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	12					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						TAACCTTAATAGTAGGTGTGG	0.328																																					p.I12I		Atlas-SNP	.											.	TMTC3	75	.	0			c.A36T						.						131.0	124.0	126.0					12																	88542128		2203	4300	6503	SO:0001819	synonymous_variant	160418	exon2			CTTAATAGTAGGT		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.36A>T	chr12.hg19:g.88542128A>T		145.0	0.0		212.0	41.0	NM_181783	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Silent	SNP	ENST00000266712.6	hg19	CCDS9032.1																																																																																			.	.		0.328	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	NM_181783	
ATP2B1	490	hgsc.bcm.edu	37	12	90020267	90020267	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:90020267T>A	ENST00000428670.3	-	8	1549	c.1093A>T	c.(1093-1095)Aaa>Taa	p.K365*	ATP2B1_ENST00000393164.2_Nonsense_Mutation_p.K108*|ATP2B1_ENST00000348959.3_Nonsense_Mutation_p.K365*|ATP2B1_ENST00000359142.3_Nonsense_Mutation_p.K365*|ATP2B1_ENST00000261173.2_Nonsense_Mutation_p.K365*			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	365					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TTTGTAAGTTTCCCTTGTAAA	0.328																																					p.K365X		Atlas-SNP	.											.	ATP2B1	191	.	0			c.A1093T						.						94.0	92.0	93.0					12																	90020267		2203	4300	6503	SO:0001587	stop_gained	490	exon7			TAAGTTTCCCTTG	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1093A>T	chr12.hg19:g.90020267T>A	ENSP00000392043:p.Lys365*	64.0	0.0		65.0	9.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Nonsense_Mutation	SNP	ENST00000428670.3	hg19	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	T	43	10.122574	0.99342	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.4303	15.9838	0.80133	0.0:0.0:0.0:1.0	.	.	.	.	X	365;365;365;365;108	.	.	K	-	1	0	ATP2B1	88544398	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.040000	0.89188	2.178000	0.69098	0.533000	0.62120	AAA	.	.		0.328	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
ANKS1B	56899	hgsc.bcm.edu	37	12	99898358	99898358	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:99898358G>T	ENST00000547776.2	-	10	1333	c.1334C>A	c.(1333-1335)aCa>aAa	p.T445K	ANKS1B_ENST00000547010.1_Missense_Mutation_p.T25K|ANKS1B_ENST00000329257.7_Missense_Mutation_p.T445K	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	445						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGAAGGAAATGTATCCAGAGA	0.383																																					p.T445K		Atlas-SNP	.											.	ANKS1B	180	.	0			c.C1334A						.						61.0	60.0	60.0					12																	99898358		1826	4080	5906	SO:0001583	missense	56899	exon10			GGAAATGTATCCA	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1334C>A	chr12.hg19:g.99898358G>T	ENSP00000449629:p.Thr445Lys	64.0	0.0		118.0	16.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	hg19	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842736	0.51057	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.59906	1.01;0.23;1.01;0.93	5.68	4.78	0.61160	.	0.404248	0.24499	N	0.037995	T	0.35219	0.0924	N	0.08118	0	0.80722	D	1	B;B;B	0.16603	0.018;0.018;0.005	B;B;B	0.21360	0.034;0.034;0.007	T	0.17319	-1.0373	9	.	.	.	-0.3752	12.3544	0.55167	0.0775:0.0:0.9225:0.0	.	411;25;445	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	K	445;25;445;24;411	ENSP00000449629:T445K;ENSP00000448512:T25K;ENSP00000331381:T445K;ENSP00000449894:T411K	.	T	-	2	0	ANKS1B	98422489	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.201000	0.42734	2.694000	0.91930	0.650000	0.86243	ACA	.	.		0.383	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
RFX4	5992	hgsc.bcm.edu	37	12	107075779	107075779	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:107075779G>T	ENST00000392842.1	+	5	738	c.324G>T	c.(322-324)agG>agT	p.R108S	RP11-482D24.2_ENST00000547531.1_RNA|RFX4_ENST00000229387.5_5'Flank|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Missense_Mutation_p.R117S	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	108					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						AGATCATAAGGCAGCAGTTTC	0.493																																					p.R117S		Atlas-SNP	.											.	RFX4	218	.	0			c.G351T						.						149.0	134.0	139.0					12																	107075779		2203	4300	6503	SO:0001583	missense	5992	exon5			CATAAGGCAGCAG	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.324G>T	chr12.hg19:g.107075779G>T	ENSP00000376585:p.Arg108Ser	89.0	0.0		99.0	15.0	NM_001206691	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	ENST00000392842.1	hg19	CCDS9106.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351733	0.82132	.	.	ENSG00000111783	ENST00000392842;ENST00000549040;ENST00000357881;ENST00000266774;ENST00000551640	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	5.29	1.91	0.25777	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.000000	0.85682	D	0.000000	D	0.91469	0.7307	M	0.81179	2.53	0.80722	D	1	D;P;P	0.57899	0.981;0.873;0.684	D;B;B	0.69142	0.962;0.385;0.258	D	0.90154	0.4223	10	0.87932	D	0	-23.1125	7.6718	0.28463	0.4644:0.0:0.5356:0.0	.	117;117;108	Q33E94-2;Q33E94-4;Q33E94	.;.;RFX4_HUMAN	S	108;25;117;117;53	ENSP00000376585:R108S;ENSP00000447735:R25S;ENSP00000350552:R117S;ENSP00000448694:R53S	ENSP00000266774:R117S	R	+	3	2	RFX4	105599909	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.120000	0.41968	0.691000	0.31592	0.609000	0.83330	AGG	.	.		0.493	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491	
TBX5	6910	hgsc.bcm.edu	37	12	114793650	114793650	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:114793650A>G	ENST00000310346.4	-	9	1910	c.1244T>C	c.(1243-1245)gTg>gCg	p.V415A	TBX5_ENST00000405440.2_Missense_Mutation_p.V415A|TBX5_ENST00000349716.5_Missense_Mutation_p.V365A	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	415					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CATGGGCTGCACGGTGGTGAC	0.657																																					p.V415A	NSCLC(152;1358 1980 4050 23898 40356)	Atlas-SNP	.											.	TBX5	188	.	0			c.T1244C						.						45.0	40.0	42.0					12																	114793650		2202	4300	6502	SO:0001583	missense	6910	exon9			GGCTGCACGGTGG	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1244T>C	chr12.hg19:g.114793650A>G	ENSP00000309913:p.Val415Ala	60.0	0.0		73.0	15.0	NM_000192	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	hg19	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.395396	0.62066	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440	T;T;T	0.46451	0.87;0.87;0.87	4.99	4.99	0.66335	.	0.050104	0.85682	D	0.000000	T	0.32285	0.0824	L	0.36672	1.1	0.80722	D	1	B	0.20368	0.044	B	0.19148	0.024	T	0.10683	-1.0619	10	0.11485	T	0.65	.	14.7159	0.69269	1.0:0.0:0.0:0.0	.	415	Q99593	TBX5_HUMAN	A	365;415;312;415	ENSP00000337723:V365A;ENSP00000309913:V415A;ENSP00000384152:V415A	ENSP00000309913:V415A	V	-	2	0	TBX5	113278033	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	8.701000	0.91331	1.883000	0.54544	0.533000	0.62120	GTG	.	.		0.657	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
PITPNM2	57605	hgsc.bcm.edu	37	12	123472882	123472882	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:123472882T>A	ENST00000542749.1	-	18	2959	c.2896A>T	c.(2896-2898)Aac>Tac	p.N966Y	PITPNM2_ENST00000320201.4_Missense_Mutation_p.N966Y|PITPNM2_ENST00000280562.5_Missense_Mutation_p.N960Y|PITPNM2_ENST00000392428.1_Missense_Mutation_p.N687Y			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	966					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		ATGCTGGAGTTGTCATGCCTC	0.637																																					p.N966Y		Atlas-SNP	.											.	PITPNM2	105	.	0			c.A2896T						.						131.0	128.0	129.0					12																	123472882		2203	4300	6503	SO:0001583	missense	57605	exon19			TGGAGTTGTCATG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2896A>T	chr12.hg19:g.123472882T>A	ENSP00000437611:p.Asn966Tyr	42.0	0.0		55.0	13.0	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	hg19	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.466733	0.84425	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.45668	1.22;1.21;0.89;1.21	5.21	5.21	0.72293	.	0.105878	0.64402	D	0.000007	T	0.44953	0.1318	L	0.44542	1.39	0.58432	D	0.999992	B;P	0.47962	0.014;0.903	B;P	0.49502	0.026;0.613	T	0.23547	-1.0185	10	0.28530	T	0.3	-12.6398	15.2349	0.73422	0.0:0.0:0.0:1.0	.	960;966	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	Y	960;966;687;966	ENSP00000280562:N960Y;ENSP00000322218:N966Y;ENSP00000376223:N687Y;ENSP00000437611:N966Y	ENSP00000280562:N960Y	N	-	1	0	PITPNM2	122038835	1.000000	0.71417	0.903000	0.35520	0.954000	0.61252	7.799000	0.85936	2.193000	0.70182	0.397000	0.26171	AAC	.	.		0.637	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
DNAH10	196385	hgsc.bcm.edu	37	12	124335527	124335527	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:124335527G>A	ENST00000409039.3	+	34	5866	c.5841G>A	c.(5839-5841)tcG>tcA	p.S1947S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1947	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGCCCGAGTCGGTGAAGGCGC	0.617																																					p.S1947S		Atlas-SNP	.											.	DNAH10	888	.	0			c.G5841A						.						41.0	45.0	44.0					12																	124335527		2146	4283	6429	SO:0001819	synonymous_variant	196385	exon34			CGAGTCGGTGAAG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5841G>A	chr12.hg19:g.124335527G>A		101.0	0.0		108.0	19.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	hg19	CCDS9255.2																																																																																			.	.		0.617	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
TMEM132B	114795	hgsc.bcm.edu	37	12	126139052	126139052	+	Silent	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:126139052T>C	ENST00000299308.3	+	9	3041	c.3033T>C	c.(3031-3033)aaT>aaC	p.N1011N	TMEM132B_ENST00000535886.1_Silent_p.N523N	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	1011						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAATTAAAAATGAACCTATGA	0.468																																					p.N1011N		Atlas-SNP	.											.	TMEM132B	207	.	0			c.T3033C						.						48.0	48.0	48.0					12																	126139052		1856	4092	5948	SO:0001819	synonymous_variant	114795	exon9			TAAAAATGAACCT	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.3033T>C	chr12.hg19:g.126139052T>C		88.0	0.0		90.0	13.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	ENST00000299308.3	hg19	CCDS41859.1																																																																																			.	.		0.468	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
TMEM132D	121256	hgsc.bcm.edu	37	12	129558522	129558522	+	Silent	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr12:129558522C>G	ENST00000422113.2	-	9	3524	c.3198G>C	c.(3196-3198)gtG>gtC	p.V1066V	TMEM132D_ENST00000389441.4_Silent_p.V604V	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1066					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CGCTACTCATCACGATGGAGT	0.512																																					p.V1066V		Atlas-SNP	.											TMEM132D,colon,carcinoma,0,1	TMEM132D	299	.	0			c.G3198C						.						174.0	165.0	168.0					12																	129558522		2203	4300	6503	SO:0001819	synonymous_variant	121256	exon9			ACTCATCACGATG	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3198G>C	chr12.hg19:g.129558522C>G		128.0	1.0		159.0	51.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	hg19	CCDS9266.1																																																																																			.	.		0.512	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
AMER2	219287	hgsc.bcm.edu	37	13	25745258	25745258	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr13:25745258A>G	ENST00000515384.1	-	1	1167	c.500T>C	c.(499-501)cTg>cCg	p.L167P	AMER2-AS1_ENST00000413501.1_lincRNA|AMER2_ENST00000357816.2_Missense_Mutation_p.L167P|AMER2_ENST00000381853.3_Missense_Mutation_p.L167P			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	167					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										GTTCTTCTTCAGCAGCGAGAA	0.721																																					p.L167P		Atlas-SNP	.											.	.	.	.	0			c.T500C						.						11.0	14.0	13.0					13																	25745258		2139	4227	6366	SO:0001583	missense	219287	exon1			TTCTTCAGCAGCG	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.500T>C	chr13.hg19:g.25745258A>G	ENSP00000426528:p.Leu167Pro	83.0	0.0		73.0	9.0	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	hg19	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.590154	0.46214	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.22945	1.93;1.93;1.93	3.53	3.53	0.40419	.	0.338611	0.24198	U	0.040647	T	0.44414	0.1292	M	0.69358	2.11	0.21527	N	0.999652	D;D	0.63046	0.992;0.99	D;D	0.66847	0.947;0.912	T	0.18587	-1.0332	10	0.41790	T	0.15	-27.2837	11.4076	0.49906	1.0:0.0:0.0:0.0	.	167;167	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	P	167	ENSP00000350469:L167P;ENSP00000371277:L167P;ENSP00000426528:L167P	ENSP00000350469:L167P	L	-	2	0	FAM123A	24643258	0.997000	0.39634	0.003000	0.11579	0.956000	0.61745	5.084000	0.64462	1.471000	0.48121	0.254000	0.18369	CTG	.	.		0.721	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
ALG5	29880	hgsc.bcm.edu	37	13	37563694	37563694	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr13:37563694T>C	ENST00000239891.3	-	5	440	c.374A>G	c.(373-375)cAg>cGg	p.Q125R	ALG5_ENST00000496689.1_5'UTR|ALG5_ENST00000413537.2_Missense_Mutation_p.Q125R|ALG5_ENST00000443765.1_Splice_Site	NM_013338.4	NP_037470.1	Q9Y673	ALG5_HUMAN	ALG5, dolichyl-phosphate beta-glucosyltransferase	125					cellular protein metabolic process (GO:0044267)|determination of left/right symmetry (GO:0007368)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dolichyl-phosphate beta-glucosyltransferase activity (GO:0004581)|oligosaccharyl transferase activity (GO:0004576)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		TCCATATTTCTGGCAATATTT	0.303																																					p.Q125R		Atlas-SNP	.											.	ALG5	28	.	0			c.A374G						.						82.0	79.0	80.0					13																	37563694		2202	4299	6501	SO:0001583	missense	29880	exon5			TATTTCTGGCAAT	AF088028	CCDS9361.1, CCDS45033.1	13q13.1	2013-02-22	2013-02-21		ENSG00000120697	ENSG00000120697	2.4.1.117	"""Glycosyltransferase family 2 domain containing"""	20266	protein-coding gene	gene with protein product		604565	"""asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase)"", ""asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)"""			10359825	Standard	NM_013338		Approved	bA421P11.2	uc001uvy.3	Q9Y673	OTTHUMG00000016741	ENST00000239891.3:c.374A>G	chr13.hg19:g.37563694T>C	ENSP00000239891:p.Gln125Arg	89.0	0.0		79.0	15.0	NM_013338	B4DR37|Q5TBA6	Missense_Mutation	SNP	ENST00000239891.3	hg19	CCDS9361.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.1|21.1	4.103337|4.103337	0.76983|0.76983	.|.	.|.	ENSG00000120697|ENSG00000120697	ENST00000443765|ENST00000239891;ENST00000413537	.|T;T	.|0.61627	.|0.09;0.09	5.91|5.91	5.91|5.91	0.95273|0.95273	.|Glycosyl transferase, family 2 (1);	.|0.263259	.|0.43416	.|D	.|0.000573	.|T	.|0.37046	.|0.0989	N|N	0.05050|0.05050	-0.12|-0.12	0.36269|0.36269	D|D	0.855048|0.855048	.|B	.|0.02656	.|0.0	.|B	.|0.06405	.|0.002	.|T	.|0.39165	.|-0.9627	.|10	.|0.19147	.|T	.|0.46	.|-20.6184	16.0084|16.0084	0.80380|0.80380	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|125	.|Q9Y673	.|ALG5_HUMAN	.|R	-1|125	.|ENSP00000239891:Q125R;ENSP00000389647:Q125R	.|ENSP00000239891:Q125R	.|Q	-|-	.|2	.|0	ALG5|ALG5	36461694|36461694	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.914000|0.914000	0.54420|0.54420	2.284000|2.284000	0.43478|0.43478	2.263000|2.263000	0.75096|0.75096	0.528000|0.528000	0.53228|0.53228	.|CAG	.	.		0.303	ALG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044528.2	NM_013338	
OR4K15	81127	hgsc.bcm.edu	37	14	20443792	20443792	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:20443792C>A	ENST00000305051.5	+	1	190	c.115C>A	c.(115-117)Ctg>Atg	p.L39M		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATTTGTGTTGCTGGGACTGTC	0.403																																					p.L39M		Atlas-SNP	.											.	OR4K15	82	.	0			c.C115A						.						122.0	130.0	127.0					14																	20443792		2203	4299	6502	SO:0001583	missense	81127	exon1			GTGTTGCTGGGAC		CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.115C>A	chr14.hg19:g.20443792C>A	ENSP00000304077:p.Leu39Met	49.0	0.0		52.0	9.0	NM_001005486	B9EIL3|Q6IEZ4	Missense_Mutation	SNP	ENST00000305051.5	hg19	CCDS32026.1	.	.	.	.	.	.	.	.	.	.	.	12.47	1.948700	0.34377	.	.	ENSG00000169488	ENST00000305051	T	0.00637	6.05	3.41	0.211	0.15236	.	0.000000	0.34025	N	0.004321	T	0.01695	0.0054	M	0.76170	2.325	0.09310	N	1	D	0.71674	0.998	D	0.64237	0.923	T	0.48246	-0.9052	10	0.72032	D	0.01	.	0.7415	0.00974	0.1891:0.3871:0.1856:0.2381	.	39	Q8NH41	OR4KF_HUMAN	M	39	ENSP00000304077:L39M	ENSP00000304077:L39M	L	+	1	2	OR4K15	19513632	0.000000	0.05858	0.726000	0.30738	0.954000	0.61252	-1.281000	0.02802	0.104000	0.17725	0.467000	0.42956	CTG	.	.		0.403	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409883.1		
MYH7	4625	hgsc.bcm.edu	37	14	23885305	23885305	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:23885305C>A	ENST00000355349.3	-	34	5023	c.4861G>T	c.(4861-4863)Gac>Tac	p.D1621Y	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1621					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCATTGAGGTCTCCTTCCATC	0.612																																					p.D1621Y		Atlas-SNP	.											.	MYH7	349	.	0			c.G4861T						.						197.0	146.0	164.0					14																	23885305		2203	4300	6503	SO:0001583	missense	4625	exon34			TGAGGTCTCCTTC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4861G>T	chr14.hg19:g.23885305C>A	ENSP00000347507:p.Asp1621Tyr	85.0	0.0		76.0	10.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135468	0.77662	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.81415	-1.49	4.55	4.55	0.56014	Myosin tail (1);	.	.	.	.	D	0.93236	0.7845	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.95480	0.8559	9	0.87932	D	0	.	17.8682	0.88803	0.0:1.0:0.0:0.0	.	1621	P12883	MYH7_HUMAN	Y	1621;1626	ENSP00000347507:D1621Y	ENSP00000347507:D1621Y	D	-	1	0	MYH7	22955145	1.000000	0.71417	0.988000	0.46212	0.980000	0.70556	7.170000	0.77587	2.537000	0.85549	0.655000	0.94253	GAC	.	.		0.612	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
FAM179B	23116	hgsc.bcm.edu	37	14	45473485	45473485	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:45473485A>T	ENST00000361577.3	+	4	2774	c.2560A>T	c.(2560-2562)Aaa>Taa	p.K854*	FAM179B_ENST00000382233.2_Nonsense_Mutation_p.K854*|FAM179B_ENST00000361462.2_Nonsense_Mutation_p.K854*|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	854										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTGGCCTCTTAAAAGCTTCGA	0.388																																					p.K854X		Atlas-SNP	.											.	FAM179B	115	.	0			c.A2560T						.						67.0	71.0	69.0					14																	45473485		2203	4300	6503	SO:0001587	stop_gained	23116	exon4			CCTCTTAAAAGCT	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2560A>T	chr14.hg19:g.45473485A>T	ENSP00000355045:p.Lys854*	132.0	0.0		134.0	24.0	NM_015091	Q68D66|Q6PG27	Nonsense_Mutation	SNP	ENST00000361577.3	hg19	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	A	38	7.167669	0.98111	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233;ENST00000555874	.	.	.	5.24	5.24	0.73138	.	0.162866	0.41823	D	0.000814	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.7371	13.3595	0.60648	1.0:0.0:0.0:0.0	.	.	.	.	X	854;854;854;854;173	.	ENSP00000354917:K854X	K	+	1	0	FAM179B	44543235	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.925000	0.70062	1.980000	0.57719	0.383000	0.25322	AAA	.	.		0.388	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
NID2	22795	hgsc.bcm.edu	37	14	52486849	52486849	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:52486849A>T	ENST00000216286.5	-	13	2721	c.2722T>A	c.(2722-2724)Tac>Aac	p.Y908N	NID2_ENST00000541773.1_Missense_Mutation_p.Y807N	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	908	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GGAGTATTGTAGCAGGTAGCT	0.463																																					p.Y908N		Atlas-SNP	.											.	NID2	201	.	0			c.T2722A						.						127.0	110.0	116.0					14																	52486849		2203	4300	6503	SO:0001583	missense	22795	exon13			TATTGTAGCAGGT	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2722T>A	chr14.hg19:g.52486849A>T	ENSP00000216286:p.Tyr908Asn	106.0	0.0		123.0	23.0	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	hg19	CCDS9706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.08|14.08	2.428638|2.428638	0.43122|0.43122	.|.	.|.	ENSG00000087303|ENSG00000087303	ENST00000556572|ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.|D;D	.|0.89485	.|-2.52;-2.52	5.46|5.46	1.8|1.8	0.24995|0.24995	.|Thyroglobulin type-1 (1);EGF domain, merozoite surface protein 1-like (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.|0.868339	.|0.10587	.|N	.|0.657154	D|D	0.84683|0.84683	0.5526|0.5526	N|N	0.14661|0.14661	0.345|0.345	0.33452|0.33452	D|D	0.583855|0.583855	.|B;P;P;P	.|0.48764	.|0.096;0.7;0.605;0.915	.|B;B;B;P	.|0.58780	.|0.102;0.111;0.34;0.845	T|T	0.80125|0.80125	-0.1513|-0.1513	5|10	.|0.30078	.|T	.|0.28	.|.	4.372|4.372	0.11253|0.11253	0.5085:0.0:0.3431:0.1484|0.5085:0.0:0.3431:0.1484	.|.	.|502;807;910;908	.|E7EPP3;Q14112-2;Q5CZI2;Q14112	.|.;.;.;NID2_HUMAN	Q|N	176|908;502;807;910	.|ENSP00000216286:Y908N;ENSP00000443730:Y807N	.|ENSP00000216286:Y908N	L|Y	-|-	2|1	0|0	NID2|NID2	51556599|51556599	0.811000|0.811000	0.29063|0.29063	0.997000|0.997000	0.53966|0.53966	0.990000|0.990000	0.78478|0.78478	0.469000|0.469000	0.22067|0.22067	0.383000|0.383000	0.24910|0.24910	0.533000|0.533000	0.62120|0.62120	CTA|TAC	.	.		0.463	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
C14orf39	317761	hgsc.bcm.edu	37	14	60923752	60923752	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:60923752C>G	ENST00000321731.3	-	15	1400	c.1241G>C	c.(1240-1242)aGa>aCa	p.R414T		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	414					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		ATTCTCAGCTCTCTCTTCTAC	0.343																																					p.R414T		Atlas-SNP	.											.	C14orf39	79	.	0			c.G1241C						.						86.0	99.0	94.0					14																	60923752		2203	4299	6502	SO:0001583	missense	317761	exon15			TCAGCTCTCTCTT	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1241G>C	chr14.hg19:g.60923752C>G	ENSP00000324920:p.Arg414Thr	192.0	0.0		182.0	30.0	NM_174978	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	hg19	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	C	1.243	-0.620798	0.03636	.	.	ENSG00000179008	ENST00000321731	T	0.23552	1.9	5.32	-1.26	0.09376	.	0.885729	0.10032	N	0.724558	T	0.17704	0.0425	L	0.51422	1.61	0.09310	N	1	B	0.32160	0.358	B	0.25140	0.058	T	0.20371	-1.0277	10	0.52906	T	0.07	1.5903	3.5547	0.07860	0.2745:0.401:0.0:0.3245	.	414	Q8N1H7	S6OS1_HUMAN	T	414	ENSP00000324920:R414T	ENSP00000324920:R414T	R	-	2	0	C14orf39	59993505	0.003000	0.15002	0.012000	0.15200	0.006000	0.05464	-0.335000	0.07873	-0.140000	0.11394	-0.253000	0.11424	AGA	.	.		0.343	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
RHOJ	57381	hgsc.bcm.edu	37	14	63757723	63757723	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:63757723G>A	ENST00000316754.3	+	5	1088	c.626G>A	c.(625-627)aGc>aAc	p.S209N		NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J	209					actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		GAGGGTCACAGCTGCTGTTCA	0.498																																					p.S209N		Atlas-SNP	.											.	RHOJ	45	.	0			c.G626A						.						102.0	94.0	96.0					14																	63757723		2203	4300	6503	SO:0001583	missense	57381	exon5			GTCACAGCTGCTG	AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	ENST00000316754.3:c.626G>A	chr14.hg19:g.63757723G>A	ENSP00000316729:p.Ser209Asn	70.0	0.0		84.0	19.0	NM_020663	Q96KC1	Missense_Mutation	SNP	ENST00000316754.3	hg19	CCDS9757.1	.	.	.	.	.	.	.	.	.	.	G	8.763	0.923982	0.18056	.	.	ENSG00000126785	ENST00000316754	T	0.67698	-0.28	5.86	2.09	0.27110	.	3.757210	0.00659	N	0.000582	T	0.45216	0.1331	N	0.03154	-0.405	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18618	-1.0331	10	0.16896	T	0.51	.	9.1268	0.36821	0.3347:0.0:0.6653:0.0	.	209	Q9H4E5	RHOJ_HUMAN	N	209	ENSP00000316729:S209N	ENSP00000316729:S209N	S	+	2	0	RHOJ	62827476	1.000000	0.71417	0.465000	0.27155	0.952000	0.60782	3.740000	0.55082	0.127000	0.18452	0.655000	0.94253	AGC	.	.		0.498	RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276975.3		
GPHN	10243	hgsc.bcm.edu	37	14	67589018	67589018	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:67589018A>T	ENST00000315266.5	+	16	2694	c.1573A>T	c.(1573-1575)Agc>Tgc	p.S525C	GPHN_ENST00000543237.1_Missense_Mutation_p.S571C|GPHN_ENST00000478722.1_Missense_Mutation_p.S558C|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000305960.9_Missense_Mutation_p.S494C	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	525	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		GATTCGAGACAGCAATCGTTC	0.383			T	MLL	AL																																p.S558C		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.A1672T						.						129.0	115.0	120.0					14																	67589018		2203	4300	6503	SO:0001583	missense	10243	exon17			CGAGACAGCAATC	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1573A>T	chr14.hg19:g.67589018A>T	ENSP00000312771:p.Ser525Cys	142.0	0.0		170.0	33.0	NM_020806	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	hg19	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.957333	0.92726	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960;ENST00000555503	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	6.17	6.17	0.99709	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.037143	0.85682	D	0.000000	D	0.88969	0.6582	M	0.84156	2.68	0.80722	D	1	P;D;P;D	0.76494	0.722;0.999;0.859;0.999	P;D;P;D	0.72338	0.474;0.966;0.609;0.977	D	0.90249	0.4292	10	0.87932	D	0	-7.7264	16.8222	0.85835	1.0:0.0:0.0:0.0	.	494;571;525;558	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	C	525;558;571;494;50	ENSP00000312771:S525C;ENSP00000417901:S558C;ENSP00000438404:S571C;ENSP00000303019:S494C;ENSP00000452009:S50C	ENSP00000303019:S494C	S	+	1	0	GPHN	66658771	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.911000	0.69939	2.371000	0.80710	0.533000	0.62120	AGC	.	.		0.383	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68264872	68264872	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:68264872T>A	ENST00000347230.4	-	11	2245	c.2107A>T	c.(2107-2109)Agc>Tgc	p.S703C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.S703C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	703					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCAGGAGGGCTGCGGCTACTG	0.517																																					p.S703C		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.A2107T						.						52.0	55.0	54.0					14																	68264872		2203	4300	6503	SO:0001583	missense	23503	exon11			GAGGGCTGCGGCT	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2107A>T	chr14.hg19:g.68264872T>A	ENSP00000251119:p.Ser703Cys	65.0	0.0		68.0	9.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.056486	0.36277	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.28666	1.74;1.6	5.95	-11.1	0.00147	.	3.301100	0.00397	N	0.000052	T	0.19765	0.0475	L	0.29908	0.895	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.17961	-1.0352	10	0.56958	D	0.05	19.721	9.5985	0.39589	0.0817:0.5657:0.1651:0.1874	.	703;703;703	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	C	703;682;703	ENSP00000251119:S703C;ENSP00000450603:S703C	ENSP00000251119:S703C	S	-	1	0	ZFYVE26	67334625	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.022000	0.12480	-2.065000	0.00887	-0.899000	0.02877	AGC	.	.		0.517	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
LTBP2	4053	hgsc.bcm.edu	37	14	75018988	75018988	+	Missense_Mutation	SNP	G	G	A	rs371940681		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:75018988G>A	ENST00000261978.4	-	6	1687	c.1301C>T	c.(1300-1302)cCg>cTg	p.P434L	CTD-2207P18.1_ENST00000554552.1_lincRNA|LTBP2_ENST00000556690.1_Missense_Mutation_p.P434L|LTBP2_ENST00000557425.1_Intron	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	434					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CTCCCTGTCCGGCTGCGGGAT	0.672																																					p.P434L		Atlas-SNP	.											.	LTBP2	158	.	0			c.C1301T						.		LEU/PRO	0,4404		0,0,2202	33.0	36.0	35.0		1301	-5.3	0.0	14		35	1,8581		0,1,4290	no	missense	LTBP2	NM_000428.2	98	0,1,6492	AA,AG,GG		0.0117,0.0,0.0077	benign	434/1822	75018988	1,12985	2202	4291	6493	SO:0001583	missense	4053	exon6			CTGTCCGGCTGCG		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1301C>T	chr14.hg19:g.75018988G>A	ENSP00000261978:p.Pro434Leu	146.0	0.0		102.0	25.0	NM_000428	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	hg19	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	g	11.35	1.614217	0.28712	0.0	1.17E-4	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.16897	2.31;2.31	4.63	-5.33	0.02713	.	0.544954	0.13688	N	0.369745	T	0.05686	0.0149	N	0.05510	-0.035	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.41088	-0.9528	10	0.07813	T	0.8	.	9.3654	0.38221	0.2885:0.0:0.5874:0.1241	.	434	Q14767	LTBP2_HUMAN	L	434	ENSP00000261978:P434L;ENSP00000451477:P434L	ENSP00000261978:P434L	P	-	2	0	LTBP2	74088741	0.127000	0.22367	0.001000	0.08648	0.916000	0.54674	0.758000	0.26447	-1.187000	0.02709	-0.387000	0.06579	CCG	.	.		0.672	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
KCNK13	56659	hgsc.bcm.edu	37	14	90650745	90650745	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:90650745T>C	ENST00000282146.4	+	2	1066	c.625T>C	c.(625-627)Tct>Cct	p.S209P		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	209					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				CATCCTCATCTCTTGCTGCGC	0.562																																					p.S209P		Atlas-SNP	.											.	KCNK13	76	.	0			c.T625C						.						168.0	141.0	150.0					14																	90650745		2203	4300	6503	SO:0001583	missense	56659	exon2			CTCATCTCTTGCT	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.625T>C	chr14.hg19:g.90650745T>C	ENSP00000282146:p.Ser209Pro	109.0	0.0		78.0	22.0	NM_022054	B5TJL8|Q96E79	Missense_Mutation	SNP	ENST00000282146.4	hg19	CCDS9889.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.687762	0.48097	.	.	ENSG00000152315	ENST00000282146	T	0.45668	0.89	5.31	5.31	0.75309	Ion transport 2 (1);	0.295030	0.21561	N	0.072576	T	0.62612	0.2442	M	0.73598	2.24	0.80722	D	1	D	0.58620	0.983	D	0.63703	0.917	T	0.63368	-0.6653	10	0.42905	T	0.14	.	15.2351	0.73422	0.0:0.0:0.0:1.0	.	209	Q9HB14	KCNKD_HUMAN	P	209	ENSP00000282146:S209P	ENSP00000282146:S209P	S	+	1	0	KCNK13	89720498	1.000000	0.71417	0.981000	0.43875	0.312000	0.27988	6.166000	0.71896	2.003000	0.58678	0.533000	0.62120	TCT	.	.		0.562	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
DICER1	23405	hgsc.bcm.edu	37	14	95577654	95577654	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:95577654T>A	ENST00000526495.1	-	16	2547	c.2256A>T	c.(2254-2256)gcA>gcT	p.A752A	DICER1_ENST00000527414.1_Splice_Site_p.A752A|DICER1_ENST00000393063.1_Splice_Site_p.A752A|DICER1_ENST00000343455.3_Splice_Site_p.A752A|DICER1_ENST00000541352.1_Splice_Site_p.A752A			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	752					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CAATACTAACTGCTTTTGGGT	0.443			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.A752A		Atlas-SNP	.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	181	.	0			c.A2256T						.						271.0	252.0	259.0					14																	95577654		2203	4300	6503	SO:0001630	splice_region_variant	23405	exon15	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	ACTAACTGCTTTT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2256+1A>T	chr14.hg19:g.95577654T>A		103.0	0.0		72.0	9.0	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Silent	SNP	ENST00000526495.1	hg19	CCDS9931.1																																																																																			.	.		0.443	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		Silent
AHNAK2	113146	hgsc.bcm.edu	37	14	105414392	105414392	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:105414392C>T	ENST00000333244.5	-	7	7515	c.7396G>A	c.(7396-7398)Gag>Aag	p.E2466K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2466						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGTCCCCCTCCAGCCACGCA	0.622																																					p.E2466K		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G7396A						.						124.0	147.0	139.0					14																	105414392		2061	4199	6260	SO:0001583	missense	113146	exon7			CCCCCTCCAGCCA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7396G>A	chr14.hg19:g.105414392C>T	ENSP00000353114:p.Glu2466Lys	137.0	0.0		98.0	21.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	9.667	1.145750	0.21288	.	.	ENSG00000185567	ENST00000333244	T	0.00776	5.71	3.74	2.82	0.32997	.	.	.	.	.	T	0.00724	0.0024	L	0.37750	1.13	0.09310	N	1	B	0.32467	0.372	B	0.29077	0.098	T	0.36648	-0.9739	9	0.05959	T	0.93	.	10.3572	0.43972	0.1969:0.8031:0.0:0.0	.	2466	Q8IVF2	AHNK2_HUMAN	K	2466	ENSP00000353114:E2466K	ENSP00000353114:E2466K	E	-	1	0	AHNAK2	104485437	0.233000	0.23772	0.028000	0.17463	0.038000	0.13279	1.257000	0.32932	0.532000	0.28657	0.485000	0.47835	GAG	.	.		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ATP10A	57194	hgsc.bcm.edu	37	15	25971123	25971123	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:25971123A>G	ENST00000356865.6	-	5	1065	c.954T>C	c.(952-954)gtT>gtC	p.V318V		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	318					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GAGACATGCAAACAAGGAGCA	0.562																																					p.V318V		Atlas-SNP	.											.	ATP10A	270	.	0			c.T954C						.						134.0	108.0	117.0					15																	25971123		2203	4300	6503	SO:0001819	synonymous_variant	57194	exon5			CATGCAAACAAGG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.954T>C	chr15.hg19:g.25971123A>G		55.0	0.0		44.0	13.0	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	hg19	CCDS32178.1																																																																																			.	.		0.562	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
RYR3	6263	hgsc.bcm.edu	37	15	34072456	34072456	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:34072456C>T	ENST00000389232.4	+	65	9252	c.9182C>T	c.(9181-9183)gCc>gTc	p.A3061V	RYR3_ENST00000415757.3_Missense_Mutation_p.A3061V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3061					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTGGCAGCTGCCATACCAGTG	0.567																																					p.A3061V		Atlas-SNP	.											.	RYR3	760	.	0			c.C9182T						.						52.0	55.0	54.0					15																	34072456		1946	4155	6101	SO:0001583	missense	6263	exon65			CAGCTGCCATACC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9182C>T	chr15.hg19:g.34072456C>T	ENSP00000373884:p.Ala3061Val	129.0	0.0		99.0	14.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	35	5.522190	0.96416	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.62788	-0.0;-0.0	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.81312	0.4796	M	0.84433	2.695	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.66084	0.941;0.913	D	0.83775	0.0222	10	0.72032	D	0.01	.	19.1786	0.93614	0.0:1.0:0.0:0.0	.	3061;3061	Q15413-2;Q15413	.;RYR3_HUMAN	V	3061	ENSP00000373884:A3061V;ENSP00000399610:A3061V	ENSP00000354735:A3061V	A	+	2	0	RYR3	31859748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.492000	0.81482	2.768000	0.95171	0.650000	0.86243	GCC	.	.		0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
AQR	9716	hgsc.bcm.edu	37	15	35253000	35253000	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:35253000A>G	ENST00000156471.5	-	3	373	c.148T>C	c.(148-150)Tat>Cat	p.Y50H		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	50					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TCTTTTTCATATATATCTTCA	0.274																																					p.Y50H		Atlas-SNP	.											.	AQR	139	.	0			c.T148C						.						49.0	45.0	46.0					15																	35253000		1752	4024	5776	SO:0001583	missense	9716	exon3			TTTCATATATATC	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.148T>C	chr15.hg19:g.35253000A>G	ENSP00000156471:p.Tyr50His	164.0	0.0		195.0	39.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	hg19	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839892	0.71488	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.96396	-4.0	5.26	5.26	0.73747	.	0.244719	0.42964	D	0.000632	D	0.98394	0.9466	M	0.93375	3.41	0.58432	D	0.999994	D	0.89917	1.0	D	0.80764	0.994	D	0.98850	1.0758	10	0.49607	T	0.09	-16.7426	12.6656	0.56840	1.0:0.0:0.0:0.0	.	50	O60306	AQR_HUMAN	H	50	ENSP00000156471:Y50H	ENSP00000156471:Y50H	Y	-	1	0	AQR	33040292	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.367000	0.52350	2.205000	0.71048	0.455000	0.32223	TAT	.	.		0.274	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
SEMA6D	80031	hgsc.bcm.edu	37	15	48062884	48062884	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:48062884A>G	ENST00000316364.5	+	19	2563	c.2124A>G	c.(2122-2124)acA>acG	p.T708T	SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000537942.1_Silent_p.T646T|SEMA6D_ENST00000389432.2_Silent_p.T665T|SEMA6D_ENST00000536845.2_Silent_p.T708T|SEMA6D_ENST00000389433.2_Silent_p.T689T|SEMA6D_ENST00000354744.4_Silent_p.T652T|SEMA6D_ENST00000389428.3_Silent_p.T633T|SEMA6D_ENST00000358066.4_Silent_p.T646T|SEMA6D_ENST00000558014.1_Silent_p.T646T|SEMA6D_ENST00000355997.3_3'UTR	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	708					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AGTCATGCACAGACTCCAGTG	0.443																																					p.T708T		Atlas-SNP	.											.	SEMA6D	322	.	0			c.A2124G						.						96.0	90.0	92.0					15																	48062884		2198	4297	6495	SO:0001819	synonymous_variant	80031	exon19			ATGCACAGACTCC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2124A>G	chr15.hg19:g.48062884A>G		114.0	0.0		95.0	30.0	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	hg19	CCDS32225.1																																																																																			.	.		0.443	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
LEO1	123169	hgsc.bcm.edu	37	15	52244087	52244087	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:52244087G>A	ENST00000299601.5	-	9	1625	c.1565C>T	c.(1564-1566)cCa>cTa	p.P522L	LEO1_ENST00000315141.5_Missense_Mutation_p.P462L	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	522					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		ACCAGCCATTGGCAAGATTCT	0.443																																					p.P522L	Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	Atlas-SNP	.											.	LEO1	46	.	0			c.C1565T						.						195.0	161.0	172.0					15																	52244087		2195	4293	6488	SO:0001583	missense	123169	exon9			GCCATTGGCAAGA	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1565C>T	chr15.hg19:g.52244087G>A	ENSP00000299601:p.Pro522Leu	62.0	0.0		62.0	10.0	NM_138792	Q96N99	Missense_Mutation	SNP	ENST00000299601.5	hg19	CCDS10146.1	.	.	.	.	.	.	.	.	.	.	.	33	5.287477	0.95517	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.978;0.999	P;D	0.72338	0.883;0.977	T	0.68352	-0.5431	9	0.11794	T	0.64	.	19.6961	0.96026	0.0:0.0:1.0:0.0	.	462;522	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	L	522;500;462	.	ENSP00000299601:P522L	P	-	2	0	LEO1	50031379	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	9.623000	0.98386	2.654000	0.90174	0.650000	0.86243	CCA	.	.		0.443	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2	NM_138792	
RNF111	54778	hgsc.bcm.edu	37	15	59350608	59350608	+	Missense_Mutation	SNP	G	G	C	rs201513331	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:59350608G>C	ENST00000557998.1	+	5	1512	c.1225G>C	c.(1225-1227)Gct>Cct	p.A409P	RNF111_ENST00000348370.4_Missense_Mutation_p.A409P|RNF111_ENST00000561186.1_Missense_Mutation_p.A409P|RNF111_ENST00000434298.1_Missense_Mutation_p.A409P|RNF111_ENST00000559209.1_Missense_Mutation_p.A409P	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	409	Ser-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		AGCTACTAGCGCTTCCATTAA	0.413																																					p.A409P	NSCLC(72;983 1365 10746 34387 47081)	Atlas-SNP	.											.	RNF111	179	.	0			c.G1225C						.						214.0	214.0	214.0					15																	59350608		2192	4291	6483	SO:0001583	missense	54778	exon5			ACTAGCGCTTCCA	AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1225G>C	chr15.hg19:g.59350608G>C	ENSP00000452732:p.Ala409Pro	80.0	0.0		78.0	8.0	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	ENST00000557998.1	hg19	CCDS58366.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952249	0.73787	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.16597	2.33;2.33	5.98	2.79	0.32731	.	0.354886	0.33272	N	0.005082	T	0.12689	0.0308	N	0.14661	0.345	0.34297	D	0.683947	P;P;P	0.47604	0.898;0.895;0.874	P;B;P	0.49192	0.602;0.397;0.521	T	0.18903	-1.0322	10	0.87932	D	0	-8.5652	5.7735	0.18267	0.2461:0.0:0.5898:0.1641	.	409;409;409	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	P	409	ENSP00000288199:A409P;ENSP00000393641:A409P	ENSP00000288199:A409P	A	+	1	0	RNF111	57137900	0.993000	0.37304	0.992000	0.48379	0.964000	0.63967	0.329000	0.19698	0.824000	0.34613	0.585000	0.79938	GCT	.	G|1.000;A|0.000		0.413	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
REC114	283677	hgsc.bcm.edu	37	15	73843382	73843382	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:73843382T>C	ENST00000331090.6	+	4	465	c.437T>C	c.(436-438)gTg>gCg	p.V146A	C15orf60_ENST00000560581.1_Missense_Mutation_p.V118A	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		146					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						TACATAACCGTGCAGGTGCCT	0.532																																					p.V146A		Atlas-SNP	.											.	C15orf60	26	.	0			c.T437C						.						65.0	67.0	66.0					15																	73843382		1979	4149	6128	SO:0001583	missense	283677	exon4			TAACCGTGCAGGT																												ENST00000331090.6:c.437T>C	chr15.hg19:g.73843382T>C	ENSP00000328423:p.Val146Ala	193.0	0.0		180.0	42.0	NM_001042367		Missense_Mutation	SNP	ENST00000331090.6	hg19	CCDS45296.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.689407	0.68271	.	.	ENSG00000183324	ENST00000331090	T	0.58940	0.3	5.52	5.52	0.82312	.	0.067578	0.64402	D	0.000018	T	0.73666	0.3616	M	0.68952	2.095	0.18873	N	0.999988	D	0.71674	0.998	D	0.77557	0.99	T	0.68288	-0.5448	10	0.72032	D	0.01	-22.7799	14.4641	0.67472	0.0:0.0:0.0:1.0	.	146	Q7Z4M0	CO060_HUMAN	A	146	ENSP00000328423:V146A	ENSP00000328423:V146A	V	+	2	0	C15orf60	71630435	0.986000	0.35501	0.020000	0.16555	0.076000	0.17211	3.731000	0.55013	2.079000	0.62486	0.496000	0.49642	GTG	.	.		0.532	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1		
CLK3	1198	hgsc.bcm.edu	37	15	74914530	74914530	+	Silent	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:74914530C>A	ENST00000395066.3	+	4	1344	c.883C>A	c.(883-885)Cgg>Agg	p.R295R	CLK3_ENST00000352989.5_Silent_p.R147R|CLK3_ENST00000345005.4_Silent_p.R147R|CLK3_ENST00000348245.3_Intron	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	295					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						CCTGGTGTGCCGGATCGGCGA	0.572																																					p.R295R	Ovarian(133;694 1754 28950 29027 31859)	Atlas-SNP	.											CLK3_ENST00000454830,colon,carcinoma,0,2	CLK3	78	.	0			c.C883A						.						144.0	117.0	126.0					15																	74914530		2197	4296	6493	SO:0001819	synonymous_variant	1198	exon4			GTGTGCCGGATCG	L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.883C>A	chr15.hg19:g.74914530C>A		108.0	0.0		113.0	39.0	NM_001130028	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Silent	SNP	ENST00000395066.3	hg19	CCDS45304.1																																																																																			.	.		0.572	CLK3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390442.3		
IREB2	3658	hgsc.bcm.edu	37	15	78765662	78765662	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:78765662A>T	ENST00000258886.8	+	8	1111	c.962A>T	c.(961-963)gAg>gTg	p.E321V	IREB2_ENST00000560440.1_Missense_Mutation_p.E321V	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	321					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		GTTGGATGTGAGTTAACTGGG	0.398																																					p.E321V	NSCLC(200;764 2208 35157 49871 50830)	Atlas-SNP	.											.	IREB2	106	.	0			c.A962T						.						262.0	234.0	244.0					15																	78765662		2196	4293	6489	SO:0001583	missense	3658	exon8			GATGTGAGTTAAC	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.962A>T	chr15.hg19:g.78765662A>T	ENSP00000258886:p.Glu321Val	141.0	0.0		138.0	24.0	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	hg19	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	A	34	5.316948	0.95682	.	.	ENSG00000136381	ENST00000258886	T	0.47177	0.85	6.08	6.08	0.98989	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (1);	0.042164	0.85682	D	0.000000	T	0.64316	0.2587	M	0.63208	1.945	0.58432	D	0.999999	D;D	0.58970	0.984;0.983	P;P	0.60236	0.855;0.871	T	0.66870	-0.5814	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	321;321	P48200;Q8WVK6	IREB2_HUMAN;.	V	321	ENSP00000258886:E321V	ENSP00000258886:E321V	E	+	2	0	IREB2	76552717	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.261000	0.78400	2.333000	0.79357	0.482000	0.46254	GAG	.	.		0.398	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
UNC45A	55898	hgsc.bcm.edu	37	15	91483701	91483701	+	Missense_Mutation	SNP	C	C	T	rs144625807		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:91483701C>T	ENST00000418476.2	+	6	725	c.685C>T	c.(685-687)Cgg>Tgg	p.R229W	UNC45A_ENST00000394275.2_Missense_Mutation_p.R214W|UNC45A_ENST00000553671.2_3'UTR	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	229					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCATCAGTCACGGGTAGGTGG	0.567																																					p.R229W		Atlas-SNP	.											.	UNC45A	57	.	0			c.C685T						.	C	TRP/ARG,TRP/ARG	1,4395	2.1+/-5.4	0,1,2197	158.0	118.0	131.0		640,685	5.5	1.0	15	dbSNP_134	131	0,8596		0,0,4298	no	missense,missense	UNC45A	NM_001039675.1,NM_018671.3	101,101	0,1,6495	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	214/930,229/945	91483701	1,12991	2198	4298	6496	SO:0001583	missense	55898	exon6			CAGTCACGGGTAG		CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.685C>T	chr15.hg19:g.91483701C>T	ENSP00000407487:p.Arg229Trp	71.0	0.0		84.0	4.0	NM_018671	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	hg19	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177737	0.78564	2.27E-4	0.0	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.48836	0.8;0.8	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.220197	0.37530	N	0.002057	T	0.70561	0.3238	M	0.74881	2.28	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;P	0.91635	0.998;0.999;0.998;0.893	T	0.69752	-0.5060	10	0.48119	T	0.1	-26.9622	19.8567	0.96761	0.0:1.0:0.0:0.0	.	229;221;229;214	B4DZL0;B4DLE6;Q9H3U1;A8K6F7	.;.;UN45A_HUMAN;.	W	214;229	ENSP00000377816:R214W;ENSP00000407487:R229W	ENSP00000377816:R214W	R	+	1	2	UNC45A	89284705	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	4.938000	0.63519	2.764000	0.94973	0.650000	0.86243	CGG	.	C|1.000;T|0.000		0.567	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671	
ALDH1A3	220	hgsc.bcm.edu	37	15	101420114	101420114	+	Start_Codon_SNP	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:101420114T>C	ENST00000329841.5	+	1	534	c.2T>C	c.(1-3)aTg>aCg	p.M1T	ALDH1A3_ENST00000560555.1_3'UTR|ALDH1A3_ENST00000346623.6_Start_Codon_SNP_p.M1T|RP11-66B24.8_ENST00000558568.1_lincRNA|ALDH1A3_ENST00000557963.1_Start_Codon_SNP_p.M1T	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	1					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	GGAGGAGCCATGGCCACCGCT	0.746																																					p.M1T		Atlas-SNP	.											.	ALDH1A3	61	.	0			c.T2C						.						6.0	11.0	9.0					15																	101420114		1521	2736	4257	SO:0001582	initiator_codon_variant	220	exon1			GAGCCATGGCCAC	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.2T>C	chr15.hg19:g.101420114T>C	ENSP00000332256:p.Met1Thr	90.0	0.0		97.0	19.0	NM_000693	Q6NT64	Missense_Mutation	SNP	ENST00000329841.5	hg19	CCDS10389.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.664486	0.47572	.	.	ENSG00000184254	ENST00000329841;ENST00000415812;ENST00000346623	T	0.74947	-0.89	3.84	2.67	0.31697	.	0.120934	0.56097	D	0.000029	T	0.65004	0.2650	.	.	.	0.80722	D	1	B;B;B	0.22909	0.017;0.077;0.077	B;B;B	0.17722	0.004;0.019;0.019	T	0.61720	-0.7005	9	0.87932	D	0	.	9.1409	0.36903	0.0:0.0:0.185:0.815	.	12;1;1	Q7Z3A2;B2R5T2;P47895	.;.;AL1A3_HUMAN	T	1;1;12	ENSP00000332256:M1T	ENSP00000332256:M1T	M	+	2	0	ALDH1A3	99237637	1.000000	0.71417	0.983000	0.44433	0.956000	0.61745	2.072000	0.41510	0.504000	0.28082	0.459000	0.35465	ATG	.	.		0.746	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2		Missense_Mutation
RHBDF1	64285	hgsc.bcm.edu	37	16	111826	111826	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:111826T>A	ENST00000262316.6	-	8	1320	c.1178A>T	c.(1177-1179)aAg>aTg	p.K393M	RHBDF1_ENST00000454039.2_Missense_Mutation_p.K393M	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	393					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GATCTGGCGCTTGACGAAGCT	0.687																																					p.K393M		Atlas-SNP	.											.	RHBDF1	54	.	0			c.A1178T						.						33.0	36.0	35.0					16																	111826		2199	4293	6492	SO:0001583	missense	64285	exon8			TGGCGCTTGACGA	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1178A>T	chr16.hg19:g.111826T>A	ENSP00000262316:p.Lys393Met	48.0	0.0		68.0	7.0	NM_022450	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	hg19	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	22.5	4.295451	0.81025	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	T;T	0.69306	0.54;-0.39	4.43	3.3	0.37823	.	0.094770	0.64402	D	0.000001	T	0.71005	0.3289	L	0.52011	1.625	0.80722	D	1	D;D;P	0.62365	0.986;0.991;0.939	P;P;P	0.59288	0.855;0.847;0.615	T	0.71354	-0.4618	10	0.66056	D	0.02	-25.3162	9.5759	0.39457	0.0:0.085:0.0:0.915	.	393;416;393	F5GWL4;B4E3Q0;Q96CC6	.;.;RHDF1_HUMAN	M	393	ENSP00000262316:K393M;ENSP00000392133:K393M	ENSP00000262316:K393M	K	-	2	0	RHBDF1	51826	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.291000	0.51764	0.802000	0.34089	0.379000	0.24179	AAG	.	.		0.687	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	NM_022450	
CACNA1H	8912	hgsc.bcm.edu	37	16	1261288	1261288	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:1261288T>A	ENST00000348261.5	+	22	4592	c.4344T>A	c.(4342-4344)ggT>ggA	p.G1448G	CACNA1H_ENST00000358590.4_Silent_p.G1448G|CACNA1H_ENST00000565831.1_Silent_p.G1448G	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1448					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GCATTTTGGGTGTGCAGGTGT	0.632																																					p.G1448G		Atlas-SNP	.											.	CACNA1H	317	.	0			c.T4344A						.						111.0	125.0	120.0					16																	1261288		2158	4243	6401	SO:0001819	synonymous_variant	8912	exon22			TTTGGGTGTGCAG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4344T>A	chr16.hg19:g.1261288T>A		83.0	0.0		92.0	12.0	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	hg19	CCDS45375.1																																																																																			.	.		0.632	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CLCN7	1186	hgsc.bcm.edu	37	16	1496643	1496643	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:1496643C>T	ENST00000382745.4	-	25	3012	c.2407G>A	c.(2407-2409)Gcc>Acc	p.A803T	LA16c-390E6.5_ENST00000566287.1_RNA|CLCN7_ENST00000262318.8_Missense_Mutation_p.G779D|CCDC154_ENST00000409671.1_5'Flank|CLCN7_ENST00000448525.1_Missense_Mutation_p.A779T|CCDC154_ENST00000389176.3_5'Flank	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	803					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				CACGTCTGGGCCAGCGAGAGC	0.642																																					p.A803T		Atlas-SNP	.											.	CLCN7	53	.	0			c.G2407A						.						37.0	25.0	29.0					16																	1496643		2172	4268	6440	SO:0001583	missense	1186	exon25			TCTGGGCCAGCGA	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.2407G>A	chr16.hg19:g.1496643C>T	ENSP00000372193:p.Ala803Thr	167.0	0.0		156.0	23.0	NM_001287	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	ENST00000382745.4	hg19	CCDS32361.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167382	0.78339	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.89939	-2.54;-2.59	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.88562	0.6470	L	0.29908	0.895	0.80722	D	1	B;D;B	0.58620	0.172;0.983;0.307	B;P;B	0.53490	0.023;0.727;0.031	D	0.89400	0.3695	10	0.54805	T	0.06	-39.1491	16.6309	0.85032	0.0:1.0:0.0:0.0	.	779;803;252	E9PDB9;P51798;B3KUD9	.;CLCN7_HUMAN;.	T	779;756;803;745	ENSP00000410907:A779T;ENSP00000372193:A803T	ENSP00000262318:A756T	A	-	1	0	CLCN7	1436644	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.005000	0.49521	2.521000	0.84997	0.561000	0.74099	GCC	.	.		0.642	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
ABCA3	21	hgsc.bcm.edu	37	16	2348419	2348419	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:2348419T>C	ENST00000301732.5	-	15	2564	c.1864A>G	c.(1864-1866)Aca>Gca	p.T622A	ABCA3_ENST00000382381.3_Missense_Mutation_p.T564A	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	622	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TCTGCGACTGTCAAGTTGTCA	0.562																																					p.T622A		Atlas-SNP	.											.	ABCA3	176	.	0			c.A1864G						.						156.0	150.0	152.0					16																	2348419		2198	4300	6498	SO:0001583	missense	21	exon15			CGACTGTCAAGTT	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1864A>G	chr16.hg19:g.2348419T>C	ENSP00000301732:p.Thr622Ala	146.0	0.0		185.0	25.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	hg19	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.797639	0.70567	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.94966	-3.57	6.08	6.08	0.98989	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.047260	0.85682	D	0.000000	D	0.98197	0.9404	H	0.96333	3.805	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.993;0.999;0.984	D	0.99402	1.0928	10	0.87932	D	0	.	15.4788	0.75508	0.0:0.0:0.0:1.0	.	622;626;622	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	A	622;626	ENSP00000301732:T622A	ENSP00000301732:T622A	T	-	1	0	ABCA3	2288420	1.000000	0.71417	0.998000	0.56505	0.019000	0.09904	6.078000	0.71282	2.333000	0.79357	0.533000	0.62120	ACA	.	.		0.562	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
ADCY9	115	hgsc.bcm.edu	37	16	4015970	4015970	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:4015970T>C	ENST00000294016.3	-	11	4406	c.3868A>G	c.(3868-3870)Aag>Gag	p.K1290E		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1290					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AGAGATGTCTTGTCCACATAC	0.602																																					p.K1290E		Atlas-SNP	.											.	ADCY9	151	.	0			c.A3868G						.						97.0	87.0	90.0					16																	4015970		2197	4300	6497	SO:0001583	missense	115	exon11			ATGTCTTGTCCAC	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3868A>G	chr16.hg19:g.4015970T>C	ENSP00000294016:p.Lys1290Glu	86.0	0.0		121.0	21.0	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	hg19	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	T	11.56	1.673805	0.29693	.	.	ENSG00000162104	ENST00000294016	D	0.83163	-1.69	5.45	3.13	0.36017	.	0.593517	0.18649	N	0.135072	T	0.68979	0.3060	N	0.17082	0.46	0.35247	D	0.778372	B	0.10296	0.003	B	0.04013	0.001	T	0.62487	-0.6844	10	0.18276	T	0.48	.	12.4153	0.55490	0.0:0.0:0.2789:0.7211	.	1290	O60503	ADCY9_HUMAN	E	1290	ENSP00000294016:K1290E	ENSP00000294016:K1290E	K	-	1	0	ADCY9	3955971	1.000000	0.71417	0.978000	0.43139	0.697000	0.40408	2.531000	0.45650	0.425000	0.26087	0.533000	0.62120	AAG	.	.		0.602	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
CORO7	79585	hgsc.bcm.edu	37	16	4405166	4405166	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:4405166T>A	ENST00000251166.4	-	28	2918		c.e28-2		CORO7_ENST00000539968.1_Splice_Site|PAM16_ENST00000576217.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Splice_Site|CORO7-PAM16_ENST00000572274.1_Intron|CORO7_ENST00000537233.2_Splice_Site	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7						actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						AGGCTAGTCCTGGGGCGAAAC	0.652																																					.		Atlas-SNP	.											.	CORO7	73	.	0			c.2518-2A>T						.						98.0	72.0	81.0					16																	4405166		2193	4292	6485	SO:0001630	splice_region_variant	79585	exon27			TAGTCCTGGGGCG	AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2773-2A>T	chr16.hg19:g.4405166T>A		152.0	0.0		159.0	23.0	NM_001201473	B4DFD6|B4DL18|I3L416|Q17RK4	Splice_Site	SNP	ENST00000251166.4	hg19	CCDS10513.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.020451	0.54576	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CORO7	4345167	0.998000	0.40836	1.000000	0.80357	0.743000	0.42351	1.794000	0.38774	1.853000	0.53794	0.482000	0.46254	.	.	.		0.652	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251628.2	NM_024535	Intron
CIITA	4261	hgsc.bcm.edu	37	16	11001808	11001808	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:11001808G>T	ENST00000324288.8	+	11	2592	c.2459G>T	c.(2458-2460)gGa>gTa	p.G820V	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	820					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GAGGAGGCTGGAATTTGGCAG	0.667			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.G820V		Atlas-SNP	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.G2459T						.						29.0	35.0	33.0					16																	11001808		2196	4297	6493	SO:0001583	missense	4261	exon11			AGGCTGGAATTTG	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2459G>T	chr16.hg19:g.11001808G>T	ENSP00000316328:p.Gly820Val	85.0	0.0		86.0	12.0	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	hg19	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	2.105	-0.405138	0.04832	.	.	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.72835	-0.69	5.0	-1.51	0.08664	.	1.197730	0.05977	N	0.643481	T	0.72407	0.3456	L	0.53249	1.67	0.09310	N	1	P;B;P;D	0.65815	0.594;0.399;0.716;0.995	B;B;B;P	0.60068	0.215;0.147;0.386;0.868	T	0.58956	-0.7544	10	0.37606	T	0.19	.	1.4533	0.02380	0.2263:0.2919:0.3349:0.147	.	820;820;772;820	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	V	820;772	ENSP00000316328:G820V	ENSP00000316328:G820V	G	+	2	0	CIITA	10909309	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	0.569000	0.23638	-0.104000	0.12154	-0.181000	0.13052	GGA	.	.		0.667	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
RSL1D1	26156	hgsc.bcm.edu	37	16	11933580	11933580	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:11933580T>C	ENST00000571133.1	-	8	1190	c.1118A>G	c.(1117-1119)aAg>aGg	p.K373R	RSL1D1_ENST00000542106.1_Missense_Mutation_p.K153R	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	373					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						TGGAGTCTTCTTTCCTATTGG	0.423																																					p.K373R		Atlas-SNP	.											.	RSL1D1	40	.	0			c.A1118G						.						241.0	214.0	223.0					16																	11933580		2197	4300	6497	SO:0001583	missense	26156	exon8			GTCTTCTTTCCTA	AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.1118A>G	chr16.hg19:g.11933580T>C	ENSP00000460871:p.Lys373Arg	79.0	0.0		85.0	10.0	NM_015659	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	ENST00000571133.1	hg19	CCDS10551.1	.	.	.	.	.	.	.	.	.	.	T	9.758	1.169380	0.21621	.	.	ENSG00000171490	ENST00000355674;ENST00000396503;ENST00000542106	T;T	0.47869	1.0;0.83	4.05	-1.67	0.08238	.	1.286670	0.05069	N	0.481365	T	0.32496	0.0831	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.16158	-1.0412	10	0.15952	T	0.53	-3.0125	6.3403	0.21319	0.0:0.1187:0.5773:0.304	.	373;373	Q32Q62;O76021	.;RL1D1_HUMAN	R	372;373;153	ENSP00000347897:K372R;ENSP00000442089:K153R	ENSP00000347897:K372R	K	-	2	0	RSL1D1	11841081	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	-0.799000	0.04560	-0.067000	0.12976	-0.648000	0.03929	AAG	.	.		0.423	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252059.2	NM_015659	
USP31	57478	hgsc.bcm.edu	37	16	23083412	23083412	+	Silent	SNP	C	C	A	rs546697725	byFrequency	TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:23083412C>A	ENST00000219689.7	-	15	2441	c.2442G>T	c.(2440-2442)tcG>tcT	p.S814S	USP31_ENST00000567975.1_Silent_p.S107S	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		ACTCAGAGAGCGACGCCAGGG	0.567																																					p.S814S		Atlas-SNP	.											.	USP31	122	.	0			c.G2442T						.						142.0	139.0	140.0					16																	23083412		2197	4300	6497	SO:0001819	synonymous_variant	57478	exon15			AGAGAGCGACGCC	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2442G>T	chr16.hg19:g.23083412C>A		56.0	0.0		64.0	21.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000219689.7	hg19	CCDS10607.1																																																																																			.	.		0.567	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
LAT	27040	hgsc.bcm.edu	37	16	28996206	28996206	+	5'Flank	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:28996206G>T	ENST00000360872.5	+	0	0				LAT_ENST00000395456.2_5'Flank|LAT_ENST00000454369.2_5'Flank|LAT_ENST00000354453.4_5'Flank|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000566177.1_5'Flank|LAT_ENST00000395461.3_Missense_Mutation_p.W8C|LAT_ENST00000564277.1_5'Flank			O43561	LAT_HUMAN	linker for activation of T cells						blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CTGCCAGCTGGCAGGTGGCTG	0.711																																					p.W8C		Atlas-SNP	.											.	LAT	22	.	0			c.G24T						.						9.0	10.0	10.0					16																	28996206		691	1588	2279	SO:0001631	upstream_gene_variant	27040	exon1			CAGCTGGCAGGTG	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761		chr16.hg19:g.28996206G>T	Exception_encountered	124.0	0.0		138.0	19.0	NM_001014989	B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	ENST00000360872.5	hg19	CCDS10647.1	.	.	.	.	.	.	.	.	.	.	G	6.988	0.552434	0.13374	.	.	ENSG00000213658	ENST00000395461	.	.	.	3.5	0.0307	0.14168	.	.	.	.	.	T	0.15998	0.0385	N	0.08118	0	0.09310	N	0.999999	P	0.38788	0.647	B	0.40165	0.321	T	0.16958	-1.0385	8	0.87932	D	0	.	6.2162	0.20656	0.1209:0.4336:0.4455:0.0	.	8	B7WPI0	.	C	8	.	ENSP00000378845:W8C	W	+	3	0	LAT	28903707	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.385000	0.07379	-0.048000	0.13401	0.561000	0.74099	TGG	.	.		0.711	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
ITGAX	3687	hgsc.bcm.edu	37	16	31374277	31374277	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:31374277T>A	ENST00000268296.4	+	13	1502	c.1381T>A	c.(1381-1383)Tcc>Acc	p.S461T	ITGAX_ENST00000562522.1_Missense_Mutation_p.S461T	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	461					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTTCGGGGCCTCCCTCTGCTC	0.672																																					p.S461T		Atlas-SNP	.											.	ITGAX	198	.	0			c.T1381A						.						67.0	70.0	69.0					16																	31374277		2197	4300	6497	SO:0001583	missense	3687	exon13			GGGGCCTCCCTCT	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1381T>A	chr16.hg19:g.31374277T>A	ENSP00000268296:p.Ser461Thr	174.0	0.0		184.0	38.0	NM_000887	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	hg19	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	T	4.756	0.140591	0.09083	.	.	ENSG00000140678	ENST00000268296	T	0.09163	3.01	3.58	2.24	0.28232	.	.	.	.	.	T	0.18173	0.0436	L	0.48986	1.54	0.21290	N	0.999731	D	0.71674	0.998	D	0.65443	0.935	T	0.18241	-1.0343	9	0.24483	T	0.36	.	3.3128	0.07022	0.2998:0.0:0.1979:0.5023	.	461	P20702	ITAX_HUMAN	T	461	ENSP00000268296:S461T	ENSP00000268296:S461T	S	+	1	0	ITGAX	31281778	0.056000	0.20664	1.000000	0.80357	0.141000	0.21300	1.047000	0.30367	1.413000	0.46997	0.248000	0.18094	TCC	.	.		0.672	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
FAM96B	51647	hgsc.bcm.edu	37	16	66969499	66969499	+	5'Flank	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:66969499G>T	ENST00000422424.2	-	0	0				CES2_ENST00000317091.4_Missense_Mutation_p.Q51H|CES2_ENST00000417689.1_Missense_Mutation_p.Q51H	NM_016062.3	NP_057146.1	Q9Y3D0	MIP18_HUMAN	family with sequence similarity 96, member B						chromosome segregation (GO:0007059)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)				kidney(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GTGAACAGCAGCGTGTCCGCC	0.677																																					p.Q51H		Atlas-SNP	.											.	CES2	43	.	0			c.G153T						.						47.0	54.0	52.0					16																	66969499		2200	4299	6499	SO:0001631	upstream_gene_variant	8824	exon1			ACAGCAGCGTGTC		CCDS45506.1	16q22.1	2014-01-16			ENSG00000166595	ENSG00000166595			24261	protein-coding gene	gene with protein product		614778				11042152, 10810093, 23891004	Standard	NM_016062		Approved	CGI-128	uc021tjy.2	Q9Y3D0	OTTHUMG00000175408		chr16.hg19:g.66969499G>T	Exception_encountered	95.0	0.0		55.0	15.0	NM_003869		Missense_Mutation	SNP	ENST00000422424.2	hg19	CCDS45506.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.844987	0.51164	.	.	ENSG00000172831	ENST00000417689;ENST00000317091	T;T	0.68331	-0.31;-0.32	3.39	1.26	0.21427	.	17.756700	0.00397	U	0.000048	T	0.47948	0.1473	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42275	-0.9461	10	0.56958	D	0.05	.	5.691	0.17829	0.0:0.2488:0.5371:0.2141	.	51	A8K367	.	H	51	ENSP00000394452:Q51H;ENSP00000317842:Q51H	ENSP00000317842:Q51H	Q	+	3	2	CES2	65527000	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.582000	0.05814	0.350000	0.24002	-0.211000	0.12701	CAG	.	.		0.677	FAM96B-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429890.1	NM_016062	
ZFHX3	463	hgsc.bcm.edu	37	16	72830306	72830306	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr16:72830306A>G	ENST00000268489.5	-	9	6947	c.6275T>C	c.(6274-6276)aTg>aCg	p.M2092T	ZFHX3_ENST00000397992.5_Missense_Mutation_p.M1178T	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2092					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGGCAGCTCCATCGGCATGGA	0.652																																					p.M2092T		Atlas-SNP	.											.	ZFHX3	404	.	0			c.T6275C						.						72.0	61.0	65.0					16																	72830306		2198	4300	6498	SO:0001583	missense	463	exon9			AGCTCCATCGGCA	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6275T>C	chr16.hg19:g.72830306A>G	ENSP00000268489:p.Met2092Thr	48.0	0.0		36.0	11.0	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	hg19	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	A	15.90	2.970550	0.53614	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.73258	-0.73;-0.71	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000009	T	0.65101	0.2659	L	0.46157	1.445	0.80722	D	1	D	0.53885	0.963	B	0.40940	0.344	T	0.69731	-0.5066	10	0.52906	T	0.07	.	15.4346	0.75137	1.0:0.0:0.0:0.0	.	2092	Q15911	ZFHX3_HUMAN	T	2092;1178	ENSP00000268489:M2092T;ENSP00000438926:M1178T	ENSP00000268489:M2092T	M	-	2	0	ZFHX3	71387807	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	9.331000	0.96430	2.041000	0.60428	0.533000	0.62120	ATG	.	.		0.652	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
FAM57A	79850	hgsc.bcm.edu	37	17	644672	644672	+	Silent	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:644672C>G	ENST00000308278.8	+	5	872	c.636C>G	c.(634-636)ctC>ctG	p.L212L	FAM57A_ENST00000301324.8_Silent_p.L180L	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	212	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		TAAGCCTGCTCCAAGTACCCT	0.557																																					p.L212L		Atlas-SNP	.											.	FAM57A	17	.	0			c.C636G						.						160.0	124.0	136.0					17																	644672		2203	4300	6503	SO:0001819	synonymous_variant	79850	exon5			CCTGCTCCAAGTA	AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.636C>G	chr17.hg19:g.644672C>G		76.0	0.0		79.0	8.0	NM_024792	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Silent	SNP	ENST00000308278.8	hg19	CCDS10996.1																																																																																			.	.		0.557	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437155.2	NM_024792	
ALOX15B	247	hgsc.bcm.edu	37	17	7946179	7946179	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:7946179A>T	ENST00000380183.4	+	5	792	c.653A>T	c.(652-654)aAc>aTc	p.N218I	ALOX15B_ENST00000572022.1_Missense_Mutation_p.N218I|ALOX15B_ENST00000573359.1_Missense_Mutation_p.N218I|ALOX15B_ENST00000380173.2_Missense_Mutation_p.N218I	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	218	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						AGGATCTTCAACTTCCGGAGG	0.567																																					p.N218I		Atlas-SNP	.											.	ALOX15B	66	.	0			c.A653T						.						34.0	31.0	32.0					17																	7946179		2176	4250	6426	SO:0001583	missense	247	exon5			TCTTCAACTTCCG	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.653A>T	chr17.hg19:g.7946179A>T	ENSP00000369530:p.Asn218Ile	102.0	0.0		108.0	21.0	NM_001141	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	hg19	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.406422	0.25378	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	T;T	0.76709	-1.04;-1.04	4.42	0.477	0.16784	Lipoxygenase, C-terminal (3);	0.727387	0.14403	N	0.321775	T	0.53722	0.1814	N	0.16201	0.385	0.29488	N	0.855847	B;B;B;B	0.19200	0.034;0.027;0.01;0.012	B;B;B;B	0.23018	0.043;0.026;0.015;0.026	T	0.38265	-0.9669	10	0.17832	T	0.49	-19.3584	3.0325	0.06111	0.5119:0.0:0.1082:0.3799	.	218;218;218;218	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	I	218	ENSP00000369520:N218I;ENSP00000369530:N218I	ENSP00000344337:N218I	N	+	2	0	ALOX15B	7886904	0.000000	0.05858	0.830000	0.32933	0.043000	0.13939	-1.136000	0.03222	0.254000	0.21573	-0.379000	0.06801	AAC	.	.		0.567	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
NTN1	9423	hgsc.bcm.edu	37	17	8926031	8926031	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:8926031C>T	ENST00000173229.2	+	2	448	c.341C>T	c.(340-342)cCg>cTg	p.P114L	NTN1_ENST00000546090.1_Missense_Mutation_p.P114L|NTN1_ENST00000538852.1_Missense_Mutation_p.P114L	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	114	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						CTCAACAACCCGCACAACCTG	0.647																																					p.P114L		Atlas-SNP	.											.	NTN1	31	.	0			c.C341T						.						21.0	14.0	16.0					17																	8926031		2110	4164	6274	SO:0001583	missense	9423	exon2			ACAACCCGCACAA	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.341C>T	chr17.hg19:g.8926031C>T	ENSP00000173229:p.Pro114Leu	104.0	0.0		117.0	15.0	NM_004822	E9KL51	Missense_Mutation	SNP	ENST00000173229.2	hg19	CCDS11148.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062819	0.76187	.	.	ENSG00000065320	ENST00000173229;ENST00000538852;ENST00000546090	T;T;T	0.76448	-1.02;-1.02;-1.02	4.71	4.71	0.59529	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81375	0.4809	M	0.87971	2.92	0.80722	D	1	P	0.36633	0.562	B	0.36608	0.229	D	0.83480	0.0064	10	0.41790	T	0.15	.	17.262	0.87072	0.0:1.0:0.0:0.0	.	114	O95631	NET1_HUMAN	L	114	ENSP00000173229:P114L;ENSP00000443259:P114L;ENSP00000441611:P114L	ENSP00000173229:P114L	P	+	2	0	NTN1	8866756	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.967000	0.70403	2.170000	0.68504	0.536000	0.68110	CCG	.	.		0.647	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252583.1		
MYH4	4622	hgsc.bcm.edu	37	17	10350413	10350413	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:10350413G>C	ENST00000255381.2	-	35	5196	c.5086C>G	c.(5086-5088)Ctg>Gtg	p.L1696V	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1696					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GTCCGTTCCAGGGATGCCCTG	0.517																																					p.L1696V		Atlas-SNP	.											.	MYH4	349	.	0			c.C5086G						.						170.0	135.0	147.0					17																	10350413		2203	4300	6503	SO:0001583	missense	4622	exon35			GTTCCAGGGATGC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5086C>G	chr17.hg19:g.10350413G>C	ENSP00000255381:p.Leu1696Val	70.0	0.0		90.0	4.0	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821619	0.50633	.	.	ENSG00000141048	ENST00000255381	D	0.81579	-1.51	5.29	3.18	0.36537	Myosin tail (1);	0.000000	0.30011	U	0.010639	D	0.82393	0.5027	M	0.76328	2.33	0.42162	D	0.991604	P	0.41345	0.746	P	0.47827	0.558	T	0.80139	-0.1507	10	0.44086	T	0.13	.	9.5163	0.39106	0.2429:0.0:0.7571:0.0	.	1696	Q9Y623	MYH4_HUMAN	V	1696	ENSP00000255381:L1696V	ENSP00000255381:L1696V	L	-	1	2	MYH4	10291138	0.980000	0.34600	0.987000	0.45799	0.959000	0.62525	1.775000	0.38584	0.637000	0.30526	-0.251000	0.11542	CTG	.	.		0.517	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
MPRIP	23164	hgsc.bcm.edu	37	17	17075128	17075128	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:17075128C>T	ENST00000341712.4	+	16	2260	c.2260C>T	c.(2260-2262)Cga>Tga	p.R754*	MPRIP_ENST00000395804.3_Nonsense_Mutation_p.R754*|MPRIP_ENST00000395811.5_Nonsense_Mutation_p.R754*|RNU6-767P_ENST00000384132.1_RNA|RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000444976.1_Nonsense_Mutation_p.R716*			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	754	Interaction with RHOA.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AGAGAAACTTCGAGAAGAGAA	0.587																																					p.R754X		Atlas-SNP	.											.	MPRIP	87	.	0			c.C2260T						.						61.0	71.0	68.0					17																	17075128		2203	4300	6503	SO:0001587	stop_gained	23164	exon16			AAACTTCGAGAAG	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2260C>T	chr17.hg19:g.17075128C>T	ENSP00000342379:p.Arg754*	266.0	0.0		286.0	54.0	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Nonsense_Mutation	SNP	ENST00000341712.4	hg19	CCDS32578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	7.086633|7.086633	0.98055|0.98055	.|.	.|.	ENSG00000133030|ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712|ENST00000313485	.|.	.|.	.|.	5.79|5.79	-1.8|-1.8	0.07907|0.07907	.|.	0.156344|.	0.39210|.	N|.	0.001430|.	.|T	.|0.62636	.|0.2444	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69731	.|-0.5066	.|3	0.05351|.	T|.	0.99|.	-7.8984|-7.8984	17.4731|17.4731	0.87652|0.87652	0.645:0.355:0.0:0.0|0.645:0.355:0.0:0.0	.|.	.|.	.|.	.|.	X|L	716;754;754;754|1118	.|.	ENSP00000342379:R754X|.	R|S	+|+	1|2	2|0	MPRIP|MPRIP	17015853|17015853	1.000000|1.000000	0.71417|0.71417	0.556000|0.556000	0.28293|0.28293	0.896000|0.896000	0.52359|0.52359	1.456000|1.456000	0.35201|0.35201	-0.165000|-0.165000	0.10908|0.10908	0.655000|0.655000	0.94253|0.94253	CGA|TCG	.	.		0.587	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
AKAP10	11216	hgsc.bcm.edu	37	17	19844215	19844215	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:19844215G>A	ENST00000225737.6	-	7	1327	c.1170C>T	c.(1168-1170)ctC>ctT	p.L390L	AKAP10_ENST00000395536.3_Silent_p.L390L	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	390	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					AGAAATAAAAGAGGGCTGACT	0.433																																					p.L390L		Atlas-SNP	.											.	AKAP10	47	.	0			c.C1170T						.						58.0	56.0	57.0					17																	19844215		2203	4299	6502	SO:0001819	synonymous_variant	11216	exon7			ATAAAAGAGGGCT	AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1170C>T	chr17.hg19:g.19844215G>A		298.0	0.0		370.0	33.0	NM_007202	B2R650|Q96AJ7	Silent	SNP	ENST00000225737.6	hg19	CCDS11214.1																																																																																			.	.		0.433	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
EFCAB5	374786	hgsc.bcm.edu	37	17	28296107	28296107	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:28296107T>A	ENST00000394835.3	+	4	681	c.489T>A	c.(487-489)acT>acA	p.T163T	EFCAB5_ENST00000378738.3_Silent_p.T163T|EFCAB5_ENST00000394832.2_Silent_p.T163T|EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000320856.5_Silent_p.T163T|EFCAB5_ENST00000534836.2_Intron|EFCAB5_ENST00000536908.2_Silent_p.T107T	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	163							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GGTTTAATACTGACAGCATGA	0.348																																					p.T163T		Atlas-SNP	.											.	EFCAB5	122	.	0			c.T489A						.						40.0	39.0	39.0					17																	28296107		1841	4086	5927	SO:0001819	synonymous_variant	374786	exon4			TAATACTGACAGC	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.489T>A	chr17.hg19:g.28296107T>A		221.0	0.0		253.0	32.0	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	ENST00000394835.3	hg19	CCDS11254.2																																																																																			.	.		0.348	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
LHX1	3975	hgsc.bcm.edu	37	17	35297689	35297689	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:35297689C>T	ENST00000254457.5	+	2	1684	c.273C>T	c.(271-273)tgC>tgT	p.C91C	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	91	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				GCTTCACCTGCATGATGTGTA	0.527																																					p.C91C		Atlas-SNP	.											.	LHX1	48	.	0			c.C273T						.						88.0	72.0	77.0					17																	35297689		2203	4300	6503	SO:0001819	synonymous_variant	3975	exon2			CACCTGCATGATG	U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.273C>T	chr17.hg19:g.35297689C>T		89.0	0.0		113.0	17.0	NM_005568	Q3MIW0	Silent	SNP	ENST00000254457.5	hg19	CCDS11316.1																																																																																			.	.		0.527	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256704.3	NM_005568	
ACACA	31	hgsc.bcm.edu	37	17	35614734	35614734	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:35614734T>C	ENST00000394406.2	-	14	1796	c.1606A>G	c.(1606-1608)Aat>Gat	p.N536D	ACACA_ENST00000360679.3_Missense_Mutation_p.N478D|ACACA_ENST00000353139.5_Missense_Mutation_p.N573D|ACACA_ENST00000335166.5_Missense_Mutation_p.N458D	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	536	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CCCCAAACATTCTTATTGCTG	0.418																																					p.N573D	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.A1717G						.						93.0	90.0	91.0					17																	35614734		2203	4300	6503	SO:0001583	missense	31	exon14			AAACATTCTTATT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.1606A>G	chr17.hg19:g.35614734T>C	ENSP00000377928:p.Asn536Asp	90.0	0.0		80.0	9.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	hg19	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.047507	0.75846	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.93	5.93	0.95920	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.77512	0.4141	N	0.25380	0.74	0.80722	D	1	B;B;B	0.31503	0.041;0.326;0.279	B;B;B	0.42087	0.059;0.375;0.258	T	0.76326	-0.3000	10	0.42905	T	0.14	-19.7328	15.5755	0.76380	0.0:0.0:0.0:1.0	.	573;536;478	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	D	573;478;536;560;458	ENSP00000344789:N573D;ENSP00000353898:N478D;ENSP00000377928:N536D;ENSP00000335323:N458D	ENSP00000335323:N458D	N	-	1	0	ACACA	32688847	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.040000	0.89188	2.281000	0.76405	0.533000	0.62120	AAT	.	.		0.418	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
C17orf96	100170841	hgsc.bcm.edu	37	17	36829800	36829800	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:36829800T>C	ENST00000325814.5	-	1	1387	c.949A>G	c.(949-951)Aac>Gac	p.N317D		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	317	Pro-rich.				neuron fate commitment (GO:0048663)												GGGAAGCAGTTGAGGAGGCTG	0.731																																					p.N317D		Atlas-SNP	.											.	.	.	.	0			c.A949G						.						5.0	6.0	6.0					17																	36829800		672	1556	2228	SO:0001583	missense	100170841	exon1			AGCAGTTGAGGAG		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.949A>G	chr17.hg19:g.36829800T>C	ENSP00000317905:p.Asn317Asp	30.0	0.0		38.0	14.0	NM_001130677		Missense_Mutation	SNP	ENST00000325814.5	hg19	CCDS45661.1	.	.	.	.	.	.	.	.	.	.	T	2.884	-0.231231	0.05983	.	.	ENSG00000179294	ENST00000325814	.	.	.	4.26	0.609	0.17575	.	.	.	.	.	T	0.11024	0.0269	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34054	-0.9844	8	0.06625	T	0.88	.	4.5718	0.12214	0.1739:0.6189:0.0:0.2072	.	317	A6NHQ4	CQ096_HUMAN	D	317	.	ENSP00000317905:N317D	N	-	1	0	C17orf96	34083326	0.222000	0.23652	0.985000	0.45067	0.971000	0.66376	0.710000	0.25748	0.252000	0.21531	-0.659000	0.03860	AAC	.	.		0.731	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
KRTAP17-1	83902	hgsc.bcm.edu	37	17	39471826	39471826	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:39471826G>A	ENST00000334202.3	-	1	121	c.77C>T	c.(76-78)cCg>cTg	p.P26L		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	26						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			acagcagCCCGGCTGACAGCA	0.692																																					p.P26L		Atlas-SNP	.											.	KRTAP17-1	14	.	0			c.C77T						.						15.0	18.0	17.0					17																	39471826		2196	4282	6478	SO:0001583	missense	83902	exon1			CAGCCCGGCTGAC	AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.77C>T	chr17.hg19:g.39471826G>A	ENSP00000333993:p.Pro26Leu	80.0	0.0		86.0	10.0	NM_031964		Missense_Mutation	SNP	ENST00000334202.3	hg19	CCDS11387.1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.358358	0.24598	.	.	ENSG00000186860	ENST00000334202	.	.	.	4.26	3.25	0.37280	.	.	.	.	.	T	0.25082	0.0609	N	0.14661	0.345	0.40845	D	0.983709	P	0.39022	0.655	B	0.28784	0.094	T	0.12656	-1.0539	8	0.87932	D	0	-13.7877	8.864	0.35276	0.0:0.0:0.766:0.234	.	26	Q9BYP8	KR171_HUMAN	L	26	.	ENSP00000333993:P26L	P	-	2	0	KRTAP17-1	36725352	0.878000	0.30173	0.991000	0.47740	0.852000	0.48524	1.075000	0.30716	0.937000	0.37394	0.462000	0.41574	CCG	.	.		0.692	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257296.1		
SGCA	6442	hgsc.bcm.edu	37	17	48245087	48245087	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:48245087A>T	ENST00000262018.3	+	3	338	c.302A>T	c.(301-303)cAg>cTg	p.Q101L	SGCA_ENST00000543315.1_Missense_Mutation_p.Q101L|SGCA_ENST00000513942.1_Intron|RP11-893F2.14_ENST00000572855.1_RNA|SGCA_ENST00000451235.2_Intron|SGCA_ENST00000344627.6_Missense_Mutation_p.Q101L	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	101					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						CGTGGGCTCCAGGTCATTGAG	0.632																																					p.Q101L		Atlas-SNP	.											.	SGCA	35	.	0			c.A302T						.						20.0	21.0	21.0					17																	48245087		2203	4300	6503	SO:0001583	missense	6442	exon3			GGCTCCAGGTCAT	L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.302A>T	chr17.hg19:g.48245087A>T	ENSP00000262018:p.Gln101Leu	94.0	0.0		90.0	18.0	NM_001135697	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	ENST00000262018.3	hg19	CCDS32679.1	.	.	.	.	.	.	.	.	.	.	A	11.53	1.665845	0.29604	.	.	ENSG00000108823	ENST00000344627;ENST00000262018;ENST00000543315	D;D;D	0.98178	-4.77;-4.77;-4.77	4.53	3.36	0.38483	Dystroglycan-type cadherin-like (1);Cadherin-like (1);	0.322034	0.29431	N	0.012178	D	0.97031	0.9030	L	0.27053	0.805	0.80722	D	1	D;B	0.67145	0.996;0.046	D;B	0.77557	0.99;0.066	D	0.94612	0.7805	10	0.25106	T	0.35	-21.717	8.0867	0.30775	0.8198:0.0:0.0:0.1802	.	101;101	Q16586-2;Q16586	.;SGCA_HUMAN	L	101	ENSP00000345522:Q101L;ENSP00000262018:Q101L;ENSP00000444539:Q101L	ENSP00000262018:Q101L	Q	+	2	0	SGCA	45600086	0.971000	0.33674	0.984000	0.44739	0.628000	0.37860	1.019000	0.30014	1.802000	0.52723	0.379000	0.24179	CAG	.	.		0.632	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1	NM_000023	
MBTD1	54799	hgsc.bcm.edu	37	17	49302381	49302381	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:49302381T>C	ENST00000586178.1	-	3	485	c.142A>G	c.(142-144)Aaa>Gaa	p.K48E	MBTD1_ENST00000593259.1_5'Flank|MBTD1_ENST00000415868.1_Missense_Mutation_p.K48E|MBTD1_ENST00000376381.2_Missense_Mutation_p.K48E	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	48					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			ATGCCAGATTTACCATCTGGG	0.423																																					p.K48E		Atlas-SNP	.											.	MBTD1	44	.	0			c.A142G						.						150.0	139.0	142.0					17																	49302381		692	1591	2283	SO:0001583	missense	54799	exon3			CAGATTTACCATC	AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.142A>G	chr17.hg19:g.49302381T>C	ENSP00000468304:p.Lys48Glu	72.0	0.0		91.0	15.0	NM_017643	Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	ENST00000586178.1	hg19	CCDS11581.2	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843128	0.91197	.	.	ENSG00000011258	ENST00000405860;ENST00000415868;ENST00000376381	T;T	0.24908	1.83;1.84	5.21	5.21	0.72293	Zinc finger, FCS-type (1);	0.044023	0.85682	D	0.000000	T	0.42359	0.1199	L	0.48642	1.525	0.80722	D	1	D;D	0.67145	0.985;0.996	P;D	0.76071	0.576;0.987	T	0.11421	-1.0588	10	0.21540	T	0.41	.	15.3505	0.74380	0.0:0.0:0.0:1.0	.	48;48	Q05BQ5;Q05BQ5-2	MBTD1_HUMAN;.	E	48	ENSP00000403946:K48E;ENSP00000365561:K48E	ENSP00000365561:K48E	K	-	1	0	MBTD1	46657380	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.965000	0.87945	2.089000	0.63090	0.482000	0.46254	AAA	.	.		0.423	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318124.1		
DGKE	8526	hgsc.bcm.edu	37	17	54939189	54939189	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:54939189T>A	ENST00000284061.3	+	10	1502	c.1322T>A	c.(1321-1323)tTg>tAg	p.L441*		NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	441					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					CTGCCCAGCTTGGAAGGTATT	0.463																																					p.L441X		Atlas-SNP	.											.	DGKE	47	.	0			c.T1322A						.						181.0	179.0	180.0					17																	54939189		2203	4300	6503	SO:0001587	stop_gained	8526	exon10			CCAGCTTGGAAGG	U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.1322T>A	chr17.hg19:g.54939189T>A	ENSP00000284061:p.Leu441*	91.0	0.0		77.0	7.0	NM_003647	Q8TBM4|Q9UKQ3	Nonsense_Mutation	SNP	ENST00000284061.3	hg19	CCDS11590.1	.	.	.	.	.	.	.	.	.	.	T	38	6.840181	0.97877	.	.	ENSG00000153933	ENST00000284061	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9436	0.79776	0.0:0.0:0.0:1.0	.	.	.	.	X	441	.	ENSP00000284061:L441X	L	+	2	0	DGKE	52294188	1.000000	0.71417	0.984000	0.44739	0.962000	0.63368	7.580000	0.82523	2.150000	0.67090	0.529000	0.55759	TTG	.	.		0.463	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647	
BZRAP1	9256	hgsc.bcm.edu	37	17	56382773	56382773	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:56382773C>A	ENST00000343736.4	-	29	5571	c.5408G>T	c.(5407-5409)gGc>gTc	p.G1803V	BZRAP1_ENST00000355701.3_Missense_Mutation_p.G1803V|BZRAP1_ENST00000268893.6_Missense_Mutation_p.G1743V			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1803	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATCGTCCATGCCCCCAAACAC	0.582																																					p.G1803V		Atlas-SNP	.											.	BZRAP1	287	.	0			c.G5408T						.						127.0	115.0	119.0					17																	56382773		2203	4300	6503	SO:0001583	missense	9256	exon29			TCCATGCCCCCAA	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.5408G>T	chr17.hg19:g.56382773C>A	ENSP00000345824:p.Gly1803Val	162.0	0.0		147.0	16.0	NM_004758	O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	hg19	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.035305	0.35893	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.08896	3.04;3.04;3.04	5.39	-6.81	0.01704	Src homology-3 domain (3);Variant SH3 (1);	0.958653	0.08680	N	0.909552	T	0.06781	0.0173	N	0.08118	0	0.32326	N	0.56176	B;P;P	0.49307	0.213;0.454;0.922	B;B;P	0.53360	0.139;0.363;0.724	T	0.38564	-0.9655	10	0.48119	T	0.1	.	10.3478	0.43916	0.0:0.1372:0.5599:0.303	.	1794;1743;1803	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	V	1803;1803;1743	ENSP00000347929:G1803V;ENSP00000345824:G1803V;ENSP00000268893:G1743V	ENSP00000268893:G1743V	G	-	2	0	BZRAP1	53737772	0.110000	0.22057	0.210000	0.23637	0.958000	0.62258	0.774000	0.26675	-0.896000	0.03915	-0.502000	0.04539	GGC	.	.		0.582	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
TANC2	26115	hgsc.bcm.edu	37	17	61278235	61278235	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:61278235C>A	ENST00000424789.2	+	5	468	c.464C>A	c.(463-465)aCa>aAa	p.T155K	TANC2_ENST00000389520.4_Missense_Mutation_p.T155K|AC037445.1_ENST00000581421.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	155					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CCCATCAGTACAAATGCAACT	0.507																																					p.T155K		Atlas-SNP	.											.	TANC2	266	.	0			c.C464A						.						149.0	145.0	146.0					17																	61278235		1980	4152	6132	SO:0001583	missense	26115	exon5			TCAGTACAAATGC	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.464C>A	chr17.hg19:g.61278235C>A	ENSP00000387593:p.Thr155Lys	218.0	0.0		236.0	40.0	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	hg19	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574538	0.45902	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.38077	1.16;1.16	5.76	5.76	0.90799	.	.	.	.	.	T	0.35335	0.0928	L	0.29908	0.895	0.41456	D	0.988016	P;B	0.35033	0.481;0.349	B;B	0.38500	0.275;0.142	T	0.09618	-1.0666	9	0.45353	T	0.12	.	19.9658	0.97266	0.0:1.0:0.0:0.0	.	155;155	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	K	155	ENSP00000374171:T155K;ENSP00000387593:T155K	ENSP00000374171:T155K	T	+	2	0	TANC2	58631967	0.999000	0.42202	1.000000	0.80357	0.168000	0.22595	5.898000	0.69838	2.721000	0.93114	0.591000	0.81541	ACA	.	.		0.507	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
CYB561	1534	hgsc.bcm.edu	37	17	61513081	61513081	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:61513081C>T	ENST00000392976.1	-	4	672	c.373G>A	c.(373-375)Ggg>Agg	p.G125R	CYB561_ENST00000582997.1_Missense_Mutation_p.G132R|CYB561_ENST00000392975.2_Missense_Mutation_p.G125R|CYB561_ENST00000582297.1_Missense_Mutation_p.G125R|CYB561_ENST00000581163.1_5'UTR|CYB561_ENST00000542042.1_Missense_Mutation_p.G192R|CYB561_ENST00000582034.1_Missense_Mutation_p.G96R|CYB561_ENST00000360793.3_Missense_Mutation_p.G125R|CYB561_ENST00000581573.1_Missense_Mutation_p.G125R|CYB561_ENST00000584031.1_Silent_p.A140A|CYB561_ENST00000448884.2_Missense_Mutation_p.G125R	NM_001017916.1	NP_001017916.1	P49447	CY561_HUMAN	cytochrome b561	125	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				electron transport chain (GO:0022900)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|transmembrane electron transfer carrier (GO:0022865)			lung(2)|ovary(1)|prostate(1)	4				READ - Rectum adenocarcinoma(1115;0.0689)		ACAAGGATCCCGCACCAGCTG	0.607																																					p.G125R		Atlas-SNP	.											.	CYB561	15	.	0			c.G373A						.						130.0	123.0	125.0					17																	61513081		2203	4300	6503	SO:0001583	missense	1534	exon4			GGATCCCGCACCA		CCDS11636.1	17q23.3	2013-03-14	2013-03-14		ENSG00000008283	ENSG00000008283		"""Cytochrome b genes"""	2571	protein-coding gene	gene with protein product	"""ferric-chelate reductase 2"", ""cytochrome b561 family, member A1"""	600019				7959749, 23249217	Standard	XM_005257091		Approved	FRRS2, CYB561A1	uc002jas.3	P49447		ENST00000392976.1:c.373G>A	chr17.hg19:g.61513081C>T	ENSP00000376702:p.Gly125Arg	135.0	0.0		137.0	16.0	NM_001915	B2RE96|B7Z775|D3DU11|Q5BJG9|Q9BU05|Q9BWR9	Missense_Mutation	SNP	ENST00000392976.1	hg19	CCDS11636.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.074125	0.55646	.	.	ENSG00000008283	ENST00000360793;ENST00000392976;ENST00000392975;ENST00000448884;ENST00000542042	D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35	4.43	4.43	0.53597	Cytochrome b561, eukaryote (1);Cytochrome b561/ferric reductase transmembrane (2);	0.000000	0.85682	D	0.000000	D	0.95771	0.8624	M	0.94101	3.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96930	0.9680	10	0.87932	D	0	-23.8694	15.8184	0.78621	0.0:1.0:0.0:0.0	.	125;192;125	B7Z775;F5H757;P49447	.;.;CY561_HUMAN	R	125;125;125;125;192	ENSP00000354028:G125R;ENSP00000376702:G125R;ENSP00000376701:G125R;ENSP00000400350:G125R;ENSP00000442773:G192R	ENSP00000354028:G125R	G	-	1	0	CYB561	58866813	1.000000	0.71417	0.866000	0.34008	0.994000	0.84299	5.516000	0.67055	2.297000	0.77311	0.561000	0.74099	GGG	.	.		0.607	CYB561-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444843.1	NM_001915	
CEP95	90799	hgsc.bcm.edu	37	17	62533182	62533182	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:62533182A>G	ENST00000556440.2	+	19	2751	c.2241A>G	c.(2239-2241)atA>atG	p.I747M	CEP95_ENST00000553412.1_Missense_Mutation_p.I583M	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	747						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						CAGAAGCCATATCACAGGAAC	0.343																																					p.I747M		Atlas-SNP	.											.	CEP95	103	.	0			c.A2241G						.						42.0	39.0	40.0					17																	62533182		1817	4078	5895	SO:0001583	missense	90799	exon19			AGCCATATCACAG	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.2241A>G	chr17.hg19:g.62533182A>G	ENSP00000450461:p.Ile747Met	386.0	0.0		425.0	109.0	NM_138363	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	hg19	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.886267	0.51908	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.34072	1.4;1.38	5.34	1.5	0.22942	.	0.170777	0.51477	D	0.000087	T	0.29524	0.0736	N	0.19112	0.55	0.33229	D	0.555721	P	0.42203	0.773	P	0.48840	0.592	T	0.42258	-0.9462	10	0.72032	D	0.01	-12.7041	8.2556	0.31754	0.4833:0.3954:0.0:0.1214	.	747	Q96GE4	CEP95_HUMAN	M	682;747;583	ENSP00000450461:I747M;ENSP00000450906:I583M	ENSP00000438458:I682M	I	+	3	3	CEP95	59963644	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.997000	0.29731	0.377000	0.24735	0.379000	0.24179	ATA	.	.		0.343	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
PRKAR1A	5573	hgsc.bcm.edu	37	17	66521090	66521090	+	Silent	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:66521090A>C	ENST00000589228.1	+	6	668	c.540A>C	c.(538-540)ggA>ggC	p.G180G	PRKAR1A_ENST00000588188.2_Silent_p.G180G|PRKAR1A_ENST00000586397.1_Silent_p.G180G|PRKAR1A_ENST00000536854.2_Silent_p.G180G|PRKAR1A_ENST00000358598.2_Silent_p.G180G|PRKAR1A_ENST00000392711.1_Silent_p.G180G	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	180					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					TTGATCAAGGAGAGACGGATG	0.313			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.G180G	Ovarian(167;637 1670 33025 39608 46699 51856)	Atlas-SNP	.	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A	48	.	0			c.A540C						.						123.0	132.0	129.0					17																	66521090		2203	4300	6503	SO:0001819	synonymous_variant	5573	exon5	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	TCAAGGAGAGACG		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.540A>C	chr17.hg19:g.66521090A>C		64.0	0.0		96.0	22.0	NM_001276290	K7ER48|Q567S7	Silent	SNP	ENST00000589228.1	hg19	CCDS11678.1																																																																																			.	.		0.313	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
CD300LF	146722	hgsc.bcm.edu	37	17	72694567	72694567	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:72694567A>T	ENST00000326165.6	-	4	611	c.500T>A	c.(499-501)cTg>cAg	p.L167Q	RAB37_ENST00000340415.3_Intron|CD300LF_ENST00000343125.4_Intron|CD300LF_ENST00000464910.1_Missense_Mutation_p.L170Q|CD300LF_ENST00000361254.4_Missense_Mutation_p.L185Q|CD300LF_ENST00000581500.1_Missense_Mutation_p.L185Q|RAB37_ENST00000402449.4_Intron|CD300LF_ENST00000469092.1_Intron|CD300LF_ENST00000301573.9_Silent_p.A182A|CD300LF_ENST00000583937.1_Missense_Mutation_p.L182Q	NM_139018.3	NP_620587.2	Q8TDQ1	CLM1_HUMAN	CD300 molecule-like family member f	167					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CAAAAGCAGCAGCAATATGGT	0.587																																					p.L167Q		Atlas-SNP	.											.	CD300LF	55	.	0			c.T500A						.						107.0	76.0	87.0					17																	72694567		2203	4300	6503	SO:0001583	missense	146722	exon4			AGCAGCAGCAATA	BC028199	CCDS11704.1, CCDS74148.1, CCDS74149.1, CCDS74150.1, CCDS74151.1, CCDS74152.1	17q25.2	2013-01-11	2006-03-29		ENSG00000186074	ENSG00000186074		"""Immunoglobulin superfamily / V-set domain containing"""	29883	protein-coding gene	gene with protein product		609807	"""CD300 antigen like family member F"""			12975309	Standard	NM_139018		Approved	IREM1, NKIR, IGSF13, CD300f, CLM1	uc002jlg.3	Q8TDQ1	OTTHUMG00000067609	ENST00000326165.6:c.500T>A	chr17.hg19:g.72694567A>T	ENSP00000327075:p.Leu167Gln	87.0	0.0		92.0	14.0	NM_139018	B2RCL2|C9JDN3|Q3Y6P0|Q6UX24|Q7Z6A6|Q7Z7I4|Q7Z7I5|Q8N6D0|Q8NAF5	Missense_Mutation	SNP	ENST00000326165.6	hg19	CCDS11704.1	.	.	.	.	.	.	.	.	.	.	A	5.751	0.323065	0.10900	.	.	ENSG00000186074	ENST00000361254;ENST00000326165	T;T	0.70631	-0.5;-0.5	5.66	4.59	0.56863	.	0.428603	0.17017	N	0.190251	T	0.82185	0.4982	M	0.80422	2.495	0.20703	N	0.999864	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.982;0.999;1.0	T	0.72513	-0.4270	10	0.62326	D	0.03	.	7.5656	0.27876	0.9066:0.0:0.0934:0.0	.	182;185;167;170	E7EME0;Q8TDQ1-2;Q8TDQ1;Q8TDQ1-6	.;.;CLM1_HUMAN;.	Q	185;167	ENSP00000355294:L185Q;ENSP00000327075:L167Q	ENSP00000327075:L167Q	L	-	2	0	CD300LF	70206162	0.948000	0.32251	0.836000	0.33094	0.041000	0.13682	2.772000	0.47678	2.154000	0.67381	0.460000	0.39030	CTG	.	.		0.587	CD300LF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000145085.1	NM_139018	
UBALD2	283991	hgsc.bcm.edu	37	17	74266433	74266433	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:74266433C>T	ENST00000327490.6	+	3	646	c.342C>T	c.(340-342)gcC>gcT	p.A114A	UBALD2_ENST00000589240.1_Silent_p.A54A	NM_182565.3	NP_872371.1	Q8IYN6	UBAD2_HUMAN	UBA-like domain containing 2	114																	CCTTCTGGGCCTCGTCCCCGC	0.706																																					p.A114A		Atlas-SNP	.											.	.	.	.	0			c.C342T						.						16.0	13.0	14.0					17																	74266433		2171	4281	6452	SO:0001819	synonymous_variant	283991	exon3			CTGGGCCTCGTCC		CCDS11742.1	17q25.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000185262	ENSG00000185262			28438	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member B"""	FAM100B			Standard	NM_182565		Approved	MGC29814	uc010wsy.1	Q8IYN6	OTTHUMG00000132666	ENST00000327490.6:c.342C>T	chr17.hg19:g.74266433C>T		56.0	0.0		88.0	16.0	NM_182565		Silent	SNP	ENST00000327490.6	hg19	CCDS11742.1																																																																																			.	.		0.706	UBALD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255920.1	NM_182565	
CYTH1	9267	hgsc.bcm.edu	37	17	76778291	76778291	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:76778291G>C	ENST00000446868.3	-	1	85	c.15C>G	c.(13-15)gaC>gaG	p.D5E	CYTH1_ENST00000591455.1_Missense_Mutation_p.D5E|CYTH1_ENST00000589296.1_Missense_Mutation_p.D5E|CYTH1_ENST00000361101.4_Missense_Mutation_p.D5E			Q15438	CYH1_HUMAN	cytohesin 1	5					establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						GACCGTAGCTGTCGTCCTCCT	0.801																																					p.D5E		Atlas-SNP	.											.	CYTH1	36	.	0			c.C15G						.						3.0	3.0	3.0					17																	76778291		1374	2726	4100	SO:0001583	missense	9267	exon1			GTAGCTGTCGTCC	M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.15C>G	chr17.hg19:g.76778291G>C	ENSP00000389095:p.Asp5Glu	50.0	0.0		67.0	6.0	NM_017456	A6NFW7|B7Z1T4|Q9P123|Q9P124	Missense_Mutation	SNP	ENST00000446868.3	hg19		.	.	.	.	.	.	.	.	.	.	g	11.20	1.569107	0.28003	.	.	ENSG00000108669	ENST00000446868;ENST00000361101;ENST00000392457;ENST00000262763	T;T	0.12255	2.7;2.7	2.44	2.44	0.29823	.	1.450410	0.04036	N	0.302257	T	0.10766	0.0263	L	0.27053	0.805	0.25886	N	0.983538	B	0.09022	0.002	B	0.09377	0.004	T	0.24584	-1.0156	10	0.15499	T	0.54	.	8.5166	0.33250	0.0:0.0:1.0:0.0	.	5	Q15438-2	.	E	5	ENSP00000389095:D5E;ENSP00000354398:D5E	ENSP00000262763:D5E	D	-	3	2	CYTH1	74289886	0.998000	0.40836	1.000000	0.80357	0.828000	0.46876	0.498000	0.22530	1.672000	0.50884	0.282000	0.19409	GAC	.	.		0.801	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317099.1	NM_004762	
AATK	9625	hgsc.bcm.edu	37	17	79095855	79095855	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:79095855T>A	ENST00000326724.4	-	11	1905	c.1881A>T	c.(1879-1881)gcA>gcT	p.A627A	AATK_ENST00000572339.1_5'Flank|AATK_ENST00000417379.1_Silent_p.A524A	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	627					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CGCCCCAGTCTGCATCCTCCG	0.726																																					p.A627A		Atlas-SNP	.											.	AATK	102	.	0			c.A1881T						.						10.0	13.0	12.0					17																	79095855		1882	4021	5903	SO:0001819	synonymous_variant	9625	exon11			CCAGTCTGCATCC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1881A>T	chr17.hg19:g.79095855T>A		64.0	0.0		75.0	9.0	NM_001080395	O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	hg19	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	T	10.14	1.269169	0.23221	.	.	ENSG00000181409	ENST00000417379	.	.	.	4.19	-7.01	0.01594	.	.	.	.	.	T	0.15046	0.0363	.	.	.	0.19575	N	0.999969	.	.	.	.	.	.	T	0.23940	-1.0174	4	.	.	.	.	0.4576	0.00511	0.3097:0.2576:0.2528:0.1799	.	.	.	.	L	580	.	.	Q	-	2	0	AATK	76710450	0.000000	0.05858	0.020000	0.16555	0.173000	0.22820	-1.287000	0.02785	-1.514000	0.01786	0.402000	0.26972	CAG	.	.		0.726	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
LAMA1	284217	hgsc.bcm.edu	37	18	7013922	7013922	+	Silent	SNP	G	G	A	rs375804587		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr18:7013922G>A	ENST00000389658.3	-	23	3348	c.3255C>T	c.(3253-3255)ccC>ccT	p.P1085P		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1085	Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P1085P(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAACACAGTCGGGAAAGTCTC	0.612																																					p.P1085P		Atlas-SNP	.											LAMA1,NS,carcinoma,0,1	LAMA1	458	.	1	Substitution - coding silent(1)	ovary(1)	c.C3255T						.	G		0,4406		0,0,2203	58.0	49.0	52.0		3255	-3.2	1.0	18		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LAMA1	NM_005559.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1085/3076	7013922	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	284217	exon23			ACAGTCGGGAAAG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3255C>T	chr18.hg19:g.7013922G>A		156.0	0.0		103.0	20.0	NM_005559		Silent	SNP	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.		0.612	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
DSG4	147409	hgsc.bcm.edu	37	18	28979346	28979346	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr18:28979346A>T	ENST00000308128.4	+	9	1252	c.1117A>T	c.(1117-1119)Aga>Tga	p.R373*	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Nonsense_Mutation_p.R373*|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	373	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AACCCCTGTGAGAATTCAAGT	0.403																																					p.R373X		Atlas-SNP	.											.	DSG4	343	.	0			c.A1117T						.						128.0	123.0	125.0					18																	28979346		2203	4300	6503	SO:0001587	stop_gained	147409	exon9			CCTGTGAGAATTC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1117A>T	chr18.hg19:g.28979346A>T	ENSP00000311859:p.Arg373*	152.0	0.0		110.0	23.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Nonsense_Mutation	SNP	ENST00000308128.4	hg19	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	A	38	6.660009	0.97743	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	.	.	.	5.33	4.14	0.48551	.	0.000000	0.36665	N	0.002468	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	7.0959	0.25309	0.7763:0.1494:0.0742:0.0	.	.	.	.	X	373	.	ENSP00000311859:R373X	R	+	1	2	DSG4	27233344	0.998000	0.40836	1.000000	0.80357	0.637000	0.38172	3.888000	0.56204	0.927000	0.37143	0.528000	0.53228	AGA	.	.		0.403	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
CDC34	997	hgsc.bcm.edu	37	19	541500	541500	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:541500C>T	ENST00000215574.4	+	5	877	c.659C>T	c.(658-660)gCc>gTc	p.A220V	GZMM_ENST00000264553.3_5'Flank	NM_004359.1	NP_004350.1	P49427	UB2R1_HUMAN	cell division cycle 34	220	Asp/Glu-rich (acidic).|SCF-binding.				cellular protein modification process (GO:0006464)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of neuron apoptotic process (GO:0043525)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|response to growth factor (GO:0070848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(1)	2		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGAGGAGGCCGACAGCTGC	0.627																																					p.A220V		Atlas-SNP	.											.	CDC34	5	.	0			c.C659T						.						58.0	51.0	53.0					19																	541500		2203	4300	6503	SO:0001583	missense	997	exon5			AGGAGGCCGACAG	L22005	CCDS12030.1	19p13.3	2013-01-17	2013-01-17					"""Ubiquitin-conjugating enzymes E2"""	1734	protein-coding gene	gene with protein product		116948	"""cell division cycle 34"", ""cell division cycle 34 homolog (S. cerevisiae)"""			8248134, 16210246	Standard	NM_004359		Approved	E2-CDC34, UBE2R1, UBC3	uc002lov.3	P49427		ENST00000215574.4:c.659C>T	chr19.hg19:g.541500C>T	ENSP00000215574:p.Ala220Val	101.0	0.0		115.0	12.0	NM_004359	A8K689	Missense_Mutation	SNP	ENST00000215574.4	hg19	CCDS12030.1	.	.	.	.	.	.	.	.	.	.	C	9.249	1.040337	0.19669	.	.	ENSG00000099804	ENST00000215574	T	0.44482	0.92	5.45	4.4	0.53042	.	1.436810	0.04575	N	0.393903	T	0.39009	0.1062	L	0.34521	1.04	0.37336	D	0.910168	B	0.26635	0.155	B	0.32864	0.154	T	0.05435	-1.0885	10	0.13470	T	0.59	-33.7016	12.5535	0.56240	0.3028:0.6972:0.0:0.0	.	220	P49427	UB2R1_HUMAN	V	220	ENSP00000215574:A220V	ENSP00000215574:A220V	A	+	2	0	CDC34	492500	0.977000	0.34250	0.464000	0.27143	0.002000	0.02628	2.459000	0.45023	1.306000	0.44926	-0.187000	0.12897	GCC	.	.		0.627	CDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451889.2	NM_004359	
GRIN3B	116444	hgsc.bcm.edu	37	19	1003596	1003596	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:1003596A>T	ENST00000234389.3	+	2	913	c.894A>T	c.(892-894)caA>caT	p.Q298H	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	298					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACATTGTGCAACTGGTGGCCC	0.766																																					p.Q298H		Atlas-SNP	.											.	GRIN3B	46	.	0			c.A894T						.						2.0	3.0	3.0					19																	1003596		1638	3485	5123	SO:0001583	missense	116444	exon2			TGTGCAACTGGTG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.894A>T	chr19.hg19:g.1003596A>T	ENSP00000234389:p.Gln298His	100.0	0.0		112.0	9.0	NM_138690	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	hg19	CCDS32861.1	.	.	.	.	.	.	.	.	.	.	a	8.581	0.882389	0.17467	.	.	ENSG00000116032	ENST00000234389	D	0.86164	-2.08	3.94	-1.25	0.09405	.	0.191195	0.33401	U	0.004946	T	0.72700	0.3493	N	0.24115	0.695	0.09310	N	0.99999	P	0.41748	0.761	B	0.38500	0.275	T	0.66834	-0.5823	10	0.66056	D	0.02	.	4.2075	0.10495	0.3239:0.3248:0.3512:0.0	.	298	O60391	NMD3B_HUMAN	H	298	ENSP00000234389:Q298H	ENSP00000234389:Q298H	Q	+	3	2	GRIN3B	954596	1.000000	0.71417	0.009000	0.14445	0.003000	0.03518	1.997000	0.40786	-0.500000	0.06614	-1.685000	0.00733	CAA	.	.		0.766	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
KLF16	83855	hgsc.bcm.edu	37	19	1854493	1854493	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:1854493T>A	ENST00000250916.4	-	2	794	c.724A>T	c.(724-726)Agc>Tgc	p.S242C	KLF16_ENST00000592313.1_5'UTR|CTB-31O20.6_ENST00000592884.1_RNA	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	242	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGCGGGGCTGGGCGCAGGG	0.751																																					p.S242C		Atlas-SNP	.											.	KLF16	9	.	0			c.A724T						.						3.0	5.0	4.0					19																	1854493		1468	3274	4742	SO:0001583	missense	83855	exon2			CGGGGCTGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.724A>T	chr19.hg19:g.1854493T>A	ENSP00000250916:p.Ser242Cys	52.0	0.0		67.0	24.0	NM_031918		Missense_Mutation	SNP	ENST00000250916.4	hg19	CCDS12075.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.901152	0.52227	.	.	ENSG00000129911	ENST00000250916;ENST00000541015	T;T	0.13901	2.55;2.55	3.34	3.34	0.38264	.	.	.	.	.	T	0.28599	0.0708	L	0.50333	1.59	0.29023	N	0.886157	D	0.76494	0.999	D	0.74674	0.984	T	0.03354	-1.1045	9	0.72032	D	0.01	.	9.7369	0.40392	0.0:0.0:0.0:1.0	.	242	Q9BXK1	KLF16_HUMAN	C	242	ENSP00000250916:S242C;ENSP00000439973:S242C	ENSP00000250916:S242C	S	-	1	0	KLF16	1805493	1.000000	0.71417	0.995000	0.50966	0.611000	0.37282	1.022000	0.30052	1.392000	0.46585	0.391000	0.25812	AGC	.	.		0.751	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
CREB3L3	84699	hgsc.bcm.edu	37	19	4171378	4171378	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:4171378A>G	ENST00000078445.2	+	9	1122		c.e9-1		CREB3L3_ENST00000602147.1_Splice_Site|CREB3L3_ENST00000602257.1_Splice_Site|CREB3L3_ENST00000595923.1_Splice_Site|CREB3L3_ENST00000252587.3_Splice_Site	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCTCCACCAGGTCCTGTTG	0.607																																					.		Atlas-SNP	.											.	CREB3L3	53	.	0			c.973-2A>G						.						91.0	79.0	83.0					19																	4171378		2203	4300	6503	SO:0001630	splice_region_variant	84699	exon9			TCCACCAGGTCCT		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.976-1A>G	chr19.hg19:g.4171378A>G		73.0	0.0		70.0	29.0	NM_001271995	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Splice_Site	SNP	ENST00000078445.2	hg19	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	A	13.39	2.221787	0.39300	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8958	0.52656	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CREB3L3	4122378	1.000000	0.71417	0.988000	0.46212	0.273000	0.26683	6.155000	0.71833	1.700000	0.51204	0.459000	0.35465	.	.	.		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	Intron
CREB3L3	84699	hgsc.bcm.edu	37	19	4171711	4171711	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:4171711A>T	ENST00000078445.2	+	10	1278	c.1131A>T	c.(1129-1131)ccA>ccT	p.P377P	CREB3L3_ENST00000602147.1_3'UTR|CREB3L3_ENST00000602257.1_Silent_p.P375P|CREB3L3_ENST00000595923.1_Silent_p.P376P|CREB3L3_ENST00000252587.3_Missense_Mutation_p.Q266L	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	377					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCTGTGCCAGGCTCCGAGG	0.647																																					p.P377P		Atlas-SNP	.											.	CREB3L3	53	.	0			c.A1131T						.						60.0	72.0	67.0					19																	4171711		2201	4294	6495	SO:0001819	synonymous_variant	84699	exon10			TGTGCCAGGCTCC		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.1131A>T	chr19.hg19:g.4171711A>T		184.0	0.0		171.0	11.0	NM_032607	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Silent	SNP	ENST00000078445.2	hg19	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	A	9.219	1.032845	0.19590	.	.	ENSG00000060566	ENST00000252587	T	0.78707	-1.2	3.53	-1.35	0.09114	.	.	.	.	.	T	0.67664	0.2917	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.57659	-0.7773	6	0.41790	T	0.15	-31.4195	4.5208	0.11958	0.6057:0.1686:0.2258:0.0	.	.	.	.	L	266	ENSP00000252587:Q266L	ENSP00000252587:Q266L	Q	+	2	0	CREB3L3	4122711	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	-1.567000	0.02146	-0.523000	0.06409	-1.277000	0.01392	CAG	.	.		0.647	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	
TNFSF14	8740	hgsc.bcm.edu	37	19	6670072	6670072	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:6670072C>G	ENST00000599359.1	-	2	390	c.9G>C	c.(7-9)gaG>gaC	p.E3D	TNFSF14_ENST00000326176.9_Missense_Mutation_p.E3D|TNFSF14_ENST00000245912.3_Missense_Mutation_p.E3D			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	3					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						GTACGACACTCTCCTCCATGC	0.602																																					p.E3D		Atlas-SNP	.											.	TNFSF14	40	.	0			c.G9C						.						95.0	72.0	80.0					19																	6670072		2203	4300	6503	SO:0001583	missense	8740	exon2			GACACTCTCCTCC	AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.9G>C	chr19.hg19:g.6670072C>G	ENSP00000469049:p.Glu3Asp	48.0	0.0		58.0	4.0	NM_003807	A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Missense_Mutation	SNP	ENST00000599359.1	hg19	CCDS12171.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.688277	0.29962	.	.	ENSG00000125735	ENST00000245912;ENST00000326176	T;T	0.37752	1.18;1.18	5.04	-4.44	0.03557	.	0.712502	0.12707	N	0.445841	T	0.21590	0.0520	L	0.28740	0.885	0.09310	N	1	B;B	0.12013	0.003;0.005	B;B	0.16722	0.007;0.016	T	0.23940	-1.0174	10	0.33141	T	0.24	-1.6926	9.5391	0.39240	0.2534:0.2734:0.4732:0.0	.	3;3	O43557;O43557-2	TNF14_HUMAN;.	D	3	ENSP00000245912:E3D;ENSP00000326940:E3D	ENSP00000245912:E3D	E	-	3	2	TNFSF14	6621072	0.000000	0.05858	0.009000	0.14445	0.028000	0.11728	-3.607000	0.00416	-0.382000	0.07870	0.563000	0.77884	GAG	.	.		0.602	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457863.1		
RPS28	6234	hgsc.bcm.edu	37	19	8387768	8387768	+	3'UTR	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:8387768A>C	ENST00000600659.2	+	0	870				KANK3_ENST00000330915.3_Silent_p.G807G|NDUFA7_ENST00000598884.1_5'Flank|NDUFA7_ENST00000301457.2_5'Flank	NM_001031.4	NP_001022.1	P62857	RS28_HUMAN	ribosomal protein S28						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)										ATTCTCCTTCACCAGGTGTGG	0.587																																					p.G807G		Atlas-SNP	.											.	KANK3	35	.	0			c.T2421G						.						84.0	67.0	73.0					19																	8387768		2203	4300	6503	SO:0001624	3_prime_UTR_variant	256949	exon11			TCCTTCACCAGGT	D14530	CCDS45953.1	19p13.2	2011-04-06				ENSG00000233927		"""S ribosomal proteins"""	10418	protein-coding gene	gene with protein product	"""40S ribosomal protein S28"""	603685				8415000, 9582194	Standard	NM_001031		Approved	S28	uc002mjn.3	P62857		ENST00000600659.2:c.*629A>C	chr19.hg19:g.8387768A>C		41.0	0.0		58.0	8.0	NM_198471	P25112	Silent	SNP	ENST00000600659.2	hg19	CCDS45953.1																																																																																			.	.		0.587	RPS28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461377.3	NM_001031	
MUC16	94025	hgsc.bcm.edu	37	19	8966763	8966763	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:8966763G>A	ENST00000397910.4	-	81	43393	c.43190C>T	c.(43189-43191)cCa>cTa	p.P14397L	MUC16_ENST00000380951.5_Missense_Mutation_p.P1038L	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14495				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCGAGCCAGTGGCGAGAAGTT	0.532																																					p.P14397L		Atlas-SNP	.											.	MUC16	4315	.	0			c.C43190T						.						27.0	30.0	29.0					19																	8966763		1954	4136	6090	SO:0001583	missense	94025	exon81			GCCAGTGGCGAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.43190C>T	chr19.hg19:g.8966763G>A	ENSP00000381008:p.Pro14397Leu	97.0	0.0		102.0	15.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.742|9.742	1.165075|1.165075	0.21538|0.21538	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.34072	.|1.38;1.38	4.22|4.22	2.07|2.07	0.26955|0.26955	.|SEA (2);	0.466719|.	0.18197|.	N|.	0.148652|.	T|T	0.54303|0.54303	0.1850|0.1850	M|M	0.88570|0.88570	2.965|2.965	.|.	.|.	.|.	.|P;D	.|0.57257	.|0.823;0.979	.|B;P	.|0.55923	.|0.405;0.787	T|T	0.64947|0.64947	-0.6287|-0.6287	5|8	.|0.66056	.|D	.|0.02	.|.	6.6835|6.6835	0.23132|0.23132	0.2181:0.0:0.7819:0.0|0.2181:0.0:0.7819:0.0	.|.	.|22042;14397	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	Y|L	1220|14397;1038	.|ENSP00000381008:P14397L;ENSP00000370338:P1038L	.|ENSP00000370338:P1038L	H|P	-|-	1|2	0|0	MUC16|MUC16	8827763|8827763	0.001000|0.001000	0.12720|0.12720	0.007000|0.007000	0.13788|0.13788	0.029000|0.029000	0.11900|0.11900	0.849000|0.849000	0.27723|0.27723	0.541000|0.541000	0.28827|0.28827	0.651000|0.651000	0.88453|0.88453	CAC|CCA	.	.		0.532	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF491	126069	hgsc.bcm.edu	37	19	11917800	11917800	+	Silent	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:11917800A>T	ENST00000323169.5	+	3	1363	c.1032A>T	c.(1030-1032)atA>atT	p.I344I	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						ACATTCGAATACATGGAAGGA	0.443																																					p.I344I		Atlas-SNP	.											.	ZNF491	61	.	0			c.A1032T						.						63.0	64.0	63.0					19																	11917800		2203	4300	6503	SO:0001819	synonymous_variant	126069	exon3			TCGAATACATGGA	AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.1032A>T	chr19.hg19:g.11917800A>T		91.0	0.0		89.0	28.0	NM_152356	Q3MJ35|Q8NAT8	Silent	SNP	ENST00000323169.5	hg19	CCDS12267.1																																																																																			.	.		0.443	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1	NM_152356	
ZNF709	163051	hgsc.bcm.edu	37	19	12575440	12575440	+	Silent	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:12575440G>T	ENST00000397732.3	-	4	1467	c.1296C>A	c.(1294-1296)tcC>tcA	p.S432S	CTD-3105H18.18_ENST00000598753.1_Intron|ZNF709_ENST00000428311.1_Silent_p.S432S	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						GAACAGAACTGGAACAACTGA	0.423																																					p.S432S	GBM(33;565 669 12371 29134 51667)	Atlas-SNP	.											.	ZNF709	80	.	0			c.C1296A						.						112.0	117.0	116.0					19																	12575440		2203	4299	6502	SO:0001819	synonymous_variant	163051	exon4			AGAACTGGAACAA	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1296C>A	chr19.hg19:g.12575440G>T		96.0	0.0		101.0	16.0	NM_152601	A8K4E6	Silent	SNP	ENST00000397732.3	hg19	CCDS42504.1																																																																																			.	.		0.423	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
CCDC130	81576	hgsc.bcm.edu	37	19	13873731	13873731	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:13873731G>A	ENST00000586600.1	+	11	1543	c.1040G>A	c.(1039-1041)aGc>aAc	p.S347N	MRI1_ENST00000319545.8_5'Flank|MRI1_ENST00000040663.6_5'Flank|CCDC130_ENST00000587019.1_3'UTR|CCDC130_ENST00000221554.8_Missense_Mutation_p.S347N			P13994	CC130_HUMAN	coiled-coil domain containing 130	347					response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			CCCAAGTGCAGCAGCCCGAGG	0.697																																					p.S347N		Atlas-SNP	.											.	CCDC130	25	.	0			c.G1040A						.						12.0	16.0	15.0					19																	13873731		2189	4277	6466	SO:0001583	missense	81576	exon10			AGTGCAGCAGCCC	AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994		ENST00000586600.1:c.1040G>A	chr19.hg19:g.13873731G>A	ENSP00000465776:p.Ser347Asn	161.0	0.0		155.0	58.0	NM_030818	Q9BQ72	Missense_Mutation	SNP	ENST00000586600.1	hg19	CCDS12296.1	.	.	.	.	.	.	.	.	.	.	G	9.245	1.039253	0.19669	.	.	ENSG00000104957	ENST00000221554	T	0.32753	1.44	3.14	2.07	0.26955	.	1.923890	0.01721	N	0.028272	T	0.30293	0.0760	L	0.57536	1.79	0.09310	N	0.999999	P;B	0.36354	0.549;0.324	B;B	0.34536	0.185;0.129	T	0.19031	-1.0318	10	0.18276	T	0.48	.	6.7732	0.23604	0.1457:0.0:0.8543:0.0	.	347;347	B3KUZ1;P13994	.;CC130_HUMAN	N	347	ENSP00000221554:S347N	ENSP00000221554:S347N	S	+	2	0	CCDC130	13734731	0.001000	0.12720	0.001000	0.08648	0.012000	0.07955	0.882000	0.28186	0.626000	0.30322	0.313000	0.20887	AGC	.	.		0.697	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453216.2	NM_030818	
UPF1	5976	hgsc.bcm.edu	37	19	18961531	18961531	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:18961531A>T	ENST00000599848.1	+	5	873	c.664A>T	c.(664-666)Atc>Ttc	p.I222F	UPF1_ENST00000600310.1_3'UTR|UPF1_ENST00000262803.5_Missense_Mutation_p.I222F			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	222	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CCTCAAGGACATCAACTGGGA	0.692																																					p.I222F		Atlas-SNP	.											.	UPF1	88	.	0			c.A664T						.						24.0	22.0	23.0					19																	18961531		2199	4296	6495	SO:0001583	missense	5976	exon5			AAGGACATCAACT	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.664A>T	chr19.hg19:g.18961531A>T	ENSP00000470142:p.Ile222Phe	105.0	0.0		105.0	7.0	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.96	3.516612	0.64634	.	.	ENSG00000005007	ENST00000262803	D	0.89617	-2.54	4.63	4.63	0.57726	RNA helicase UPF1, UPF2-interacting domain (1);	0.054008	0.64402	D	0.000001	D	0.88529	0.6461	M	0.62723	1.935	0.80722	D	1	B;B	0.26041	0.14;0.012	B;B	0.34138	0.176;0.024	D	0.87636	0.2519	10	0.62326	D	0.03	-26.121	13.4865	0.61369	1.0:0.0:0.0:0.0	.	222;222	Q92900;Q92900-2	RENT1_HUMAN;.	F	222	ENSP00000262803:I222F	ENSP00000262803:I222F	I	+	1	0	UPF1	18822531	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.618000	0.90932	1.843000	0.53566	0.482000	0.46254	ATC	.	.		0.692	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
ETHE1	23474	hgsc.bcm.edu	37	19	44012166	44012166	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:44012166C>T	ENST00000292147.2	-	6	708	c.642G>A	c.(640-642)cgG>cgA	p.R214R	ETHE1_ENST00000600651.1_Silent_p.R214R	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	214					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				TGAGGGTGAGCCGAGGGTTCA	0.567																																					p.R214R		Atlas-SNP	.											.	ETHE1	7	.	0			c.G642A						.						82.0	65.0	71.0					19																	44012166		2203	4300	6503	SO:0001819	synonymous_variant	23474	exon6			GGTGAGCCGAGGG		CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.642G>A	chr19.hg19:g.44012166C>T		62.0	0.0		75.0	8.0	NM_014297	Q96HR0|Q9H001	Silent	SNP	ENST00000292147.2	hg19	CCDS12622.1																																																																																			.	.		0.567	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463184.1	NM_014297	
ZNF221	7638	hgsc.bcm.edu	37	19	44469460	44469460	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:44469460A>T	ENST00000251269.5	+	5	612	c.284A>T	c.(283-285)cAa>cTa	p.Q95L	ZNF221_ENST00000587682.1_Missense_Mutation_p.Q95L|ZNF221_ENST00000592350.1_Missense_Mutation_p.Q95L	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	95	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				ACAACAAGCCAAAGAGAAGGG	0.423																																					p.Q95L		Atlas-SNP	.											.	ZNF221	59	.	0			c.A284T						.						92.0	85.0	87.0					19																	44469460		2203	4300	6503	SO:0001583	missense	7638	exon5			CAAGCCAAAGAGA	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.284A>T	chr19.hg19:g.44469460A>T	ENSP00000251269:p.Gln95Leu	198.0	0.0		183.0	19.0	NM_013359	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	hg19	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	A	2.119	-0.401963	0.04865	.	.	ENSG00000159905	ENST00000251269	T	0.05580	3.42	2.02	0.904	0.19302	Krueppel-associated box (1);	.	.	.	.	T	0.06142	0.0159	N	0.17278	0.47	0.09310	N	1	D	0.60160	0.987	P	0.55455	0.776	T	0.31081	-0.9956	9	0.11182	T	0.66	.	5.4263	0.16427	0.75:0.0:0.0:0.25	.	95	Q9UK13	ZN221_HUMAN	L	95	ENSP00000251269:Q95L	ENSP00000251269:Q95L	Q	+	2	0	ZNF221	49161300	0.002000	0.14202	0.001000	0.08648	0.008000	0.06430	1.569000	0.36428	0.176000	0.19873	0.379000	0.24179	CAA	.	.		0.423	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
CCDC114	93233	hgsc.bcm.edu	37	19	48806026	48806026	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:48806026T>A	ENST00000315396.7	-	10	1736	c.1054A>T	c.(1054-1056)Aag>Tag	p.K352*		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	352					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GAGTGCACCTTGTCCATGCGC	0.637																																					p.K352X		Atlas-SNP	.											.	CCDC114	100	.	0			c.A1054T						.						93.0	86.0	88.0					19																	48806026		2203	4300	6503	SO:0001587	stop_gained	93233	exon10			GCACCTTGTCCAT	BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1054A>T	chr19.hg19:g.48806026T>A	ENSP00000318429:p.Lys352*	61.0	0.0		62.0	9.0	NM_144577	Q6ZRL4|Q96M06|Q9UFG8	Nonsense_Mutation	SNP	ENST00000315396.7	hg19	CCDS12714.2	.	.	.	.	.	.	.	.	.	.	t	41	8.817285	0.98964	.	.	ENSG00000105479	ENST00000315396	.	.	.	3.88	0.208	0.15221	.	0.718496	0.11355	N	0.572600	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5373	2.8307	0.05499	0.0:0.3042:0.2487:0.4471	.	.	.	.	X	352	.	ENSP00000318429:K352X	K	-	1	0	CCDC114	53497838	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.353000	0.07691	-0.016000	0.14127	0.440000	0.28878	AAG	.	.		0.637	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343207.1	NM_144577	
PIH1D1	55011	hgsc.bcm.edu	37	19	49954058	49954058	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:49954058T>A	ENST00000262265.5	-	2	373	c.138A>T	c.(136-138)acA>acT	p.T46T	ALDH16A1_ENST00000293350.4_5'Flank|PIH1D1_ENST00000596049.1_Silent_p.T46T|ALDH16A1_ENST00000455361.2_5'Flank|ALDH16A1_ENST00000540132.1_5'Flank|ALDH16A1_ENST00000433981.2_5'Flank	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	46					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		GCTGGATTTGTGTCGATTCTG	0.552																																					p.T46T		Atlas-SNP	.											.	PIH1D1	23	.	0			c.A138T						.						196.0	171.0	180.0					19																	49954058		2203	4300	6503	SO:0001819	synonymous_variant	55011	exon2			GATTTGTGTCGAT	AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.138A>T	chr19.hg19:g.49954058T>A		67.0	0.0		77.0	29.0	NM_017916	B4DGN7|B4E2X7|Q9BVL0	Silent	SNP	ENST00000262265.5	hg19	CCDS12765.1																																																																																			.	.		0.552	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916	
MYH14	79784	hgsc.bcm.edu	37	19	50752386	50752386	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:50752386A>T	ENST00000596571.1	+	11	1448	c.1448A>T	c.(1447-1449)gAg>gTg	p.E483V	MYH14_ENST00000440075.2_Missense_Mutation_p.E491V|MYH14_ENST00000262269.8_Missense_Mutation_p.E491V|MYH14_ENST00000425460.1_Missense_Mutation_p.E491V|MYH14_ENST00000376970.2_Missense_Mutation_p.E483V|MYH14_ENST00000601313.1_Missense_Mutation_p.E491V|MYH14_ENST00000598205.1_Missense_Mutation_p.E491V			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	483	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GCGGGCTTTGAGATCTTCCAG	0.652																																					p.E491V		Atlas-SNP	.											.	MYH14	261	.	0			c.A1472T						.						16.0	19.0	18.0					19																	50752386		2025	4189	6214	SO:0001583	missense	79784	exon13			GCTTTGAGATCTT	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1448A>T	chr19.hg19:g.50752386A>T	ENSP00000472819:p.Glu483Val	135.0	0.0		153.0	14.0	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	hg19	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.324635	0.81580	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45	4.4	4.4	0.53042	Myosin head, motor domain (3);	.	.	.	.	D	0.94059	0.8096	H	0.99619	4.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.999	D	0.95515	0.8589	9	0.87932	D	0	.	11.888	0.52613	1.0:0.0:0.0:0.0	.	491;483;491	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	V	483;491;483;491;483;491	ENSP00000406273:E491V;ENSP00000366169:E483V;ENSP00000407879:E491V;ENSP00000262269:E491V	ENSP00000262269:E491V	E	+	2	0	MYH14	55444198	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.956000	0.93066	1.981000	0.57761	0.459000	0.35465	GAG	.	.		0.652	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
EMC10	284361	hgsc.bcm.edu	37	19	50984225	50984225	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:50984225C>T	ENST00000334976.6	+	6	715	c.669C>T	c.(667-669)ttC>ttT	p.F223F	EMC10_ENST00000598585.1_Silent_p.F223F|CTD-2545M3.2_ENST00000598194.1_RNA|EMC10_ENST00000376918.3_Silent_p.F223F	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10	223						ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)											AGTCCTTCTTCGCCAAATACG	0.642																																					p.F223F		Atlas-SNP	.											.	.	.	.	0			c.C669T						.						61.0	79.0	73.0					19																	50984225		2203	4300	6503	SO:0001819	synonymous_variant	284361	exon6			CTTCTTCGCCAAA	BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.669C>T	chr19.hg19:g.50984225C>T		144.0	0.0		149.0	27.0	NM_175063	Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Silent	SNP	ENST00000334976.6	hg19	CCDS12796.1																																																																																			.	.		0.642	EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464760.2	NM_175063	
SHANK1	50944	hgsc.bcm.edu	37	19	51201148	51201148	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:51201148A>T	ENST00000293441.1	-	12	1831	c.1813T>A	c.(1813-1815)Tct>Act	p.S605T	SHANK1_ENST00000359082.3_Missense_Mutation_p.S605T|SHANK1_ENST00000391814.1_Missense_Mutation_p.S605T	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	605	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		AGGCAGTCAGAGGGGAACCAG	0.557																																					p.S605T		Atlas-SNP	.											.	SHANK1	210	.	0			c.T1813A						.						95.0	82.0	86.0					19																	51201148		2203	4299	6502	SO:0001583	missense	50944	exon12			AGTCAGAGGGGAA	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.1813T>A	chr19.hg19:g.51201148A>T	ENSP00000293441:p.Ser605Thr	57.0	0.0		41.0	12.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	hg19	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.882279	0.51908	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.09163	3.01;3.01;3.01	3.27	3.27	0.37495	Src homology-3 domain (3);Variant SH3 (1);	0.181082	0.35235	U	0.003343	T	0.27697	0.0681	M	0.65975	2.015	0.47621	D	0.999476	D	0.58620	0.983	D	0.70227	0.968	T	0.01982	-1.1235	10	0.72032	D	0.01	-15.0275	11.0375	0.47811	1.0:0.0:0.0:0.0	.	605	Q9Y566	SHAN1_HUMAN	T	605	ENSP00000293441:S605T;ENSP00000351984:S605T;ENSP00000375690:S605T	ENSP00000293441:S605T	S	-	1	0	SHANK1	55892960	0.992000	0.36948	0.999000	0.59377	0.917000	0.54804	3.067000	0.50010	1.498000	0.48600	0.375000	0.23000	TCT	.	.		0.557	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
ZNF320	162967	hgsc.bcm.edu	37	19	53384338	53384338	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:53384338A>T	ENST00000595635.1	-	8	1542	c.1041T>A	c.(1039-1041)caT>caA	p.H347Q	ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.H347Q|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		GAATCCTCCTATGTCTTTCAA	0.423																																					p.H347Q		Atlas-SNP	.											.	ZNF320	67	.	0			c.T1041A						.						105.0	101.0	103.0					19																	53384338		2203	4300	6503	SO:0001583	missense	162967	exon4			CCTCCTATGTCTT	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.1041T>A	chr19.hg19:g.53384338A>T	ENSP00000473091:p.His347Gln	77.0	0.0		81.0	23.0	NM_207333	Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	hg19	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	12.75	2.032273	0.35893	.	.	ENSG00000182986	ENST00000391781	D	0.86865	-2.18	1.8	0.716	0.18191	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94298	0.8168	H	0.96333	3.805	0.23501	N	0.997543	D	0.89917	1.0	D	0.97110	1.0	D	0.84949	0.0870	9	0.87932	D	0	.	5.9339	0.19154	0.8496:0.0:0.1504:0.0	.	347	A2RRD8	ZN320_HUMAN	Q	347	ENSP00000375660:H347Q	ENSP00000375660:H347Q	H	-	3	2	ZNF320	58076150	0.005000	0.15991	0.004000	0.12327	0.012000	0.07955	-0.259000	0.08721	-0.005000	0.14395	-0.925000	0.02716	CAT	.	.		0.423	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333	
VSTM1	284415	hgsc.bcm.edu	37	19	54545063	54545063	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:54545063A>G	ENST00000338372.2	-	8	736	c.561T>C	c.(559-561)gaT>gaC	p.D187D	VSTM1_ENST00000376626.1_Silent_p.D156D|VSTM1_ENST00000366170.2_Silent_p.D99D|VSTM1_ENST00000425006.2_3'UTR	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	187					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		TATTGGATAAATCTGCCTCTG	0.483																																					p.D187D		Atlas-SNP	.											.	VSTM1	30	.	0			c.T561C						.						56.0	52.0	53.0					19																	54545063		2203	4300	6503	SO:0001819	synonymous_variant	284415	exon8			GGATAAATCTGCC	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.561T>C	chr19.hg19:g.54545063A>G		84.0	0.0		58.0	11.0	NM_198481	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	ENST00000338372.2	hg19	CCDS12872.1																																																																																			.	.		0.483	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
FIZ1	84922	hgsc.bcm.edu	37	19	56109118	56109118	+	Silent	SNP	C	C	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:56109118C>G	ENST00000221665.3	-	2	203	c.114G>C	c.(112-114)ctG>ctC	p.L38L	ZNF524_ENST00000301073.3_5'Flank|FIZ1_ENST00000592585.1_Silent_p.L38L	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	38					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		AGTGGCGCCGCAGGTCTGAGC	0.672																																					p.L38L		Atlas-SNP	.											.	FIZ1	29	.	0			c.G114C						.						45.0	42.0	43.0					19																	56109118		2202	4299	6501	SO:0001819	synonymous_variant	84922	exon2			GCGCCGCAGGTCT	AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.114G>C	chr19.hg19:g.56109118C>G		193.0	0.0		202.0	18.0	NM_032836	A2RU72|Q6ZMJ7	Silent	SNP	ENST00000221665.3	hg19	CCDS12928.1																																																																																			.	.		0.672	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453350.1	NM_032836	
ZNF582	147948	hgsc.bcm.edu	37	19	56896349	56896349	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr19:56896349T>A	ENST00000301310.4	-	5	595	c.437A>T	c.(436-438)cAt>cTt	p.H146L	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.H146L	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		CATTTCTTCATGTCTGATGAT	0.373																																					p.H146L	Ovarian(183;1887 2032 4349 30507 51343)	Atlas-SNP	.											.	ZNF582	56	.	0			c.A437T						.						155.0	153.0	154.0					19																	56896349		2203	4300	6503	SO:0001583	missense	147948	exon5			TCTTCATGTCTGA	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.437A>T	chr19.hg19:g.56896349T>A	ENSP00000301310:p.His146Leu	73.0	0.0		70.0	28.0	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	hg19	CCDS33121.1	.	.	.	.	.	.	.	.	.	.	T	10.19	1.282265	0.23392	.	.	ENSG00000018869	ENST00000301310	T	0.06142	3.34	4.23	-0.207	0.13189	.	0.560961	0.13669	N	0.371007	T	0.03263	0.0095	N	0.12182	0.205	0.09310	N	1	B;B	0.23058	0.079;0.079	B;B	0.20955	0.032;0.032	T	0.41875	-0.9484	10	0.40728	T	0.16	.	5.3398	0.15976	0.0:0.3487:0.1523:0.4991	.	146;177	Q96NG8;B4DQZ9	ZN582_HUMAN;.	L	146	ENSP00000301310:H146L	ENSP00000301310:H146L	H	-	2	0	ZNF582	61588161	0.925000	0.31364	0.000000	0.03702	0.159000	0.22180	0.208000	0.17415	-0.131000	0.11578	0.482000	0.46254	CAT	.	.		0.373	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
CDC25B	994	hgsc.bcm.edu	37	20	3781408	3781408	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:3781408A>T	ENST00000245960.5	+	6	1175	c.478A>T	c.(478-480)Agc>Tgc	p.S160C	CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000379598.5_Missense_Mutation_p.S96C|CDC25B_ENST00000439880.2_Missense_Mutation_p.S146C|CDC25B_ENST00000344256.6_Missense_Mutation_p.S96C|CDC25B_ENST00000340833.4_Intron	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	160					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						GCTGGGCCACAGCCCCGTGCT	0.667																																					p.S160C		Atlas-SNP	.											.	CDC25B	76	.	0			c.A478T						.						35.0	40.0	39.0					20																	3781408		2196	4294	6490	SO:0001583	missense	994	exon6			GGCCACAGCCCCG		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.478A>T	chr20.hg19:g.3781408A>T	ENSP00000245960:p.Ser160Cys	106.0	0.0		97.0	14.0	NM_021873	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	hg19	CCDS13067.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.390118	0.61956	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.59088	0.2168	M	0.79123	2.44	0.47341	D	0.999398	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	T	0.63611	-0.6598	10	0.72032	D	0.01	-5.6901	11.3224	0.49430	1.0:0.0:0.0:0.0	.	96;82;96;146;160	B4DQZ3;B4DRC3;B4DIG0;P30305-2;P30305	.;.;.;.;MPIP2_HUMAN	C	96;96;160;146	ENSP00000339125:S96C;ENSP00000368918:S96C;ENSP00000245960:S160C;ENSP00000405972:S146C	ENSP00000245960:S160C	S	+	1	0	CDC25B	3729408	0.988000	0.35896	1.000000	0.80357	0.652000	0.38707	1.057000	0.30492	2.124000	0.65301	0.459000	0.35465	AGC	.	.		0.667	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077779.2	NM_021874	
SMOX	54498	hgsc.bcm.edu	37	20	4163397	4163397	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:4163397T>A	ENST00000305958.4	+	5	1496	c.1271T>A	c.(1270-1272)cTg>cAg	p.L424Q	SMOX_ENST00000379460.2_Missense_Mutation_p.L424Q|SMOX_ENST00000339123.6_Missense_Mutation_p.L371Q|SMOX_ENST00000346595.2_Intron|SMOX_ENST00000278795.3_Missense_Mutation_p.L371Q	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	424					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	GGCCATGTGCTGAGCGGCTGG	0.612																																					p.L424Q		Atlas-SNP	.											.	SMOX	119	.	0			c.T1271A						.						84.0	77.0	79.0					20																	4163397		2203	4300	6503	SO:0001583	missense	54498	exon5			ATGTGCTGAGCGG	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1271T>A	chr20.hg19:g.4163397T>A	ENSP00000307252:p.Leu424Gln	57.0	0.0		85.0	31.0	NM_175839	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	hg19	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	T	18.77	3.694385	0.68386	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000379460;ENST00000457205	D;D;D;D;D	0.95918	-3.85;-3.85;-3.85;-3.85;-3.85	5.5	5.5	0.81552	Amine oxidase (1);	0.067148	0.64402	D	0.000009	D	0.98595	0.9530	H	0.98133	4.155	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.996;1.0;0.994;0.996	D	0.99521	1.0958	10	0.87932	D	0	-11.7321	13.6121	0.62086	0.0:0.0:0.0:1.0	.	348;424;424;371;371	B4DE63;Q9NWM0-6;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;SMOX_HUMAN;.;.	Q	371;424;371;424;281	ENSP00000344595:L371Q;ENSP00000307252:L424Q;ENSP00000278795:L371Q;ENSP00000368773:L424Q;ENSP00000407269:L281Q	ENSP00000278795:L371Q	L	+	2	0	SMOX	4111397	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	8.035000	0.88872	2.103000	0.63969	0.529000	0.55759	CTG	.	.		0.612	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
XRN2	22803	hgsc.bcm.edu	37	20	21362681	21362681	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:21362681G>A	ENST00000377191.3	+	28	2729	c.2634G>A	c.(2632-2634)caG>caA	p.Q878Q	XRN2_ENST00000430571.2_Silent_p.Q802Q|XRN2_ENST00000539513.1_Silent_p.Q824Q	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	878					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TTTTCCAGCAGCAAAGGTTTG	0.383																																					p.Q878Q		Atlas-SNP	.											.	XRN2	90	.	0			c.G2634A						.						52.0	56.0	54.0					20																	21362681		2203	4300	6503	SO:0001819	synonymous_variant	22803	exon28			CCAGCAGCAAAGG	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2634G>A	chr20.hg19:g.21362681G>A		54.0	0.0		84.0	13.0	NM_012255	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Silent	SNP	ENST00000377191.3	hg19	CCDS13144.1																																																																																			.	.		0.383	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
THBD	7056	hgsc.bcm.edu	37	20	23028430	23028430	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:23028430G>A	ENST00000377103.2	-	1	1948	c.1712C>T	c.(1711-1713)aCg>aTg	p.T571M		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	571					blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	TCTCTGCGGCGTCCGCTCGGT	0.667																																					p.T571M		Atlas-SNP	.											.	THBD	26	.	0			c.C1712T						.						17.0	16.0	16.0					20																	23028430		2194	4291	6485	SO:0001583	missense	7056	exon1			TGCGGCGTCCGCT		CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1712C>T	chr20.hg19:g.23028430G>A	ENSP00000366307:p.Thr571Met	104.0	0.0		144.0	8.0	NM_000361	Q8IV29|Q9UC32	Missense_Mutation	SNP	ENST00000377103.2	hg19	CCDS13148.1	.	.	.	.	.	.	.	.	.	.	G	5.169	0.216766	0.09810	.	.	ENSG00000178726	ENST00000377103;ENST00000503590	T	0.79749	-1.3	5.29	-0.487	0.12060	.	1.479610	0.04348	N	0.355171	T	0.65863	0.2732	N	0.17674	0.51	0.09310	N	1	B	0.24317	0.101	B	0.13407	0.009	T	0.49021	-0.8982	10	0.29301	T	0.29	-5.7256	6.3627	0.21437	0.2248:0.0:0.5543:0.2209	.	571	P07204	TRBM_HUMAN	M	571;553	ENSP00000366307:T571M	ENSP00000366307:T571M	T	-	2	0	THBD	22976430	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.408000	0.07169	-0.188000	0.10499	-1.367000	0.01198	ACG	.	.		0.667	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2		
REM1	28954	hgsc.bcm.edu	37	20	30070206	30070206	+	Silent	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:30070206G>T	ENST00000201979.2	+	4	833	c.540G>T	c.(538-540)cgG>cgT	p.R180R		NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	180					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TCCAGCTGCGGCGCACACATC	0.607																																					p.R180R		Atlas-SNP	.											.	REM1	54	.	0			c.G540T						.						93.0	82.0	85.0					20																	30070206		2203	4300	6503	SO:0001819	synonymous_variant	28954	exon4			GCTGCGGCGCACA	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.540G>T	chr20.hg19:g.30070206G>T		79.0	0.0		71.0	9.0	NM_014012	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Silent	SNP	ENST00000201979.2	hg19	CCDS13181.1																																																																																			.	.		0.607	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012	
MYLK2	85366	hgsc.bcm.edu	37	20	30408220	30408220	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:30408220A>T	ENST00000375994.2	+	2	617	c.344A>T	c.(343-345)cAg>cTg	p.Q115L	MYLK2_ENST00000375985.4_Missense_Mutation_p.Q115L			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	115					cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AAGGCTGAGCAGGGAGCCTCA	0.692																																					p.Q115L		Atlas-SNP	.											.	MYLK2	76	.	0			c.A344T						.						27.0	31.0	30.0					20																	30408220		2202	4297	6499	SO:0001583	missense	85366	exon3			CTGAGCAGGGAGC	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.344A>T	chr20.hg19:g.30408220A>T	ENSP00000365162:p.Gln115Leu	1187.0	0.0		1612.0	314.0	NM_033118	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	hg19	CCDS13191.1	.	.	.	.	.	.	.	.	.	.	A	12.66	2.005545	0.35415	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.67523	-0.27;-0.27	4.7	4.7	0.59300	.	.	.	.	.	T	0.51753	0.1693	L	0.32530	0.975	0.09310	N	1	B	0.32245	0.361	B	0.24155	0.051	T	0.40459	-0.9562	9	0.32370	T	0.25	.	10.49	0.44746	1.0:0.0:0.0:0.0	.	115	Q9H1R3	MYLK2_HUMAN	L	115	ENSP00000365162:Q115L;ENSP00000365152:Q115L	ENSP00000365152:Q115L	Q	+	2	0	MYLK2	29871881	0.000000	0.05858	0.053000	0.19242	0.056000	0.15407	0.385000	0.20685	1.972000	0.57404	0.459000	0.35465	CAG	.	.		0.692	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118	
E2F1	1869	hgsc.bcm.edu	37	20	32266109	32266109	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:32266109T>A	ENST00000343380.5	-	4	762	c.623A>T	c.(622-624)cAg>cTg	p.Q208L	RP1-63M2.5_ENST00000606866.1_RNA	NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	208	Dimerization. {ECO:0000255}.|Required for interaction with TRIM28.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						TCGGAGGTCCTGGGTCAACCC	0.642																																					p.Q208L		Atlas-SNP	.											.	E2F1	41	.	0			c.A623T						.						43.0	39.0	40.0					20																	32266109		2203	4300	6503	SO:0001583	missense	1869	exon4			AGGTCCTGGGTCA		CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.623A>T	chr20.hg19:g.32266109T>A	ENSP00000345571:p.Gln208Leu	132.0	0.0		175.0	38.0	NM_005225	Q13143|Q92768	Missense_Mutation	SNP	ENST00000343380.5	hg19	CCDS13224.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.301664	0.40694	.	.	ENSG00000101412	ENST00000343380	D	0.84223	-1.82	5.34	4.25	0.50352	.	0.861550	0.10388	N	0.680701	T	0.80623	0.4658	L	0.41573	1.285	0.33273	D	0.561248	B	0.21381	0.055	B	0.23852	0.049	T	0.78894	-0.2024	10	0.59425	D	0.04	-11.5257	10.0921	0.42453	0.0:0.0793:0.0:0.9207	.	208	Q01094	E2F1_HUMAN	L	208	ENSP00000345571:Q208L	ENSP00000345571:Q208L	Q	-	2	0	E2F1	31729770	1.000000	0.71417	0.998000	0.56505	0.449000	0.32228	3.120000	0.50430	1.063000	0.40649	0.533000	0.62120	CAG	.	.		0.642	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078731.2		
MAP1LC3A	84557	hgsc.bcm.edu	37	20	33147194	33147194	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:33147194T>A	ENST00000360668.3	+	3	901	c.140T>A	c.(139-141)cTg>cAg	p.L47Q	MAP1LC3A_ENST00000476428.1_3'UTR|MAP1LC3A_ENST00000397709.1_Missense_Mutation_p.L47Q|MAP1LC3A_ENST00000374837.3_Missense_Mutation_p.L51Q			Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3 alpha	47					autophagic vacuole assembly (GO:0000045)|mitochondrion degradation (GO:0000422)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|late endosome (GO:0005770)|microtubule (GO:0005874)|organelle membrane (GO:0031090)	phosphatidylethanolamine binding (GO:0008429)|phospholipid binding (GO:0005543)			cervix(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(2)	5						CTGCCCGTCCTGGACAAGACC	0.662																																					p.L51Q		Atlas-SNP	.											.	MAP1LC3A	10	.	0			c.T152A						.						44.0	44.0	44.0					20																	33147194		2199	4296	6495	SO:0001583	missense	84557	exon4			CCGTCCTGGACAA		CCDS13237.1, CCDS13238.1	20q11.22	2014-02-12			ENSG00000101460	ENSG00000101460			6838	protein-coding gene	gene with protein product		601242				8833088, 17580304	Standard	NM_032514		Approved	MAP1BLC3, MAP1ALC3, LC3, LC3A, ATG8E	uc002xaq.2	Q9H492	OTTHUMG00000032306	ENST00000360668.3:c.140T>A	chr20.hg19:g.33147194T>A	ENSP00000353886:p.Leu47Gln	103.0	0.0		131.0	17.0	NM_181509	E1P5P4|E1P5P5|Q9BXW5	Missense_Mutation	SNP	ENST00000360668.3	hg19	CCDS13238.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.838694	0.91117	.	.	ENSG00000101460	ENST00000374837;ENST00000360668;ENST00000397709	T;T;T	0.55234	0.53;0.53;0.53	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.77638	0.4160	M	0.91249	3.19	0.80722	D	1	P;D	0.89917	0.766;1.0	P;D	0.79108	0.901;0.992	D	0.83482	0.0065	10	0.87932	D	0	-7.232	14.499	0.67709	0.0:0.0:0.0:1.0	.	47;51	Q9H492;Q9H492-2	MLP3A_HUMAN;.	Q	51;47;47	ENSP00000363970:L51Q;ENSP00000353886:L47Q;ENSP00000380821:L47Q	ENSP00000353886:L47Q	L	+	2	0	MAP1LC3A	32610855	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.940000	0.87693	1.908000	0.55244	0.260000	0.18958	CTG	.	.		0.662	MAP1LC3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078801.2	NM_181509	
DHX35	60625	hgsc.bcm.edu	37	20	37662954	37662954	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:37662954A>G	ENST00000252011.3	+	21	2094	c.2061A>G	c.(2059-2061)caA>caG	p.Q687Q	DHX35_ENST00000373323.4_Silent_p.Q656Q|DHX35_ENST00000373325.2_Silent_p.Q663Q	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	687					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TTTATCAACAAGGAACGGTAG	0.443																																					p.Q687Q		Atlas-SNP	.											.	DHX35	82	.	0			c.A2061G						.						86.0	80.0	82.0					20																	37662954		2203	4300	6503	SO:0001819	synonymous_variant	60625	exon21			TCAACAAGGAACG	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.2061A>G	chr20.hg19:g.37662954A>G		45.0	0.0		73.0	19.0	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	ENST00000252011.3	hg19	CCDS13310.1																																																																																			.	.		0.443	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
HNF4A	3172	hgsc.bcm.edu	37	20	43058295	43058295	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:43058295A>T	ENST00000316099.4	+	10	1504	c.1415A>T	c.(1414-1416)gAa>gTa	p.E472V	HNF4A_ENST00000457232.1_Missense_Mutation_p.E440V|HNF4A_ENST00000415691.2_Missense_Mutation_p.E462V|HNF4A_ENST00000316673.4_Missense_Mutation_p.E450V	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	472					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACCAAGCAGGAAGTTATCTAG	0.632																																					p.E472V	Colon(79;2 1269 8820 14841 52347)	Atlas-SNP	.											.	HNF4A	150	.	0			c.A1415T						.						61.0	64.0	63.0					20																	43058295		2203	4300	6503	SO:0001583	missense	3172	exon10			AGCAGGAAGTTAT	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1415A>T	chr20.hg19:g.43058295A>T	ENSP00000312987:p.Glu472Val	121.0	0.0		132.0	15.0	NM_000457	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	hg19	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.953070	0.92660	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000338692;ENST00000415691	T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72	5.36	5.36	0.76844	.	1.610870	0.04225	N	0.334197	D	0.84844	0.5562	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D	0.89917	0.993;0.993;0.999;0.993;1.0	P;P;D;P;D	0.87578	0.782;0.843;0.996;0.722;0.998	T	0.70550	-0.4841	10	0.87932	D	0	.	14.0703	0.64856	1.0:0.0:0.0:0.0	.	465;472;462;450;440	Q5QPB7;P41235;F1D8S2;F1D8T0;P41235-6	.;HNF4A_HUMAN;.;.;.	V	450;440;472;502;462	ENSP00000315180:E450V;ENSP00000396216:E440V;ENSP00000312987:E472V;ENSP00000412111:E462V	ENSP00000312987:E472V	E	+	2	0	HNF4A	42491709	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.707000	0.91367	2.250000	0.74265	0.533000	0.62120	GAA	.	.		0.632	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
PABPC1L	80336	hgsc.bcm.edu	37	20	43566766	43566766	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:43566766G>C	ENST00000217073.2	+	13	1710	c.1710G>C	c.(1708-1710)atG>atC	p.M570I	PABPC1L_ENST00000537323.1_3'UTR|PABPC1L_ENST00000217075.2_Missense_Mutation_p.M124I|PABPC1L_ENST00000490798.1_Intron|PABPC1L_ENST00000372819.1_Missense_Mutation_p.M124I|PABPC1L_ENST00000255136.3_Missense_Mutation_p.M570I|PABPC1L_ENST00000372824.1_Missense_Mutation_p.M124I			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	570	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						TCACGGGCATGCTGCTGGAGA	0.587																																					p.M570I		Atlas-SNP	.											.	PABPC1L	59	.	0			c.G1710C						.						71.0	63.0	65.0					20																	43566766		1568	3582	5150	SO:0001583	missense	80336	exon13			GGGCATGCTGCTG	AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.1710G>C	chr20.hg19:g.43566766G>C	ENSP00000217073:p.Met570Ile	117.0	0.0		126.0	10.0	NM_001124756	Q4VY17	Missense_Mutation	SNP	ENST00000217073.2	hg19	CCDS42878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.1|27.1	4.800764|4.800764	0.90538|0.90538	.|.	.|.	ENSG00000101104|ENSG00000101104	ENST00000372821;ENST00000372826;ENST00000372822|ENST00000255136;ENST00000421240;ENST00000217073;ENST00000372824;ENST00000372819;ENST00000217075	.|T;T;T;T;T	.|0.58506	.|0.33;0.33;0.33;0.33;0.33	4.72|4.72	4.72|4.72	0.59763|0.59763	.|Polyadenylate-binding protein/Hyperplastic disc protein (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77691|0.77691	0.4168|0.4168	M|M	0.80616|0.80616	2.505|2.505	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.997;0.998	.|D;D	.|0.78314	.|0.951;0.991	T|T	0.81581|0.81581	-0.0867|-0.0867	6|10	0.56958|0.87932	D|D	0.05|0	.|.	17.8816|17.8816	0.88842|0.88842	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|570;124	.|Q4VXU2;G5E9L3	.|PAP1L_HUMAN;.	S|I	152;106;93|570;124;570;124;124;124	.|ENSP00000255136:M570I;ENSP00000217073:M570I;ENSP00000361911:M124I;ENSP00000361906:M124I;ENSP00000217075:M124I	ENSP00000361908:C152S|ENSP00000217073:M570I	C|M	+|+	2|3	0|0	PABPC1L|PABPC1L	43000180|43000180	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.657000|9.657000	0.98554|0.98554	2.459000|2.459000	0.83118|0.83118	0.591000|0.591000	0.81541|0.81541	TGC|ATG	.	.		0.587	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2		
ZNF335	63925	hgsc.bcm.edu	37	20	44596976	44596976	+	Silent	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:44596976C>T	ENST00000322927.2	-	4	568	c.468G>A	c.(466-468)gaG>gaA	p.E156E	ZNF335_ENST00000494955.1_5'UTR|ZNF335_ENST00000426788.1_Intron	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	156					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CCCCGCCATCCTCAGCACTGG	0.662																																					p.E156E		Atlas-SNP	.											.	ZNF335	115	.	0			c.G468A						.						132.0	116.0	122.0					20																	44596976		2203	4300	6503	SO:0001819	synonymous_variant	63925	exon4			GCCATCCTCAGCA	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.468G>A	chr20.hg19:g.44596976C>T		59.0	0.0		79.0	7.0	NM_022095	B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	hg19	CCDS13389.1																																																																																			.	.		0.662	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
PREX1	57580	hgsc.bcm.edu	37	20	47361579	47361579	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:47361579T>A	ENST00000371941.3	-	3	419	c.397A>T	c.(397-399)Aat>Tat	p.N133Y	PREX1_ENST00000396220.1_Missense_Mutation_p.N133Y	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	133	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AAGAAAACATTCCCAAGTTCA	0.502																																					p.N133Y		Atlas-SNP	.											.	PREX1	441	.	0			c.A397T						.						111.0	114.0	113.0					20																	47361579		2203	4300	6503	SO:0001583	missense	57580	exon3			AAACATTCCCAAG	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.397A>T	chr20.hg19:g.47361579T>A	ENSP00000361009:p.Asn133Tyr	109.0	0.0		164.0	18.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	T	12.39	1.924235	0.34002	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.69040	-0.37;-0.37	4.85	4.85	0.62838	Dbl homology (DH) domain (5);	0.118844	0.35555	U	0.003128	T	0.53674	0.1811	L	0.39326	1.205	0.42336	D	0.992312	P	0.41188	0.741	B	0.38921	0.285	T	0.59825	-0.7381	10	0.72032	D	0.01	.	5.9556	0.19271	0.0:0.085:0.168:0.747	.	133	Q8TCU6	PREX1_HUMAN	Y	133	ENSP00000361009:N133Y;ENSP00000379522:N133Y	ENSP00000361009:N133Y	N	-	1	0	PREX1	46794986	1.000000	0.71417	0.993000	0.49108	0.559000	0.35586	3.641000	0.54360	2.039000	0.60335	0.459000	0.35465	AAT	.	.		0.502	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
STX16	8675	hgsc.bcm.edu	37	20	57246334	57246334	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:57246334G>A	ENST00000371141.4	+	7	1497	c.773G>A	c.(772-774)gGg>gAg	p.G258E	STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.G258E|STX16_ENST00000371132.4_Missense_Mutation_p.G237E|STX16_ENST00000496003.1_Intron|STX16_ENST00000355957.5_Missense_Mutation_p.G241E|STX16_ENST00000361770.5_Missense_Mutation_p.G241E|STX16_ENST00000361830.3_Missense_Mutation_p.G258E|STX16_ENST00000358029.4_Missense_Mutation_p.G254E|STX16_ENST00000359617.4_Missense_Mutation_p.G205E	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	258	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			AGGGACTTAGGGGCGATGATT	0.478																																					p.G258E		Atlas-SNP	.											.	STX16	36	.	0			c.G773A						.						154.0	142.0	146.0					20																	57246334		2203	4300	6503	SO:0001583	missense	8675	exon7			ACTTAGGGGCGAT	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.773G>A	chr20.hg19:g.57246334G>A	ENSP00000360183:p.Gly258Glu	98.0	0.0		125.0	15.0	NM_001001433	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	ENST00000371141.4	hg19	CCDS13468.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808187	0.90707	.	.	ENSG00000124222	ENST00000355957;ENST00000361770;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000435446	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.75	5.75	0.90469	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.064326	0.64402	U	0.000014	T	0.35098	0.0920	L	0.31752	0.955	0.53005	D	0.999969	B;P;P;D	0.53885	0.389;0.837;0.696;0.963	B;B;B;P	0.59221	0.403;0.444;0.274;0.854	T	0.02437	-1.1159	10	0.52906	T	0.07	.	14.5995	0.68429	0.0:0.1454:0.8546:0.0	.	254;241;237;258	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	E	241;241;205;258;205;237;254;258;72	ENSP00000348229:G241E;ENSP00000355408:G241E;ENSP00000352634:G205E;ENSP00000360183:G258E;ENSP00000360173:G237E;ENSP00000350723:G254E;ENSP00000354445:G258E	ENSP00000360180:G205E	G	+	2	0	STX16	56679740	1.000000	0.71417	0.770000	0.31555	0.950000	0.60333	6.788000	0.75105	2.727000	0.93392	0.644000	0.83932	GGG	.	.		0.478	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433	
BIRC7	79444	hgsc.bcm.edu	37	20	61869278	61869278	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr20:61869278T>A	ENST00000217169.3	+	2	587	c.373T>A	c.(373-375)Ttc>Atc	p.F125I	BIRC7_ENST00000395306.1_5'Flank|MIR3196_ENST00000579556.1_RNA|BIRC7_ENST00000342412.6_Missense_Mutation_p.F125I	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	125					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					GGTGAGGTGCTTCTTCTGCTA	0.682																																					p.F125I		Atlas-SNP	.											.	BIRC7	25	.	0			c.T373A						.						39.0	40.0	39.0					20																	61869278		2203	4298	6501	SO:0001583	missense	79444	exon2			AGGTGCTTCTTCT	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.373T>A	chr20.hg19:g.61869278T>A	ENSP00000217169:p.Phe125Ile	140.0	0.0		180.0	26.0	NM_139317	Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	ENST00000217169.3	hg19	CCDS13513.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.578791	0.86645	.	.	ENSG00000101197	ENST00000342412;ENST00000217169	T;T	0.05081	3.5;3.5	5.16	5.16	0.70880	Baculoviral inhibition of apoptosis protein repeat (5);	0.142736	0.32836	N	0.005593	T	0.37785	0.1016	H	0.95917	3.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.998	T	0.56902	-0.7902	10	0.87932	D	0	.	14.6667	0.68913	0.0:0.0:0.0:1.0	.	125;125;125	Q6R308;Q96CA5;Q96CA5-2	.;BIRC7_HUMAN;.	I	125	ENSP00000345213:F125I;ENSP00000217169:F125I	ENSP00000217169:F125I	F	+	1	0	BIRC7	61339723	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	4.296000	0.59055	1.941000	0.56285	0.459000	0.35465	TTC	.	.		0.682	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317	
IFNAR2	3455	hgsc.bcm.edu	37	21	34625087	34625087	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr21:34625087A>G	ENST00000342136.4	+	7	987	c.661A>G	c.(661-663)Ata>Gta	p.I221V	IFNAR2_ENST00000382264.3_Missense_Mutation_p.I221V|IFNAR2_ENST00000404220.3_Missense_Mutation_p.I221V|IFNAR2_ENST00000342101.3_Missense_Mutation_p.I221V|IFNAR2_ENST00000382241.3_Missense_Mutation_p.I221V|AP000295.9_ENST00000433395.2_Silent_p.*128*|IFNAR2_ENST00000413881.1_Missense_Mutation_p.I149V			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2	221					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	GCAAGCAGTAATAAAGTCTCC	0.358																																					p.I221V		Atlas-SNP	.											.	IFNAR2	44	.	0			c.A661G						.						117.0	104.0	108.0					21																	34625087		2203	4300	6503	SO:0001583	missense	3455	exon7			GCAGTAATAAAGT		CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.661A>G	chr21.hg19:g.34625087A>G	ENSP00000343957:p.Ile221Val	181.0	0.0		169.0	34.0	NM_207585	A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Missense_Mutation	SNP	ENST00000342136.4	hg19	CCDS13621.1	.	.	.	.	.	.	.	.	.	.	A	0.029	-1.349584	0.01266	.	.	ENSG00000159110	ENST00000382264;ENST00000404220;ENST00000382241;ENST00000342136;ENST00000342101;ENST00000413881;ENST00000443073	T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88	3.44	-5.84	0.02318	Fibronectin, type III (1);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	5.089080	0.00531	N	0.000209	T	0.30070	0.0753	L	0.29908	0.895	0.09310	N	1	B;B;B	0.22683	0.03;0.037;0.073	B;B;B	0.25884	0.038;0.064;0.063	T	0.32824	-0.9892	10	0.87932	D	0	.	5.7758	0.18279	0.2622:0.4437:0.294:0.0	.	221;221;221	P48551-3;P48551;P48551-2	.;INAR2_HUMAN;.	V	221;221;221;221;221;149;149	ENSP00000371699:I221V;ENSP00000384309:I221V;ENSP00000371676:I221V;ENSP00000343957:I221V;ENSP00000343289:I221V;ENSP00000413160:I149V;ENSP00000403569:I149V	ENSP00000447913:I11V	I	+	1	0	IFNAR2	33546957	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.380000	0.07427	-1.280000	0.02402	-0.441000	0.05720	ATA	.	.		0.358	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139825.1		
HLCS	3141	hgsc.bcm.edu	37	21	38308987	38308987	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr21:38308987C>T	ENST00000399120.1	-	5	1988	c.758G>A	c.(757-759)gGt>gAt	p.G253D	HLCS_ENST00000336648.4_Missense_Mutation_p.G253D	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	253					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CTGAAAGCCACCAAAGGTGAA	0.537																																					p.G253D		Atlas-SNP	.											.	HLCS	64	.	0			c.G758A						.						74.0	72.0	73.0					21																	38308987		2203	4300	6503	SO:0001583	missense	3141	exon5			AAGCCACCAAAGG		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.758G>A	chr21.hg19:g.38308987C>T	ENSP00000382071:p.Gly253Asp	166.0	0.0		116.0	23.0	NM_000411	B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	hg19	CCDS13647.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.726766	0.30593	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.98437	-4.93;-4.93	5.91	3.13	0.36017	.	0.301675	0.40908	N	0.000982	D	0.94169	0.8129	N	0.21448	0.665	0.42614	D	0.993329	B;B	0.23735	0.09;0.043	B;B	0.21151	0.033;0.027	D	0.89163	0.3531	10	0.49607	T	0.09	.	7.5862	0.27993	0.0:0.6352:0.1429:0.2219	.	253;253	B2RAH1;P50747	.;BPL1_HUMAN	D	253	ENSP00000382071:G253D;ENSP00000338387:G253D	ENSP00000338387:G253D	G	-	2	0	HLCS	37230857	0.729000	0.28090	0.307000	0.25127	0.921000	0.55340	1.170000	0.31883	0.388000	0.25054	0.655000	0.94253	GGT	.	.		0.537	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
SLC5A1	6523	hgsc.bcm.edu	37	22	32462982	32462982	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr22:32462982A>C	ENST00000266088.4	+	3	518	c.268A>C	c.(268-270)Act>Cct	p.T90P	SLC5A1_ENST00000543737.1_5'UTR	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	90					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	GCTGGCCGGGACTGGGGCAGC	0.552																																					p.T90P		Atlas-SNP	.											.	SLC5A1	80	.	0			c.A268C						.						79.0	78.0	78.0					22																	32462982		2203	4300	6503	SO:0001583	missense	6523	exon3			GCCGGGACTGGGG		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.268A>C	chr22.hg19:g.32462982A>C	ENSP00000266088:p.Thr90Pro	105.0	0.0		88.0	7.0	NM_000343	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	hg19	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596112	0.46318	.	.	ENSG00000100170	ENST00000266088	D	0.88896	-2.44	5.1	4.05	0.47172	.	0.044280	0.85682	D	0.000000	D	0.93877	0.8041	M	0.90977	3.165	0.80722	D	1	P	0.50272	0.933	P	0.57057	0.812	D	0.93764	0.7069	10	0.87932	D	0	.	10.459	0.44567	0.8539:0.0:0.0:0.1461	.	90	P13866	SC5A1_HUMAN	P	90	ENSP00000266088:T90P	ENSP00000266088:T90P	T	+	1	0	SLC5A1	30792982	1.000000	0.71417	0.486000	0.27416	0.061000	0.15899	5.684000	0.68197	0.871000	0.35750	0.533000	0.62120	ACT	.	.		0.552	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343	
TOMM22	56993	hgsc.bcm.edu	37	22	39078014	39078014	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr22:39078014G>A	ENST00000216034.4	+	1	62	c.31G>A	c.(31-33)Ggg>Agg	p.G11R	RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000412067.1_RNA	NM_020243.4	NP_064628.1	Q9NS69	TOM22_HUMAN	translocase of outer mitochondrial membrane 22 homolog (yeast)	11					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			large_intestine(1)|lung(2)	3	Melanoma(58;0.04)					TGCCGGTGCAGGGGAACCCCA	0.662																																					p.G11R		Atlas-SNP	.											.	TOMM22	10	.	0			c.G31A						.						13.0	14.0	14.0					22																	39078014		2199	4293	6492	SO:0001583	missense	56993	exon1			GGTGCAGGGGAAC	AB040119	CCDS13975.1	22q12-q13	2010-07-29			ENSG00000100216	ENSG00000100216			18002	protein-coding gene	gene with protein product		607046				10982837, 10900208	Standard	NM_020243		Approved	TOM22	uc003awe.3	Q9NS69	OTTHUMG00000150991	ENST00000216034.4:c.31G>A	chr22.hg19:g.39078014G>A	ENSP00000216034:p.Gly11Arg	161.0	0.0		129.0	25.0	NM_020243		Missense_Mutation	SNP	ENST00000216034.4	hg19	CCDS13975.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981173	0.34942	.	.	ENSG00000100216	ENST00000216034	.	.	.	4.92	3.85	0.44370	.	0.147639	0.42821	D	0.000650	T	0.45216	0.1331	M	0.65975	2.015	0.18873	N	0.999982	B	0.06786	0.001	B	0.14578	0.011	T	0.42241	-0.9463	9	0.52906	T	0.07	-11.1439	11.2416	0.48972	0.0:0.1839:0.8161:0.0	.	11	Q9NS69	TOM22_HUMAN	R	11	.	ENSP00000216034:G11R	G	+	1	0	TOMM22	37407960	0.998000	0.40836	0.372000	0.25991	0.028000	0.11728	4.271000	0.58902	2.547000	0.85894	0.655000	0.94253	GGG	.	.		0.662	TOMM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320842.1		
PHEX	5251	hgsc.bcm.edu	37	X	22231054	22231054	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:22231054T>C	ENST00000379374.4	+	16	2244	c.1679T>C	c.(1678-1680)tTt>tCt	p.F560S	PHEX_ENST00000535894.1_Missense_Mutation_p.F463S|PHEX_ENST00000537599.1_Missense_Mutation_p.F560S|PHEX_ENST00000418858.3_Missense_Mutation_p.F263S	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	560					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						AAGCCTTTCTTTTGGGGAACA	0.398																																					p.F560S		Atlas-SNP	.											.	PHEX	95	.	0			c.T1679C						.						106.0	103.0	104.0					X																	22231054		2203	4300	6503	SO:0001583	missense	5251	exon16			CTTTCTTTTGGGG	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1679T>C	chrX.hg19:g.22231054T>C	ENSP00000368682:p.Phe560Ser	178.0	0.0		206.0	65.0	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	hg19	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527753	0.85706	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.69	5.69	0.88448	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97539	0.9194	M	0.90759	3.145	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68483	0.929;0.958	D	0.98333	1.0534	10	0.87932	D	0	.	14.916	0.70798	0.0:0.0:0.0:1.0	.	560;560	F5GXU4;P78562	.;PHEX_HUMAN	S	560;560;463;263	ENSP00000368682:F560S;ENSP00000440362:F560S;ENSP00000439418:F463S;ENSP00000443531:F263S	ENSP00000368682:F560S	F	+	2	0	PHEX	22140975	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.941000	0.75922	1.904000	0.55121	0.486000	0.48141	TTT	.	.		0.398	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
WDR45	11152	hgsc.bcm.edu	37	X	48935320	48935320	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:48935320T>A	ENST00000376372.3	-	4	398	c.217A>T	c.(217-219)Aag>Tag	p.K73*	WDR45_ENST00000376368.2_Nonsense_Mutation_p.K73*|WDR45_ENST00000356463.3_Nonsense_Mutation_p.K73*|AF196779.12_ENST00000376358.3_Intron|WDR45_ENST00000473974.1_Nonsense_Mutation_p.K73*|WDR45_ENST00000465431.1_Intron|WDR45_ENST00000485908.1_Intron|WDR45_ENST00000553851.1_Intron|WDR45_ENST00000322995.8_Nonsense_Mutation_p.K73*|WDR45_ENST00000396681.4_Nonsense_Mutation_p.K73*	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	73					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						TCTGAGAACTTGGGACTACTA	0.597																																					p.K73X		Atlas-SNP	.											.	WDR45	40	.	0			c.A217T						.						49.0	30.0	37.0					X																	48935320		2200	4298	6498	SO:0001587	stop_gained	11152	exon5			AGAACTTGGGACT	BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.217A>T	chrX.hg19:g.48935320T>A	ENSP00000365551:p.Lys73*	66.0	0.0		75.0	23.0	NM_007075	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Nonsense_Mutation	SNP	ENST00000376372.3	hg19	CCDS35250.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.5|24.5	4.533205|4.533205	0.85812|0.85812	.|.	.|.	ENSG00000196998|ENSG00000196998	ENST00000376372;ENST00000322995;ENST00000356463;ENST00000473974;ENST00000376368;ENST00000396681;ENST00000471338;ENST00000474053;ENST00000419567;ENST00000465382|ENST00000367375	.|.	.|.	.|.	3.81|3.81	3.81|3.81	0.43845|0.43845	.|.	0.058895|.	0.64402|.	D|.	0.000005|.	.|T	.|0.61515	.|0.2353	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.60177	.|-0.7314	.|4	0.02654|.	T|.	1|.	-11.4686|-11.4686	11.4195|11.4195	0.49974|0.49974	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|L	73|29	.|.	ENSP00000365543:K73X|.	K|Q	-|-	1|2	0|0	WDR45|WDR45	48822264|48822264	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	7.259000|7.259000	0.78381|0.78381	1.723000|1.723000	0.51488|0.51488	0.430000|0.430000	0.28490|0.28490	AAG|CAA	.	.		0.597	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083418.2	NM_007075	
ALAS2	212	hgsc.bcm.edu	37	X	55052401	55052401	+	Silent	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:55052401G>A	ENST00000330807.5	-	2	170	c.33C>T	c.(31-33)tgC>tgT	p.C11C	ALAS2_ENST00000335854.4_Silent_p.C11C|ALAS2_ENST00000396198.3_Silent_p.C35C	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	11					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	CAAGCACTGGGCAGCACTGTA	0.552																																					p.C35C		Atlas-SNP	.											.	ALAS2	163	.	0			c.C105T						.						78.0	59.0	66.0					X																	55052401		2203	4300	6503	SO:0001819	synonymous_variant	212	exon3			CACTGGGCAGCAC		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.33C>T	chrX.hg19:g.55052401G>A		66.0	0.0		54.0	24.0	NM_001037968	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Silent	SNP	ENST00000330807.5	hg19	CCDS14366.1																																																																																			.	.		0.552	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	
KLF8	11279	hgsc.bcm.edu	37	X	56295811	56295811	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:56295811T>A	ENST00000468660.1	+	4	935	c.647T>A	c.(646-648)gTg>gAg	p.V216E	KLF8_ENST00000374928.3_Splice_Site_p.V216E	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	216					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						TTGCTTTTAGTGAAAGTTGAC	0.468																																					p.V216E		Atlas-SNP	.											.	KLF8	38	.	0			c.T647A						.						104.0	79.0	88.0					X																	56295811		2203	4299	6502	SO:0001630	splice_region_variant	11279	exon5			TTTTAGTGAAAGT	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.647-1T>A	chrX.hg19:g.56295811T>A		26.0	0.0		36.0	11.0	NM_001159296	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	hg19	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	T	19.85	3.903155	0.72754	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T	0.07567	3.18	4.65	4.65	0.58169	.	0.310345	0.27371	N	0.019673	T	0.19886	0.0478	M	0.65975	2.015	0.48830	D	0.999712	D;D	0.62365	0.989;0.991	P;P	0.58454	0.839;0.766	T	0.00605	-1.1648	9	.	.	.	.	9.7981	0.40748	0.0:0.0:0.0:1.0	.	216;216	E7EQQ8;O95600	.;KLF8_HUMAN	E	216	ENSP00000417303:V216E	.	V	+	2	0	KLF8	56312536	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.319000	0.43788	1.647000	0.50633	0.486000	0.48141	GTG	.	.		0.468	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056887.2	NM_007250	Missense_Mutation
RBM41	55285	hgsc.bcm.edu	37	X	106312542	106312542	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:106312542T>A	ENST00000372479.3	-	6	1048	c.1018A>T	c.(1018-1020)Att>Ttt	p.I340F	RBM41_ENST00000372487.1_Missense_Mutation_p.I340F	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	340	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						CGGAATTGAATTGGAGGTCCT	0.443																																					p.I340F		Atlas-SNP	.											.	RBM41	34	.	0			c.A1018T						.						152.0	142.0	145.0					X																	106312542		2203	4300	6503	SO:0001583	missense	55285	exon6			ATTGAATTGGAGG	BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.1018A>T	chrX.hg19:g.106312542T>A	ENSP00000361557:p.Ile340Phe	92.0	0.0		110.0	34.0	NM_001171080	Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Missense_Mutation	SNP	ENST00000372479.3	hg19	CCDS14526.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002109	0.74932	.	.	ENSG00000089682	ENST00000372487;ENST00000372479	T;T	0.49432	0.78;0.78	5.83	4.66	0.58398	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.192266	0.45361	D	0.000379	T	0.47691	0.1459	N	0.16368	0.405	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.42413	-0.9453	10	0.34782	T	0.22	.	7.7853	0.29089	0.0:0.0953:0.0:0.9047	.	340	Q96IZ5	RBM41_HUMAN	F	340	ENSP00000361565:I340F;ENSP00000361557:I340F	ENSP00000361557:I340F	I	-	1	0	RBM41	106199198	0.991000	0.36638	0.955000	0.39395	0.874000	0.50279	2.323000	0.43823	0.805000	0.34159	-0.360000	0.07572	ATT	.	.		0.443	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057819.1	NM_018301	
IRS4	8471	hgsc.bcm.edu	37	X	107975901	107975901	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:107975901G>T	ENST00000372129.2	-	1	3750	c.3674C>A	c.(3673-3675)cCc>cAc	p.P1225H	RP6-24A23.6_ENST00000563887.1_Missense_Mutation_p.P6H	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1225					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TCTCTCCGGGGGTCTTGGCAC	0.582																																					p.P1225H		Atlas-SNP	.											.	IRS4	253	.	0			c.C3674A						.						104.0	105.0	105.0					X																	107975901		2203	4300	6503	SO:0001583	missense	8471	exon1			TCCGGGGGTCTTG	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3674C>A	chrX.hg19:g.107975901G>T	ENSP00000361202:p.Pro1225His	150.0	0.0		150.0	79.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	hg19	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518846	0.44763	.	.	ENSG00000133124	ENST00000372129	T	0.38401	1.14	4.39	3.45	0.39498	.	0.432236	0.20549	N	0.090145	T	0.36413	0.0966	L	0.27053	0.805	0.30234	N	0.795633	D	0.71674	0.998	P	0.58013	0.831	T	0.26710	-1.0095	10	0.72032	D	0.01	-5.8904	6.3692	0.21471	0.1501:0.0:0.8499:0.0	.	1225	O14654	IRS4_HUMAN	H	1225	ENSP00000361202:P1225H	ENSP00000361202:P1225H	P	-	2	0	IRS4	107862557	0.912000	0.30974	0.902000	0.35471	0.527000	0.34593	1.493000	0.35605	1.074000	0.40909	0.600000	0.82982	CCC	.	.		0.582	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
THOC2	57187	hgsc.bcm.edu	37	X	122755374	122755374	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:122755374T>A	ENST00000245838.8	-	31	3881	c.3850A>T	c.(3850-3852)Aag>Tag	p.K1284*	THOC2_ENST00000355725.4_Nonsense_Mutation_p.K1284*|THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000491737.1_Nonsense_Mutation_p.K1169*	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1284	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GCTGGAGtcttttcttttttc	0.348																																					p.K1284X		Atlas-SNP	.											.	THOC2	310	.	0			c.A3850T						.						94.0	80.0	84.0					X																	122755374		1796	4063	5859	SO:0001587	stop_gained	57187	exon31			GAGTCTTTTCTTT	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3850A>T	chrX.hg19:g.122755374T>A	ENSP00000245838:p.Lys1284*	38.0	0.0		73.0	11.0	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Nonsense_Mutation	SNP	ENST00000245838.8	hg19	CCDS43988.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	42|42|42	9.595869|9.595869|9.595869	0.99214|0.99214|0.99214	.|.|.	.|.|.	ENSG00000125676|ENSG00000125676|ENSG00000125676	ENST00000438358|ENST00000441692|ENST00000245838;ENST00000355725;ENST00000491737	.|.|.	.|.|.	.|.|.	5.05|5.05|5.05	5.05|5.05|5.05	0.67936|0.67936|0.67936	.|.|.	0.180201|0.180201|0.180201	0.37483|0.37483|0.37483	N|N|N	0.002065|0.002065|0.002065	T|T|.	0.34513|0.34513|.	0.0900|0.0900|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.35425|0.35425|.	-0.9789|-0.9789|.	4|4|.	.|.|0.02654	.|.|T	.|.|1	-9.9393|-9.9393|-9.9393	13.8245|13.8245|13.8245	0.63342|0.63342|0.63342	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|.|.	.|.|.	.|.|.	I|N|X	378|51|1284;1284;1169	.|.|.	.|.|ENSP00000245838:K1284X	K|K|K	-|-|-	2|3|1	0|2|0	THOC2|THOC2|THOC2	122583055|122583055|122583055	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.603000|7.603000|7.603000	0.82811|0.82811|0.82811	1.793000|1.793000|1.793000	0.52555|0.52555|0.52555	0.486000|0.486000|0.486000	0.48141|0.48141|0.48141	AAA|AAA|AAG	.	.		0.348	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
THOC2	57187	hgsc.bcm.edu	37	X	122755376	122755376	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:122755376T>G	ENST00000245838.8	-	31	3879	c.3848A>C	c.(3847-3849)gAa>gCa	p.E1283A	THOC2_ENST00000355725.4_Missense_Mutation_p.E1283A|THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000491737.1_Missense_Mutation_p.E1168A	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1283	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TGGAGtcttttcttttttctc	0.348																																					p.E1283A		Atlas-SNP	.											.	THOC2	310	.	0			c.A3848C						.						90.0	76.0	81.0					X																	122755376		1796	4062	5858	SO:0001583	missense	57187	exon31			GTCTTTTCTTTTT	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3848A>C	chrX.hg19:g.122755376T>G	ENSP00000245838:p.Glu1283Ala	38.0	0.0		71.0	11.0	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	hg19	CCDS43988.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	15.90|15.90|15.90	2.969961|2.969961|2.969961	0.53614|0.53614|0.53614	.|.|.	.|.|.	ENSG00000125676|ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000441692|ENST00000438358	T;T;T|.|.	0.41065|.|.	1.01;1.01;1.01|.|.	4.81|4.81|4.81	4.81|4.81|4.81	0.61882|0.61882|0.61882	.|.|.	0.359735|.|.	0.23832|.|.	N|.|.	0.044134|.|.	T|T|T	0.54431|0.54431|0.54431	0.1858|0.1858|0.1858	L|L|L	0.32530|0.32530|0.32530	0.975|0.975|0.975	0.80722|0.80722|0.80722	D|D|D	1|1|1	P|.|.	0.39060|.|.	0.657|.|.	B|.|.	0.35182|.|.	0.197|.|.	T|T|T	0.51505|0.51505|0.51505	-0.8697|-0.8697|-0.8697	10|5|5	0.12766|.|.	T|.|.	0.61|.|.	-14.4696|-14.4696|-14.4696	13.4607|13.4607|13.4607	0.61225|0.61225|0.61225	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	1283|.|.	Q8NI27|.|.	THOC2_HUMAN|.|.	A|Q|S	1283;1283;1168|51|377	ENSP00000245838:E1283A;ENSP00000347959:E1283A;ENSP00000419795:E1168A|.|.	ENSP00000245838:E1283A|.|.	E|K|R	-|-|-	2|1|3	0|0|2	THOC2|THOC2|THOC2	122583057|122583057|122583057	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.603000|7.603000|7.603000	0.82811|0.82811|0.82811	1.705000|1.705000|1.705000	0.51264|0.51264|0.51264	0.486000|0.486000|0.486000	0.48141|0.48141|0.48141	GAA|AAA|AGA	.	.		0.348	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
DCAF12L2	340578	hgsc.bcm.edu	37	X	125299819	125299819	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:125299819G>A	ENST00000360028.2	-	1	115	c.89C>T	c.(88-90)gCg>gTg	p.A30V	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.A30V			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	30										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TCCGTCCGCCGCCGCTAAACC	0.701																																					p.A30V		Atlas-SNP	.											.	DCAF12L2	157	.	0			c.C89T						.						9.0	12.0	11.0					X																	125299819		1890	3817	5707	SO:0001583	missense	340578	exon1			TCCGCCGCCGCTA	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.89C>T	chrX.hg19:g.125299819G>A	ENSP00000353128:p.Ala30Val	65.0	0.0		152.0	23.0	NM_001013628	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	hg19	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	g	13.17	2.158466	0.38119	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.20738	2.05;2.05	3.0	1.08	0.20341	.	.	.	.	.	T	0.18882	0.0453	L	0.57536	1.79	0.09310	N	1	B	0.24368	0.102	B	0.15484	0.013	T	0.19386	-1.0307	9	0.46703	T	0.11	.	6.5328	0.22336	0.0:0.1937:0.6044:0.2019	.	30	Q5VW00	DC122_HUMAN	V	30	ENSP00000441489:A30V;ENSP00000353128:A30V	ENSP00000353128:A30V	A	-	2	0	DCAF12L2	125127500	0.006000	0.16342	0.000000	0.03702	0.173000	0.22820	1.506000	0.35747	0.150000	0.19136	0.287000	0.19450	GCG	.	.		0.701	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
USP26	83844	hgsc.bcm.edu	37	X	132161579	132161579	+	Silent	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:132161579A>G	ENST00000511190.1	-	6	1139	c.670T>C	c.(670-672)Tta>Cta	p.L224L	USP26_ENST00000370832.1_Silent_p.L224L|USP26_ENST00000406273.1_Silent_p.L224L	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	224					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					AACTCTTTTAACTTCAATTGT	0.358																																					p.L224L	NSCLC(104;342 1621 36940 47097 52632)	Atlas-SNP	.											.	USP26	135	.	0			c.T670C						.						80.0	66.0	70.0					X																	132161579		2203	4300	6503	SO:0001819	synonymous_variant	83844	exon1			CTTTTAACTTCAA	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.670T>C	chrX.hg19:g.132161579A>G		54.0	0.0		108.0	27.0	NM_031907	B9WRT6|Q5H9H4	Silent	SNP	ENST00000511190.1	hg19	CCDS14635.1																																																																																			.	.		0.358	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
FHL1	2273	hgsc.bcm.edu	37	X	135291566	135291566	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:135291566A>G	ENST00000345434.3	+	6	934	c.853A>G	c.(853-855)Aga>Gga	p.R285G	FHL1_ENST00000543669.1_Intron|FHL1_ENST00000370690.3_Intron|FHL1_ENST00000370683.1_Intron|FHL1_ENST00000370676.3_Intron|FHL1_ENST00000394153.2_Intron|FHL1_ENST00000539015.1_Intron|FHL1_ENST00000394155.2_Missense_Mutation_p.R285G|FHL1_ENST00000535737.1_Intron			Q13642	FHL1_HUMAN	four and a half LIM domains 1	285					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					GGTTCTTTATAGAAAAAATCG	0.587											OREG0019943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R285G		Atlas-SNP	.											.	FHL1	114	.	0			c.A853G						.						61.0	54.0	56.0					X																	135291566		1568	3582	5150	SO:0001583	missense	2273	exon7			CTTTATAGAAAAA	U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.853A>G	chrX.hg19:g.135291566A>G	ENSP00000071281:p.Arg285Gly	50.0	0.0	1617	96.0	23.0	NM_001159702	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Missense_Mutation	SNP	ENST00000345434.3	hg19	CCDS55507.1	.	.	.	.	.	.	.	.	.	.	a	12.79	2.042172	0.35989	.	.	ENSG00000022267	ENST00000394155;ENST00000345434	T;T	0.65916	-0.18;-0.18	4.47	4.47	0.54385	.	0.092585	0.44483	D	0.000449	T	0.46151	0.1378	N	0.08118	0	0.28244	N	0.925542	P	0.48350	0.909	P	0.48704	0.587	T	0.37056	-0.9722	10	0.33141	T	0.24	.	9.1475	0.36942	1.0:0.0:0.0:0.0	.	285	Q13642	FHL1_HUMAN	G	285	ENSP00000377710:R285G;ENSP00000071281:R285G	ENSP00000071281:R285G	R	+	1	2	FHL1	135119232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.861000	0.56002	1.758000	0.51981	0.352000	0.21897	AGA	.	.		0.587	FHL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058461.1	NM_001449	
BRS3	680	hgsc.bcm.edu	37	X	135570516	135570516	+	Silent	SNP	T	T	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrX:135570516T>A	ENST00000370648.3	+	1	471	c.243T>A	c.(241-243)gtT>gtA	p.V81V	Z97632.1_ENST00000580943.1_RNA	NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	81					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					TGCAAACAGTTCCAAATATTT	0.413																																					p.V81V		Atlas-SNP	.											.	BRS3	62	.	0			c.T243A						.						153.0	135.0	141.0					X																	135570516		2203	4300	6503	SO:0001819	synonymous_variant	680	exon1			AACAGTTCCAAAT		CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.243T>A	chrX.hg19:g.135570516T>A		89.0	0.0		187.0	41.0	NM_001727		Silent	SNP	ENST00000370648.3	hg19	CCDS14656.1																																																																																			.	.		0.413	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059005.1	NM_001727	
MT-ND5	4540	hgsc.bcm.edu	37	M	12818	12818	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chrM:12818G>A	ENST00000361567.2	+	1	482	c.482G>A	c.(481-483)cGa>cAa	p.R161Q	MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	161					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ATGATACGCCCGAGCAGATGC	0.458																																					p.R161Q		Atlas-SNP	.											.	.	.	.	0			c.G482A						.																																			SO:0001583	missense	0	exon1			ACGCCCGAGCAGA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.482G>A	chrM.hg19:g.12818G>A	ENSP00000354813:p.Arg161Gln	19.0	0.0		27.0	19.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.458	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
TXN2	25828	hgsc.bcm.edu	37	22	36876815	36876815	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr22:36876815delA	ENST00000216185.2	-	2	536	c.70delT	c.(70-72)tggfs	p.W24fs	TXN2_ENST00000403313.1_Frame_Shift_Del_p.W24fs|TXN2_ENST00000487725.1_Intron|TXN2_ENST00000416967.1_5'UTR			Q99757	THIOM_HUMAN	thioredoxin 2	24					cell redox homeostasis (GO:0045454)|cellular response to nutrient levels (GO:0031669)|glycerol ether metabolic process (GO:0006662)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)	dendrite (GO:0030425)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)	protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|lung(1)|prostate(1)	3						AGGGGTGGCCACTGACCCTGA	0.587																																					p.W24fs		Atlas-INDEL	.											.	TXN2	15	.	0			c.71delG						.						91.0	86.0	88.0					22																	36876815		2203	4300	6503	SO:0001589	frameshift_variant	25828	exon2			.	U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348			17772	protein-coding gene	gene with protein product		609063				9006939, 17220299	Standard	NM_012473		Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.70delT	chr22.hg19:g.36876815delA	ENSP00000216185:p.Trp24fs	101.0	0.0		82.0	15.0	NM_012473	Q5JZA0|Q6FH60|Q9UH29	Frame_Shift_Del	DEL	ENST00000216185.2	hg19	CCDS13928.1																																																																																			.	.		0.587	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319016.1	NM_012473	
TMC6	11322	hgsc.bcm.edu	37	17	76121042	76121042	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:76121042delC	ENST00000590602.1	-	7	720	c.561delG	c.(559-561)gggfs	p.G187fs	TMC6_ENST00000392467.3_Frame_Shift_Del_p.G187fs|TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000306591.7_Frame_Shift_Del_p.G187fs|TMC6_ENST00000322914.3_Frame_Shift_Del_p.G187fs|TMC6_ENST00000591436.1_5'Flank|TMC6_ENST00000322933.4_5'UTR|TMC6_ENST00000589553.1_Intron			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	187					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CCCTCCACTTCCCCCTCGGGG	0.682																																					p.K188fs		Atlas-INDEL	.											.	TMC6	42	.	0			c.562delA						.						8.0	10.0	9.0					17																	76121042		2174	4271	6445	SO:0001589	frameshift_variant	11322	exon7			.	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.561delG	chr17.hg19:g.76121042delC	ENSP00000465261:p.Gly187fs	100.0	0.0		95.0	10.0	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Frame_Shift_Del	DEL	ENST00000590602.1	hg19	CCDS32748.1																																																																																			.	.		0.682	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
HCN4	10021	hgsc.bcm.edu	37	15	73636059	73636059	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr15:73636059delG	ENST00000261917.3	-	2	1869	c.876delC	c.(874-876)accfs	p.T293fs	RP11-272D12.1_ENST00000558742.1_RNA|RP11-272D12.1_ENST00000557981.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	293					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TCCAGGGTGTGGTGTTCTCAT	0.507																																					p.T293fs		Atlas-INDEL	.											.	HCN4	150	.	0			c.877delA						.						99.0	88.0	92.0					15																	73636059		2198	4297	6495	SO:0001589	frameshift_variant	10021	exon2			.	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.876delC	chr15.hg19:g.73636059delG	ENSP00000261917:p.Thr293fs	125.0	0.0		159.0	37.0	NM_005477	Q9UMQ7	Frame_Shift_Del	DEL	ENST00000261917.3	hg19	CCDS10248.1																																																																																			.	.		0.507	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
COQ6	51004	hgsc.bcm.edu	37	14	74428174	74428177	+	Frame_Shift_Del	DEL	GTCC	GTCC	-	rs528712914		TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	GTCC	GTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr14:74428174_74428177delGTCC	ENST00000334571.2	+	10	1151_1154	c.1111_1114delGTCC	c.(1111-1116)gtccatfs	p.VH371fs	COQ6_ENST00000238709.4_Frame_Shift_Del_p.VH296fs|COQ6_ENST00000554920.1_Intron|ENTPD5_ENST00000557325.1_Intron|COQ6_ENST00000394026.4_Frame_Shift_Del_p.VH346fs	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	371					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		AGCCCACAGAGTCCATCCGCTTGC	0.529																																					p.370_371del		Atlas-INDEL	.											.	COQ6	27	.	0			c.1110_1113del						.																																			SO:0001589	frameshift_variant	51004	exon10			.	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.1111_1114delGTCC	chr14.hg19:g.74428174_74428177delGTCC	ENSP00000333946:p.Val371fs	79.0	0.0		63.0	13.0	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Frame_Shift_Del	DEL	ENST00000334571.2	hg19	CCDS9823.1																																																																																			.	.		0.529	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
APP	351	hgsc.bcm.edu	37	21	27328044	27328044	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr21:27328044delT	ENST00000346798.3	-	12	1517	c.1484delA	c.(1483-1485)aagfs	p.K496fs	APP_ENST00000440126.3_Frame_Shift_Del_p.K472fs|APP_ENST00000439274.2_Frame_Shift_Del_p.K440fs|APP_ENST00000348990.5_Frame_Shift_Del_p.K421fs|APP_ENST00000358918.3_Frame_Shift_Del_p.K496fs|APP_ENST00000448388.2_Frame_Shift_Del_p.K386fs|APP_ENST00000354192.3_Frame_Shift_Del_p.K365fs|APP_ENST00000359726.3_Frame_Shift_Del_p.K440fs|APP_ENST00000357903.3_Frame_Shift_Del_p.K477fs	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	496	Heparin-binding.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GACATACTTCTTTAGCATATT	0.483																																					p.K495fs		Atlas-INDEL	.											.	APP	90	.	0			c.1485delG						.						218.0	175.0	190.0					21																	27328044		2203	4300	6503	SO:0001589	frameshift_variant	351	exon12			.	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1484delA	chr21.hg19:g.27328044delT	ENSP00000284981:p.Lys496fs	149.0	0.0		98.0	19.0	NM_001204301	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Frame_Shift_Del	DEL	ENST00000346798.3	hg19	CCDS13576.1																																																																																			.	.		0.483	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
EGFR	1956	hgsc.bcm.edu	37	7	55248998	55248999	+	In_Frame_Ins	INS	-	-	TGGCCAGCG			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr7:55248998_55248999insTGGCCAGCG	ENST00000275493.2	+	20	2473_2474	c.2296_2297insTGGCCAGCG	c.(2296-2298)atg>aTGGCCAGCGtg	p.769_770insASV	EGFR_ENST00000442591.1_Intron|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_In_Frame_Ins_p.724_725insASV|EGFR_ENST00000454757.2_In_Frame_Ins_p.716_717insASV	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> M (found in a lung cancer sample; dbSNP:rs147149347). {ECO:0000269|PubMed:15623594}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.M766T(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AGCCTACGTGATGGCCAGCGTG	0.644		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.M766delinsMASV		Atlas-INDEL	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,caecum,carcinoma,0,1	EGFR	20426	.	1	Substitution - Missense(1)	lung(1)	c.2296_2297insTGGCCAGCG						.																																			SO:0001652	inframe_insertion	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	.		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2297_2305dupTGGCCAGCG	chr7.hg19:g.55248999_55249007dupTGGCCAGCG	ENSP00000275493:p.Ala767_Val769dup	110.0	0.0		145.0	19.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	In_Frame_Ins	INS	ENST00000275493.2	hg19	CCDS5514.1																																																																																			.	.		0.644	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ACLY	47	hgsc.bcm.edu	37	17	40063809	40063810	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr17:40063809_40063810insC	ENST00000352035.2	-	7	762_763	c.632_633insG	c.(631-633)ggafs	p.G211fs	ACLY_ENST00000353196.1_Frame_Shift_Ins_p.G211fs|ACLY_ENST00000537919.1_Intron|ACLY_ENST00000590151.1_Frame_Shift_Ins_p.G211fs|ACLY_ENST00000393896.2_Frame_Shift_Ins_p.G211fs	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	211	ATP-grasp.				ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				GGACATAGACTCCATCTTTGGT	0.574																																					p.G211fs	Colon(64;807 1396 15971 30971)	Atlas-INDEL	.											.	ACLY	85	.	0			c.633_634insG						.																																			SO:0001589	frameshift_variant	47	exon7			.	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.633dupG	chr17.hg19:g.40063811_40063811dupC	ENSP00000253792:p.Gly211fs	77.0	0.0		92.0	39.0	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Frame_Shift_Ins	INS	ENST00000352035.2	hg19	CCDS11412.1																																																																																			.	.		0.574	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
PRSS48	345062	hgsc.bcm.edu	37	4	152203321	152203321	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr4:152203321delT	ENST00000455694.2	+	3	239	c.237delT	c.(235-237)tatfs	p.Y79fs	PRSS48_ENST00000441586.2_Intron|SH3D19_ENST00000604030.1_Intron	NM_183375.2	NP_899231.2	Q7RTY5	PRS48_HUMAN	protease, serine, 48	79	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8						CTTTTTCATATACTGTGTGGC	0.473																																					p.Y79fs		Atlas-INDEL	.											.	PRSS48	91	.	0			c.236delA						.						257.0	237.0	244.0					4																	152203321		1942	4144	6086	SO:0001589	frameshift_variant	345062	exon3			.	BN000134	CCDS47145.1	4q31.3	2010-05-07			ENSG00000189099	ENSG00000189099		"""Serine peptidases / Serine peptidases"""	24635	protein-coding gene	gene with protein product						12838346	Standard	NM_183375		Approved	ESSPL	uc011cif.2	Q7RTY5	OTTHUMG00000161673	ENST00000455694.2:c.237delT	chr4.hg19:g.152203321delT	ENSP00000401328:p.Tyr79fs	94.0	0.0		135.0	21.0	NM_183375	Q08E82|Q0VAD4	Frame_Shift_Del	DEL	ENST00000455694.2	hg19	CCDS47145.1																																																																																			.	.		0.473	PRSS48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365685.3	NM_183375	
EPM2A	7957	hgsc.bcm.edu	37	6	146056478	146056478	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr6:146056478delC	ENST00000367519.3	-	1	682	c.157delG	c.(157-159)gccfs	p.A53fs	RP3-466P17.2_ENST00000603042.1_lincRNA|RP3-466P17.1_ENST00000603994.1_lincRNA	NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	53	CBM20. {ECO:0000255|PROSITE- ProRule:PRU00594}.				autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		TCCTGCAGGGCCAGGGCCCCG	0.801																																					p.A53fs		Atlas-INDEL	.											.	EPM2A	21	.	0			c.158delC						.						1.0	1.0	1.0					6																	146056478		904	2006	2910	SO:0001589	frameshift_variant	7957	exon1			.	AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.157delG	chr6.hg19:g.146056478delC	ENSP00000356489:p.Ala53fs	150.0	0.0		164.0	36.0	NM_001018041	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Frame_Shift_Del	DEL	ENST00000367519.3	hg19	CCDS5206.1																																																																																			.	.		0.801	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042564.1		
CSMD1	64478	hgsc.bcm.edu	37	8	3087715	3087715	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACI-01A-11D-A40R-10	TCGA-DD-AACI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	247f1556-4111-4fee-ab12-312a9cd3b2ce	145d1bb3-e78f-4ac7-9b82-12983f7080e4	g.chr8:3087715delG	ENST00000520002.1	-	28	4750	c.4195delC	c.(4195-4197)caafs	p.Q1399fs	CSMD1_ENST00000542608.1_Frame_Shift_Del_p.Q1398fs|CSMD1_ENST00000602557.1_Frame_Shift_Del_p.Q1399fs|CSMD1_ENST00000539096.1_Frame_Shift_Del_p.Q1398fs|CSMD1_ENST00000537824.1_Frame_Shift_Del_p.Q1398fs|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602723.1_Frame_Shift_Del_p.Q1399fs|CSMD1_ENST00000400186.3_Frame_Shift_Del_p.Q1399fs			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1399	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTGCCATTTTGGGGCATACCT	0.522																																					p.Q1398fs		Atlas-INDEL	.											.	CSMD1	1469	.	0			c.4193delA						.						62.0	62.0	62.0					8																	3087715		2004	4189	6193	SO:0001589	frameshift_variant	64478	exon27			.			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4195delC	chr8.hg19:g.3087715delG	ENSP00000430733:p.Gln1399fs	109.0	0.0		155.0	13.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Frame_Shift_Del	DEL	ENST00000520002.1	hg19																																																																																				.	.		0.522	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
