#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OR6K2	81448	hgsc.bcm.edu	37	1	158669714	158669714	+	Silent	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:158669714G>A	ENST00000359610.2	-	1	772	c.729C>T	c.(727-729)gtC>gtT	p.V243V		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					TGAAGTGAGAGACACACGTGG	0.478																																					p.V243V		Atlas-SNP	.											.	OR6K2	104	.	0			c.C729T						.						120.0	109.0	113.0					1																	158669714		2203	4300	6503	SO:0001819	synonymous_variant	81448	exon1			GTGAGAGACACAC	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.729C>T	chr1.hg19:g.158669714G>A		223.0	0.0		330.0	42.0	NM_001005279	B9EH33|Q6IFR6	Silent	SNP	ENST00000359610.2	hg19	CCDS30902.1																																																																																			.	.		0.478	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
OR6N1	128372	hgsc.bcm.edu	37	1	158735540	158735540	+	Silent	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:158735540C>T	ENST00000335094.2	-	1	952	c.933G>A	c.(931-933)ttG>ttA	p.L311L		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					CAACTCATGCCAATATCCCAA	0.532																																					p.L311L		Atlas-SNP	.											OR6N1,NS,carcinoma,0,1	OR6N1	96	.	0			c.G933A						.						136.0	133.0	134.0					1																	158735540		2203	4300	6503	SO:0001819	synonymous_variant	128372	exon1			TCATGCCAATATC	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.933G>A	chr1.hg19:g.158735540C>T		61.0	0.0		96.0	15.0	NM_001005185	Q5VUU8|Q96R35	Silent	SNP	ENST00000335094.2	hg19	CCDS30905.1																																																																																			.	.		0.532	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185	
GPR161	23432	hgsc.bcm.edu	37	1	168066166	168066166	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:168066166C>T	ENST00000367838.1	-	5	992	c.679G>A	c.(679-681)Gtc>Atc	p.V227I	GPR161_ENST00000537209.1_Missense_Mutation_p.V247I|GPR161_ENST00000539777.1_Missense_Mutation_p.V149I|GPR161_ENST00000361697.2_Missense_Mutation_p.V227I|GPR161_ENST00000367836.1_Missense_Mutation_p.V95I|GPR161_ENST00000367835.1_Missense_Mutation_p.V227I|GPR161_ENST00000271357.5_Missense_Mutation_p.V227I|GPR161_ENST00000546300.1_Missense_Mutation_p.V113I	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	227					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					ACGATGACGACTGTGCCACAG	0.592																																					p.V247I		Atlas-SNP	.											.	GPR161	56	.	0			c.G739A						.						88.0	87.0	87.0					1																	168066166		2203	4300	6503	SO:0001583	missense	23432	exon4			TGACGACTGTGCC	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.679G>A	chr1.hg19:g.168066166C>T	ENSP00000356812:p.Val227Ile	154.0	0.0		171.0	17.0	NM_001267609	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	hg19	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292717	0.59976	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;D;T;T;T;T;T	0.81739	-0.04;-0.04;-1.53;-0.04;-1.07;-1.03;0.05;-0.04	5.48	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.78941	0.4363	L	0.41415	1.275	0.38105	D	0.937396	P;D;D;P;B;P	0.67145	0.48;0.992;0.996;0.529;0.244;0.659	B;D;D;B;B;P	0.77557	0.198;0.923;0.99;0.376;0.099;0.499	T	0.77552	-0.2545	9	0.24483	T	0.36	-28.9782	13.9679	0.64221	0.0:0.9261:0.0:0.0739	.	247;113;149;247;227;227	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	I	227;227;95;227;113;149;247;227	ENSP00000356812:V227I;ENSP00000271357:V227I;ENSP00000356810:V95I;ENSP00000356809:V227I;ENSP00000444348:V113I;ENSP00000437576:V149I;ENSP00000441039:V247I;ENSP00000355194:V227I	ENSP00000271357:V227I	V	-	1	0	GPR161	166332790	1.000000	0.71417	0.941000	0.38009	0.727000	0.41649	4.824000	0.62701	1.442000	0.47568	0.561000	0.74099	GTC	.	.		0.592	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
PAPPA2	60676	hgsc.bcm.edu	37	1	176762739	176762739	+	Silent	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:176762739C>T	ENST00000367662.3	+	20	6228	c.5064C>T	c.(5062-5064)ccC>ccT	p.P1688P		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1688	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCAGTGACCCCGTGATGCTAC	0.478																																					p.P1688P		Atlas-SNP	.											.	PAPPA2	665	.	0			c.C5064T						.						187.0	185.0	186.0					1																	176762739		1980	4158	6138	SO:0001819	synonymous_variant	60676	exon20			TGACCCCGTGATG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5064C>T	chr1.hg19:g.176762739C>T		127.0	0.0		162.0	108.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	hg19	CCDS41438.1																																																																																			.	.		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
KDM5B	10765	hgsc.bcm.edu	37	1	202702884	202702884	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:202702884G>A	ENST00000367265.3	-	23	4718	c.3554C>T	c.(3553-3555)cCa>cTa	p.P1185L	KDM5B_ENST00000367264.2_Missense_Mutation_p.P1221L	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1185					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						AGGGGCAGCTGGGGCCTTCTG	0.502																																					p.P1185L		Atlas-SNP	.											.	KDM5B	166	.	0			c.C3554T						.						74.0	79.0	77.0					1																	202702884		2203	4300	6503	SO:0001583	missense	10765	exon23			GCAGCTGGGGCCT	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3554C>T	chr1.hg19:g.202702884G>A	ENSP00000356234:p.Pro1185Leu	146.0	0.0		195.0	44.0	NM_006618	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	hg19	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974774	0.92919	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.84873	-1.91;-1.91;-1.91	6.09	6.09	0.99107	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.91788	0.7402	M	0.75615	2.305	0.80722	D	1	D;B	0.76494	0.999;0.05	D;B	0.70935	0.971;0.135	D	0.87505	0.2436	10	0.17832	T	0.49	-16.8674	20.6935	0.99705	0.0:0.0:1.0:0.0	.	1221;1185	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	L	1185;1027;1221;1027	ENSP00000356234:P1185L;ENSP00000356233:P1221L;ENSP00000235790:P1027L	ENSP00000235790:P1027L	P	-	2	0	KDM5B	200969507	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	9.473000	0.97714	2.897000	0.99335	0.643000	0.83706	CCA	.	.		0.502	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
LYST	1130	hgsc.bcm.edu	37	1	235955183	235955183	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:235955183T>C	ENST00000389794.3	-	12	4533	c.4359A>G	c.(4357-4359)atA>atG	p.I1453M	LYST_ENST00000536965.1_Intron|LYST_ENST00000389793.2_Missense_Mutation_p.I1453M			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1453					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGACTGGGGCTATGTGCCAAG	0.502																																					p.I1453M		Atlas-SNP	.											.	LYST	370	.	0			c.A4359G						.						99.0	98.0	98.0					1																	235955183		2203	4300	6503	SO:0001583	missense	1130	exon12			TGGGGCTATGTGC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.4359A>G	chr1.hg19:g.235955183T>C	ENSP00000374444:p.Ile1453Met	134.0	0.0		166.0	77.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.209811	0.58343	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.63417	-0.04;-0.04	5.76	0.669	0.17918	.	0.618960	0.18131	N	0.150736	T	0.53530	0.1802	L	0.44542	1.39	0.80722	D	1	P;P	0.46512	0.879;0.684	P;P	0.47528	0.549;0.453	T	0.50668	-0.8801	10	0.62326	D	0.03	.	3.9591	0.09403	0.3351:0.2793:0.0:0.3856	.	1453;1453	Q99698-3;Q99698	.;LYST_HUMAN	M	1453	ENSP00000374444:I1453M;ENSP00000374443:I1453M	ENSP00000374443:I1453M	I	-	3	3	LYST	234021806	0.009000	0.17119	0.823000	0.32752	0.885000	0.51271	-0.782000	0.04643	0.139000	0.18822	0.528000	0.53228	ATA	.	.		0.502	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
OR2L8	391190	hgsc.bcm.edu	37	1	248112256	248112256	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr1:248112256A>G	ENST00000357191.3	+	1	97	c.97A>G	c.(97-99)Att>Gtt	p.I33V	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CATTGTTTTCATTTTCCTGAT	0.398																																					p.I33V		Atlas-SNP	.											.	OR2L8	92	.	0			c.A97G						.						240.0	223.0	229.0					1																	248112256		2203	4300	6503	SO:0001583	missense	391190	exon1			GTTTTCATTTTCC	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.97A>G	chr1.hg19:g.248112256A>G	ENSP00000349719:p.Ile33Val	131.0	0.0		208.0	95.0	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	hg19	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	A	0.738	-0.777436	0.02929	.	.	ENSG00000196936	ENST00000357191	T	0.04970	3.52	1.48	0.19	0.15125	.	.	.	.	.	T	0.03520	0.0101	N	0.20483	0.58	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.48581	-0.9023	9	0.15066	T	0.55	.	4.4784	0.11755	0.7911:0.0:0.2089:0.0	.	33	Q8NGY9	OR2L8_HUMAN	V	33	ENSP00000349719:I33V	ENSP00000349719:I33V	I	+	1	0	OR2L8	246178879	0.000000	0.05858	0.002000	0.10522	0.123000	0.20343	-2.291000	0.01147	-0.115000	0.11915	0.248000	0.18094	ATT	.	.		0.398	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
NLRC4	58484	hgsc.bcm.edu	37	2	32476106	32476106	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:32476106A>T	ENST00000404025.2	-	5	1315	c.827T>A	c.(826-828)aTc>aAc	p.I276N	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Missense_Mutation_p.I276N|NLRC4_ENST00000402280.1_Missense_Mutation_p.I276N			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	276	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Nucleotide-binding domain (NBD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGTGGTGACGATGACCATGTT	0.517																																					p.I276N		Atlas-SNP	.											.	NLRC4	165	.	0			c.T827A						.						135.0	111.0	119.0					2																	32476106		2203	4300	6503	SO:0001583	missense	58484	exon4			GTGACGATGACCA	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.827T>A	chr2.hg19:g.32476106A>T	ENSP00000385090:p.Ile276Asn	65.0	0.0		56.0	23.0	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	hg19	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.176411	0.57692	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.26810	1.71;1.71;1.71	3.27	3.27	0.37495	.	0.252759	0.25030	N	0.033689	T	0.34716	0.0907	L	0.55481	1.735	0.36283	D	0.855908	P	0.46457	0.878	P	0.51895	0.683	T	0.53781	-0.8390	9	0.87932	D	0	-1.9877	11.0079	0.47646	1.0:0.0:0.0:0.0	.	276	Q9NPP4	NLRC4_HUMAN	N	276	ENSP00000354159:I276N;ENSP00000385428:I276N;ENSP00000385090:I276N	ENSP00000354159:I276N	I	-	2	0	NLRC4	32329610	0.794000	0.28838	0.944000	0.38274	0.897000	0.52465	2.480000	0.45206	1.497000	0.48584	0.443000	0.29094	ATC	.	.		0.517	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
BIRC6	57448	hgsc.bcm.edu	37	2	32724675	32724675	+	Silent	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:32724675C>T	ENST00000421745.2	+	46	8664	c.8530C>T	c.(8530-8532)Ctg>Ttg	p.L2844L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2844					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGAATTCACTCTGGAGCAGAA	0.443																																					p.L2844L	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											BIRC6_ENST00000421745,NS,carcinoma,0,2	BIRC6	838	.	0			c.C8530T						.						92.0	87.0	89.0					2																	32724675		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon46			TTCACTCTGGAGC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8530C>T	chr2.hg19:g.32724675C>T		75.0	0.0		66.0	23.0	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	hg19	CCDS33175.2																																																																																			.	.		0.443	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
CNGA3	1261	hgsc.bcm.edu	37	2	99012481	99012481	+	Missense_Mutation	SNP	G	G	A	rs104893614		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:99012481G>A	ENST00000272602.2	+	7	887	c.848G>A	c.(847-849)cGg>cAg	p.R283Q	CNGA3_ENST00000436404.2_Missense_Mutation_p.R265Q|CNGA3_ENST00000409937.1_Missense_Mutation_p.R287Q|CNGA3_ENST00000393504.1_Missense_Mutation_p.R283Q			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	283			R -> Q (in ACHM2; does not reveal any detectable calcium influx upon agonist application at 37 degrees Celsius; the channel function could be restored by incubating the transfected cells at 27 degrees Celsius; the dose-response relationship for cGMP-activation is not significantly different from that of wild-type CNGA3; the dose-response relationship of the mutant CNGA3 + CNGB3 is similar to that of the wild-type protein; a substantial reduction of macroscopic cGMP maximum current to only one-third of the mean value for wild-type CNGA3 + CNGB3 is observed for the mutant CNGA3 + CNGB3; the channel density into the cell membrane is considerably improved by decreasing the cultivation temparature). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:18521937, ECO:0000269|PubMed:9662398}.|R -> W (in ACHM2; also found in patients with cone-rod dystrophy). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:24903488, ECO:0000269|PubMed:9662398}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AAGTTTTCCCGGCTCTTTGAA	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19479	0.0		0.0	False		,,,				2504	0.0				p.R283Q		Atlas-SNP	.											CNGA3,colon,carcinoma,+1,1	CNGA3	118	.	0			c.G848A	GRCh37	CM980375	CNGA3	M	rs104893614	.	G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	84.0	79.0	81.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	794,848	5.2	1.0	2	dbSNP_132	81	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CNGA3	NM_001079878.1,NM_001298.2	43,43	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	265/677,283/695	99012481	2,13004	2203	4300	6503	SO:0001583	missense	1261	exon8			TTTCCCGGCTCTT	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.848G>A	chr2.hg19:g.99012481G>A	ENSP00000272602:p.Arg283Gln	179.0	0.0		165.0	61.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	hg19	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790138	0.90367	2.27E-4	1.16E-4	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.99511	-6.05;-6.05;-6.05;-6.05	5.15	5.15	0.70609	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	M	0.90369	3.11	0.80722	A	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.998;1.0;0.965	D	0.98050	1.0387	9	0.87932	D	0	.	17.5731	0.87940	0.0:0.0:1.0:0.0	.	287;265;283	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	Q	283;265;283;287	ENSP00000377140:R283Q;ENSP00000410070:R265Q;ENSP00000272602:R283Q;ENSP00000386761:R287Q	ENSP00000272602:R283Q	R	+	2	0	CNGA3	98378913	0.999000	0.42202	1.000000	0.80357	0.972000	0.66771	9.263000	0.95617	2.677000	0.91161	0.563000	0.77884	CGG	.	G|1.000;A|0.000		0.493	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
RANBP2	5903	hgsc.bcm.edu	37	2	109381547	109381547	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:109381547C>T	ENST00000283195.6	+	20	4678	c.4552C>T	c.(4552-4554)Cct>Tct	p.P1518S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1518					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TATTCCAACACCTGCCTCTTT	0.413																																					p.P1518S		Atlas-SNP	.											.	RANBP2	488	.	0			c.C4552T						.						95.0	96.0	96.0					2																	109381547		2203	4300	6503	SO:0001583	missense	5903	exon20			CCAACACCTGCCT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4552C>T	chr2.hg19:g.109381547C>T	ENSP00000283195:p.Pro1518Ser	109.0	0.0		86.0	31.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	C	2.833	-0.242171	0.05906	.	.	ENSG00000153201	ENST00000283195	T	0.28255	1.62	4.93	1.12	0.20585	.	.	.	.	.	T	0.18299	0.0439	N	0.19112	0.55	0.23287	N	0.997978	B	0.02656	0.0	B	0.04013	0.001	T	0.22626	-1.0211	9	0.34782	T	0.22	-2.4032	8.2095	0.31476	0.0:0.6032:0.0:0.3967	.	1518	P49792	RBP2_HUMAN	S	1518	ENSP00000283195:P1518S	ENSP00000283195:P1518S	P	+	1	0	RANBP2	108747979	0.000000	0.05858	0.125000	0.21846	0.532000	0.34746	-0.480000	0.06559	-0.081000	0.12662	-0.137000	0.14449	CCT	.	.		0.413	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SCN7A	6332	hgsc.bcm.edu	37	2	167288893	167288893	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:167288893A>T	ENST00000409855.1	-	15	2653	c.2527T>A	c.(2527-2529)Tct>Act	p.S843T		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	843					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TCTATATCAGATTCTCCTGAA	0.403																																					p.S843T		Atlas-SNP	.											.	SCN7A	410	.	0			c.T2527A						.						112.0	111.0	111.0					2																	167288893		1904	4105	6009	SO:0001583	missense	6332	exon15			TATCAGATTCTCC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2527T>A	chr2.hg19:g.167288893A>T	ENSP00000386796:p.Ser843Thr	99.0	0.0		51.0	22.0	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	hg19	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716541	0.89205	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.86627	-2.15;-2.15	5.05	5.05	0.67936	Sodium ion transport-associated (1);	0.000000	0.56097	D	0.000040	D	0.93736	0.7998	M	0.90542	3.125	0.38146	D	0.938582	D	0.71674	0.998	D	0.67103	0.949	D	0.95231	0.8342	10	0.54805	T	0.06	.	12.8014	0.57588	1.0:0.0:0.0:0.0	.	843	Q01118	SCN7A_HUMAN	T	843	ENSP00000386796:S843T;ENSP00000413699:S843T	ENSP00000259060:S843T	S	-	1	0	SCN7A	166997139	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.046000	0.71029	2.134000	0.65973	0.459000	0.35465	TCT	.	.		0.403	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
NUP35	129401	hgsc.bcm.edu	37	2	184022187	184022187	+	Silent	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:184022187T>A	ENST00000295119.4	+	6	658	c.555T>A	c.(553-555)tcT>tcA	p.S185S	NUP35_ENST00000409798.1_Silent_p.S168S|NUP35_ENST00000541912.1_Silent_p.S50S	NM_138285.3	NP_612142.2	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa	185	RRM Nup35-type. {ECO:0000255|PROSITE- ProRule:PRU00804}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	8						CTCAAGCATCTGCTTCCTACA	0.328																																					p.S185S		Atlas-SNP	.											.	NUP35	28	.	0			c.T555A						.						145.0	143.0	144.0					2																	184022187		2202	4300	6502	SO:0001819	synonymous_variant	129401	exon6			AGCATCTGCTTCC	AF514993	CCDS2290.1, CCDS74614.1	2q32	2008-02-05			ENSG00000163002	ENSG00000163002			29797	protein-coding gene	gene with protein product		608140					Standard	XM_005246284		Approved	MP44	uc002upf.3	Q8NFH5	OTTHUMG00000132621	ENST00000295119.4:c.555T>A	chr2.hg19:g.184022187T>A		42.0	0.0		47.0	17.0	NM_138285	B4DP57|B4DYB4|Q4ZFZ9|Q53S95|Q8TDJ1	Silent	SNP	ENST00000295119.4	hg19	CCDS2290.1																																																																																			.	.		0.328	NUP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255865.1	NM_138285	
MFSD6	54842	hgsc.bcm.edu	37	2	191334570	191334570	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:191334570A>C	ENST00000392328.1	+	4	1943	c.1619A>C	c.(1618-1620)gAa>gCa	p.E540A	MFSD6_ENST00000535751.1_Missense_Mutation_p.E2A|MFSD6_ENST00000281416.7_Missense_Mutation_p.E540A|MFSD6_ENST00000489793.1_3'UTR	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	540					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CTCCCCATGGAAGTTCTTCAA	0.433																																					p.E540A		Atlas-SNP	.											.	MFSD6	58	.	0			c.A1619C						.						68.0	67.0	68.0					2																	191334570		2203	4300	6503	SO:0001583	missense	54842	exon4			CCATGGAAGTTCT		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.1619A>C	chr2.hg19:g.191334570A>C	ENSP00000376141:p.Glu540Ala	76.0	0.0		64.0	29.0	NM_017694	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	hg19	CCDS2306.1	.	.	.	.	.	.	.	.	.	.	A	15.67	2.900893	0.52227	.	.	ENSG00000151690	ENST00000392328;ENST00000281416;ENST00000444317;ENST00000542423;ENST00000535751	T;T	0.56103	0.48;0.48	6.16	5.0	0.66597	Major facilitator superfamily domain, general substrate transporter (1);	0.091877	0.85682	D	0.000000	T	0.75781	0.3896	M	0.88842	2.985	0.54753	D	0.999987	D	0.89917	1.0	D	0.85130	0.997	T	0.79926	-0.1597	10	0.72032	D	0.01	-13.493	12.7598	0.57356	0.8629:0.1371:0.0:0.0	.	540	Q6ZSS7	MFSD6_HUMAN	A	540;540;2;2;2	ENSP00000376141:E540A;ENSP00000281416:E540A	ENSP00000281416:E540A	E	+	2	0	MFSD6	191042815	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	8.729000	0.91490	1.133000	0.42147	-0.321000	0.08615	GAA	.	.		0.433	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
NIF3L1	60491	hgsc.bcm.edu	37	2	201761868	201761868	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:201761868A>C	ENST00000409020.1	+	5	1090	c.796A>C	c.(796-798)Att>Ctt	p.I266L	NIF3L1_ENST00000359683.4_Missense_Mutation_p.I239L|NIF3L1_ENST00000416651.1_Missense_Mutation_p.I266L|NIF3L1_ENST00000409588.1_Intron|NIF3L1_ENST00000409357.1_Missense_Mutation_p.I266L|RNU6-762P_ENST00000517107.1_RNA			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	266					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						GGCAACCATGATTGATCGAAT	0.438																																					p.I266L		Atlas-SNP	.											.	NIF3L1	51	.	0			c.A796C						.						132.0	122.0	125.0					2																	201761868		1931	4127	6058	SO:0001583	missense	60491	exon5			ACCATGATTGATC	AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.796A>C	chr2.hg19:g.201761868A>C	ENSP00000386394:p.Ile266Leu	151.0	0.0		80.0	34.0	NM_001136039	Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	ENST00000409020.1	hg19	CCDS46485.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.82|13.82	2.351135|2.351135	0.41599|0.41599	.|.	.|.	ENSG00000196290|ENSG00000196290	ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357|ENST00000436412	T;T;T;T|.	0.44083|.	0.93;0.93;0.93;0.93|.	6.01|6.01	2.44|2.44	0.29823|0.29823	.|.	0.368655|.	0.31438|.	N|.	0.007653|.	T|.	0.33089|.	0.0851|.	L|L	0.38953|0.38953	1.18|1.18	0.30342|0.30342	N|N	0.785597|0.785597	B|.	0.20164|.	0.042|.	B|.	0.19148|.	0.024|.	T|.	0.30297|.	-0.9983|.	10|.	0.25106|.	T|.	0.35|.	-11.4911|-11.4911	5.3599|5.3599	0.16081|0.16081	0.5456:0.1417:0.3127:0.0|0.5456:0.1417:0.3127:0.0	.|.	266|.	Q9GZT8|.	NIF3L_HUMAN|.	L|C	266;266;239;266|24	ENSP00000400787:I266L;ENSP00000386394:I266L;ENSP00000352711:I239L;ENSP00000387315:I266L|.	ENSP00000352711:I239L|.	I|X	+|+	1|3	0|0	NIF3L1|NIF3L1	201470113|201470113	0.005000|0.005000	0.15991|0.15991	0.998000|0.998000	0.56505|0.56505	0.839000|0.839000	0.47603|0.47603	0.223000|0.223000	0.17719|0.17719	0.182000|0.182000	0.20032|0.20032	0.533000|0.533000	0.62120|0.62120	ATT|TGA	.	.		0.438	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1	NM_021824	
ABCA12	26154	hgsc.bcm.edu	37	2	215852376	215852376	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:215852376G>T	ENST00000272895.7	-	27	4190	c.3971C>A	c.(3970-3972)tCt>tAt	p.S1324Y	ABCA12_ENST00000389661.4_Missense_Mutation_p.S1006Y	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1324					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTTACTGGCAGATGGGTTGGT	0.408																																					p.S1324Y	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											ABCA12,bladder,carcinoma,0,1	ABCA12	368	.	0			c.C3971A						.						116.0	98.0	104.0					2																	215852376		2203	4300	6503	SO:0001583	missense	26154	exon27			CTGGCAGATGGGT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3971C>A	chr2.hg19:g.215852376G>T	ENSP00000272895:p.Ser1324Tyr	255.0	0.0		222.0	11.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614320	0.46631	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.89415	-2.51;-2.51	5.26	5.26	0.73747	.	0.000000	0.53938	D	0.000047	D	0.86789	0.6017	M	0.77616	2.38	0.80722	D	1	P;P	0.37612	0.602;0.506	B;B	0.39419	0.237;0.299	T	0.83035	-0.0160	10	0.02654	T	1	.	11.4959	0.50408	0.086:0.0:0.914:0.0	.	1324;1006	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	Y	1324;1006	ENSP00000272895:S1324Y;ENSP00000374312:S1006Y	ENSP00000272895:S1324Y	S	-	2	0	ABCA12	215560621	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	2.958000	0.49145	2.464000	0.83262	0.561000	0.74099	TCT	.	.		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
PRKAG3	53632	hgsc.bcm.edu	37	2	219692330	219692330	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr2:219692330G>C	ENST00000529249.1	-	8	1158	c.843C>G	c.(841-843)ttC>ttG	p.F281L	PRKAG3_ENST00000439262.2_Missense_Mutation_p.F256L|PRKAG3_ENST00000545803.1_Missense_Mutation_p.F97L|PRKAG3_ENST00000392098.3_Nonsense_Mutation_p.S266*			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	281	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	CCAGAGGCTTGAAGCAGCCTT	0.592																																					p.F281L		Atlas-SNP	.											.	PRKAG3	47	.	0			c.C843G						.						117.0	118.0	118.0					2																	219692330		2203	4300	6503	SO:0001583	missense	53632	exon8			AGGCTTGAAGCAG	AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.843C>G	chr2.hg19:g.219692330G>C	ENSP00000436068:p.Phe281Leu	92.0	0.0		90.0	32.0	NM_017431	Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	ENST00000529249.1	hg19	CCDS2424.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.931104|4.931104	0.92389|0.92389	.|.	.|.	ENSG00000115592|ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249|ENST00000392098	D;D;D|.	0.91011|.	-2.77;-2.77;-2.77|.	4.54|4.54	2.75|2.75	0.32379|0.32379	Cystathionine beta-synthase, core (1);|.	0.293673|.	0.38436|.	N|.	0.001690|.	T|.	0.40448|.	0.1117|.	L|L	0.28400|0.28400	0.85|0.85	0.80722|0.80722	A|A	1|1	B|.	0.09022|.	0.002|.	B|.	0.08055|.	0.003|.	T|.	0.51092|.	-0.8749|.	9|.	0.16420|0.38643	T|T	0.52|0.18	-15.4959|-15.4959	9.7489|9.7489	0.40464|0.40464	0.1674:0.0:0.8326:0.0|0.1674:0.0:0.8326:0.0	.|.	281|.	Q9UGI9|.	AAKG3_HUMAN|.	L|X	256;97;281|266	ENSP00000397133:F256L;ENSP00000444536:F97L;ENSP00000436068:F281L|.	ENSP00000233944:F281L|ENSP00000375947:S266X	F|S	-|-	3|2	2|0	PRKAG3|PRKAG3	219400574|219400574	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.891000|3.891000	0.56227|0.56227	0.554000|0.554000	0.29061|0.29061	-0.136000|-0.136000	0.14681|0.14681	TTC|TCA	.	.		0.592	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385992.1		
ACVR2B	93	hgsc.bcm.edu	37	3	38520626	38520626	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:38520626A>G	ENST00000352511.4	+	6	1146	c.674A>G	c.(673-675)cAg>cGg	p.Q225R		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	225	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		CAGGACAAGCAGTCGTGGCAG	0.587																																					p.Q225R		Atlas-SNP	.											.	ACVR2B	88	.	0			c.A674G						.						139.0	138.0	138.0					3																	38520626		2203	4300	6503	SO:0001583	missense	93	exon6			ACAAGCAGTCGTG	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.674A>G	chr3.hg19:g.38520626A>G	ENSP00000340361:p.Gln225Arg	254.0	0.0		191.0	76.0	NM_001106	Q4VAV0	Missense_Mutation	SNP	ENST00000352511.4	hg19	CCDS2679.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.944240	0.53079	.	.	ENSG00000114739	ENST00000352511	D	0.93076	-3.16	4.75	4.75	0.60458	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.117840	0.64402	D	0.000015	D	0.87904	0.6295	N	0.20445	0.575	0.54753	D	0.999981	B	0.14438	0.01	B	0.16289	0.015	D	0.84871	0.0825	10	0.59425	D	0.04	.	14.4386	0.67301	1.0:0.0:0.0:0.0	.	225	Q13705	AVR2B_HUMAN	R	225	ENSP00000340361:Q225R	ENSP00000340361:Q225R	Q	+	2	0	ACVR2B	38495630	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.025000	0.64097	1.992000	0.58205	0.460000	0.39030	CAG	.	.		0.587	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,1	CTNNB1	4904	.	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	chr3.hg19:g.41266124A>G	ENSP00000344456:p.Thr41Ala	190.0	1.0		134.0	53.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
RAD54L2	23132	hgsc.bcm.edu	37	3	51664804	51664804	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:51664804G>T	ENST00000409535.2	+	6	807	c.682G>T	c.(682-684)Gaa>Taa	p.E228*	RAD54L2_ENST00000296477.3_5'UTR	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	228						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		TGATGAGGAAGAAGAGAAGGG	0.498																																					p.E228X		Atlas-SNP	.											.	RAD54L2	94	.	0			c.G682T						.						109.0	93.0	98.0					3																	51664804		2203	4300	6503	SO:0001587	stop_gained	23132	exon6			GAGGAAGAAGAGA	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.682G>T	chr3.hg19:g.51664804G>T	ENSP00000386520:p.Glu228*	61.0	0.0		55.0	27.0	NM_015106	Q8TB57|Q9BV54	Nonsense_Mutation	SNP	ENST00000409535.2	hg19	CCDS33765.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.264694|4.264694	0.80358|0.80358	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535|ENST00000432863	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.408168|.	0.30742|.	N|.	0.008973|.	.|T	.|0.64907	.|0.2641	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62282	.|-0.6887	.|4	0.15499|.	T|.	0.54|.	-18.7537|-18.7537	12.3782|12.3782	0.55291|0.55291	0.0762:0.0:0.9238:0.0|0.0762:0.0:0.9238:0.0	.|.	.|.	.|.	.|.	X|I	228|56	.|.	ENSP00000386520:E228X|.	E|R	+|+	1|2	0|0	RAD54L2|RAD54L2	51639844|51639844	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	6.377000|6.377000	0.73145|0.73145	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	GAA|AGA	.	.		0.498	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
PSMD6	9861	hgsc.bcm.edu	37	3	64004653	64004653	+	Silent	SNP	A	A	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:64004653A>C	ENST00000295901.4	-	4	698	c.558T>G	c.(556-558)ctT>ctG	p.L186L	PSMD6_ENST00000394431.2_Silent_p.L148L|PSMD6_ENST00000482510.1_Silent_p.L147L|RP11-245J9.4_ENST00000462717.1_RNA|RP11-245J9.6_ENST00000605919.1_RNA|PSMD6_ENST00000492933.1_Silent_p.L239L	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	186					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		CCACACAATAAAGACCCTGAT	0.378																																					p.L239L		Atlas-SNP	.											.	PSMD6	30	.	0			c.T717G						.						163.0	167.0	166.0					3																	64004653		2203	4300	6503	SO:0001819	synonymous_variant	9861	exon5			ACAATAAAGACCC	AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.558T>G	chr3.hg19:g.64004653A>C		257.0	0.0		184.0	62.0	NM_001271779	A8K2E0|E9PHI9|Q6UV22	Silent	SNP	ENST00000295901.4	hg19	CCDS2901.1	.	.	.	.	.	.	.	.	.	.	A	9.613	1.131798	0.21041	.	.	ENSG00000163636	ENST00000480205	.	.	.	5.84	-0.758	0.11049	.	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.08889	-1.0700	6	0.26408	T	0.33	-1.0257	2.1961	0.03911	0.3797:0.3295:0.1843:0.1066	.	.	.	.	V	34	.	ENSP00000418843:L34V	L	-	1	2	PSMD6	63979693	0.607000	0.26958	0.938000	0.37757	0.986000	0.74619	-0.032000	0.12266	-0.341000	0.08376	0.459000	0.35465	TTA	.	.		0.378	PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352082.1	NM_014814	
SHQ1	55164	hgsc.bcm.edu	37	3	72873605	72873605	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:72873605T>C	ENST00000325599.8	-	6	836	c.697A>G	c.(697-699)Agt>Ggt	p.S233G	SHQ1_ENST00000463369.1_Missense_Mutation_p.S205G	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	233					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		TGTTCCTGACTCTTTTCCAAA	0.353																																					p.S233G		Atlas-SNP	.											.	SHQ1	60	.	0			c.A697G						.						95.0	92.0	93.0					3																	72873605		2201	4298	6499	SO:0001583	missense	55164	exon6			CCTGACTCTTTTC	BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.697A>G	chr3.hg19:g.72873605T>C	ENSP00000315182:p.Ser233Gly	106.0	0.0		70.0	25.0	NM_018130	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	hg19	CCDS33788.1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.209440	0.39003	.	.	ENSG00000144736	ENST00000325599;ENST00000463369	T;T	0.33865	1.4;1.39	5.61	4.45	0.53987	SHQ1 protein (1);	0.759174	0.13015	N	0.420586	T	0.33818	0.0876	L	0.47716	1.5	0.43803	D	0.996355	B	0.14012	0.009	B	0.19391	0.025	T	0.06110	-1.0845	10	0.48119	T	0.1	-8.289	10.7416	0.46156	0.0:0.0759:0.0:0.9241	.	233	Q6PI26	SHQ1_HUMAN	G	233;205	ENSP00000315182:S233G;ENSP00000417452:S205G	ENSP00000315182:S233G	S	-	1	0	SHQ1	72956295	0.000000	0.05858	0.934000	0.37439	0.077000	0.17291	0.732000	0.26072	0.964000	0.38108	-0.290000	0.09829	AGT	.	.		0.353	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130	
GOLGB1	2804	hgsc.bcm.edu	37	3	121410757	121410757	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:121410757T>C	ENST00000340645.5	-	14	7564	c.7439A>G	c.(7438-7440)tAt>tGt	p.Y2480C	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Y2485C	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2480					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CAGCTGTTGATAGTCACCCAC	0.403																																					p.Y2485C		Atlas-SNP	.											.	GOLGB1	319	.	0			c.A7454G						.						164.0	163.0	163.0					3																	121410757		2203	4300	6503	SO:0001583	missense	2804	exon14			TGTTGATAGTCAC	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7439A>G	chr3.hg19:g.121410757T>C	ENSP00000341848:p.Tyr2480Cys	144.0	0.0		90.0	39.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.038514	0.35989	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.27402	1.67;1.67	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000030	T	0.55673	0.1935	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.986	T	0.56426	-0.7981	10	0.39692	T	0.17	.	13.648	0.62292	0.0:0.0:0.0:1.0	.	2485;2485;2480	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	C	2480;2485	ENSP00000341848:Y2480C;ENSP00000377275:Y2485C	ENSP00000341848:Y2480C	Y	-	2	0	GOLGB1	122893447	1.000000	0.71417	0.987000	0.45799	0.878000	0.50629	7.634000	0.83273	2.102000	0.63906	0.460000	0.39030	TAT	.	.		0.403	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
DTX3L	151636	hgsc.bcm.edu	37	3	122284854	122284854	+	Silent	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:122284854G>A	ENST00000296161.4	+	2	525	c.336G>A	c.(334-336)ccG>ccA	p.P112P	PARP9_ENST00000360356.2_5'Flank|PARP9_ENST00000477522.2_5'Flank|PARP9_ENST00000462315.1_5'Flank|PARP9_ENST00000492382.1_5'Flank|PARP9_ENST00000471785.1_5'Flank|DTX3L_ENST00000383661.3_Silent_p.P112P	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	112					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CAGAAACACCGTCTGGTGATA	0.438																																					p.P112P		Atlas-SNP	.											.	DTX3L	59	.	0			c.G336A						.						105.0	93.0	97.0					3																	122284854		2203	4300	6503	SO:0001819	synonymous_variant	151636	exon2			AACACCGTCTGGT		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.336G>A	chr3.hg19:g.122284854G>A		166.0	0.0		109.0	40.0	NM_138287	B3KWH6|Q53ZZ3|Q5MJP7	Silent	SNP	ENST00000296161.4	hg19	CCDS3015.1																																																																																			.	.		0.438	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
P2RY1	5028	hgsc.bcm.edu	37	3	152554320	152554320	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr3:152554320A>T	ENST00000305097.3	+	1	1585	c.749A>T	c.(748-750)gAc>gTc	p.D250V	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	250					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AAAGATCTGGACAACTCTCCT	0.438																																					p.D250V		Atlas-SNP	.											.	P2RY1	49	.	0			c.A749T						.						105.0	100.0	102.0					3																	152554320		2203	4300	6503	SO:0001583	missense	5028	exon1			ATCTGGACAACTC	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.749A>T	chr3.hg19:g.152554320A>T	ENSP00000304767:p.Asp250Val	109.0	0.0		83.0	38.0	NM_002563		Missense_Mutation	SNP	ENST00000305097.3	hg19	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.260760	0.39995	.	.	ENSG00000169860	ENST00000305097	T	0.20463	2.07	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.062065	0.64402	D	0.000002	T	0.17662	0.0424	N	0.05554	-0.025	0.80722	D	1	P	0.45396	0.857	P	0.49387	0.609	T	0.13845	-1.0494	10	0.29301	T	0.29	.	14.9343	0.70941	1.0:0.0:0.0:0.0	.	250	P47900	P2RY1_HUMAN	V	250	ENSP00000304767:D250V	ENSP00000304767:D250V	D	+	2	0	P2RY1	154037010	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.098000	0.71458	2.117000	0.64856	0.460000	0.39030	GAC	.	.		0.438	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
WWC2	80014	hgsc.bcm.edu	37	4	184180883	184180883	+	Splice_Site	SNP	T	T	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr4:184180883T>G	ENST00000403733.3	+	10	1485		c.e10+2		WWC2_ENST00000378925.3_Splice_Site|WWC2_ENST00000513834.1_Splice_Site|WWC2_ENST00000448232.2_Splice_Site|WWC2_ENST00000504005.1_Splice_Site	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		ACTTAAAAGGTGAGCTTATCA	0.318																																					.		Atlas-SNP	.											.	WWC2	78	.	0			c.1286+2T>G						.						39.0	42.0	41.0					4																	184180883		2085	4052	6137	SO:0001630	splice_region_variant	80014	exon10			AAAAGGTGAGCTT	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1286+2T>G	chr4.hg19:g.184180883T>G		285.0	1.0		208.0	93.0	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Splice_Site	SNP	ENST00000403733.3	hg19	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812925	0.50527	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	.	.	.	4.99	2.54	0.30619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4802	0.38895	0.0:0.1446:0.0:0.8554	.	.	.	.	.	-1	.	.	.	+	.	.	WWC2	184417877	1.000000	0.71417	0.732000	0.30844	0.796000	0.44982	3.729000	0.54999	0.471000	0.27319	0.459000	0.35465	.	.	.		0.318	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	Intron
FAT1	2195	hgsc.bcm.edu	37	4	187510117	187510117	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr4:187510117T>C	ENST00000441802.2	-	27	13605	c.13396A>G	c.(13396-13398)Aga>Gga	p.R4466G		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4466					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGCATGTCTCTAGGAGGGTGG	0.502										HNSCC(5;0.00058)																											p.R4466G	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.A13396G						.						210.0	212.0	212.0					4																	187510117		1909	4110	6019	SO:0001583	missense	2195	exon27			TGTCTCTAGGAGG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.13396A>G	chr4.hg19:g.187510117T>C	ENSP00000406229:p.Arg4466Gly	217.0	0.0		194.0	63.0	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.14|11.14	1.549765|1.549765	0.27652|0.27652	.|.	.|.	ENSG00000083857|ENSG00000083857	ENST00000441802;ENST00000260147|ENST00000512772;ENST00000507105	T|.	0.23754|.	1.89|.	5.37|5.37	2.9|2.9	0.33743|0.33743	.|.	0.094242|.	0.64402|.	N|.	0.000002|.	T|.	0.57666|.	0.2069|.	L|L	0.54323|0.54323	1.7|1.7	0.47949|0.47949	D|D	0.999556|0.999556	B|.	0.25441|.	0.126|.	B|.	0.27500|.	0.08|.	T|.	0.50693|.	-0.8798|.	10|.	0.34782|.	T|.	0.22|.	.|.	8.2943|8.2943	0.31976|0.31976	0.0:0.0689:0.1335:0.7976|0.0:0.0689:0.1335:0.7976	.|.	4466|.	Q14517|.	FAT1_HUMAN|.	G|W	4466;4468|245;233	ENSP00000406229:R4466G|.	ENSP00000260147:R4468G|.	R|X	-|-	1|2	2|0	FAT1|FAT1	187747111|187747111	0.949000|0.949000	0.32298|0.32298	0.524000|0.524000	0.27887|0.27887	0.618000|0.618000	0.37518|0.37518	1.621000|1.621000	0.36986|0.36986	0.468000|0.468000	0.27243|0.27243	0.374000|0.374000	0.22700|0.22700	AGA|TAG	.	.		0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60825879	60825879	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr5:60825879A>T	ENST00000252744.5	+	8	1838	c.1838A>T	c.(1837-1839)gAg>gTg	p.E613V		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	613					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CCTTACACAGAGCTACCCCAT	0.488																																					p.E613V		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.A1838T						.						111.0	92.0	98.0					5																	60825879		692	1591	2283	SO:0001630	splice_region_variant	57688	exon8			ACACAGAGCTACC	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1838-1A>T	chr5.hg19:g.60825879A>T		163.0	0.0		151.0	90.0	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.824052	0.90873	.	.	ENSG00000130449	ENST00000252744	T	0.50548	0.74	5.73	5.73	0.89815	.	0.051912	0.85682	D	0.000000	T	0.61400	0.2344	M	0.66939	2.045	0.58432	D	0.999992	P	0.40332	0.713	P	0.52109	0.69	T	0.59300	-0.7480	9	.	.	.	.	16.0106	0.80399	1.0:0.0:0.0:0.0	.	613	Q9HCJ5	ZSWM6_HUMAN	V	613	ENSP00000252744:E613V	.	E	+	2	0	ZSWIM6	60861636	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.929000	0.92859	2.181000	0.69327	0.459000	0.35465	GAG	.	.		0.488	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	Missense_Mutation
ST8SIA4	7903	hgsc.bcm.edu	37	5	100231434	100231434	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr5:100231434G>A	ENST00000231461.5	-	2	479	c.169C>T	c.(169-171)Cga>Tga	p.R57*	ST8SIA4_ENST00000451528.2_Nonsense_Mutation_p.R57*	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	57					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.R57*(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CCAGCCTTTCGAATGATTTTA	0.373																																					p.R57X		Atlas-SNP	.											ST8SIA4,NS,carcinoma,+1,1	ST8SIA4	77	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C169T						.						112.0	109.0	110.0					5																	100231434		2203	4299	6502	SO:0001587	stop_gained	7903	exon2			CCTTTCGAATGAT	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.169C>T	chr5.hg19:g.100231434G>A	ENSP00000231461:p.Arg57*	119.0	0.0		137.0	39.0	NM_175052	A8KA07|G3V104|Q8N1F4|Q92693	Nonsense_Mutation	SNP	ENST00000231461.5	hg19	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	G	37	6.260157	0.97421	.	.	ENSG00000113532	ENST00000231461;ENST00000451528	.	.	.	5.96	5.96	0.96718	.	0.083749	0.50627	D	0.000120	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	19.3963	0.94608	0.0:0.0:1.0:0.0	.	.	.	.	X	57	.	ENSP00000231461:R57X	R	-	1	2	ST8SIA4	100259333	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.235000	0.51328	2.814000	0.96858	0.655000	0.94253	CGA	.	.		0.373	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128861992	128861992	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr5:128861992G>C	ENST00000274487.4	+	4	1056	c.911G>C	c.(910-912)aGg>aCg	p.R304T	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	304						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGAAGACCTAGGTCTAGAAAA	0.348																																					p.R304T		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.G911C						.						63.0	60.0	61.0					5																	128861992		2203	4300	6503	SO:0001583	missense	171019	exon4			GACCTAGGTCTAG	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.911G>C	chr5.hg19:g.128861992G>C	ENSP00000274487:p.Arg304Thr	315.0	0.0		345.0	210.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011789	0.35511	.	.	ENSG00000145808	ENST00000274487	T	0.66280	-0.2	4.45	2.68	0.31781	.	0.139461	0.46758	D	0.000274	T	0.33498	0.0865	N	0.08118	0	0.33325	D	0.567825	B	0.27117	0.168	B	0.15052	0.012	T	0.34403	-0.9830	9	.	.	.	.	7.4419	0.27187	0.3295:0.0:0.6705:0.0	.	304	Q8TE59	ATS19_HUMAN	T	304	ENSP00000274487:R304T	.	R	+	2	0	ADAMTS19	128889891	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.858000	0.27845	0.825000	0.34637	0.557000	0.71058	AGG	.	.		0.348	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
UBR2	23304	hgsc.bcm.edu	37	6	42629942	42629942	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr6:42629942A>G	ENST00000372899.1	+	31	3721	c.3463A>G	c.(3463-3465)Atg>Gtg	p.M1155V	UBR2_ENST00000372901.1_Missense_Mutation_p.M1155V|UBR2_ENST00000372883.3_3'UTR|RNU6-890P_ENST00000384121.1_RNA	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1155					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TCCATTATTCATGCACCCTGA	0.318																																					p.M1155V		Atlas-SNP	.											.	UBR2	134	.	0			c.A3463G						.						178.0	167.0	170.0					6																	42629942		2203	4300	6503	SO:0001583	missense	23304	exon31			TTATTCATGCACC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.3463A>G	chr6.hg19:g.42629942A>G	ENSP00000361990:p.Met1155Val	60.0	0.0		66.0	14.0	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	hg19	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154915	0.38021	.	.	ENSG00000024048	ENST00000372899;ENST00000372901	T;T	0.45668	0.89;0.89	5.16	5.16	0.70880	Zinc finger, RING-type (1);	0.036871	0.85682	D	0.000000	T	0.19525	0.0469	L	0.43757	1.38	0.80722	D	1	B;B	0.12013	0.005;0.002	B;B	0.14023	0.01;0.006	T	0.07790	-1.0754	10	0.13853	T	0.58	-10.1973	15.295	0.73898	1.0:0.0:0.0:0.0	.	1155;1155	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	V	1155	ENSP00000361990:M1155V;ENSP00000361992:M1155V	ENSP00000361990:M1155V	M	+	1	0	UBR2	42737920	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	6.014000	0.70784	2.086000	0.62901	0.379000	0.24179	ATG	.	.		0.318	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
MLIP	90523	hgsc.bcm.edu	37	6	54095631	54095631	+	Silent	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr6:54095631A>G	ENST00000274897.5	+	11	1346	c.1233A>G	c.(1231-1233)ccA>ccG	p.P411P	MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Silent_p.P946P|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000358276.5_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	411						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						GTCTTGCCCCAGGACCCTTCA	0.512																																					p.P411P		Atlas-SNP	.											.	MLIP	84	.	0			c.A1233G						.						262.0	231.0	241.0					6																	54095631		2203	4300	6503	SO:0001819	synonymous_variant	90523	exon11			TGCCCCAGGACCC	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1233A>G	chr6.hg19:g.54095631A>G		66.0	0.0		73.0	40.0	NM_138569	B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	ENST00000274897.5	hg19	CCDS4954.1																																																																																			.	.		0.512	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569	
GPR63	81491	hgsc.bcm.edu	37	6	97246634	97246634	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr6:97246634A>G	ENST00000229955.3	-	2	1319	c.974T>C	c.(973-975)gTc>gCc	p.V325A	RP3-417O22.3_ENST00000442184.1_RNA|GPR63_ENST00000417980.1_Missense_Mutation_p.V325A	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	325						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GGCCCAGCAGACAATGAAGAC	0.453																																					p.V325A		Atlas-SNP	.											.	GPR63	60	.	0			c.T974C						.						107.0	90.0	96.0					6																	97246634		2203	4300	6503	SO:0001583	missense	81491	exon2			CAGCAGACAATGA	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.974T>C	chr6.hg19:g.97246634A>G	ENSP00000229955:p.Val325Ala	166.0	0.0		169.0	53.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	hg19	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.042816	0.36085	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.41758	0.99;0.99;0.99	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.160895	0.41194	D	0.000926	T	0.21468	0.0517	L	0.31294	0.92	0.43647	D	0.996056	B	0.06786	0.001	B	0.19391	0.025	T	0.08207	-1.0733	10	0.62326	D	0.03	-0.2317	15.3582	0.74443	1.0:0.0:0.0:0.0	.	325	Q9BZJ6	GPR63_HUMAN	A	349;325;325;325	ENSP00000393170:V325A;ENSP00000229955:V325A;ENSP00000358273:V325A	ENSP00000229955:V325A	V	-	2	0	GPR63	97353355	1.000000	0.71417	0.978000	0.43139	0.998000	0.95712	5.927000	0.70080	2.097000	0.63578	0.528000	0.53228	GTC	.	.		0.453	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
TFB1M	51106	hgsc.bcm.edu	37	6	155632360	155632360	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr6:155632360C>A	ENST00000367166.4	-	2	302	c.247G>T	c.(247-249)Gtg>Ttg	p.V83L	TFB1M_ENST00000480390.1_5'UTR	NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		TTTTCAACCACCAGAAGTTCA	0.438																																					p.V83L		Atlas-SNP	.											.	TFB1M	30	.	0			c.G247T						.						128.0	116.0	120.0					6																	155632360		2203	4300	6503	SO:0001583	missense	51106	exon2			CAACCACCAGAAG	AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.247G>T	chr6.hg19:g.155632360C>A	ENSP00000356134:p.Val83Leu	106.0	0.0		130.0	46.0	NM_016020	Q05DR0|Q9Y384	Missense_Mutation	SNP	ENST00000367166.4	hg19	CCDS5248.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553728	0.65425	.	.	ENSG00000029639	ENST00000367166	T	0.27720	1.65	5.96	5.96	0.96718	Ribosomal RNA adenine methylase transferase, conserved site (1);Ribosomal RNA adenine methylase transferase, N-terminal (1);	0.057121	0.64402	D	0.000001	T	0.21921	0.0528	L	0.49455	1.56	0.58432	D	0.999994	B	0.22541	0.071	B	0.33690	0.168	T	0.02683	-1.1124	10	0.36615	T	0.2	-27.1362	14.7978	0.69891	0.1794:0.8206:0.0:0.0	.	83	Q8WVM0	TFB1M_HUMAN	L	83	ENSP00000356134:V83L	ENSP00000356134:V83L	V	-	1	0	TFB1M	155674052	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.452000	0.60054	2.832000	0.97577	0.655000	0.94253	GTG	.	.		0.438	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042809.1		
RADIL	55698	hgsc.bcm.edu	37	7	4917682	4917682	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr7:4917682C>T	ENST00000399583.3	-	2	276	c.89G>A	c.(88-90)cGg>cAg	p.R30Q	RADIL_ENST00000536091.1_Missense_Mutation_p.R30Q	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	30					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GCTCAGCGTCCGGGACAGCAT	0.632																																					p.R30Q		Atlas-SNP	.											.	RADIL	110	.	0			c.G89A						.						22.0	26.0	25.0					7																	4917682		2070	4203	6273	SO:0001583	missense	55698	exon2			AGCGTCCGGGACA	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.89G>A	chr7.hg19:g.4917682C>T	ENSP00000382492:p.Arg30Gln	71.0	0.0		58.0	26.0	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	hg19	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227487	0.79576	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000457174	T;T	0.28255	3.0;1.62	5.84	5.84	0.93424	.	0.068935	0.64402	D	0.000016	T	0.41627	0.1167	M	0.63843	1.955	0.41280	D	0.986906	D	0.58620	0.983	P	0.47470	0.548	T	0.38156	-0.9674	10	0.87932	D	0	-54.2171	17.2991	0.87177	0.0:1.0:0.0:0.0	.	30	Q96JH8	RADIL_HUMAN	Q	30;4;30;30	ENSP00000382492:R30Q;ENSP00000442533:R30Q	ENSP00000320946:R4Q	R	-	2	0	RADIL	4884208	1.000000	0.71417	0.999000	0.59377	0.368000	0.29767	5.450000	0.66626	2.769000	0.95229	0.561000	0.74099	CGG	.	.		0.632	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
ANKMY2	57037	hgsc.bcm.edu	37	7	16666729	16666729	+	Silent	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr7:16666729T>A	ENST00000306999.2	-	3	450	c.207A>T	c.(205-207)ggA>ggT	p.G69G	ANKMY2_ENST00000421746.1_5'UTR	NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	69						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTACATCGGCTCCATGTCGCA	0.353																																					p.G69G		Atlas-SNP	.											.	ANKMY2	46	.	0			c.A207T						.						97.0	84.0	89.0					7																	16666729		2203	4300	6503	SO:0001819	synonymous_variant	57037	exon3			ATCGGCTCCATGT	AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.207A>T	chr7.hg19:g.16666729T>A		77.0	0.0		61.0	17.0	NM_020319	A4D124|Q659G1|Q96BL3	Silent	SNP	ENST00000306999.2	hg19	CCDS5361.1																																																																																			.	.		0.353	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319	
PLEKHA8	84725	hgsc.bcm.edu	37	7	30102308	30102308	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr7:30102308G>T	ENST00000449726.1	+	12	1600	c.1250G>T	c.(1249-1251)gGa>gTa	p.G417V	PLEKHA8_ENST00000396259.1_Missense_Mutation_p.G417V|PLEKHA8_ENST00000396257.2_Missense_Mutation_p.G417V|PLEKHA8_ENST00000258679.7_Missense_Mutation_p.G417V	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	417	Glycolipid transfer protein homology domain.				ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						TTTTTGAAGGGATTTTTGACA	0.343																																					p.G417V		Atlas-SNP	.											.	PLEKHA8	68	.	0			c.G1250T						.						74.0	77.0	76.0					7																	30102308		2203	4300	6503	SO:0001583	missense	84725	exon12			TGAAGGGATTTTT	BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.1250G>T	chr7.hg19:g.30102308G>T	ENSP00000397947:p.Gly417Val	58.0	0.0		54.0	18.0	NM_001197027	B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Missense_Mutation	SNP	ENST00000449726.1	hg19	CCDS56473.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383723	0.61845	.	.	ENSG00000106086	ENST00000258679;ENST00000449726;ENST00000396257;ENST00000396259;ENST00000440706	.	.	.	5.15	4.26	0.50523	Glycolipid transfer protein domain (3);	0.189745	0.46145	D	0.000312	T	0.40067	0.1102	N	0.02751	-0.505	0.58432	D	0.999999	P;P;D;P	0.89917	0.617;0.811;1.0;0.72	B;P;D;P	0.91635	0.242;0.516;0.999;0.517	T	0.40308	-0.9570	9	0.34782	T	0.22	-16.2627	9.4036	0.38449	0.1673:0.0:0.8327:0.0	.	417;417;417;417	Q96JA3-2;Q96JA3;Q96JA3-3;B4DH00	.;PKHA8_HUMAN;.;.	V	417;417;417;417;443	.	ENSP00000258679:G417V	G	+	2	0	PLEKHA8	30068833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.507000	0.45442	2.398000	0.81561	0.655000	0.94253	GGA	.	.		0.343	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032639	
CFTR	1080	hgsc.bcm.edu	37	7	117243681	117243681	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr7:117243681T>A	ENST00000003084.6	+	17	2885	c.2753T>A	c.(2752-2754)aTt>aAt	p.I918N	CFTR_ENST00000454343.1_Missense_Mutation_p.I857N|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	918	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GTGTTTTACATTTACGTGGGA	0.408									Cystic Fibrosis																												p.I918N		Atlas-SNP	.											.	CFTR	171	.	0			c.T2753A						.						217.0	185.0	196.0					7																	117243681		2203	4300	6503	SO:0001583	missense	1080	exon17	Familial Cancer Database	CF	TTTACATTTACGT	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2753T>A	chr7.hg19:g.117243681T>A	ENSP00000003084:p.Ile918Asn	125.0	0.0		112.0	21.0	NM_000492	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	hg19	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419619	0.83559	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.91521	-2.86;-2.86;-2.86	5.82	5.82	0.92795	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96043	0.8711	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96715	0.9528	10	0.87932	D	0	-18.3837	16.179	0.81887	0.0:0.0:0.0:1.0	.	918	P13569	CFTR_HUMAN	N	918;857;888	ENSP00000003084:I918N;ENSP00000403677:I857N;ENSP00000389119:I888N	ENSP00000003084:I918N	I	+	2	0	CFTR	117030917	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	7.990000	0.88215	2.232000	0.73038	0.477000	0.44152	ATT	.	.		0.408	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
LONRF1	91694	hgsc.bcm.edu	37	8	12589255	12589255	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr8:12589255C>A	ENST00000398246.3	-	8	1747	c.1678G>T	c.(1678-1680)Gaa>Taa	p.E560*	LONRF1_ENST00000525024.1_5'Flank|LONRF1_ENST00000533751.1_Nonsense_Mutation_p.E203*	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	560							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		TGTGAGAGTTCAGCAGTTTCT	0.363																																					p.E560X		Atlas-SNP	.											.	LONRF1	45	.	0			c.G1678T						.						80.0	74.0	76.0					8																	12589255		1811	4070	5881	SO:0001587	stop_gained	91694	exon8			AGAGTTCAGCAGT	AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1678G>T	chr8.hg19:g.12589255C>A	ENSP00000381298:p.Glu560*	234.0	1.0		99.0	69.0	NM_152271	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Nonsense_Mutation	SNP	ENST00000398246.3	hg19	CCDS5987.2	.	.	.	.	.	.	.	.	.	.	C	35	5.483070	0.96307	.	.	ENSG00000154359	ENST00000398246;ENST00000533751;ENST00000524526	.	.	.	4.98	4.98	0.66077	.	0.048296	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-18.7649	19.1544	0.93504	0.0:1.0:0.0:0.0	.	.	.	.	X	560;203;163	.	ENSP00000381298:E560X	E	-	1	0	LONRF1	12633626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.401000	0.79962	2.700000	0.92200	0.557000	0.71058	GAA	.	.		0.363	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271	
TRIB1	10221	hgsc.bcm.edu	37	8	126445629	126445629	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr8:126445629C>G	ENST00000311922.3	+	2	1013	c.431C>G	c.(430-432)aCt>aGt	p.T144S	TRIB1_ENST00000520847.1_5'UTR|TRIB1_ENST00000521778.1_3'UTR|TRIB1_ENST00000519576.1_5'Flank	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			AGCAACATTACTGGCATTGTG	0.517																																					p.T144S		Atlas-SNP	.											.	TRIB1	73	.	0			c.C431G						.						188.0	188.0	188.0					8																	126445629		2203	4300	6503	SO:0001583	missense	10221	exon2			ACATTACTGGCAT	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.431C>G	chr8.hg19:g.126445629C>G	ENSP00000312150:p.Thr144Ser	138.0	0.0		273.0	53.0	NM_025195		Missense_Mutation	SNP	ENST00000311922.3	hg19	CCDS6357.1	.	.	.	.	.	.	.	.	.	.	C	9.235	1.036721	0.19669	.	.	ENSG00000173334	ENST00000311922	T	0.65549	-0.16	4.91	4.02	0.46733	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.34223	U	0.004152	T	0.49490	0.1560	N	0.24115	0.695	0.80722	D	1	P	0.37352	0.591	B	0.38156	0.266	T	0.54748	-0.8247	10	0.66056	D	0.02	-18.8068	12.6457	0.56733	0.3011:0.6989:0.0:0.0	.	144	Q96RU8	TRIB1_HUMAN	S	144	ENSP00000312150:T144S	ENSP00000312150:T144S	T	+	2	0	TRIB1	126514811	0.991000	0.36638	0.693000	0.30195	0.919000	0.55068	3.068000	0.50018	1.184000	0.42957	0.511000	0.50034	ACT	.	.		0.517	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195	
COL22A1	169044	hgsc.bcm.edu	37	8	139895407	139895407	+	Silent	SNP	G	G	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr8:139895407G>T	ENST00000303045.6	-	2	455	c.9C>A	c.(7-9)ggC>ggA	p.G3G	COL22A1_ENST00000435777.1_Silent_p.G3G	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	3					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCCCTCGGAGGCCGGCCATGG	0.662										HNSCC(7;0.00092)																											p.G3G		Atlas-SNP	.											.	COL22A1	390	.	0			c.C9A						.						18.0	23.0	21.0					8																	139895407		2189	4289	6478	SO:0001819	synonymous_variant	169044	exon2			TCGGAGGCCGGCC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.9C>A	chr8.hg19:g.139895407G>T		74.0	0.0		154.0	82.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.		0.662	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
IGFBPL1	347252	hgsc.bcm.edu	37	9	38411534	38411534	+	Silent	SNP	G	G	T	rs375493692		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr9:38411534G>T	ENST00000377694.1	-	4	722	c.700C>A	c.(700-702)Cga>Aga	p.R234R		NM_001007563.1	NP_001007564.1	Q8WX77	IBPL1_HUMAN	insulin-like growth factor binding protein-like 1	234	Ig-like C2-type.				regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)				endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	4				GBM - Glioblastoma multiforme(29;0.0437)|Lung(182;0.116)		TCCTCCTTTCGCAGGGGGTTG	0.448																																					p.R234R		Atlas-SNP	.											.	IGFBPL1	8	.	0			c.C700A						.						97.0	81.0	86.0					9																	38411534		2203	4300	6503	SO:0001819	synonymous_variant	347252	exon4			CCTTTCGCAGGGG		CCDS35017.1	9p12	2013-01-11			ENSG00000137142	ENSG00000137142		"""Immunoglobulin superfamily / I-set domain containing"""	20081	protein-coding gene	gene with protein product		610413					Standard	NM_001007563		Approved	bA113O24.1	uc004aaz.3	Q8WX77	OTTHUMG00000019937	ENST00000377694.1:c.700C>A	chr9.hg19:g.38411534G>T		76.0	0.0		70.0	20.0	NM_001007563		Silent	SNP	ENST00000377694.1	hg19	CCDS35017.1																																																																																			.	.		0.448	IGFBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052491.1	XM_294567	
NTRK2	4915	hgsc.bcm.edu	37	9	87635234	87635234	+	Silent	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr9:87635234T>A	ENST00000323115.4	+	16	2591	c.2238T>A	c.(2236-2238)atT>atA	p.I746I	NTRK2_ENST00000376213.1_Silent_p.I746I|NTRK2_ENST00000277120.3_Silent_p.I762I|NTRK2_ENST00000376214.1_Silent_p.I762I			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	746	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TGTGGGAGATTTTCACCTATG	0.557										TSP Lung(25;0.17)																											p.I762I		Atlas-SNP	.											.	NTRK2	331	.	0			c.T2286A						.						132.0	121.0	125.0					9																	87635234		2203	4300	6503	SO:0001819	synonymous_variant	4915	exon20			GGAGATTTTCACC	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.2238T>A	chr9.hg19:g.87635234T>A		153.0	0.0		114.0	37.0	NM_006180	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Silent	SNP	ENST00000323115.4	hg19	CCDS35050.1																																																																																			.	.		0.557	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
PTCHD3	374308	hgsc.bcm.edu	37	10	27702854	27702854	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr10:27702854C>T	ENST00000438700.3	-	1	443	c.326G>A	c.(325-327)aGg>aAg	p.R109K		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	109					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GTGCCGGTGCCTGCAGATGGC	0.706																																					p.R109K		Atlas-SNP	.											.	PTCHD3	140	.	0			c.G326A						.						32.0	34.0	33.0					10																	27702854		2203	4299	6502	SO:0001583	missense	374308	exon1			CGGTGCCTGCAGA	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.326G>A	chr10.hg19:g.27702854C>T	ENSP00000417658:p.Arg109Lys	67.0	0.0		38.0	13.0	NM_001034842	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	hg19	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.539085	0.00942	.	.	ENSG00000182077	ENST00000438700	D	0.87571	-2.27	1.66	1.66	0.24008	.	.	.	.	.	T	0.73458	0.3589	L	0.29908	0.895	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.55598	-0.8116	9	0.07482	T	0.82	.	3.4831	0.07610	0.0:0.7102:0.0:0.2898	.	109	Q3KNS1	PTHD3_HUMAN	K	109	ENSP00000417658:R109K	ENSP00000417658:R109K	R	-	2	0	PTCHD3	27742860	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.963000	0.03837	0.681000	0.31386	0.313000	0.20887	AGG	.	.		0.706	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
WDFY4	57705	hgsc.bcm.edu	37	10	50085112	50085112	+	Silent	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr10:50085112G>A	ENST00000325239.5	+	42	7062	c.7035G>A	c.(7033-7035)ccG>ccA	p.P2345P	RP11-563N6.6_ENST00000423256.1_RNA|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2345						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGGGCGAGCCGGACGAGGTGG	0.577																																					p.P2345P		Atlas-SNP	.											.	WDFY4	205	.	0			c.G7035A						.						53.0	62.0	59.0					10																	50085112		692	1591	2283	SO:0001819	synonymous_variant	57705	exon43			CGAGCCGGACGAG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7035G>A	chr10.hg19:g.50085112G>A		131.0	0.0		81.0	33.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	hg19	CCDS44385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.91|11.91	1.778666|1.778666	0.31502|0.31502	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000265453	.|.	.|.	.|.	5.2|5.2	-10.4|-10.4	0.00318|0.00318	.|.	.|.	.|.	.|.	.|.	T|T	0.14227|0.14227	0.0344|0.0344	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.07947|0.07947	-1.0746|-1.0746	4|4	.|.	.|.	.|.	.|.	1.74|1.74	0.02950|0.02950	0.1479:0.1769:0.3186:0.3566|0.1479:0.1769:0.3186:0.3566	.|.	.|.	.|.	.|.	R|Q	1436|432	.|.	.|.	G|R	+|+	1|2	0|0	WDFY4|WDFY4	49755118|49755118	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-2.161000|-2.161000	0.01278|0.01278	-3.776000|-3.776000	0.00108|0.00108	-4.510000|-4.510000	0.00005|0.00005	GGA|CGG	.	.		0.577	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
UNC5B	219699	hgsc.bcm.edu	37	10	73050696	73050696	+	Missense_Mutation	SNP	C	C	T	rs533838225		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr10:73050696C>T	ENST00000335350.6	+	9	1540	c.1124C>T	c.(1123-1125)gCg>gTg	p.A375V	UNC5B_ENST00000373192.4_Missense_Mutation_p.A364V	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	375					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GGGGATGCGGCGCTGTATGCG	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17337	0.0		0.0	False		,,,				2504	0.001				p.A375V		Atlas-SNP	.											.	UNC5B	123	.	0			c.C1124T						.						133.0	137.0	136.0					10																	73050696		2203	4300	6503	SO:0001583	missense	219699	exon9			ATGCGGCGCTGTA	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1124C>T	chr10.hg19:g.73050696C>T	ENSP00000334329:p.Ala375Val	69.0	0.0		47.0	22.0	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	hg19	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411414	0.83340	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.56275	0.58;0.47	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.75824	0.3902	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.78033	-0.2362	10	0.51188	T	0.08	-28.5221	18.8547	0.92247	0.0:1.0:0.0:0.0	.	364;375	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	V	375;364	ENSP00000334329:A375V;ENSP00000362288:A364V	ENSP00000334329:A375V	A	+	2	0	UNC5B	72720702	1.000000	0.71417	0.998000	0.56505	0.221000	0.24807	7.786000	0.85741	2.466000	0.83321	0.563000	0.77884	GCG	.	.		0.667	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
ABCC2	1244	hgsc.bcm.edu	37	10	101590535	101590535	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr10:101590535A>G	ENST00000370449.4	+	21	2923	c.2810A>G	c.(2809-2811)aAt>aGt	p.N937S		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	937					cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CGGAATGTGAATAGCCTGAAG	0.433																																					p.N937S		Atlas-SNP	.											.	ABCC2	160	.	0			c.A2810G						.						92.0	90.0	91.0					10																	101590535		2203	4300	6503	SO:0001583	missense	1244	exon21			ATGTGAATAGCCT	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.2810A>G	chr10.hg19:g.101590535A>G	ENSP00000359478:p.Asn937Ser	170.0	0.0		96.0	49.0	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	hg19	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	A	2.914	-0.224710	0.06022	.	.	ENSG00000023839	ENST00000370449	D	0.88586	-2.4	5.67	-0.967	0.10316	.	1.212080	0.05452	N	0.549609	T	0.77438	0.4130	L	0.29908	0.895	0.09310	N	1	B	0.17038	0.02	B	0.11329	0.006	T	0.59721	-0.7401	10	0.08837	T	0.75	0.3298	1.4555	0.02384	0.4352:0.1398:0.2883:0.1367	.	937	Q92887	MRP2_HUMAN	S	937	ENSP00000359478:N937S	ENSP00000359478:N937S	N	+	2	0	ABCC2	101580525	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.419000	0.21247	-0.106000	0.12110	0.459000	0.35465	AAT	.	.		0.433	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
PKD2L1	9033	hgsc.bcm.edu	37	10	102054310	102054310	+	Silent	SNP	G	G	A	rs148570260		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr10:102054310G>A	ENST00000318222.3	-	9	2023	c.1641C>T	c.(1639-1641)ttC>ttT	p.F547F	PKD2L1_ENST00000338519.3_Silent_p.F472F|PKD2L1_ENST00000353274.3_Silent_p.F547F	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	547					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CGAAGAAGACGAAGAAGACAT	0.532																																					p.F547F		Atlas-SNP	.											.	PKD2L1	103	.	0			c.C1641T						.	G		1,4405	2.1+/-5.4	0,1,2202	138.0	121.0	127.0		1641	-1.1	1.0	10	dbSNP_134	127	0,8600		0,0,4300	no	coding-synonymous	PKD2L1	NM_016112.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		547/806	102054310	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9033	exon9			GAAGACGAAGAAG	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1641C>T	chr10.hg19:g.102054310G>A		151.0	0.0		132.0	50.0	NM_016112	O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	ENST00000318222.3	hg19	CCDS7492.1																																																																																			.	G|1.000;A|0.000		0.532	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112	
C11orf16	56673	hgsc.bcm.edu	37	11	8950997	8950997	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:8950997G>A	ENST00000326053.5	-	3	357	c.251C>T	c.(250-252)gCc>gTc	p.A84V	C11orf16_ENST00000528998.1_Intron|C11orf16_ENST00000525780.1_Missense_Mutation_p.A84V	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	84										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		CCATGTGTTGGCAGCATCTCC	0.567																																					p.A84V		Atlas-SNP	.											.	C11orf16	43	.	0			c.C251T						.						103.0	100.0	101.0					11																	8950997		2201	4296	6497	SO:0001583	missense	56673	exon3			GTGTTGGCAGCAT	AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.251C>T	chr11.hg19:g.8950997G>A	ENSP00000318999:p.Ala84Val	104.0	0.0		73.0	29.0	NM_020643	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	hg19	CCDS7794.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366614	0.61513	.	.	ENSG00000176029	ENST00000525780;ENST00000326053;ENST00000526227	T;T	0.31510	1.5;1.49	4.57	2.52	0.30459	.	0.702222	0.13381	N	0.392178	T	0.35364	0.0929	L	0.57536	1.79	0.09310	N	1	P;P	0.47302	0.893;0.893	P;P	0.47981	0.563;0.563	T	0.10291	-1.0636	10	0.39692	T	0.17	-19.5754	9.5443	0.39271	0.0:0.2784:0.5793:0.1423	.	84;84	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	V	84	ENSP00000436818:A84V;ENSP00000318999:A84V	ENSP00000318999:A84V	A	-	2	0	C11orf16	8907573	0.002000	0.14202	0.326000	0.25389	0.884000	0.51177	0.620000	0.24403	1.241000	0.43820	0.591000	0.81541	GCC	.	.		0.567	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385626.1	NM_020643	
PLEKHA7	144100	hgsc.bcm.edu	37	11	16863238	16863238	+	Missense_Mutation	SNP	T	T	C	rs200394760		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:16863238T>C	ENST00000355661.3	-	9	738	c.728A>G	c.(727-729)tAt>tGt	p.Y243C	PLEKHA7_ENST00000531066.1_Missense_Mutation_p.Y243C|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.Y243C|PLEKHA7_ENST00000532079.1_Intron|RN7SKP90_ENST00000363013.1_RNA			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	243	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						GGAGCTGTTATAGATGAGCGC	0.557																																					p.Y243C		Atlas-SNP	.											.	PLEKHA7	120	.	0			c.A728G						.	T	CYS/TYR	0,4400		0,0,2200	69.0	59.0	63.0		728	1.4	0.9	11		63	4,8584	3.7+/-12.6	0,4,4290	yes	missense	PLEKHA7	NM_175058.4	194	0,4,6490	CC,CT,TT		0.0466,0.0,0.0308	possibly-damaging	243/1122	16863238	4,12984	2200	4294	6494	SO:0001583	missense	144100	exon9			CTGTTATAGATGA	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.728A>G	chr11.hg19:g.16863238T>C	ENSP00000347883:p.Tyr243Cys	49.0	0.0		37.0	16.0	NM_175058	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	hg19	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	T	10.40	1.340829	0.24339	0.0	4.66E-4	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080	T;T;T	0.06687	3.27;3.27;3.27	5.16	1.41	0.22369	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.441389	0.26820	N	0.022332	T	0.10165	0.0249	M	0.65975	2.015	0.42515	D	0.992983	B;B	0.14438	0.01;0.003	B;B	0.24701	0.055;0.017	T	0.07309	-1.0779	10	0.45353	T	0.12	-1.1366	6.856	0.24040	0.0:0.1435:0.4574:0.3992	.	243;243	E9PKC0;Q6IQ23	.;PKHA7_HUMAN	C	243	ENSP00000435389:Y243C;ENSP00000347883:Y243C;ENSP00000416895:Y243C	ENSP00000347883:Y243C	Y	-	2	0	PLEKHA7	16819814	1.000000	0.71417	0.856000	0.33681	0.496000	0.33645	1.744000	0.38268	0.120000	0.18254	0.528000	0.53228	TAT	.	T|0.999;C|0.001		0.557	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
API5	8539	hgsc.bcm.edu	37	11	43340327	43340327	+	Silent	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:43340327C>T	ENST00000531273.1	+	2	346	c.207C>T	c.(205-207)gaC>gaT	p.D69D	API5_ENST00000378852.3_Silent_p.D69D|API5_ENST00000420461.2_Intron|API5_ENST00000455725.2_Silent_p.D58D|API5_ENST00000534600.1_Silent_p.D69D|API5_ENST00000534695.1_Silent_p.D69D			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	69	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						CACAGTTAGACCTCTGTGAGG	0.373																																					p.D69D	Pancreas(1;98 122 5625 20895 49453)	Atlas-SNP	.											.	API5	91	.	0			c.C207T						.						115.0	109.0	111.0					11																	43340327		2203	4300	6503	SO:0001819	synonymous_variant	8539	exon2			GTTAGACCTCTGT	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.207C>T	chr11.hg19:g.43340327C>T		27.0	0.0		37.0	19.0	NM_006595	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Silent	SNP	ENST00000531273.1	hg19	CCDS44572.1																																																																																			.	.		0.373	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595	
SPCS2	9789	hgsc.bcm.edu	37	11	74687909	74687909	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:74687909G>A	ENST00000263672.6	+	5	541	c.502G>A	c.(502-504)Gac>Aac	p.D168N	SPCS2_ENST00000530257.1_Missense_Mutation_p.D99N|SPCS2_ENST00000528265.1_Intron|SPCS2_ENST00000526361.1_Missense_Mutation_p.D29N	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)	168					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			breast(1)	1						TAGGTTTGATGACAAATACAC	0.433																																					p.D168N		Atlas-SNP	.											.	SPCS2	17	.	0			c.G502A						.						73.0	72.0	72.0					11																	74687909		1896	4101	5997	SO:0001583	missense	9789	exon5			TTTGATGACAAAT	D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517	ENST00000263672.6:c.502G>A	chr11.hg19:g.74687909G>A	ENSP00000263672:p.Asp168Asn	367.0	0.0		316.0	110.0	NM_014752	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	Missense_Mutation	SNP	ENST00000263672.6	hg19	CCDS44681.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.850321	0.91277	.	.	ENSG00000118363	ENST00000263672;ENST00000530257;ENST00000526361;ENST00000532972	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.71459	0.3342	M	0.81942	2.565	0.80722	D	1	B	0.31256	0.316	B	0.37508	0.252	T	0.68142	-0.5487	9	0.21014	T	0.42	-6.1455	16.9363	0.86203	0.0:0.0:1.0:0.0	.	168	Q15005	SPCS2_HUMAN	N	168;99;29;199	.	ENSP00000263672:D168N	D	+	1	0	SPCS2	74365557	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.795000	0.91872	2.669000	0.90835	0.655000	0.94253	GAC	.	.		0.433	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384587.1	NM_014752	
ATM	472	hgsc.bcm.edu	37	11	108124684	108124684	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:108124684C>G	ENST00000452508.2	+	14	2231	c.2042C>G	c.(2041-2043)tCt>tGt	p.S681C	ATM_ENST00000278616.4_Missense_Mutation_p.S681C			Q13315	ATM_HUMAN	ATM serine/threonine kinase	681					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATTGGCTTCTCTGTCCACCAG	0.378			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.S681C		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.C2042G						.						108.0	103.0	104.0					11																	108124684		2201	4298	6499	SO:0001583	missense	472	exon13	Familial Cancer Database	AT, Louis-Bar syndrome	GCTTCTCTGTCCA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2042C>G	chr11.hg19:g.108124684C>G	ENSP00000388058:p.Ser681Cys	64.0	0.0		43.0	16.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.655540	0.47467	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.74842	-0.88;-0.88;-0.88	6.11	4.26	0.50523	Armadillo-type fold (1);	0.409334	0.27080	N	0.021030	T	0.69169	0.3081	L	0.60455	1.87	0.25419	N	0.988287	P	0.47106	0.89	B	0.43155	0.41	T	0.61153	-0.7120	10	0.36615	T	0.2	.	8.5886	0.33672	0.0:0.7667:0.0:0.2333	.	681	Q13315	ATM_HUMAN	C	681	ENSP00000435747:S681C;ENSP00000278616:S681C;ENSP00000388058:S681C	ENSP00000278616:S681C	S	+	2	0	ATM	107629894	1.000000	0.71417	0.996000	0.52242	0.780000	0.44128	1.270000	0.33086	0.922000	0.37019	0.655000	0.94253	TCT	.	.		0.378	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
C2CD2L	9854	hgsc.bcm.edu	37	11	118984970	118984970	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:118984970G>A	ENST00000528586.1	+	9	1118	c.1048G>A	c.(1048-1050)Gag>Aag	p.E350K	C2CD2L_ENST00000336702.3_Missense_Mutation_p.E603K			O14523	C2C2L_HUMAN	C2CD2-like	602						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						GGAAGCAGACGAGACAACCCG	0.587																																					p.E603K		Atlas-SNP	.											.	C2CD2L	39	.	0			c.G1807A						.						142.0	141.0	141.0					11																	118984970		2200	4295	6495	SO:0001583	missense	9854	exon13			GCAGACGAGACAA	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.1048G>A	chr11.hg19:g.118984970G>A	ENSP00000433600:p.Glu350Lys	89.0	0.0		60.0	28.0	NM_014807	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	hg19		.	.	.	.	.	.	.	.	.	.	G	34	5.340950	0.95783	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.54279	0.58;0.58	5.41	5.41	0.78517	.	0.101724	0.64402	D	0.000003	T	0.62490	0.2432	L	0.44542	1.39	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	P;P	0.61201	0.885;0.885	T	0.54159	-0.8335	10	0.24483	T	0.36	.	18.3582	0.90365	0.0:0.0:1.0:0.0	.	602;603	O14523;O14523-2	C2C2L_HUMAN;.	K	603;350	ENSP00000338885:E603K;ENSP00000433600:E350K	ENSP00000338885:E603K	E	+	1	0	C2CD2L	118490180	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.025000	0.93694	2.798000	0.96311	0.655000	0.94253	GAG	.	.		0.587	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000388199.2	NM_014807	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123477353	123477353	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:123477353G>C	ENST00000529750.1	+	10	1258	c.931G>C	c.(931-933)Gga>Cga	p.G311R	GRAMD1B_ENST00000450171.2_5'Flank|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.G311R|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.G318R	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	311						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GGCGCTGGAGGGAGACGGGTC	0.552																																					p.G311R		Atlas-SNP	.											.	GRAMD1B	122	.	0			c.G931C						.						39.0	43.0	42.0					11																	123477353		1966	4140	6106	SO:0001583	missense	57476	exon10			CTGGAGGGAGACG	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.931G>C	chr11.hg19:g.123477353G>C	ENSP00000436500:p.Gly311Arg	81.0	0.0		63.0	22.0	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	hg19	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215516	0.39102	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.28895	2.0;2.0;2.0;2.0;1.59	5.25	5.25	0.73442	.	0.374956	0.28011	N	0.016958	T	0.20210	0.0486	N	0.08118	0	0.38800	D	0.95518	B;P;B;B	0.36683	0.201;0.565;0.09;0.019	B;B;B;B	0.39419	0.054;0.299;0.024;0.011	T	0.12837	-1.0532	10	0.18276	T	0.48	.	17.8325	0.88687	0.0:0.0:1.0:0.0	.	271;318;311;318	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	R	318;318;311;311;271;307	ENSP00000402457:G318R;ENSP00000325628:G311R;ENSP00000436500:G311R;ENSP00000432987:G271R;ENSP00000434214:G307R	ENSP00000325628:G311R	G	+	1	0	GRAMD1B	122982563	1.000000	0.71417	0.941000	0.38009	0.938000	0.57974	2.353000	0.44089	2.437000	0.82529	0.462000	0.41574	GGA	.	.		0.552	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
ACRV1	56	hgsc.bcm.edu	37	11	125546342	125546342	+	Silent	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:125546342A>G	ENST00000533904.1	-	3	927	c.585T>C	c.(583-585)taT>taC	p.Y195Y	ACRV1_ENST00000345274.1_Intron|ACRV1_ENST00000348856.3_Silent_p.Y95Y|ACRV1_ENST00000530048.1_Silent_p.Y140Y|ACRV1_ENST00000425431.1_Silent_p.Y51Y|ACRV1_ENST00000353070.1_Intron|ACRV1_ENST00000453509.1_Silent_p.Y106Y|ACRV1_ENST00000527795.1_Silent_p.Y125Y|ACRV1_ENST00000445562.1_Silent_p.Y100Y|ACRV1_ENST00000315608.3_Silent_p.Y176Y			P26436	ASPX_HUMAN	acrosomal vesicle protein 1	195					multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				kidney(1)|large_intestine(3)|lung(2)	6	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		GATCATTCATATAAGCACATG	0.403																																					p.Y195Y		Atlas-SNP	.											.	ACRV1	21	.	0			c.T585C						.						142.0	137.0	139.0					11																	125546342		2201	4299	6500	SO:0001819	synonymous_variant	56	exon3			ATTCATATAAGCA	AK223335	CCDS8460.1, CCDS8461.1, CCDS44759.1, CCDS44761.1	11q24.2	2012-05-16			ENSG00000134940	ENSG00000134940			127	protein-coding gene	gene with protein product	"""sperm protein 10"""	102525				1693291, 8288254	Standard	NM_001612		Approved	SPACA2, SP-10, D11S4365	uc001qcs.3	P26436	OTTHUMG00000165854	ENST00000533904.1:c.585T>C	chr11.hg19:g.125546342A>G		69.0	0.0		64.0	30.0	NM_001612	Q53FF4	Silent	SNP	ENST00000533904.1	hg19	CCDS8460.1																																																																																			.	.		0.403	ACRV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386722.1	NM_001612	
FAR2	55711	hgsc.bcm.edu	37	12	29460716	29460716	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr12:29460716T>C	ENST00000536681.3	+	5	917	c.671T>C	c.(670-672)aTt>aCt	p.I224T	FAR2_ENST00000547116.1_Missense_Mutation_p.I127T|FAR2_ENST00000182377.4_Missense_Mutation_p.I224T|RP11-996F15.2_ENST00000553105.1_RNA	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	224					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						AACCTGAACATTGCCATCATA	0.488																																					p.I224T		Atlas-SNP	.											.	FAR2	60	.	0			c.T671C						.						101.0	95.0	97.0					12																	29460716		2203	4300	6503	SO:0001583	missense	55711	exon5			TGAACATTGCCAT	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.671T>C	chr12.hg19:g.29460716T>C	ENSP00000443291:p.Ile224Thr	65.0	0.0		56.0	25.0	NM_018099	F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	ENST00000536681.3	hg19	CCDS8717.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.338309	0.41398	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.21543	2.0;2.0;2.0	5.34	2.91	0.33838	NAD(P)-binding domain (1);Male sterility, NAD-binding (1);	0.332943	0.32231	N	0.006384	T	0.18593	0.0446	L	0.52759	1.655	0.32691	N	0.514192	B	0.18013	0.025	B	0.25759	0.063	T	0.10776	-1.0615	10	0.46703	T	0.11	-9.0932	6.4098	0.21684	0.0:0.0842:0.1586:0.7572	.	224	Q96K12	FACR2_HUMAN	T	224;224;127	ENSP00000443291:I224T;ENSP00000182377:I224T;ENSP00000449349:I127T	ENSP00000182377:I224T	I	+	2	0	FAR2	29351983	0.995000	0.38212	0.002000	0.10522	0.908000	0.53690	5.044000	0.64214	0.308000	0.22923	0.533000	0.62120	ATT	.	.		0.488	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099	
STAC3	246329	hgsc.bcm.edu	37	12	57642930	57642930	+	Silent	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr12:57642930C>T	ENST00000332782.2	-	3	429	c.228G>A	c.(226-228)gaG>gaA	p.E76E	STAC3_ENST00000554578.1_Silent_p.E37E|STAC3_ENST00000546246.2_Intron	NM_145064.1	NP_659501.1	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	76	Poly-Glu.				intracellular signal transduction (GO:0035556)|neuromuscular synaptic transmission (GO:0007274)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)		identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(2)|skin(1)	18						CTGGGGGTGGctcctcctcct	0.552																																					p.E76E		Atlas-SNP	.											.	STAC3	32	.	0			c.G228A						.						74.0	75.0	75.0					12																	57642930		2203	4300	6503	SO:0001819	synonymous_variant	246329	exon3			GGGTGGCTCCTCC	AK057013	CCDS8936.1, CCDS66405.1, CCDS66406.1	12q13.3	2014-08-12			ENSG00000185482	ENSG00000185482			28423	protein-coding gene	gene with protein product		615521				12477932	Standard	NM_001286257		Approved	MGC2793	uc009zpl.2	Q96MF2	OTTHUMG00000171271	ENST00000332782.2:c.228G>A	chr12.hg19:g.57642930C>T		55.0	0.0		42.0	19.0	NM_145064	B4DUK9|Q96HU5	Silent	SNP	ENST00000332782.2	hg19	CCDS8936.1																																																																																			.	.		0.552	STAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412724.2	NM_145064	
XPOT	11260	hgsc.bcm.edu	37	12	64813856	64813856	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr12:64813856C>T	ENST00000332707.5	+	7	1025	c.496C>T	c.(496-498)Cgt>Tgt	p.R166C		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	166	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TTAGGAGGCTCGTAGGAATAC	0.338																																					p.R166C		Atlas-SNP	.											.	XPOT	105	.	0			c.C496T						.						63.0	62.0	62.0					12																	64813856		2203	4300	6503	SO:0001583	missense	11260	exon7			GAGGCTCGTAGGA	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.496C>T	chr12.hg19:g.64813856C>T	ENSP00000327821:p.Arg166Cys	52.0	0.0		40.0	17.0	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	hg19	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570359	0.86542	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	T;T	0.44083	0.93;0.93	4.79	4.79	0.61399	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.050506	0.85682	D	0.000000	T	0.54029	0.1833	L	0.43152	1.355	0.80722	D	1	D	0.69078	0.997	P	0.60541	0.876	T	0.48948	-0.8989	9	.	.	.	.	18.7197	0.91688	0.0:1.0:0.0:0.0	.	166	O43592	XPOT_HUMAN	C	166	ENSP00000327821:R166C;ENSP00000383722:R166C	.	R	+	1	0	XPOT	63100123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.657000	0.83745	2.593000	0.87608	0.655000	0.94253	CGT	.	.		0.338	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
KBTBD6	89890	hgsc.bcm.edu	37	13	41705671	41705671	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr13:41705671G>C	ENST00000379485.1	-	1	1211	c.977C>G	c.(976-978)tCt>tGt	p.S326C	KBTBD6_ENST00000499385.2_Missense_Mutation_p.S260C	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	326										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		AGATACAAGAGAGTtgctgct	0.527																																					p.S326C		Atlas-SNP	.											.	KBTBD6	83	.	0			c.C977G						.						30.0	37.0	35.0					13																	41705671		2202	4280	6482	SO:0001583	missense	89890	exon1			ACAAGAGAGTTGC	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.977C>G	chr13.hg19:g.41705671G>C	ENSP00000368799:p.Ser326Cys	294.0	0.0		243.0	76.0	NM_152903	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	hg19	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	g	5.478	0.273208	0.10403	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.77877	-1.05;-1.13	3.73	1.85	0.25348	.	0.261034	0.25065	N	0.033407	T	0.64000	0.2559	L	0.36672	1.1	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.002	T	0.55373	-0.8151	10	0.56958	D	0.05	.	5.7702	0.18249	0.111:0.393:0.496:0.0	.	260;326	F5GZN7;Q86V97	.;KBTB6_HUMAN	C	326;260	ENSP00000368799:S326C;ENSP00000444326:S260C	ENSP00000368799:S326C	S	-	2	0	KBTBD6	40603671	0.448000	0.25681	0.186000	0.23195	0.905000	0.53344	1.070000	0.30653	0.323000	0.23307	0.462000	0.41574	TCT	.	.		0.527	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
HECTD1	25831	hgsc.bcm.edu	37	14	31576900	31576900	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr14:31576900A>G	ENST00000399332.1	-	37	6979	c.6491T>C	c.(6490-6492)tTa>tCa	p.L2164S	HECTD1_ENST00000553700.1_Missense_Mutation_p.L2164S	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2164	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTCTTCTCCTAAAAATTCAAC	0.353																																					p.L2164S		Atlas-SNP	.											.	HECTD1	159	.	0			c.T6491C						.						54.0	51.0	52.0					14																	31576900		1794	4068	5862	SO:0001583	missense	25831	exon37			TCTCCTAAAAATT	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6491T>C	chr14.hg19:g.31576900A>G	ENSP00000382269:p.Leu2164Ser	71.0	0.0		66.0	28.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.854|4.854	0.158828|0.158828	0.09236|0.09236	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332|ENST00000554882	T;T|.	0.43294|.	0.95;0.95|.	5.28|5.28	5.28|5.28	0.74379|0.74379	HECT (3);|.	0.317042|.	0.23389|.	U|.	0.048708|.	T|.	0.51092|.	0.1654|.	N|N	0.22421|0.22421	0.69|0.69	0.44587|0.44587	D|D	0.99755|0.99755	B|.	0.24186|.	0.099|.	B|.	0.14578|.	0.011|.	T|.	0.48175|.	-0.9058|.	10|.	0.32370|.	T|.	0.25|.	-7.9822|-7.9822	13.7825|13.7825	0.63091|0.63091	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2164|.	Q9ULT8|.	HECD1_HUMAN|.	S|Q	2164;2166;2164|530	ENSP00000450697:L2164S;ENSP00000382269:L2164S|.	ENSP00000261312:L2166S|.	L|X	-|-	2|1	0|0	HECTD1|HECTD1	30646651|30646651	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.375000|4.375000	0.59549|0.59549	1.996000|1.996000	0.58369|0.58369	0.482000|0.482000	0.46254|0.46254	TTA|TAG	.	.		0.353	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
PSEN1	5663	hgsc.bcm.edu	37	14	73678608	73678608	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr14:73678608G>C	ENST00000324501.5	+	10	1359	c.1087G>C	c.(1087-1089)Gaa>Caa	p.E363Q	PSEN1_ENST00000394164.1_Missense_Mutation_p.E359Q|PSEN1_ENST00000261970.3_Intron|PSEN1_ENST00000344094.3_3'UTR|PSEN1_ENST00000557511.1_Intron|PSEN1_ENST00000357710.4_Missense_Mutation_p.E359Q|PSEN1_ENST00000406768.1_Missense_Mutation_p.E271Q	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	363	Required for interaction with CTNNB1.				activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TGCTGTCCAGGAACTTTCCAG	0.493																																					p.E363Q		Atlas-SNP	.											.	PSEN1	38	.	0			c.G1087C						.						103.0	89.0	94.0					14																	73678608		2203	4300	6503	SO:0001583	missense	5663	exon10			GTCCAGGAACTTT	AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.1087G>C	chr14.hg19:g.73678608G>C	ENSP00000326366:p.Glu363Gln	109.0	0.0		106.0	39.0	NM_000021	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Missense_Mutation	SNP	ENST00000324501.5	hg19	CCDS9812.1	.	.	.	.	.	.	.	.	.	.	G	9.613	1.131676	0.21041	.	.	ENSG00000080815	ENST00000324501;ENST00000357710;ENST00000394164;ENST00000406768	D;D;D;D	0.99619	-6.28;-6.28;-6.28;-6.28	6.07	5.18	0.71444	.	0.209202	0.50627	D	0.000120	D	0.97390	0.9146	N	0.04994	-0.135	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.14578	0.003;0.011	D	0.95918	0.8928	10	0.23891	T	0.37	-5.9736	17.5556	0.87888	0.0:0.1235:0.8764:0.0	.	359;363	P49768-2;P49768	.;PSN1_HUMAN	Q	363;359;359;271	ENSP00000326366:E363Q;ENSP00000350342:E359Q;ENSP00000377719:E359Q;ENSP00000385948:E271Q	ENSP00000326366:E363Q	E	+	1	0	PSEN1	72748361	1.000000	0.71417	0.864000	0.33941	0.129000	0.20672	7.429000	0.80309	1.567000	0.49668	0.655000	0.94253	GAA	.	.		0.493	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280500.2		
TRIP11	9321	hgsc.bcm.edu	37	14	92488109	92488109	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr14:92488109C>T	ENST00000267622.4	-	4	752	c.379G>A	c.(379-381)Gct>Act	p.A127T		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	127					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		GACTGAGCAGCTGACTGCAGT	0.433			T	PDGFRB	AML																																p.A127T	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	184	.	0			c.G379A						.						84.0	83.0	83.0					14																	92488109		2203	4300	6503	SO:0001583	missense	9321	exon4			GAGCAGCTGACTG	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.379G>A	chr14.hg19:g.92488109C>T	ENSP00000267622:p.Ala127Thr	70.0	0.0		43.0	11.0	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	hg19	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	c	9.210	1.030589	0.19512	.	.	ENSG00000100815	ENST00000267622	T	0.66280	-0.2	5.2	4.31	0.51392	.	0.360535	0.28983	N	0.013510	T	0.55289	0.1911	M	0.61703	1.905	0.25971	N	0.982505	B	0.19935	0.04	B	0.24848	0.056	T	0.44205	-0.9343	10	0.18710	T	0.47	.	8.3773	0.32451	0.1543:0.7681:0.0:0.0776	.	127	Q15643	TRIPB_HUMAN	T	127	ENSP00000267622:A127T	ENSP00000267622:A127T	A	-	1	0	TRIP11	91557862	0.943000	0.32029	0.013000	0.15412	0.007000	0.05969	2.060000	0.41394	1.194000	0.43101	0.655000	0.94253	GCT	.	.		0.433	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
GABRB3	2562	hgsc.bcm.edu	37	15	26866602	26866602	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr15:26866602G>A	ENST00000311550.5	-	4	431	c.320C>T	c.(319-321)aCg>aTg	p.T107M	GABRB3_ENST00000299267.4_Missense_Mutation_p.T107M|GABRB3_ENST00000545868.1_Missense_Mutation_p.T22M|GABRB3_ENST00000400188.3_Missense_Mutation_p.T36M|GABRB3_ENST00000541819.2_Missense_Mutation_p.T163M	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	107					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATTGTCAAGCGTGAGGTTGAG	0.428																																					p.T107M		Atlas-SNP	.											.	GABRB3	338	.	0			c.C320T						.						105.0	102.0	103.0					15																	26866602		2203	4300	6503	SO:0001583	missense	2562	exon4			TCAAGCGTGAGGT		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.320C>T	chr15.hg19:g.26866602G>A	ENSP00000308725:p.Thr107Met	123.0	0.0		94.0	34.0	NM_021912	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	hg19	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.898193	0.91962	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868;ENST00000555094	T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	5.81	5.81	0.92471	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90848	0.7125	M	0.84156	2.68	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.996;0.998	D	0.91331	0.5090	10	0.72032	D	0.01	.	19.0679	0.93119	0.0:0.0:1.0:0.0	.	163;107;107	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	M	107;163;107;36;22;22	ENSP00000308725:T107M;ENSP00000442408:T163M;ENSP00000299267:T107M;ENSP00000383049:T36M;ENSP00000439169:T22M;ENSP00000452272:T22M	ENSP00000299267:T107M	T	-	2	0	GABRB3	24417695	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.669000	0.98622	2.752000	0.94435	0.467000	0.42956	ACG	.	.		0.428	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
KIF7	374654	hgsc.bcm.edu	37	15	90171679	90171679	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr15:90171679T>A	ENST00000394412.3	-	19	4079	c.4003A>T	c.(4003-4005)Atg>Ttg	p.M1335L	KIF7_ENST00000558928.1_Intron	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1335					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			ACATCAATCATCCCCGGGCTG	0.647																																					p.M1335L		Atlas-SNP	.											.	KIF7	130	.	0			c.A4003T						.						46.0	56.0	53.0					15																	90171679		2180	4250	6430	SO:0001583	missense	374654	exon19			CAATCATCCCCGG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.4003A>T	chr15.hg19:g.90171679T>A	ENSP00000377934:p.Met1335Leu	110.0	0.0		94.0	37.0	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	hg19	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	T	5.027	0.190690	0.09547	.	.	ENSG00000166813	ENST00000394412	T	0.66460	-0.21	5.59	5.59	0.84812	.	0.210318	0.49916	D	0.000133	T	0.52885	0.1762	L	0.27053	0.805	0.33303	D	0.565138	B;B	0.11235	0.004;0.0	B;B	0.10450	0.005;0.0	T	0.56360	-0.7992	10	0.12103	T	0.63	.	15.7488	0.77967	0.0:0.0:0.0:1.0	.	821;1335	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	L	1335	ENSP00000377934:M1335L	ENSP00000377934:M1335L	M	-	1	0	KIF7	87972683	0.974000	0.33945	0.939000	0.37840	0.219000	0.24729	3.512000	0.53407	2.128000	0.65567	0.379000	0.24179	ATG	.	.		0.647	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
DNAH3	55567	hgsc.bcm.edu	37	16	20966168	20966168	+	Missense_Mutation	SNP	C	C	T	rs142557616	byFrequency	TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr16:20966168C>T	ENST00000261383.3	-	55	11037	c.11038G>A	c.(11038-11040)Gtt>Att	p.V3680I	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3680	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCTTGAACAACGGCGTGGAAG	0.488																																					p.V3680I		Atlas-SNP	.											.	DNAH3	1142	.	0			c.G11038A						.						117.0	114.0	115.0					16																	20966168		2201	4300	6501	SO:0001583	missense	55567	exon55			GAACAACGGCGTG	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.11038G>A	chr16.hg19:g.20966168C>T	ENSP00000261383:p.Val3680Ile	95.0	0.0		75.0	32.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	8.672	0.903178	0.17760	.	.	ENSG00000158486	ENST00000261383	T	0.12147	2.71	5.43	0.641	0.17759	Dynein heavy chain (1);	0.227292	0.38837	N	0.001555	T	0.05593	0.0147	N	0.12182	0.205	0.38697	D	0.952906	B	0.06786	0.001	B	0.04013	0.001	T	0.42068	-0.9473	10	0.13108	T	0.6	.	6.1732	0.20429	0.0:0.3409:0.2323:0.4268	.	3680	Q8TD57	DYH3_HUMAN	I	3680	ENSP00000261383:V3680I	ENSP00000261383:V3680I	V	-	1	0	DNAH3	20873669	0.953000	0.32496	0.566000	0.28421	0.977000	0.68977	0.459000	0.21908	-0.158000	0.11040	-0.238000	0.12139	GTT	.	C|0.996;A|0.004		0.488	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
RBBP6	5930	hgsc.bcm.edu	37	16	24583618	24583618	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr16:24583618A>G	ENST00000319715.4	+	18	5663	c.5231A>G	c.(5230-5232)cAt>cGt	p.H1744R	RBBP6_ENST00000381039.3_Missense_Mutation_p.H904R|RBBP6_ENST00000348022.2_Missense_Mutation_p.H1710R	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1744					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		cataaaaagcataagaagcat	0.378																																					p.H1744R		Atlas-SNP	.											.	RBBP6	158	.	0			c.A5231G						.						35.0	32.0	33.0					16																	24583618		2193	4299	6492	SO:0001583	missense	5930	exon18			AAAAGCATAAGAA		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.5231A>G	chr16.hg19:g.24583618A>G	ENSP00000317872:p.His1744Arg	204.0	0.0		212.0	99.0	NM_006910	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	hg19	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	A	13.42	2.230965	0.39399	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.36340	1.26;1.68;1.61	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000002	T	0.42810	0.1219	N	0.14661	0.345	0.51012	D	0.9999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.997;0.994	T	0.34650	-0.9820	10	0.22706	T	0.39	-16.3606	16.3436	0.83110	1.0:0.0:0.0:0.0	.	904;1710;1744	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	R	904;1744;1710	ENSP00000370427:H904R;ENSP00000317872:H1744R;ENSP00000316291:H1710R	ENSP00000317872:H1744R	H	+	2	0	RBBP6	24491119	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.928000	0.87587	2.269000	0.75478	0.533000	0.62120	CAT	.	.		0.378	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
SNX20	124460	hgsc.bcm.edu	37	16	50707378	50707378	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr16:50707378C>T	ENST00000330943.4	-	4	1061	c.890G>A	c.(889-891)cGg>cAg	p.R297Q	RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000300590.3_Intron|SNX20_ENST00000423026.2_Intron|RP11-401P9.5_ENST00000570241.2_RNA	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	297					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						CGTGGGCCTCCGGAGCTGGCT	0.667																																					p.R297Q		Atlas-SNP	.											.	SNX20	50	.	0			c.G890A						.						39.0	43.0	42.0					16																	50707378		2193	4297	6490	SO:0001583	missense	124460	exon4			GGCCTCCGGAGCT	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.890G>A	chr16.hg19:g.50707378C>T	ENSP00000332062:p.Arg297Gln	72.0	0.0		58.0	25.0	NM_182854	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	hg19	CCDS10745.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378979	0.24944	.	.	ENSG00000167208	ENST00000330943;ENST00000413750	T	0.29655	1.56	5.67	2.22	0.28083	.	0.593626	0.16759	N	0.200718	T	0.20129	0.0484	L	0.38838	1.175	0.25478	N	0.987768	B	0.29037	0.231	B	0.18561	0.022	T	0.12656	-1.0539	10	0.26408	T	0.33	-34.8905	9.464	0.38802	0.0:0.683:0.0:0.317	.	297	Q7Z614	SNX20_HUMAN	Q	297;133	ENSP00000332062:R297Q	ENSP00000332062:R297Q	R	-	2	0	SNX20	49264879	0.017000	0.18338	0.728000	0.30774	0.891000	0.51852	0.564000	0.23563	0.761000	0.33130	0.561000	0.74099	CGG	.	.		0.667	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337	
IST1	9798	hgsc.bcm.edu	37	16	71961659	71961659	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr16:71961659A>C	ENST00000378799.6	+	10	1400	c.1044A>C	c.(1042-1044)gaA>gaC	p.E348D	IST1_ENST00000535424.1_Missense_Mutation_p.E361D|RP11-498D10.6_ENST00000573861.1_RNA|IST1_ENST00000538850.1_Missense_Mutation_p.E200D|IST1_ENST00000544564.1_Missense_Mutation_p.E348D|IST1_ENST00000329908.8_Missense_Mutation_p.K347T|IST1_ENST00000541571.2_Missense_Mutation_p.E348D|IST1_ENST00000538565.1_3'UTR|IST1_ENST00000378798.5_Missense_Mutation_p.E317D|RP11-498D10.5_ENST00000567146.1_RNA|PKD1L3_ENST00000534738.1_RNA|IST1_ENST00000606369.1_Missense_Mutation_p.E200D			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	346	Interaction with VPS4A, VTA1, MITD1 STAMBP and USP8.|Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										CAGCATCTGAAGACATTGACT	0.458																																					p.E361D		Atlas-SNP	.											.	.	.	.	0			c.A1083C						.						191.0	196.0	195.0					16																	71961659		2198	4300	6498	SO:0001583	missense	9798	exon11			ATCTGAAGACATT	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.1044A>C	chr16.hg19:g.71961659A>C	ENSP00000368076:p.Glu348Asp	61.0	0.0		53.0	28.0	NM_001270976	A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Missense_Mutation	SNP	ENST00000378799.6	hg19	CCDS59272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.69|12.69	2.012321|2.012321	0.35511|0.35511	.|.	.|.	ENSG00000182149|ENSG00000182149	ENST00000535424;ENST00000378799;ENST00000538963;ENST00000538850;ENST00000378798;ENST00000456820|ENST00000329908	.|.	.|.	.|.	5.44|5.44	-0.794|-0.794	0.10918|0.10918	.|.	0.044330|.	0.85682|.	D|.	0.000000|.	T|T	0.50701|0.50701	0.1631|0.1631	.|.	.|.	.|.	0.53688|0.53688	D|D	0.999972|0.999972	B;B;B|B	0.16166|0.06786	0.009;0.016;0.012|0.001	B;B;B|B	0.14578|0.08055	0.005;0.011;0.007|0.003	T|T	0.46857|0.46857	-0.9161|-0.9161	8|7	0.02654|0.87932	T|D	1|0	-30.4029|-30.4029	10.4073|10.4073	0.44272|0.44272	0.6556:0.0:0.3444:0.0|0.6556:0.0:0.3444:0.0	.|.	346;317;361|347	P53990;P53990-2;A8KAH5|P53990-3	IST1_HUMAN;.;.|.	D|T	361;348;337;200;317;271|347	.|.	ENSP00000368075:E317D|ENSP00000330408:K347T	E|K	+|+	3|2	2|0	KIAA0174|KIAA0174	70519160|70519160	0.985000|0.985000	0.35326|0.35326	0.997000|0.997000	0.53966|0.53966	0.998000|0.998000	0.95712|0.95712	0.308000|0.308000	0.19314|0.19314	-0.057000|-0.057000	0.13199|0.13199	0.528000|0.528000	0.53228|0.53228	GAA|AAG	.	.		0.458	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761	
ZNF469	84627	hgsc.bcm.edu	37	16	88495895	88495895	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr16:88495895G>A	ENST00000437464.1	+	1	2017	c.2017G>A	c.(2017-2019)Gca>Aca	p.A673T	ZNF469_ENST00000565624.1_Missense_Mutation_p.A673T	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	673	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCTTTTCCCGCAGATGGGCT	0.716																																					p.A673T		Atlas-SNP	.											.	ZNF469	121	.	0			c.G2017A						.						3.0	3.0	3.0					16																	88495895		620	1465	2085	SO:0001583	missense	84627	exon1			TTTCCCGCAGATG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.2017G>A	chr16.hg19:g.88495895G>A	ENSP00000402343:p.Ala673Thr	252.0	0.0		195.0	18.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	8.293	0.818160	0.16607	.	.	ENSG00000225614	ENST00000437464	T	0.04862	3.54	4.34	-8.68	0.00859	.	.	.	.	.	T	0.01905	0.0060	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.12156	0.007	T	0.42447	-0.9451	9	0.07990	T	0.79	.	2.7656	0.05319	0.2527:0.1012:0.445:0.2012	.	673	Q96JG9	ZN469_HUMAN	T	673	ENSP00000402343:A673T	ENSP00000402343:A673T	A	+	1	0	ZNF469	87023396	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.915000	0.01578	-2.051000	0.00904	-0.373000	0.07131	GCA	.	.		0.716	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
C17orf74	201243	hgsc.bcm.edu	37	17	7329876	7329876	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:7329876A>G	ENST00000333870.3	+	3	640	c.566A>G	c.(565-567)gAc>gGc	p.D189G	C17orf74_ENST00000574034.1_Silent_p.G76G|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	189						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				GAGGAGGAGGACAACCTGCCC	0.592																																					p.D189G		Atlas-SNP	.											.	C17orf74	56	.	0			c.A566G						.						135.0	141.0	139.0					17																	7329876		2006	4156	6162	SO:0001583	missense	201243	exon3			AGGAGGACAACCT	BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.566A>G	chr17.hg19:g.7329876A>G	ENSP00000328061:p.Asp189Gly	70.0	0.0		30.0	20.0	NM_175734		Missense_Mutation	SNP	ENST00000333870.3	hg19	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	A	11.44	1.638689	0.29157	.	.	ENSG00000184560	ENST00000333870	T	0.42900	0.96	4.1	3.0	0.34707	.	1.675350	0.04018	N	0.299310	T	0.33381	0.0861	L	0.27053	0.805	0.09310	N	0.999999	B	0.11235	0.004	B	0.11329	0.006	T	0.27739	-1.0065	10	0.62326	D	0.03	-13.998	6.4414	0.21851	0.8863:0.0:0.1137:0.0	.	189	Q0P670	CQ074_HUMAN	G	189	ENSP00000328061:D189G	ENSP00000328061:D189G	D	+	2	0	C17orf74	7270600	0.053000	0.20554	0.003000	0.11579	0.006000	0.05464	2.006000	0.40874	0.707000	0.31934	0.402000	0.26972	GAC	.	.		0.592	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2	NM_175734	
KRBA2	124751	hgsc.bcm.edu	37	17	8272535	8272535	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:8272535C>A	ENST00000331336.2	-	2	1401	c.1396G>T	c.(1396-1398)Gat>Tat	p.D466Y	RP11-849F2.7_ENST00000582471.1_3'UTR|KRBA2_ENST00000396267.1_Missense_Mutation_p.D384Y|RP11-849F2.5_ENST00000580537.1_RNA|RP11-849F2.5_ENST00000583963.1_RNA	NM_213597.2	NP_998762.1	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	466					DNA integration (GO:0015074)|regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(2)|kidney(2)|large_intestine(7)|lung(5)|stomach(1)|urinary_tract(1)	18						TCGTCCATATCAGATCTGTCT	0.493																																					p.D466Y		Atlas-SNP	.											.	KRBA2	34	.	0			c.G1396T						.						157.0	141.0	146.0					17																	8272535		2203	4300	6503	SO:0001583	missense	124751	exon2			CCATATCAGATCT	BC024723	CCDS11141.1	17p13.1	2013-01-08	2006-08-15		ENSG00000184619	ENSG00000184619		"""-"""	26989	protein-coding gene	gene with protein product			"""KRAB A domain containing 2"""			12477932	Standard	NM_213597		Approved		uc002glf.1	Q6ZNG9	OTTHUMG00000132864	ENST00000331336.2:c.1396G>T	chr17.hg19:g.8272535C>A	ENSP00000328017:p.Asp466Tyr	101.0	0.0		36.0	25.0	NM_213597	Q8IYY0	Missense_Mutation	SNP	ENST00000331336.2	hg19	CCDS11141.1	.	.	.	.	.	.	.	.	.	.	c	8.382	0.837844	0.16891	.	.	ENSG00000184619	ENST00000396267;ENST00000331336	T;T	0.27256	1.75;1.68	2.78	2.78	0.32641	.	.	.	.	.	T	0.42810	0.1219	L	0.57536	1.79	0.09310	N	1	D	0.89917	1.0	D	0.68621	0.959	T	0.09185	-1.0686	9	0.72032	D	0.01	.	9.2674	0.37650	0.0:1.0:0.0:0.0	.	466	Q6ZNG9	KRBA2_HUMAN	Y	384;466	ENSP00000379565:D384Y;ENSP00000328017:D466Y	ENSP00000328017:D466Y	D	-	1	0	KRBA2	8213260	0.043000	0.20138	0.008000	0.14137	0.121000	0.20230	1.093000	0.30939	1.875000	0.54330	0.650000	0.86243	GAT	.	.		0.493	KRBA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256338.1	NM_213597	
ZNF286B	729288	hgsc.bcm.edu	37	17	18566384	18566384	+	Silent	SNP	C	C	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:18566384C>A	ENST00000545289.1	-	5	685	c.435G>T	c.(433-435)cgG>cgT	p.R145R	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						AGACACTATTCCGTGTCAGTC	0.413																																					p.R145R		Atlas-SNP	.											.	ZNF286B	75	.	0			c.G435T						.						114.0	101.0	105.0					17																	18566384		692	1590	2282	SO:0001819	synonymous_variant	729288	exon5			ACTATTCCGTGTC		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.435G>T	chr17.hg19:g.18566384C>A		253.0	1.0		111.0	78.0	NM_001145045		Silent	SNP	ENST00000545289.1	hg19	CCDS58523.1																																																																																			.	.		0.413	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047	
SLC13A2	9058	hgsc.bcm.edu	37	17	26817351	26817351	+	Intron	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:26817351T>A	ENST00000314669.5	+	3	651				SLC13A2_ENST00000537681.1_5'UTR|SLC13A2_ENST00000444914.3_Missense_Mutation_p.S86R|SLC13A2_ENST00000545060.1_Intron	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2						dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	TTCCATCCAGTTTCGAGAGCC	0.517																																					p.S86R		Atlas-SNP	.											.	SLC13A2	125	.	0			c.T258A						.						17.0	19.0	18.0					17																	26817351		692	1591	2283	SO:0001627	intron_variant	9058	exon3			ATCCAGTTTCGAG	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.232-121T>A	chr17.hg19:g.26817351T>A		81.0	0.0		157.0	29.0	NM_001145975	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	hg19	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	T	6.504	0.461280	0.12342	.	.	ENSG00000007216	ENST00000444914	T	0.67345	-0.26	3.83	-1.71	0.08133	.	.	.	.	.	T	0.34890	0.0913	N	0.08118	0	0.09310	N	0.999998	B	0.33413	0.411	B	0.33454	0.164	T	0.21484	-1.0244	9	0.16896	T	0.51	.	0.6745	0.00864	0.3255:0.106:0.1844:0.3841	.	86	E7ETH5	.	R	86	ENSP00000392411:S86R	ENSP00000392411:S86R	S	+	3	2	SLC13A2	23841478	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.177000	0.16801	-0.472000	0.06881	0.528000	0.53228	AGT	.	.		0.517	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984	
KRT20	54474	hgsc.bcm.edu	37	17	39034466	39034466	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:39034466A>G	ENST00000167588.3	-	6	1111	c.1070T>C	c.(1069-1071)cTt>cCt	p.L357P		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	357	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				CTTTATGTCAAGAAGGATATG	0.473																																					p.L357P		Atlas-SNP	.											.	KRT20	38	.	0			c.T1070C						.						290.0	243.0	259.0					17																	39034466		2203	4300	6503	SO:0001583	missense	54474	exon6			ATGTCAAGAAGGA	BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.1070T>C	chr17.hg19:g.39034466A>G	ENSP00000167588:p.Leu357Pro	102.0	0.0		136.0	21.0	NM_019010	B2R6W7	Missense_Mutation	SNP	ENST00000167588.3	hg19	CCDS11379.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.679389	0.68042	.	.	ENSG00000171431	ENST00000167588	D	0.93488	-3.23	5.0	5.0	0.66597	Filament (1);	0.243433	0.28996	N	0.013462	D	0.97892	0.9307	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99312	1.0904	10	0.87932	D	0	.	14.6964	0.69124	1.0:0.0:0.0:0.0	.	357	P35900	K1C20_HUMAN	P	357	ENSP00000167588:L357P	ENSP00000167588:L357P	L	-	2	0	KRT20	36287992	1.000000	0.71417	0.982000	0.44146	0.467000	0.32768	5.988000	0.70579	1.873000	0.54277	0.482000	0.46254	CTT	.	.		0.473	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257202.2		
NME2	4831	hgsc.bcm.edu	37	17	49247317	49247317	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:49247317T>C	ENST00000393193.2	+	7	670	c.593T>C	c.(592-594)gTg>gCg	p.V198A	NME1-NME2_ENST00000514264.2_Missense_Mutation_p.V83A|NME1-NME2_ENST00000393183.3_Missense_Mutation_p.V8A|NME1-NME2_ENST00000393198.3_Missense_Mutation_p.V198A|NME1-NME2_ENST00000503064.1_Missense_Mutation_p.V83A|NME1-NME2_ENST00000608447.1_Missense_Mutation_p.V223A|NME1-NME2_ENST00000513177.1_Missense_Mutation_p.V83A|NME1-NME2_ENST00000512737.1_Missense_Mutation_p.V83A|NME1-NME2_ENST00000393190.1_Missense_Mutation_p.V83A|NME2_ENST00000376392.6_Intron|NME1-NME2_ENST00000393185.1_Missense_Mutation_p.V8A|NME2_ENST00000555572.1_Missense_Mutation_p.V223A			P22392	NDKB_HUMAN	NME/NM23 nucleoside diphosphate kinase 2	83					cell adhesion (GO:0007155)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of apoptotic process (GO:0043066)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside triphosphate biosynthetic process (GO:0009142)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|UTP biosynthetic process (GO:0006228)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)|protein histidine kinase activity (GO:0004673)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)		Adefovir Dipivoxil(DB00718)|Lamivudine(DB00709)|Tenofovir(DB00300)	GGGCTGAACGTGGTGAAGACA	0.517																																					p.V198A	Esophageal Squamous(49;809 1203 4404 15246)	Atlas-SNP	.											.	NME1-NME2	17	.	0			c.T593C						.						111.0	102.0	105.0					17																	49247317		2203	4300	6503	SO:0001583	missense	654364	exon7			TGAACGTGGTGAA	X58965	CCDS11580.1, CCDS74107.1	17q21.33	2013-04-29	2012-05-18		ENSG00000011052	ENSG00000011052			7850	protein-coding gene	gene with protein product		156491	"""non-metastatic cells 2, protein (NM23B) expressed in"""			1988104, 19852809	Standard	NM_001018137		Approved	NM23-H2, NDPKB		P22392	OTTHUMG00000154062	ENST00000393193.2:c.593T>C	chr17.hg19:g.49247317T>C	ENSP00000376889:p.Val198Ala	79.0	0.0		188.0	32.0	NM_001018136	A8MWA3|Q1WM23|Q6LCT6	Missense_Mutation	SNP	ENST00000393193.2	hg19	CCDS32682.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.555218	0.45487	.	.	ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000243678;ENSG00000243678	ENST00000376392;ENST00000555572;ENST00000514264;ENST00000393185;ENST00000513177;ENST00000512737;ENST00000503064;ENST00000393183;ENST00000393190;ENST00000393193;ENST00000393198	T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	4.92	4.92	0.64577	.	0.096714	0.40554	U	0.001068	T	0.38719	0.1051	N	0.11560	0.145	0.58432	D	0.999992	B;P	0.36733	0.026;0.567	B;P	0.46110	0.161;0.504	T	0.37430	-0.9706	10	0.35671	T	0.21	-13.2897	14.552	0.68073	0.0:0.0:0.0:1.0	.	83;223	P22392;Q32Q12	NDKB_HUMAN;.	A	198;223;83;8;83;83;83;8;83;198;223	ENSP00000451932:V223A;ENSP00000426976:V83A;ENSP00000376882:V8A;ENSP00000425581:V83A;ENSP00000421064:V83A;ENSP00000426901:V83A;ENSP00000376880:V8A;ENSP00000376886:V83A;ENSP00000376889:V198A	ENSP00000365572:V83A	V	+	2	0	NME2;NME1-NME2	46602316	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.921000	0.56454	1.975000	0.57531	0.482000	0.46254	GTG	.	.		0.517	NME2-001	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000268664.2	NM_002512	
USH1G	124590	hgsc.bcm.edu	37	17	72916457	72916457	+	Silent	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr17:72916457G>A	ENST00000319642.1	-	2	656	c.474C>T	c.(472-474)caC>caT	p.H158H		NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	158					equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					CCATGCGTTCGTGGTGCCTCC	0.692																																					p.H158H		Atlas-SNP	.											.	USH1G	40	.	0			c.C474T						.						63.0	45.0	51.0					17																	72916457		2203	4299	6502	SO:0001819	synonymous_variant	124590	exon2			GCGTTCGTGGTGC	AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.474C>T	chr17.hg19:g.72916457G>A		55.0	0.0		90.0	14.0	NM_173477	Q8N251	Silent	SNP	ENST00000319642.1	hg19	CCDS32725.1																																																																																			.	.		0.692	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443676.1	NM_173477	
LAMA1	284217	hgsc.bcm.edu	37	18	7008502	7008502	+	Silent	SNP	C	C	A	rs374423781		TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr18:7008502C>A	ENST00000389658.3	-	28	4200	c.4107G>T	c.(4105-4107)gtG>gtT	p.V1369V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1369	Laminin EGF-like 14; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATGAGAATCCCACAGTGCCAG	0.453																																					p.V1369V		Atlas-SNP	.											.	LAMA1	458	.	0			c.G4107T						.	C		1,4405	2.1+/-5.4	0,1,2202	103.0	91.0	95.0		4107	-5.0	0.0	18		95	0,8600		0,0,4300	no	coding-synonymous	LAMA1	NM_005559.3		0,1,6502	AA,AC,CC		0.0,0.0227,0.0077		1369/3076	7008502	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	284217	exon28			GAATCCCACAGTG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4107G>T	chr18.hg19:g.7008502C>A		67.0	0.0		69.0	31.0	NM_005559		Silent	SNP	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.		0.453	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ZNF397	84307	hgsc.bcm.edu	37	18	32825455	32825455	+	Silent	SNP	T	T	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr18:32825455T>A	ENST00000330501.7	+	4	939	c.786T>A	c.(784-786)gcT>gcA	p.A262A	ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000261333.6_Intron|ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000592264.1_Intron	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	262					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						ATGATGAGGCTGAAAGATGCT	0.423																																					p.A262A		Atlas-SNP	.											.	ZNF397	51	.	0			c.T786A						.						80.0	73.0	75.0					18																	32825455		692	1591	2283	SO:0001819	synonymous_variant	84307	exon4			TGAGGCTGAAAGA	BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.786T>A	chr18.hg19:g.32825455T>A		94.0	0.0		105.0	24.0	NM_001135178	Q9BRM2	Silent	SNP	ENST00000330501.7	hg19	CCDS45852.1																																																																																			.	.		0.423	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442398.1	NM_032347	
PLPPR3	79948	hgsc.bcm.edu	37	19	813158	813158	+	Silent	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:813158G>A	ENST00000520876.3	-	8	1647	c.1569C>T	c.(1567-1569)gcC>gcT	p.A523A	LPPR3_ENST00000359894.2_Silent_p.A551A|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		523						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										CGCTCTTCTCGGCCATCATGA	0.756																																					p.A551A		Atlas-SNP	.											.	.	.	.	0			c.C1653T						.																																			SO:0001819	synonymous_variant	0	exon7			CTTCTCGGCCATC																												ENST00000520876.3:c.1569C>T	chr19.hg19:g.813158G>A		30.0	0.0		28.0	6.0	NM_024888	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	ENST00000520876.3	hg19	CCDS58636.1																																																																																			.	.		0.756	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
MBD3L1	85509	hgsc.bcm.edu	37	19	8953470	8953470	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:8953470T>C	ENST00000595891.1	+	3	347	c.116T>C	c.(115-117)gTa>gCa	p.V39A	MBD3L1_ENST00000305625.2_Missense_Mutation_p.V39A			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	39	Transcription repressor.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						AAGAGGCCAGTAACGAGAATT	0.502																																					p.V39A		Atlas-SNP	.											.	MBD3L1	24	.	0			c.T116C						.						127.0	113.0	118.0					19																	8953470		2203	4300	6503	SO:0001583	missense	85509	exon1			GGCCAGTAACGAG	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.116T>C	chr19.hg19:g.8953470T>C	ENSP00000471575:p.Val39Ala	157.0	0.0		116.0	53.0	NM_145208	B5BUM6|Q2M291	Missense_Mutation	SNP	ENST00000595891.1	hg19	CCDS12209.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.093751	0.36952	.	.	ENSG00000170948	ENST00000305625	T	0.68331	-0.32	3.92	3.92	0.45320	.	0.160194	0.25065	N	0.033405	T	0.76219	0.3957	M	0.86097	2.795	0.48040	D	0.999572	D	0.62365	0.991	P	0.54174	0.744	T	0.80120	-0.1515	10	0.87932	D	0	-16.7206	9.4528	0.38736	0.0:0.0:0.0:1.0	.	39	Q8WWY6	MB3L1_HUMAN	A	39	ENSP00000304198:V39A	ENSP00000304198:V39A	V	+	2	0	MBD3L1	8814470	0.982000	0.34865	0.445000	0.26908	0.100000	0.18952	2.980000	0.49321	1.990000	0.58119	0.533000	0.62120	GTA	.	.		0.502	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459973.1	NM_145208	
STX10	8677	hgsc.bcm.edu	37	19	13260405	13260405	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:13260405T>C	ENST00000587230.1	-	3	272	c.208A>G	c.(208-210)Ata>Gta	p.I70V	IER2_ENST00000587885.1_5'Flank|STX10_ENST00000589083.1_Missense_Mutation_p.I70V|STX10_ENST00000242770.5_Missense_Mutation_p.I70V|IER2_ENST00000588173.1_5'Flank|IER2_ENST00000292433.3_5'Flank|STX10_ENST00000343587.5_Missense_Mutation_p.I70V	NM_001271609.1	NP_001258538.1	O60499	STX10_HUMAN	syntaxin 10	70					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|kidney(1)|lung(2)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GCTTCCACTATACGTGGGCTG	0.622																																					p.I70V		Atlas-SNP	.											.	STX10	12	.	0			c.A208G						.						69.0	72.0	71.0					19																	13260405		2203	4300	6503	SO:0001583	missense	8677	exon3			CCACTATACGTGG	AF035531	CCDS32922.1, CCDS62569.1, CCDS62570.1, CCDS62571.1	19p13.13	2008-07-22				ENSG00000104915			11428	protein-coding gene	gene with protein product		603765				9446797	Standard	NM_003765		Approved	hsyn10, SYN10	uc021upq.2	O60499		ENST00000587230.1:c.208A>G	chr19.hg19:g.13260405T>C	ENSP00000466298:p.Ile70Val	86.0	0.0		72.0	26.0	NM_003765	A6NC41|Q6IAP4|Q96AE8	Missense_Mutation	SNP	ENST00000587230.1	hg19	CCDS32922.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.295183	0.60086	.	.	ENSG00000104915	ENST00000343587;ENST00000242770;ENST00000440593	.	.	.	3.35	3.35	0.38373	t-SNARE (1);Syntaxin 6, N-terminal (1);	0.000000	0.64402	U	0.000004	T	0.71341	0.3328	M	0.74258	2.255	0.50313	D	0.999867	P	0.44139	0.827	P	0.60789	0.879	T	0.68172	-0.5479	9	0.10377	T	0.69	.	10.3814	0.44115	0.0:0.0:0.0:1.0	.	70	O60499	STX10_HUMAN	V	70	.	ENSP00000242770:I70V	I	-	1	0	STX10	13121405	1.000000	0.71417	0.207000	0.23584	0.911000	0.54048	5.059000	0.64306	1.773000	0.52216	0.460000	0.39030	ATA	.	.		0.622	STX10-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452918.1	NM_003765	
ZNF100	163227	hgsc.bcm.edu	37	19	21909720	21909720	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:21909720G>A	ENST00000358296.6	-	5	1592	c.1394C>T	c.(1393-1395)gCc>gTc	p.A465V	ZNF100_ENST00000305570.6_Missense_Mutation_p.A401V	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						CCGGTTAAAGGCTTTGCCACA	0.413																																					p.A465V		Atlas-SNP	.											.	ZNF100	62	.	0			c.C1394T						.																																			SO:0001583	missense	163227	exon5			TTAAAGGCTTTGC	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.1394C>T	chr19.hg19:g.21909720G>A	ENSP00000351042:p.Ala465Val	62.0	0.0		33.0	15.0	NM_173531	Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	hg19	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	13.08	2.130618	0.37630	.	.	ENSG00000197020	ENST00000358296	T	0.19105	2.17	0.867	0.867	0.19085	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16085	0.0387	N	0.04508	-0.205	0.20638	N	0.999872	P;P	0.45902	0.825;0.868	P;P	0.55087	0.58;0.768	T	0.16305	-1.0407	9	0.54805	T	0.06	.	6.2611	0.20901	0.0:0.5619:0.4381:0.0	.	465;519	Q8IYN0;Q4G131	ZN100_HUMAN;.	V	465	ENSP00000351042:A465V	ENSP00000351042:A465V	A	-	2	0	ZNF100	21701560	0.000000	0.05858	0.882000	0.34594	0.881000	0.50899	-1.282000	0.02799	0.284000	0.22305	0.289000	0.19496	GCC	.	.		0.413	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	
ZNF284	342909	hgsc.bcm.edu	37	19	44590539	44590539	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:44590539A>G	ENST00000421176.3	+	5	1124	c.908A>G	c.(907-909)aAt>aGt	p.N303S	RNU6-902P_ENST00000517212.1_RNA|ZNF223_ENST00000591793.1_3'UTR	NM_001037813.2	NP_001032902.1	Q2VY69	ZN284_HUMAN	zinc finger protein 284	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0435)				TCAAATCTTAATAGGCATTCC	0.393																																					p.N303S		Atlas-SNP	.											.	ZNF284	38	.	0			c.A908G						.						85.0	88.0	87.0					19																	44590539		2144	4279	6423	SO:0001583	missense	342909	exon5			ATCTTAATAGGCA	AY166789	CCDS46099.1	19q13.32	2013-01-08				ENSG00000186026		"""Zinc fingers, C2H2-type"", ""-"""	13078	protein-coding gene	gene with protein product						12743021	Standard	NM_001037813		Approved	DKFZp781F1775	uc002oyg.1	Q2VY69		ENST00000421176.3:c.908A>G	chr19.hg19:g.44590539A>G	ENSP00000411032:p.Asn303Ser	64.0	0.0		53.0	21.0	NM_001037813	Q86WM1	Missense_Mutation	SNP	ENST00000421176.3	hg19	CCDS46099.1	.	.	.	.	.	.	.	.	.	.	A	9.259	1.042708	0.19748	.	.	ENSG00000186026	ENST00000421176	T	0.17054	2.3	2.59	-0.103	0.13609	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12774	0.0310	N	0.11892	0.195	0.09310	N	1	D	0.55605	0.972	P	0.54629	0.757	T	0.21143	-1.0254	9	0.25751	T	0.34	.	4.2442	0.10663	0.5439:0.286:0.0:0.1701	.	303	Q2VY69	ZN284_HUMAN	S	303	ENSP00000411032:N303S	ENSP00000411032:N303S	N	+	2	0	ZNF284	49282379	0.000000	0.05858	0.001000	0.08648	0.601000	0.36947	-5.001000	0.00161	0.183000	0.20059	0.379000	0.24179	AAT	.	.		0.393	ZNF284-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460473.1	NM_001037813	
SIX5	147912	hgsc.bcm.edu	37	19	46271365	46271366	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:46271365_46271366GC>AA	ENST00000317578.6	-	1	1118_1119	c.737_738GC>TT	c.(736-738)aGC>aTT	p.S246I	SIX5_ENST00000560168.1_Nonsense_Mutation_p.45_46QQ>H*|AC074212.6_ENST00000590076.1_RNA|AC074212.6_ENST00000591530.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.6_ENST00000586251.1_RNA|AC074212.6_ENST00000586498.1_RNA|AC074212.5_ENST00000559756.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	246					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		TGAACCAGTTGCTGACCTGCGT	0.728																																					p.S246S|p.S246I		Atlas-SNP	.											.	SIX5	35	.	0			c.C738T|c.G737T						.																																			SO:0001583	missense	147912	exon1			CCAGTTGCTGACC|CAGTTGCTGACCT	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.737_738delinsAA	chr19.hg19:g.46271365_46271366delinsAA	ENSP00000316842:p.Ser246Ile	53.0|55.0	0.0		35.0	13.0	NM_175875		Silent|Missense_Mutation	SNP	ENST00000317578.6	hg19	CCDS12673.1																																																																																			.	.		0.728	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417341.3	NM_175875	
ADRA1D	146	hgsc.bcm.edu	37	20	4202607	4202607	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr20:4202607G>A	ENST00000379453.4	-	2	1398	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C		NM_000678.3	NP_000669.1	P25100	ADA1D_HUMAN	adrenoceptor alpha 1D	428	Poly-Arg.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			endometrium(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	14					Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CAGAGAGGGCGGCGGCGCCGG	0.741																																					p.R428C		Atlas-SNP	.											.	ADRA1D	36	.	0			c.C1282T						.						3.0	4.0	3.0					20																	4202607		1757	3584	5341	SO:0001583	missense	146	exon2			GAGGGCGGCGGCG	U03864	CCDS13079.1	20p13	2012-08-08	2012-05-09		ENSG00000171873	ENSG00000171873		"""GPCR / Class A : Adrenoceptors : alpha"""	280	protein-coding gene	gene with protein product		104219	"""adrenergic, alpha-1D-, receptor"""			8039425	Standard	NM_000678		Approved	ADRA1R, ADRA1A, ADRA1	uc002wkr.2	P25100	OTTHUMG00000031779	ENST00000379453.4:c.1282C>T	chr20.hg19:g.4202607G>A	ENSP00000368766:p.Arg428Cys	62.0	0.0		45.0	19.0	NM_000678	Q9NPY0	Missense_Mutation	SNP	ENST00000379453.4	hg19	CCDS13079.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882873	0.72410	.	.	ENSG00000171873	ENST00000379453	T	0.38560	1.13	4.1	4.1	0.47936	.	1.869330	0.03293	U	0.187910	T	0.63908	0.2551	M	0.68593	2.085	0.39665	D	0.970662	D	0.89917	1.0	P	0.58928	0.848	T	0.50285	-0.8846	10	0.59425	D	0.04	.	14.1472	0.65357	0.0:0.0:1.0:0.0	.	428	P25100	ADA1D_HUMAN	C	428	ENSP00000368766:R428C	ENSP00000368766:R428C	R	-	1	0	ADRA1D	4150607	0.996000	0.38824	0.967000	0.41034	0.975000	0.68041	3.156000	0.50708	1.953000	0.56701	0.585000	0.79938	CGC	.	.		0.741	ADRA1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077812.2	NM_000678	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47605200	47605200	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr20:47605200G>A	ENST00000371917.4	+	18	2533		c.e18+1			NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)						endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ACTAAGCAGAGTAAGGTCTAA	0.323																																					.	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.2533+1G>A						.						59.0	57.0	58.0					20																	47605200		2203	4298	6501	SO:0001630	splice_region_variant	10564	exon18			AGCAGAGTAAGGT	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.2533+1G>A	chr20.hg19:g.47605200G>A		211.0	0.0		178.0	62.0	NM_006420	Q5TFT9|Q9NTS1	Splice_Site	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915324	0.92178	.	.	ENSG00000124198	ENST00000371917	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARFGEF2	47038607	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.568000	0.98166	2.873000	0.98535	0.563000	0.77884	.	.	.		0.323	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	Intron
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46020913	46020913	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr21:46020913T>C	ENST00000380102.2	+	1	417	c.392T>C	c.(391-393)gTg>gCg	p.V131A	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	131	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GTGTACTGTGTGCCTGTCTGC	0.627																																					p.V126A		Atlas-SNP	.											.	KRTAP10-7	41	.	0			c.T377C						.						179.0	173.0	175.0					21																	46020913		2188	4300	6488	SO:0001583	missense	386675	exon2			ACTGTGTGCCTGT	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.392T>C	chr21.hg19:g.46020913T>C	ENSP00000369445:p.Val131Ala	96.0	0.0		70.0	27.0	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	hg19		.	.	.	.	.	.	.	.	.	.	N	0.006	-2.046656	0.00398	.	.	ENSG00000205441	ENST00000380102	T	0.01335	5.0	3.96	-7.91	0.01165	.	.	.	.	.	T	0.01222	0.0040	L	0.58810	1.83	0.09310	N	1	B	0.25441	0.126	B	0.19666	0.026	T	0.50642	-0.8804	9	0.09338	T	0.73	.	3.2367	0.06767	0.099:0.3258:0.3261:0.2491	.	126	P60409-2	.	A	131	ENSP00000369445:V131A	ENSP00000369445:V131A	V	+	2	0	KRTAP10-7	44845341	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-6.391000	0.00004	-1.621000	0.00791	GTG	.	.		0.627	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
HIRA	7290	hgsc.bcm.edu	37	22	19373215	19373215	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr22:19373215C>T	ENST00000263208.5	-	12	1414	c.1158G>A	c.(1156-1158)atG>atA	p.M386I	HIRA_ENST00000340170.4_Missense_Mutation_p.M386I|HIRA_ENST00000541063.1_Missense_Mutation_p.M342I|HIRA_ENST00000546308.1_Missense_Mutation_p.M342I	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	386					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GGGCCTCGGTCATGATGGCTA	0.592																																					p.M386I		Atlas-SNP	.											.	HIRA	100	.	0			c.G1158A						.						100.0	80.0	86.0					22																	19373215		2203	4300	6503	SO:0001583	missense	7290	exon12			CTCGGTCATGATG	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1158G>A	chr22.hg19:g.19373215C>T	ENSP00000263208:p.Met386Ile	68.0	0.0		80.0	26.0	NM_003325	Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	hg19	CCDS13759.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687048	0.29962	.	.	ENSG00000100084	ENST00000340170;ENST00000263208;ENST00000541063;ENST00000546308	T;T;T;T	0.70749	-0.28;-0.51;-0.35;-0.3	5.65	5.65	0.86999	.	0.095099	0.64402	D	0.000002	T	0.54532	0.1864	L	0.29908	0.895	0.80722	D	1	B;B;B	0.32467	0.052;0.372;0.031	B;B;B	0.25140	0.008;0.058;0.003	T	0.51260	-0.8728	10	0.17369	T	0.5	-32.0471	13.1248	0.59349	0.0:0.9278:0.0:0.0721	.	342;386;386	F5H4M2;P54198-2;P54198	.;.;HIRA_HUMAN	I	386;386;342;342	ENSP00000345350:M386I;ENSP00000263208:M386I;ENSP00000446073:M342I;ENSP00000441870:M342I	ENSP00000263208:M386I	M	-	3	0	HIRA	17753215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.740000	0.47418	2.941000	0.99782	0.655000	0.94253	ATG	.	.		0.592	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
BCR	613	hgsc.bcm.edu	37	22	23632562	23632562	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr22:23632562T>C	ENST00000305877.8	+	14	3495	c.2744T>C	c.(2743-2745)gTc>gCc	p.V915A	BCR_ENST00000359540.3_Missense_Mutation_p.V915A	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	915	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TTTCTGAATGTCATCGTCCAC	0.547			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""						OREG0026390	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V915A		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	74	.	0			c.T2744C						.						230.0	221.0	224.0					22																	23632562		2203	4300	6503	SO:0001583	missense	613	exon14			TGAATGTCATCGT		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2744T>C	chr22.hg19:g.23632562T>C	ENSP00000303507:p.Val915Ala	71.0	0.0	765	73.0	27.0	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	hg19	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489246	0.84962	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;D	0.86627	0.32;-2.15	4.47	3.41	0.39046	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.063066	0.64402	N	0.000007	D	0.90631	0.7062	M	0.67953	2.075	0.80722	D	1	D;D;D	0.60575	0.976;0.966;0.988	D;P;D	0.67382	0.913;0.872;0.951	D	0.88532	0.3103	10	0.39692	T	0.17	.	9.9686	0.41741	0.0:0.0838:0.0:0.9162	.	504;915;915	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	A	915;915;580	ENSP00000303507:V915A;ENSP00000352535:V915A	ENSP00000303507:V915A	V	+	2	0	BCR	21962562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.057000	0.71119	0.777000	0.33496	0.529000	0.55759	GTC	.	.		0.547	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
SREBF2	6721	hgsc.bcm.edu	37	22	42269979	42269979	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr22:42269979A>G	ENST00000361204.4	+	5	1211	c.1045A>G	c.(1045-1047)Aaa>Gaa	p.K349E		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	349	Interaction with LMNA. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CATCAATGACAAAATCATCGA	0.483																																					p.K349E		Atlas-SNP	.											.	SREBF2	99	.	0			c.A1045G						.						89.0	76.0	80.0					22																	42269979		2203	4300	6503	SO:0001583	missense	6721	exon5			AATGACAAAATCA	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1045A>G	chr22.hg19:g.42269979A>G	ENSP00000354476:p.Lys349Glu	196.0	0.0		220.0	52.0	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	hg19	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	A	35	5.449729	0.96205	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	D	0.98075	-4.7	6.17	6.17	0.99709	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	M	0.72576	2.205	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.99744	1.1016	10	0.72032	D	0.01	-13.3427	16.8222	0.85835	1.0:0.0:0.0:0.0	.	349	Q12772	SRBP2_HUMAN	E	349	ENSP00000354476:K349E	ENSP00000354476:K349E	K	+	1	0	SREBF2	40599925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.329000	0.96413	2.371000	0.80710	0.533000	0.62120	AAA	.	.		0.483	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
CHIC1	53344	hgsc.bcm.edu	37	X	72783217	72783217	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chrX:72783217T>C	ENST00000373502.5	+	1	174	c.97T>C	c.(97-99)Tcg>Ccg	p.S33P	MAP2K4P1_ENST00000602584.1_RNA|CHIC1_ENST00000373504.6_Missense_Mutation_p.S33P	NM_001039840.2	NP_001034929.2	Q5VXU3	CHIC1_HUMAN	cysteine-rich hydrophobic domain 1	33	Ser-rich.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(2)	4	Renal(35;0.156)					gtcgtcgccgtcgtcgtcgtc	0.602																																					p.S33P		Atlas-SNP	.											.	CHIC1	13	.	0			c.T97C						.						25.0	13.0	17.0					X																	72783217		2126	4135	6261	SO:0001583	missense	53344	exon1			TCGCCGTCGTCGT	Y11897	CCDS35335.2, CCDS75993.1	Xq13.2	2008-05-14			ENSG00000204116	ENSG00000204116			1934	protein-coding gene	gene with protein product		300922				9321471, 11257495	Standard	NM_001039840		Approved	BRX	uc004ebk.4	Q5VXU3	OTTHUMG00000021835	ENST00000373502.5:c.97T>C	chrX.hg19:g.72783217T>C	ENSP00000362601:p.Ser33Pro	104.0	0.0		98.0	4.0	NM_001039840	A0PJZ2|B0QZ87|B9EGS5|Q5CZ84	Missense_Mutation	SNP	ENST00000373502.5	hg19	CCDS35335.2	.	.	.	.	.	.	.	.	.	.	T	15.34	2.804045	0.50315	.	.	ENSG00000204116	ENST00000373502;ENST00000373504	.	.	.	4.12	-3.13	0.05266	.	0.853808	0.09342	N	0.815269	T	0.15435	0.0372	N	0.08118	0	0.23314	N	0.997926	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.20940	-1.0260	9	0.40728	T	0.16	-5.6818	5.0909	0.14708	0.1852:0.5222:0.0:0.2927	.	33;33;33	B7Z3I1;Q5VXU3-2;Q5VXU3	.;.;CHIC1_HUMAN	P	33	.	ENSP00000362601:S33P	S	+	1	0	CHIC1	72699942	1.000000	0.71417	0.954000	0.39281	0.919000	0.55068	0.811000	0.27198	-0.283000	0.09115	0.345000	0.21793	TCG	.	.		0.602	CHIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057233.3		
IFI30	10437	hgsc.bcm.edu	37	19	18284678	18284678	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:18284678delC	ENST00000407280.3	+	1	202	c.27delC	c.(25-27)ttcfs	p.F9fs	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	9					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						TTctgctgttcctgccaccgc	0.637																																					p.F9fs		Atlas-INDEL	.											.	IFI30	12	.	0			c.26delT						.						15.0	18.0	17.0					19																	18284678		2041	3945	5986	SO:0001589	frameshift_variant	10437	exon1			.	J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.27delC	chr19.hg19:g.18284678delC	ENSP00000384886:p.Phe9fs	42.0	0.0		35.0	20.0	NM_006332	Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Frame_Shift_Del	DEL	ENST00000407280.3	hg19	CCDS46015.1																																																																																			.	.		0.637	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466396.3	NM_006332	
USP2	9099	hgsc.bcm.edu	37	11	119243702	119243707	+	In_Frame_Del	DEL	GGGGTC	GGGGTC	-			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	GGGGTC	GGGGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:119243702_119243707delGGGGTC	ENST00000260187.2	-	2	778_783	c.484_489delGACCCC	c.(484-489)gaccccdel	p.DP162del	RP11-334E6.3_ENST00000530918.2_RNA|USP2_ENST00000455332.2_Intron	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	162	Necessary for interaction with MDM4.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CCAGGTTCCTGGGGTCTATCCGGTAG	0.641																																					p.162_164del		Atlas-INDEL	.											.	USP2	71	.	0			c.485_490del						.																																			SO:0001651	inframe_deletion	9099	exon2			.	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.484_489delGACCCC	chr11.hg19:g.119243702_119243707delGGGGTC	ENSP00000260187:p.Asp162_Pro163del	71.0	0.0		56.0	20.0	NM_004205	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	In_Frame_Del	DEL	ENST00000260187.2	hg19	CCDS8422.1																																																																																			.	.		0.641	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
FARSA	2193	hgsc.bcm.edu	37	19	13035721	13035740	+	Frame_Shift_Del	DEL	CTGGGCAAGGCGGTAGAGCG	CTGGGCAAGGCGGTAGAGCG	-	rs35087277|rs201276620	byFrequency	TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	CTGGGCAAGGCGGTAGAGCG	CTGGGCAAGGCGGTAGAGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr19:13035721_13035740delCTGGGCAAGGCGGTAGAGCG	ENST00000314606.4	-	9	1022_1041	c.1004_1023delCGCTCTACCGCCTTGCCCAG	c.(1003-1023)gcgctctaccgccttgcccagfs	p.ALYRLAQ335fs	FARSA_ENST00000588025.1_Frame_Shift_Del_p.ALYRLAQ375fs|FARSA_ENST00000423140.2_Frame_Shift_Del_p.ALYRLAQ304fs	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	335					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	ACCGCACCTTCTGGGCAAGGCGGTAGAGCGCACGGGCGCT	0.623																																					p.335_342del		Atlas-INDEL	.											.	FARSA	46	.	0			c.1005_1024del						.																																			SO:0001589	frameshift_variant	2193	exon9			.	U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.1004_1023delCGCTCTACCGCCTTGCCCAG	chr19.hg19:g.13035721_13035740delCTGGGCAAGGCGGTAGAGCG	ENSP00000320309:p.Ala335fs	103.0	0.0		89.0	31.0	NM_004461	B4E363|Q9NSD8|Q9Y4W8	Frame_Shift_Del	DEL	ENST00000314606.4	hg19	CCDS12287.1																																																																																			.	.		0.623	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461	
GPR144	347088	hgsc.bcm.edu	37	9	127217400	127217406	+	Splice_Site	DEL	CCGTGAA	CCGTGAA	-	rs540077227|rs527753414	byFrequency	TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	CCGTGAA	CCGTGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr9:127217400_127217406delCCGTGAA	ENST00000334810.1	+	7	1443_1449	c.1443_1449delCCGTGAA	c.(1441-1449)ctccgtgaa>ct	p.LRE481fs				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	481					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GGCTCTCCCTCCGTGAAGTGAGGCTGG	0.628																																					p.481_483del		Atlas-INDEL	.											.	GPR144	33	.	0			c.1442_1448del						.																																			SO:0001630	splice_region_variant	347088	exon7			.	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.1449+1CCGTGAA>-	chr9.hg19:g.127217400_127217406delCCGTGAA		47.0	0.0		38.0	15.0	NM_001161808	Q86SL4|Q8NH12	Frame_Shift_Del	DEL	ENST00000334810.1	hg19	CCDS48016.1																																																																																			.	.		0.628	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	Frame_Shift_Del
REST	5978	hgsc.bcm.edu	37	4	57796354	57796355	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr4:57796354_57796355insA	ENST00000309042.7	+	4	1644_1645	c.1330_1331insA	c.(1330-1332)gaafs	p.E444fs		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	444	Lys-rich.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					TATTACCAATGAAAAAACAGAA	0.337																																					p.E444fs		Atlas-INDEL	.											.	REST	104	.	0			c.1330_1331insA						.																																			SO:0001589	frameshift_variant	5978	exon4			.	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.1336dupA	chr4.hg19:g.57796360_57796360dupA	ENSP00000311816:p.Glu444fs	236.0	0.0		185.0	84.0	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Frame_Shift_Ins	INS	ENST00000309042.7	hg19	CCDS3509.1																																																																																			.	.		0.337	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
JAM3	83700	hgsc.bcm.edu	37	11	134018452	134018452	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:134018452delC	ENST00000299106.4	+	7	882	c.723delC	c.(721-723)aacfs	p.N241fs	JAM3_ENST00000529443.2_Frame_Shift_Del_p.N286fs|JAM3_ENST00000441717.3_Frame_Shift_Del_p.N190fs|NCAPD3_ENST00000526787.2_5'Flank			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	241					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		ATGACCTGAACATTGGCGGAA	0.502																																					p.N241fs		Atlas-INDEL	.											.	JAM3	41	.	0			c.722delA						.						75.0	71.0	73.0					11																	134018452		2201	4297	6498	SO:0001589	frameshift_variant	83700	exon7			.	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.723delC	chr11.hg19:g.134018452delC	ENSP00000299106:p.Asn241fs	128.0	0.0		103.0	48.0	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Frame_Shift_Del	DEL	ENST00000299106.4	hg19	CCDS8494.2																																																																																			.	.		0.502	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
DEAF1	10522	hgsc.bcm.edu	37	11	694962	694988	+	In_Frame_Del	DEL	GCCGCCGCCGCCACAGCGGCCGCGGCC	GCCGCCGCCGCCACAGCGGCCGCGGCC	-			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	GCCGCCGCCGCCACAGCGGCCGCGGCC	GCCGCCGCCGCCACAGCGGCCGCGGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr11:694962_694988delGCCGCCGCCGCCACAGCGGCCGCGGCC	ENST00000382409.3	-	1	544_570	c.60_86delGGCCGCGGCCGCTGTGGCGGCGGCGGC	c.(58-87)gcggccgcggccgctgtggcggcggcggcc>gcc	p.20_29AAAAAVAAAA>A	TMEM80_ENST00000397512.3_5'Flank|TMEM80_ENST00000608174.1_5'Flank|DEAF1_ENST00000338675.6_In_Frame_Del_p.20_29AAAAAVAAAA>A|TMEM80_ENST00000397510.3_5'Flank	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	20	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		cgcggccgcggccgccgccgccacagcggccgcggccgccaccgccg	0.78																																					p.21_29del		Atlas-INDEL	.											DEAF1,NS,carcinoma,0,1	DEAF1	47	.	0			c.61_87del						.																																			SO:0001651	inframe_deletion	10522	exon1			.	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.60_86delGGCCGCGGCCGCTGTGGCGGCGGCGGC	chr11.hg19:g.694962_694988delGCCGCCGCCGCCACAGCGGCCGCGGCC	ENSP00000371846:p.Ala20_Ala28del	18.0	0.0		14.0	13.0	NM_021008	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	In_Frame_Del	DEL	ENST00000382409.3	hg19	CCDS31327.1																																																																																			.	.		0.780	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383614.3	NM_021008	
TEP1	7011	hgsc.bcm.edu	37	14	20851711	20851711	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACJ-01A-11D-A40R-10	TCGA-DD-AACJ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23475083-0f7f-4acb-a446-f65a896c9c60	a29286c8-285a-4358-9bcc-357f531707af	g.chr14:20851711delG	ENST00000262715.5	-	26	3843	c.3803delC	c.(3802-3804)gctfs	p.A1268fs	TEP1_ENST00000556935.1_Frame_Shift_Del_p.A1160fs|TEP1_ENST00000545983.1_5'Flank	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1268	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TAACCTATCAGCCCCATCGAT	0.587																																					p.A1268fs		Atlas-INDEL	.											.	TEP1	224	.	0			c.3804delT						.						68.0	65.0	66.0					14																	20851711		2203	4300	6503	SO:0001589	frameshift_variant	7011	exon26			.		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3803delC	chr14.hg19:g.20851711delG	ENSP00000262715:p.Ala1268fs	100.0	0.0		94.0	43.0	NM_007110	A0AUV9	Frame_Shift_Del	DEL	ENST00000262715.5	hg19	CCDS9548.1																																																																																			.	.		0.587	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
