#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2236002	2236002	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:2236002A>T	ENST00000378536.4	+	5	1817	c.1745A>T	c.(1744-1746)cAg>cTg	p.Q582L		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	582					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		GCAGCCCTGCAGGCCAAGCGC	0.652																																					p.Q582L	Ovarian(177;144 1678 13697 20086 27838 40755)	Atlas-SNP	.											.	SKI	33	.	0			c.A1745T						.						21.0	15.0	17.0					1																	2236002		2175	4268	6443	SO:0001583	missense	6497	exon5			CCCTGCAGGCCAA	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1745A>T	chr1.hg19:g.2236002A>T	ENSP00000367797:p.Gln582Leu	67.0	0.0		83.0	14.0	NM_003036	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	hg19	CCDS39.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959431	0.74016	.	.	ENSG00000157933	ENST00000378536	D	0.96491	-4.03	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	D	0.97387	0.9145	M	0.71581	2.175	0.46096	D	0.998868	D	0.60160	0.987	D	0.67725	0.953	D	0.97887	1.0295	10	0.87932	D	0	-21.6274	12.8803	0.58014	1.0:0.0:0.0:0.0	.	582	P12755	SKI_HUMAN	L	582	ENSP00000367797:Q582L	ENSP00000367797:Q582L	Q	+	2	0	SKI	2225862	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.457000	0.73505	1.823000	0.53134	0.459000	0.35465	CAG	.	.		0.652	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
SLC45A1	50651	hgsc.bcm.edu	37	1	8384424	8384424	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:8384424A>T	ENST00000471889.1	+	2	420	c.35A>T	c.(34-36)gAt>gTt	p.D12V	SLC45A1_ENST00000377479.2_Missense_Mutation_p.D46V|SLC45A1_ENST00000289877.8_Missense_Mutation_p.D12V			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	12					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCCGGGAGATGCCCTCTTC	0.667																																					p.D12V		Atlas-SNP	.											.	SLC45A1	85	.	0			c.A35T						.						44.0	52.0	49.0					1																	8384424		2203	4298	6501	SO:0001583	missense	50651	exon1			CGGGAGATGCCCT	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.35A>T	chr1.hg19:g.8384424A>T	ENSP00000418096:p.Asp12Val	82.0	0.0		79.0	19.0	NM_001080397	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	hg19	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	A	9.349	1.064929	0.20067	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	T;T;T	0.20881	2.04;2.09;2.04	4.32	4.32	0.51571	.	0.380726	0.26780	N	0.022534	T	0.15435	0.0372	L	0.27053	0.805	0.58432	D	0.999999	B	0.27559	0.181	B	0.28011	0.085	T	0.05852	-1.0860	10	0.59425	D	0.04	-15.6051	9.9293	0.41512	0.8153:0.1847:0.0:0.0	.	12	Q9Y2W3	S45A1_HUMAN	V	12;46;12	ENSP00000418096:D12V;ENSP00000366699:D46V;ENSP00000289877:D12V	ENSP00000289877:D12V	D	+	2	0	SLC45A1	8307011	1.000000	0.71417	0.930000	0.37139	0.050000	0.14768	6.453000	0.73488	1.732000	0.51606	0.482000	0.46254	GAT	.	.		0.667	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5		
EXOSC10	5394	hgsc.bcm.edu	37	1	11142771	11142771	+	Silent	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:11142771T>C	ENST00000376936.4	-	10	1303	c.1254A>G	c.(1252-1254)caA>caG	p.Q418Q	EXOSC10_ENST00000485606.1_5'Flank|EXOSC10_ENST00000304457.7_Silent_p.Q418Q|EXOSC10_ENST00000544779.1_Silent_p.Q418Q	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	418					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CCAGCTGATATTGCTTGTTTG	0.463																																					p.Q418Q	Colon(179;105 1987 14326 27364 29542)	Atlas-SNP	.											.	EXOSC10	59	.	0			c.A1254G						.						194.0	176.0	182.0					1																	11142771		2203	4300	6503	SO:0001819	synonymous_variant	5394	exon10			CTGATATTGCTTG	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1254A>G	chr1.hg19:g.11142771T>C		101.0	0.0		122.0	22.0	NM_001001998	B1AKQ0|B1AKQ1|Q15158	Silent	SNP	ENST00000376936.4	hg19	CCDS30584.1																																																																																			.	.		0.463	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
LRRC38	126755	hgsc.bcm.edu	37	1	13839491	13839491	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:13839491A>T	ENST00000376085.3	-	1	1052	c.598T>A	c.(598-600)Tgg>Agg	p.W200R	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	200	LRRCT.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TCCTGGATCCAGGAGAAGAGG	0.706																																					p.W200R		Atlas-SNP	.											.	LRRC38	12	.	0			c.T598A						.																																			SO:0001583	missense	126755	exon1			GGATCCAGGAGAA	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.598T>A	chr1.hg19:g.13839491A>T	ENSP00000365253:p.Trp200Arg	146.0	0.0		153.0	35.0	NM_001010847	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	hg19	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.328444	0.81690	.	.	ENSG00000162494	ENST00000376085	T	0.02446	4.29	4.96	4.96	0.65561	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.19644	0.0472	M	0.91038	3.17	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.02179	-1.1200	10	0.87932	D	0	.	13.4711	0.61283	1.0:0.0:0.0:0.0	.	200	Q5VT99	LRC38_HUMAN	R	200	ENSP00000365253:W200R	ENSP00000365253:W200R	W	-	1	0	LRRC38	13712078	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.938000	0.75904	1.852000	0.53769	0.443000	0.29094	TGG	.	.		0.706	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
NBPF3	84224	hgsc.bcm.edu	37	1	21799874	21799874	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:21799874G>T	ENST00000318249.5	+	7	1086	c.736G>T	c.(736-738)Gag>Tag	p.E246*	NBPF3_ENST00000342104.5_Splice_Site_p.E246*|NBPF3_ENST00000454000.2_Splice_Site_p.E176*|NBPF3_ENST00000318220.6_Splice_Site_p.E190*	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	246	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCTCATCAGGGAGGTGCAGAA	0.522																																					p.L246F		Atlas-SNP	.											.	NBPF3	55	.	0			c.C736T						.						131.0	129.0	130.0					1																	21799874		2203	4300	6503	SO:0001630	splice_region_variant	84224	exon7			ATCAGGGAGGTGC	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.735-1G>T	chr1.hg19:g.21799874G>T		90.0	0.0		133.0	39.0	NM_001256416	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	hg19	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	36	5.890999	0.97074	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000417552;ENST00000342104;ENST00000434838	.	.	.	0.9	0.9	0.19278	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	5.1902	0.15205	0.0:0.0:1.0:0.0	.	.	.	.	X	176;190;246;190;246;190	.	ENSP00000316739:E190X	E	+	1	0	NBPF3	21672461	0.456000	0.25744	0.001000	0.08648	0.029000	0.11900	0.257000	0.18369	0.810000	0.34279	0.184000	0.17185	GAG	.	.		0.522	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	Nonsense_Mutation
CLSPN	63967	hgsc.bcm.edu	37	1	36226433	36226433	+	Missense_Mutation	SNP	T	T	A	rs78526448		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:36226433T>A	ENST00000318121.3	-	8	1146	c.1089A>T	c.(1087-1089)aaA>aaT	p.K363N	CLSPN_ENST00000251195.5_Missense_Mutation_p.K363N|CLSPN_ENST00000520551.1_Missense_Mutation_p.K363N|CLSPN_ENST00000373220.3_Missense_Mutation_p.K363N	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	363					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCTCAGAACCTTTACTATGGT	0.383																																					p.K363N		Atlas-SNP	.											.	CLSPN	248	.	0			c.A1089T						.						92.0	93.0	93.0					1																	36226433		2201	4299	6500	SO:0001583	missense	63967	exon8			AGAACCTTTACTA	AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.1089A>T	chr1.hg19:g.36226433T>A	ENSP00000312995:p.Lys363Asn	34.0	0.0		40.0	7.0	NM_001190481	A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	ENST00000318121.3	hg19	CCDS396.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.578559	0.46006	.	.	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551;ENST00000544356	T;T;T;T	0.26067	1.76;1.76;1.81;1.82	5.51	3.08	0.35506	.	0.572927	0.20109	N	0.099056	T	0.27384	0.0672	L	0.57536	1.79	0.09310	N	1	P;P	0.52316	0.763;0.952	B;P	0.46659	0.387;0.523	T	0.09862	-1.0655	10	0.48119	T	0.1	-16.7277	6.6832	0.23131	0.0:0.0781:0.1537:0.7682	.	363;363	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	N	363	ENSP00000251195:K363N;ENSP00000312995:K363N;ENSP00000362317:K363N;ENSP00000428848:K363N	ENSP00000251195:K363N	K	-	3	2	CLSPN	35999020	0.064000	0.20934	0.918000	0.36340	0.397000	0.30659	1.359000	0.34113	0.928000	0.37168	0.482000	0.46254	AAA	.	.		0.383	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377857.1	NM_022111	
MSH4	4438	hgsc.bcm.edu	37	1	76378494	76378494	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:76378494A>G	ENST00000263187.3	+	20	2837	c.2733A>G	c.(2731-2733)atA>atG	p.I911M		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	911					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						GTTTACGAATATATTTAAGTA	0.378								Mismatch excision repair (MMR)																													p.I911M		Atlas-SNP	.											.	MSH4	147	.	0			c.A2733G						.						53.0	56.0	55.0					1																	76378494		2203	4300	6503	SO:0001583	missense	4438	exon20			ACGAATATATTTA	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2733A>G	chr1.hg19:g.76378494A>G	ENSP00000263187:p.Ile911Met	149.0	0.0		156.0	34.0	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	hg19	CCDS670.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382745	0.25031	.	.	ENSG00000057468	ENST00000263187	D	0.87179	-2.22	5.22	-2.95	0.05564	.	0.652627	0.16419	N	0.215234	T	0.47414	0.1444	N	0.04508	-0.205	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.50566	-0.8813	10	0.42905	T	0.14	-15.5076	6.0029	0.19531	0.5169:0.2278:0.2553:0.0	.	911	O15457	MSH4_HUMAN	M	911	ENSP00000263187:I911M	ENSP00000263187:I911M	I	+	3	3	MSH4	76151082	0.644000	0.27277	0.359000	0.25824	0.867000	0.49689	0.056000	0.14256	-0.151000	0.11176	0.383000	0.25322	ATA	.	.		0.378	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
LPHN2	23266	hgsc.bcm.edu	37	1	82456641	82456641	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:82456641A>T	ENST00000370728.1	+	25	4837	c.4192A>T	c.(4192-4194)Agg>Tgg	p.R1398W	LPHN2_ENST00000370727.1_Missense_Mutation_p.R1370W|LPHN2_ENST00000359929.3_Missense_Mutation_p.R1342W|LPHN2_ENST00000271029.4_Missense_Mutation_p.R1370W|LPHN2_ENST00000319517.6_Missense_Mutation_p.R1342W|LPHN2_ENST00000370730.1_Missense_Mutation_p.R1355W|LPHN2_ENST00000394879.1_Missense_Mutation_p.R1400W|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000370723.1_Missense_Mutation_p.R1400W|LPHN2_ENST00000335786.5_Missense_Mutation_p.R1355W|LPHN2_ENST00000370721.1_Missense_Mutation_p.R1323W|LPHN2_ENST00000370717.2_Missense_Mutation_p.R1413W|LPHN2_ENST00000370725.1_Missense_Mutation_p.R1413W|LPHN2_ENST00000370715.1_3'UTR|LPHN2_ENST00000469377.2_3'UTR			O95490	LPHN2_HUMAN	latrophilin 2	1398					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CTCTCCCTCCAGGAGGAGTGA	0.498																																					p.R1342W		Atlas-SNP	.											.	LPHN2	464	.	0			c.A4024T						.						74.0	70.0	71.0					1																	82456641		2203	4300	6503	SO:0001583	missense	23266	exon20			CCCTCCAGGAGGA	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.4192A>T	chr1.hg19:g.82456641A>T	ENSP00000359763:p.Arg1398Trp	99.0	0.0		98.0	18.0	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.99|16.99	3.274967|3.274967	0.59649|0.59649	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000402328|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.70045	.|-0.42;-0.45;-0.43;-0.38;-0.39;-0.34;-0.39;-0.39;-0.39;-0.34;-0.38;-0.43	5.15|5.15	-4.79|-4.79	0.03200|0.03200	.|.	.|0.207171	.|0.39615	.|N	.|0.001305	T|T	0.58963|0.58963	0.2159|0.2159	L|L	0.29908|0.29908	0.895|0.895	0.37418|0.37418	D|D	0.913513|0.913513	.|D;D	.|0.65815	.|0.995;0.992	.|P;P	.|0.60173	.|0.87;0.868	T|T	0.70346|0.70346	-0.4897|-0.4897	5|10	.|0.72032	.|D	.|0.01	.|.	20.2633|20.2633	0.98458|0.98458	0.2505:0.7495:0.0:0.0|0.2505:0.7495:0.0:0.0	.|.	.|1342;322	.|O95490-2;B3KVU1	.|.;.	L|W	409|1323;1398;1355;1370;1413;1400;1342;1342;1413;1400;1370;1355	.|ENSP00000359756:R1323W;ENSP00000359763:R1398W;ENSP00000359765:R1355W;ENSP00000359762:R1370W;ENSP00000359760:R1413W;ENSP00000359758:R1400W;ENSP00000353006:R1342W;ENSP00000322270:R1342W;ENSP00000359752:R1413W;ENSP00000378344:R1400W;ENSP00000271029:R1370W;ENSP00000337306:R1355W	.|ENSP00000271029:R1370W	Q|R	+|+	2|1	0|2	LPHN2|LPHN2	82229229|82229229	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.997000|0.997000	0.91878|0.91878	1.551000|1.551000	0.36233|0.36233	-0.309000|-0.309000	0.08779|0.08779	0.459000|0.459000	0.35465|0.35465	CAG|AGG	.	.		0.498	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
RPAP2	79871	hgsc.bcm.edu	37	1	92846304	92846304	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:92846304A>T	ENST00000610020.1	+	12	1821	c.1712A>T	c.(1711-1713)cAg>cTg	p.Q571L		NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	571					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		CTTGGCATTCAGAAACATTCT	0.383																																					p.Q571L		Atlas-SNP	.											.	RPAP2	48	.	0			c.A1712T						.						131.0	134.0	133.0					1																	92846304		2203	4300	6503	SO:0001583	missense	79871	exon12			GCATTCAGAAACA	AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1712A>T	chr1.hg19:g.92846304A>T	ENSP00000476948:p.Gln571Leu	65.0	0.0		67.0	13.0	NM_024813	C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	ENST00000610020.1	hg19	CCDS740.1	.	.	.	.	.	.	.	.	.	.	A	8.959	0.970214	0.18659	.	.	ENSG00000122484	ENST00000370343	.	.	.	5.71	4.57	0.56435	.	0.500596	0.21383	N	0.075440	T	0.08846	0.0219	N	0.17082	0.46	0.26685	N	0.971467	P	0.41313	0.745	B	0.38803	0.282	T	0.06041	-1.0849	8	0.02654	T	1	-1.7658	10.1167	0.42596	0.8317:0.1683:0.0:0.0	.	571	Q8IXW5	RPAP2_HUMAN	L	571	.	ENSP00000359368:Q571L	Q	+	2	0	RPAP2	92618892	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.249000	0.32839	1.079000	0.41038	-0.323000	0.08544	CAG	.	.		0.383	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028368.2	NM_024813	
IGSF3	3321	hgsc.bcm.edu	37	1	117127378	117127378	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:117127378T>A	ENST00000369486.3	-	9	3502	c.2737A>T	c.(2737-2739)Agc>Tgc	p.S913C	IGSF3_ENST00000369483.1_Missense_Mutation_p.S933C|IGSF3_ENST00000318837.6_Missense_Mutation_p.S933C	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	913	Ig-like C2-type 7.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TAGGTCCCGCTGTCCTGCACA	0.612																																					p.S933C		Atlas-SNP	.											.	IGSF3	294	.	0			c.A2797T						.						52.0	49.0	50.0					1																	117127378		2203	4300	6503	SO:0001583	missense	3321	exon10			TCCCGCTGTCCTG	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2737A>T	chr1.hg19:g.117127378T>A	ENSP00000358498:p.Ser913Cys	76.0	0.0		102.0	28.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.716048	0.48622	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.70986	-0.53;-0.53;-0.53	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.366291	0.26851	N	0.022179	T	0.73079	0.3541	L	0.52573	1.65	0.38385	D	0.945251	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.68192	0.927;0.934;0.956	T	0.77827	-0.2443	10	0.87932	D	0	-30.3136	12.3806	0.55305	0.0:0.0:0.0:1.0	.	933;913;933	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	C	913;933;933	ENSP00000358498:S913C;ENSP00000358495:S933C;ENSP00000321184:S933C	ENSP00000321184:S933C	S	-	1	0	IGSF3	116928901	0.999000	0.42202	0.998000	0.56505	0.635000	0.38103	1.604000	0.36804	2.017000	0.59298	0.533000	0.62120	AGC	.	.		0.612	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
CGN	57530	hgsc.bcm.edu	37	1	151501990	151501990	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:151501990A>G	ENST00000271636.7	+	11	2194	c.2061A>G	c.(2059-2061)caA>caG	p.Q687Q	SNORA44_ENST00000517031.1_RNA	NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	681	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCCAGCTACAAAAGACCCTCC	0.627																																					p.Q687Q		Atlas-SNP	.											.	CGN	106	.	0			c.A2061G						.						35.0	32.0	33.0					1																	151501990		2203	4300	6503	SO:0001819	synonymous_variant	57530	exon11			GCTACAAAAGACC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2061A>G	chr1.hg19:g.151501990A>G		166.0	0.0		250.0	94.0	NM_020770	A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	ENST00000271636.7	hg19	CCDS999.1																																																																																			.	.		0.627	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
FLG	2312	hgsc.bcm.edu	37	1	152281864	152281864	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:152281864A>T	ENST00000368799.1	-	3	5533	c.5498T>A	c.(5497-5499)gTa>gAa	p.V1833E	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1833	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGAACTATCTACCGATTGCTC	0.572									Ichthyosis																												p.V1833E		Atlas-SNP	.											.	FLG	900	.	0			c.T5498A						.						360.0	351.0	354.0					1																	152281864		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTATCTACCGATT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5498T>A	chr1.hg19:g.152281864A>T	ENSP00000357789:p.Val1833Glu	84.0	0.0		116.0	31.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	A	9.540	1.113176	0.20795	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01629	4.72	3.76	-7.53	0.01336	.	.	.	.	.	T	0.00552	0.0018	M	0.76838	2.35	0.09310	N	1	P	0.49185	0.92	B	0.41036	0.346	T	0.49244	-0.8960	9	0.05525	T	0.97	0.1171	4.7315	0.12966	0.3865:0.1327:0.4018:0.0791	.	1833	P20930	FILA_HUMAN	E	1833;68	ENSP00000357789:V1833E	ENSP00000271820:V68E	V	-	2	0	FLG	150548488	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.185000	0.03073	-2.402000	0.00577	-0.262000	0.10625	GTA	.	.		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
S100A7A	338324	hgsc.bcm.edu	37	1	153391627	153391627	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:153391627A>T	ENST00000368729.4	+	3	205	c.148A>T	c.(148-150)Aag>Tag	p.K50*	S100A7A_ENST00000368728.2_Nonsense_Mutation_p.K50*|S100A7A_ENST00000329256.2_Nonsense_Mutation_p.K50*	NM_176823.3	NP_789793.1	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7A	50	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein self-association (GO:0043621)			cervix(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	12	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACAGGACAAAAAGGGCATACA	0.408																																					p.K50X		Atlas-SNP	.											.	S100A7A	24	.	0			c.A148T						.						85.0	78.0	81.0					1																	153391627		2203	4300	6503	SO:0001587	stop_gained	338324	exon3			GACAAAAAGGGCA	AY189118	CCDS30872.1	1q22	2013-01-10	2006-09-11	2006-09-11	ENSG00000184330	ENSG00000184330		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	21657	protein-coding gene	gene with protein product			"""S100 calcium binding protein A15"", ""S100 calcium binding protein A7-like 1"""	S100A15, S100A7L1		11230159	Standard	NM_176823		Approved	S100A7f	uc001fbt.1	Q86SG5	OTTHUMG00000013122	ENST00000368729.4:c.148A>T	chr1.hg19:g.153391627A>T	ENSP00000357718:p.Lys50*	226.0	0.0		337.0	122.0	NM_176823	D3DV38|Q5SY69	Nonsense_Mutation	SNP	ENST00000368729.4	hg19	CCDS30872.1	.	.	.	.	.	.	.	.	.	.	.	13.28	2.191419	0.38707	.	.	ENSG00000184330	ENST00000368729;ENST00000368728;ENST00000329256	.	.	.	1.72	1.72	0.24424	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4906	0.16774	1.0:0.0:0.0:0.0	.	.	.	.	X	50	.	ENSP00000329008:K50X	K	+	1	0	S100A7A	151658251	0.006000	0.16342	0.005000	0.12908	0.232000	0.25224	2.396000	0.44468	1.019000	0.39547	0.383000	0.25322	AAG	.	.		0.408	S100A7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036786.2	NM_176823	
THBS3	7059	hgsc.bcm.edu	37	1	155165894	155165894	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:155165894T>A	ENST00000368378.3	-	22	2716	c.2696A>T	c.(2695-2697)cAg>cTg	p.Q899L	RP11-263K19.4_ENST00000454348.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000541576.1_Missense_Mutation_p.Q296L|THBS3_ENST00000541990.1_Missense_Mutation_p.Q428L|MIR92B_ENST00000607575.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.Q779L	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	899	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGCCACAAGCTGGGGTCCCTC	0.547																																					p.Q899L		Atlas-SNP	.											.	THBS3	70	.	0			c.A2696T						.						97.0	104.0	102.0					1																	155165894		2203	4300	6503	SO:0001583	missense	7059	exon22			ACAAGCTGGGGTC	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.2696A>T	chr1.hg19:g.155165894T>A	ENSP00000357362:p.Gln899Leu	69.0	0.0		131.0	16.0	NM_007112	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	hg19	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616820	0.46736	.	.	ENSG00000169231	ENST00000368378;ENST00000541576;ENST00000457183;ENST00000541990	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	3.5	3.5	0.40072	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.534600	0.17581	N	0.169134	D	0.87180	0.6113	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.33345	0.409;0.131;0.066;0.409	B;B;B;B	0.38755	0.281;0.103;0.103;0.158	D	0.87378	0.2355	10	0.52906	T	0.07	-12.0819	10.6152	0.45445	0.0:0.0:0.0:1.0	.	779;899;899;899	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	L	899;296;779;428	ENSP00000357362:Q899L;ENSP00000444792:Q296L;ENSP00000392207:Q779L;ENSP00000437353:Q428L	ENSP00000357362:Q899L	Q	-	2	0	THBS3	153432518	0.001000	0.12720	1.000000	0.80357	0.989000	0.77384	1.123000	0.31308	1.842000	0.53543	0.402000	0.26972	CAG	.	.		0.547	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161023128	161023128	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:161023128A>T	ENST00000368013.3	-	6	904	c.584T>A	c.(583-585)aTg>aAg	p.M195K	ARHGAP30_ENST00000368015.1_Missense_Mutation_p.M18K|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.M195K	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	195	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CCGCACCTCCATGAAGGCCGC	0.567																																					p.M195K		Atlas-SNP	.											.	ARHGAP30	105	.	0			c.T584A						.						144.0	107.0	120.0					1																	161023128		2203	4300	6503	SO:0001583	missense	257106	exon6			ACCTCCATGAAGG	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.584T>A	chr1.hg19:g.161023128A>T	ENSP00000356992:p.Met195Lys	79.0	0.0		119.0	46.0	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	hg19	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	A	17.82	3.482658	0.63962	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.34472	2.81;2.81;1.36	5.54	5.54	0.83059	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.047007	0.85682	D	0.000000	T	0.25531	0.0621	L	0.48935	1.535	0.48696	D	0.999693	B;B	0.28584	0.138;0.216	B;B	0.36845	0.168;0.234	T	0.15867	-1.0422	10	0.66056	D	0.02	.	13.6974	0.62589	1.0:0.0:0.0:0.0	.	195;195	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	K	195;195;47;18	ENSP00000356995:M195K;ENSP00000356992:M195K;ENSP00000356994:M18K	ENSP00000356992:M195K	M	-	2	0	ARHGAP30	159289752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.687000	0.74552	2.117000	0.64856	0.529000	0.55759	ATG	.	.		0.567	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
OLFML2B	25903	hgsc.bcm.edu	37	1	161968003	161968003	+	Silent	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:161968003G>A	ENST00000294794.3	-	6	1509	c.1086C>T	c.(1084-1086)agC>agT	p.S362S	OLFML2B_ENST00000367940.2_Silent_p.S363S	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	362					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CGTTCAGGTCGCTTGTCACAG	0.617																																					p.S362S		Atlas-SNP	.											.	OLFML2B	114	.	0			c.C1086T						.						134.0	134.0	134.0					1																	161968003		2203	4300	6503	SO:0001819	synonymous_variant	25903	exon6			CAGGTCGCTTGTC	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1086C>T	chr1.hg19:g.161968003G>A		111.0	0.0		135.0	24.0	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Silent	SNP	ENST00000294794.3	hg19	CCDS1236.1																																																																																			.	.		0.617	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
KIF21B	23046	hgsc.bcm.edu	37	1	200974470	200974470	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:200974470A>T	ENST00000422435.2	-	5	1014	c.698T>A	c.(697-699)cTg>cAg	p.L233Q	KIF21B_ENST00000461742.2_Missense_Mutation_p.L233Q|KIF21B_ENST00000332129.2_Missense_Mutation_p.L233Q|KIF21B_ENST00000360529.5_Missense_Mutation_p.L233Q	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	233	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CATCTGGCACAGGTGGATGGT	0.652																																					p.L233Q		Atlas-SNP	.											.	KIF21B	208	.	0			c.T698A						.						92.0	81.0	85.0					1																	200974470		2203	4300	6503	SO:0001583	missense	23046	exon5			TGGCACAGGTGGA	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.698T>A	chr1.hg19:g.200974470A>T	ENSP00000411831:p.Leu233Gln	43.0	0.0		58.0	21.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	hg19	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.724370	0.89298	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	5.17	5.17	0.71159	Kinesin, motor domain (5);	0.079373	0.52532	D	0.000072	D	0.90041	0.6890	M	0.82716	2.605	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.809;1.0	D;D;P;D	0.91635	0.999;0.999;0.814;0.999	D	0.91649	0.5333	10	0.87932	D	0	.	15.0047	0.71501	1.0:0.0:0.0:0.0	.	233;233;233;233	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	Q	233	ENSP00000328494:L233Q;ENSP00000353724:L233Q;ENSP00000433808:L233Q;ENSP00000411831:L233Q	ENSP00000328494:L233Q	L	-	2	0	KIF21B	199241093	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.845000	0.92153	1.946000	0.56461	0.533000	0.62120	CTG	.	.		0.652	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
NFASC	23114	hgsc.bcm.edu	37	1	204923314	204923314	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:204923314A>T	ENST00000401399.1	+	5	414		c.e5-1		NFASC_ENST00000539706.1_Splice_Site|NFASC_ENST00000404907.1_Splice_Site|NFASC_ENST00000338586.6_Splice_Site|NFASC_ENST00000404076.1_Splice_Site|NFASC_ENST00000403080.1_Splice_Site|NFASC_ENST00000367172.4_Splice_Site|NFASC_ENST00000367169.4_Splice_Site|NFASC_ENST00000339876.6_Splice_Site|NFASC_ENST00000367170.4_Splice_Site|NFASC_ENST00000360049.4_Splice_Site|NFASC_ENST00000513543.1_Splice_Site|NFASC_ENST00000367171.4_Splice_Site|NFASC_ENST00000338515.6_Splice_Site			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CACTCTCCACAGCTTCCACTG	0.582																																					.		Atlas-SNP	.											.	NFASC	396	.	0			c.198-2A>T						.						45.0	41.0	42.0					1																	204923314		2203	4300	6503	SO:0001630	splice_region_variant	23114	exon5			CTCCACAGCTTCC	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.216-1A>T	chr1.hg19:g.204923314A>T		72.0	0.0		86.0	23.0	NM_015090	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Splice_Site	SNP	ENST00000401399.1	hg19	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220034	0.79464	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000505079;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000367173	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0284	0.71687	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NFASC	203189937	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.876000	0.75556	2.036000	0.60181	0.533000	0.62120	.	.	.		0.582	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	Intron
TGFB2	7042	hgsc.bcm.edu	37	1	218609331	218609331	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:218609331A>T	ENST00000366930.4	+	5	1241	c.774A>T	c.(772-774)acA>acT	p.T258T	TGFB2_ENST00000366929.4_Silent_p.T286T|TGFB2_ENST00000479322.1_3'UTR	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	258					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GCACCTCCACATATACCAGTG	0.373																																					p.T286T		Atlas-SNP	.											.	TGFB2	102	.	0			c.A858T						.						82.0	86.0	85.0					1																	218609331		2203	4300	6503	SO:0001819	synonymous_variant	7042	exon6			CTCCACATATACC	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.774A>T	chr1.hg19:g.218609331A>T		100.0	0.0		193.0	28.0	NM_001135599	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Silent	SNP	ENST00000366930.4	hg19	CCDS1521.1																																																																																			.	.		0.373	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
OBSCN	84033	hgsc.bcm.edu	37	1	228520596	228520596	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:228520596A>T	ENST00000422127.1	+	57	15732	c.15688A>T	c.(15688-15690)Acg>Tcg	p.T5230S	OBSCN_ENST00000284548.11_Missense_Mutation_p.T5230S|OBSCN_ENST00000366709.4_Missense_Mutation_p.T2349S|OBSCN_ENST00000570156.2_Missense_Mutation_p.T6187S|OBSCN_ENST00000366707.4_Missense_Mutation_p.T2864S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5230					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCAGATGCCACGGAGTCCTC	0.612																																					p.T6187S		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A18559T						.						87.0	90.0	89.0					1																	228520596		2119	4227	6346	SO:0001583	missense	84033	exon68			GATGCCACGGAGT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15688A>T	chr1.hg19:g.228520596A>T	ENSP00000409493:p.Thr5230Ser	99.0	0.0		94.0	16.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	31	5.085053	0.94100	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.63417	0.42;-0.04;0.0;0.47	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.66934	0.2840	L	0.29908	0.895	0.48185	D	0.999601	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.60860	-0.7179	10	0.12103	T	0.63	.	15.4727	0.75453	1.0:0.0:0.0:0.0	.	5230;5230	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	5230;5230;2864;2349	ENSP00000284548:T5230S;ENSP00000409493:T5230S;ENSP00000355668:T2864S;ENSP00000355670:T2349S	ENSP00000284548:T5230S	T	+	1	0	OBSCN	226587219	1.000000	0.71417	0.985000	0.45067	0.685000	0.39939	8.463000	0.90377	2.240000	0.73641	0.533000	0.62120	ACG	.	.		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2T12	127064	hgsc.bcm.edu	37	1	248458280	248458280	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr1:248458280A>T	ENST00000317996.1	-	1	600	c.601T>A	c.(601-603)Tgt>Agt	p.C201S		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			ATTAACACACAGCAGATGTAC	0.542																																					p.C201S		Atlas-SNP	.											.	OR2T12	113	.	0			c.T601A						.						48.0	39.0	42.0					1																	248458280		2202	4296	6498	SO:0001583	missense	127064	exon1			ACACACAGCAGAT	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.601T>A	chr1.hg19:g.248458280A>T	ENSP00000324583:p.Cys201Ser	441.0	0.0		529.0	177.0	NM_001004692		Missense_Mutation	SNP	ENST00000317996.1	hg19	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	a	13.78	2.337893	0.41398	.	.	ENSG00000177201	ENST00000317996	T	0.34667	1.35	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38436	U	0.001687	T	0.34048	0.0884	N	0.16201	0.385	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.05649	-1.0872	10	0.45353	T	0.12	.	4.556	0.12136	0.7143:0.0:0.0:0.2857	.	201	Q8NG77	O2T12_HUMAN	S	201	ENSP00000324583:C201S	ENSP00000324583:C201S	C	-	1	0	OR2T12	246524903	0.000000	0.05858	0.124000	0.21820	0.369000	0.29798	-2.464000	0.00996	0.540000	0.28808	0.147000	0.16070	TGT	.	.		0.542	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
NTSR2	23620	hgsc.bcm.edu	37	2	11798756	11798756	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:11798756A>T	ENST00000306928.5	-	4	1116	c.1082T>A	c.(1081-1083)gTg>gAg	p.V361E		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	361					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	GGAGGAGGACACGGCGTTGTA	0.542																																					p.V361E		Atlas-SNP	.											.	NTSR2	36	.	0			c.T1082A						.						93.0	93.0	93.0					2																	11798756		2203	4300	6503	SO:0001583	missense	23620	exon4			GAGGACACGGCGT	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.1082T>A	chr2.hg19:g.11798756A>T	ENSP00000303686:p.Val361Glu	66.0	0.0		112.0	27.0	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Missense_Mutation	SNP	ENST00000306928.5	hg19	CCDS1681.1	.	.	.	.	.	.	.	.	.	.	A	13.40	2.225312	0.39300	.	.	ENSG00000169006	ENST00000306928	T	0.38560	1.13	4.31	1.8	0.24995	.	1.479790	0.04388	N	0.361983	T	0.35770	0.0943	L	0.32530	0.975	0.26333	N	0.977492	B	0.22909	0.077	B	0.26517	0.07	T	0.36817	-0.9732	10	0.66056	D	0.02	-2.9716	7.0514	0.25075	0.7764:0.0:0.2236:0.0	.	361	O95665	NTR2_HUMAN	E	361	ENSP00000303686:V361E	ENSP00000303686:V361E	V	-	2	0	NTSR2	11716207	0.978000	0.34361	0.279000	0.24732	0.099000	0.18886	5.099000	0.64554	0.236000	0.21180	-0.417000	0.06048	GTG	.	.		0.542	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
DPYSL5	56896	hgsc.bcm.edu	37	2	27121452	27121452	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:27121452T>A	ENST00000288699.6	+	2	243	c.85T>A	c.(85-87)Tac>Aac	p.Y29N	DPYSL5_ENST00000401478.1_Missense_Mutation_p.Y29N	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	29					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTGACGTCTACATCGAGAA	0.572																																					p.Y29N		Atlas-SNP	.											.	DPYSL5	69	.	0			c.T85A						.						154.0	127.0	136.0					2																	27121452		2203	4300	6503	SO:0001583	missense	56896	exon2			GACGTCTACATCG	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.85T>A	chr2.hg19:g.27121452T>A	ENSP00000288699:p.Tyr29Asn	219.0	0.0		208.0	38.0	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	hg19	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.409471	0.83340	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	T;D;D;T;T	0.85773	-1.09;-2.03;-2.03;-1.09;-1.09	4.61	4.61	0.57282	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.92694	0.7678	M	0.88906	2.99	0.51767	D	0.999938	D	0.71674	0.998	D	0.71656	0.974	D	0.93866	0.7158	10	0.72032	D	0.01	-20.6452	13.2923	0.60278	0.0:0.0:0.0:1.0	.	29	Q9BPU6	DPYL5_HUMAN	N	29	ENSP00000407174:Y29N;ENSP00000288699:Y29N;ENSP00000385549:Y29N;ENSP00000399581:Y29N;ENSP00000413075:Y29N	ENSP00000288699:Y29N	Y	+	1	0	DPYSL5	26974956	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.555000	0.82223	1.854000	0.53819	0.459000	0.35465	TAC	.	.		0.572	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
LRPPRC	10128	hgsc.bcm.edu	37	2	44187687	44187687	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:44187687T>A	ENST00000260665.7	-	13	1632	c.1575A>T	c.(1573-1575)ttA>ttT	p.L525F	LRPPRC_ENST00000409946.1_Missense_Mutation_p.L525F	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	525					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TACAAAATGATAATACAAAGT	0.373																																					p.L525F		Atlas-SNP	.											.	LRPPRC	105	.	0			c.A1575T						.						134.0	128.0	130.0					2																	44187687		2203	4300	6503	SO:0001583	missense	10128	exon13			AAATGATAATACA	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1575A>T	chr2.hg19:g.44187687T>A	ENSP00000260665:p.Leu525Phe	52.0	0.0		71.0	12.0	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	hg19	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	T	8.325	0.825086	0.16678	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946	T;T	0.59906	0.39;0.23	4.93	1.11	0.20524	.	0.491609	0.21147	N	0.079392	T	0.44953	0.1318	M	0.75447	2.3	0.80722	D	1	B;B	0.22746	0.074;0.06	B;B	0.18871	0.023;0.011	T	0.19418	-1.0306	10	0.12103	T	0.63	-5.6491	0.6772	0.00869	0.166:0.2007:0.2972:0.336	.	425;525	F5H4J6;P42704	.;LPPRC_HUMAN	F	425;525;525	ENSP00000260665:L525F;ENSP00000386234:L525F	ENSP00000260665:L525F	L	-	3	2	LRPPRC	44041191	0.992000	0.36948	0.927000	0.36925	0.549000	0.35272	0.002000	0.13061	0.031000	0.15407	0.482000	0.46254	TTA	.	.		0.373	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
TSPYL6	388951	hgsc.bcm.edu	37	2	54483166	54483166	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:54483166A>G	ENST00000317802.7	-	1	243	c.123T>C	c.(121-123)gaT>gaC	p.D41D	ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	41					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						CCAAGCGGCCATCAAACATAT	0.607																																					p.D41D		Atlas-SNP	.											.	TSPYL6	54	.	0			c.T123C						.						82.0	93.0	90.0					2																	54483166		1954	4137	6091	SO:0001819	synonymous_variant	388951	exon1			GCGGCCATCAAAC	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.123T>C	chr2.hg19:g.54483166A>G		93.0	0.0		82.0	18.0	NM_001003937	Q6NUJ3	Silent	SNP	ENST00000317802.7	hg19	CCDS42682.1																																																																																			.	.		0.607	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
LMAN2L	81562	hgsc.bcm.edu	37	2	97373021	97373021	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:97373021T>A	ENST00000264963.4	-	8	1041	c.1019A>T	c.(1018-1020)cAg>cTg	p.Q340L	LMAN2L_ENST00000534882.1_Missense_Mutation_p.Q195L|LMAN2L_ENST00000426463.2_Missense_Mutation_p.Q206L|LMAN2L_ENST00000537039.1_Missense_Mutation_p.Q202L|FER1L5_ENST00000457909.1_RNA|LMAN2L_ENST00000377079.4_Missense_Mutation_p.Q351L	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	340					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						GCTCTGTTCCTGCCATTTGTT	0.527																																					p.Q351L		Atlas-SNP	.											.	LMAN2L	27	.	0			c.A1052T						.						89.0	71.0	77.0					2																	97373021		2203	4300	6503	SO:0001583	missense	81562	exon9			TGTTCCTGCCATT	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.1019A>T	chr2.hg19:g.97373021T>A	ENSP00000264963:p.Gln340Leu	164.0	0.0		169.0	39.0	NM_001142292	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	ENST00000264963.4	hg19	CCDS2023.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.583117	0.65992	.	.	ENSG00000114988	ENST00000264963;ENST00000377079;ENST00000426463;ENST00000537039;ENST00000534882	T;T;T;T;T	0.79352	0.75;0.74;-1.26;-1.21;-1.25	5.58	5.58	0.84498	.	0.241636	0.42548	D	0.000695	T	0.78868	0.4351	M	0.72479	2.2	0.52099	D	0.999942	B;B;B;B;P	0.36683	0.167;0.282;0.167;0.138;0.565	B;B;B;B;B	0.38562	0.045;0.103;0.045;0.071;0.276	T	0.81313	-0.0989	10	0.72032	D	0.01	.	15.0359	0.71748	0.0:0.0:0.0:1.0	.	195;213;206;351;340	B4DVH1;B4DI83;B4DSH3;Q9H0V9-2;Q9H0V9	.;.;.;.;LMA2L_HUMAN	L	340;351;206;202;195	ENSP00000264963:Q340L;ENSP00000366280:Q351L;ENSP00000396391:Q206L;ENSP00000441701:Q202L;ENSP00000438501:Q195L	ENSP00000264963:Q340L	Q	-	2	0	LMAN2L	96736748	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.902000	0.69869	2.246000	0.74042	0.533000	0.62120	CAG	.	.		0.527	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
CHST10	9486	hgsc.bcm.edu	37	2	101023082	101023082	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:101023082A>G	ENST00000264249.3	-	3	441	c.56T>C	c.(55-57)aTg>aCg	p.M19T	CHST10_ENST00000542617.1_Missense_Mutation_p.M67T|CHST10_ENST00000409701.1_Missense_Mutation_p.M19T|CHST10_ENST00000485085.1_5'Flank	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	19					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						GCTAGCCACCATGAACATGAA	0.473																																					p.M19T		Atlas-SNP	.											.	CHST10	42	.	0			c.T56C						.						290.0	273.0	279.0					2																	101023082		2203	4300	6503	SO:0001583	missense	9486	exon3			GCCACCATGAACA	BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.56T>C	chr2.hg19:g.101023082A>G	ENSP00000264249:p.Met19Thr	98.0	0.0		127.0	37.0	NM_004854	Q53T18	Missense_Mutation	SNP	ENST00000264249.3	hg19	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.287216	0.59867	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989;ENST00000421474;ENST00000418201;ENST00000435960	T;T;T;T;T;T;T;T;T	0.72394	-0.56;-0.65;-0.56;0.73;0.67;0.45;0.32;0.11;-0.25	5.18	5.18	0.71444	.	0.041188	0.85682	D	0.000000	T	0.58836	0.2150	L	0.29908	0.895	0.80722	D	1	P	0.38922	0.651	B	0.33521	0.165	T	0.64901	-0.6298	10	0.59425	D	0.04	-45.4345	15.3465	0.74343	1.0:0.0:0.0:0.0	.	19	O43529	CHSTA_HUMAN	T	19;67;19;19;19;67;19;19;19	ENSP00000264249:M19T;ENSP00000438869:M67T;ENSP00000387309:M19T;ENSP00000387121:M19T;ENSP00000405922:M19T;ENSP00000387977:M67T;ENSP00000407525:M19T;ENSP00000416831:M19T;ENSP00000395643:M19T	ENSP00000264249:M19T	M	-	2	0	CHST10	100389514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.877000	0.87225	2.084000	0.62774	0.533000	0.62120	ATG	.	.		0.473	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
RIF1	55183	hgsc.bcm.edu	37	2	152298453	152298453	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:152298453A>T	ENST00000243326.5	+	15	2165	c.1682A>T	c.(1681-1683)cAg>cTg	p.Q561L	RIF1_ENST00000433166.2_3'UTR|RIF1_ENST00000453091.2_Missense_Mutation_p.Q561L|RIF1_ENST00000444746.2_Missense_Mutation_p.Q561L|RIF1_ENST00000428287.2_Missense_Mutation_p.Q561L|RIF1_ENST00000430328.2_Missense_Mutation_p.Q561L			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		GGACTTCCTCAGAAAGTATTA	0.299																																					p.Q561L		Atlas-SNP	.											.	RIF1	244	.	0			c.A1682T						.						61.0	63.0	63.0					2																	152298453		2202	4284	6486	SO:0001583	missense	55183	exon16			TTCCTCAGAAAGT	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.1682A>T	chr2.hg19:g.152298453A>T	ENSP00000243326:p.Gln561Leu	336.0	0.0		429.0	108.0	NM_018151	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	hg19	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.953541	0.53293	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.4	4.22	0.49857	.	0.242707	0.42964	D	0.000632	T	0.60818	0.2298	L	0.54323	1.7	0.80722	D	1	P;P	0.44627	0.839;0.804	B;P	0.44394	0.205;0.448	T	0.62353	-0.6872	10	0.59425	D	0.04	-0.1278	12.0171	0.53319	0.6644:0.3355:0.0:0.0	.	561;561	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	L	561	ENSP00000390181:Q561L;ENSP00000414615:Q561L;ENSP00000415691:Q561L;ENSP00000243326:Q561L;ENSP00000416123:Q561L	ENSP00000243326:Q561L	Q	+	2	0	RIF1	152006699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.740000	0.55082	0.858000	0.35431	0.528000	0.53228	CAG	.	.		0.299	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
TANC1	85461	hgsc.bcm.edu	37	2	160086384	160086384	+	Missense_Mutation	SNP	G	G	T	rs370179463		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:160086384G>T	ENST00000263635.6	+	27	4684	c.4447G>T	c.(4447-4449)Gtc>Ttc	p.V1483F	TANC1_ENST00000454300.1_Missense_Mutation_p.V1377F	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1483					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ATCCTCATCTGTCCCTTCCTC	0.522																																					p.V1483F		Atlas-SNP	.											.	TANC1	157	.	0			c.G4447T						.						97.0	103.0	101.0					2																	160086384		1995	4158	6153	SO:0001583	missense	85461	exon27			TCATCTGTCCCTT	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4447G>T	chr2.hg19:g.160086384G>T	ENSP00000263635:p.Val1483Phe	116.0	0.0		149.0	37.0	NM_033394	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	hg19	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	G	6.542	0.468302	0.12461	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.69806	-0.43;-0.43	5.52	3.72	0.42706	.	1.299240	0.04737	N	0.422150	T	0.52693	0.1750	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35871	-0.9771	9	.	.	.	.	6.7065	0.23254	0.213:0.1282:0.6588:0.0	.	1483	Q9C0D5	TANC1_HUMAN	F	1377;1483	ENSP00000396339:V1377F;ENSP00000263635:V1483F	.	V	+	1	0	TANC1	159794630	0.000000	0.05858	0.002000	0.10522	0.646000	0.38490	0.490000	0.22403	0.688000	0.31529	0.655000	0.94253	GTC	.	.		0.522	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
PLA2R1	22925	hgsc.bcm.edu	37	2	160873149	160873149	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:160873149A>T	ENST00000283243.7	-	9	1733	c.1527T>A	c.(1525-1527)tcT>tcA	p.S509S	PLA2R1_ENST00000392771.1_Silent_p.S509S	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	509					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ATTCAGCATCAGAGAGGACAT	0.373																																					p.S509S		Atlas-SNP	.											.	PLA2R1	153	.	0			c.T1527A						.						166.0	158.0	161.0					2																	160873149		2203	4300	6503	SO:0001819	synonymous_variant	22925	exon9			AGCATCAGAGAGG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1527T>A	chr2.hg19:g.160873149A>T		87.0	0.0		100.0	20.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	hg19	CCDS33309.1																																																																																			.	.		0.373	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
SCN3A	6328	hgsc.bcm.edu	37	2	165987869	165987869	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:165987869T>G	ENST00000360093.3	-	16	2941	c.2450A>C	c.(2449-2451)tAt>tCt	p.Y817S	SCN3A_ENST00000409101.3_Missense_Mutation_p.Y768S|SCN3A_ENST00000283254.7_Missense_Mutation_p.Y817S	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	817					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GAAATAGTAATAAGGATCCAT	0.388																																					p.Y817S		Atlas-SNP	.											.	SCN3A	544	.	0			c.A2450C						.						106.0	107.0	107.0					2																	165987869		2203	4300	6503	SO:0001583	missense	6328	exon16			TAGTAATAAGGAT	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2450A>C	chr2.hg19:g.165987869T>G	ENSP00000353206:p.Tyr817Ser	248.0	0.0		295.0	71.0	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	hg19		.	.	.	.	.	.	.	.	.	.	T	25.7	4.664383	0.88251	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.82	5.82	0.92795	Ion transport (1);	0.000000	0.52532	D	0.000074	D	0.98172	0.9396	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.87578	0.989;0.997;0.994;0.994;0.998	D	0.99327	1.0908	10	0.87932	D	0	.	16.1758	0.81851	0.0:0.0:0.0:1.0	.	817;768;768;768;817	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	S	817;817;768;768	ENSP00000353206:Y817S;ENSP00000283254:Y817S;ENSP00000386726:Y768S;ENSP00000403348:Y768S	ENSP00000283254:Y817S	Y	-	2	0	SCN3A	165696115	1.000000	0.71417	0.997000	0.53966	0.914000	0.54420	6.100000	0.71473	2.225000	0.72522	0.477000	0.44152	TAT	.	.		0.388	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
GAD1	2571	hgsc.bcm.edu	37	2	171705847	171705847	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:171705847A>T	ENST00000358196.3	+	12	1721	c.1171A>T	c.(1171-1173)Aac>Tac	p.N391Y		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	391					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CCATAAACTCAACGGCATAGA	0.572																																					p.N391Y		Atlas-SNP	.											.	GAD1	79	.	0			c.A1171T						.						83.0	72.0	76.0					2																	171705847		2203	4300	6503	SO:0001583	missense	2571	exon12			AAACTCAACGGCA		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1171A>T	chr2.hg19:g.171705847A>T	ENSP00000350928:p.Asn391Tyr	39.0	0.0		46.0	14.0	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	hg19	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	A	16.01	2.999986	0.54147	.	.	ENSG00000128683	ENST00000358196	T	0.38722	1.12	5.76	5.76	0.90799	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.301820	0.46442	D	0.000290	T	0.55449	0.1921	M	0.71036	2.16	0.80722	D	1	P	0.44139	0.827	P	0.53722	0.733	T	0.59674	-0.7410	10	0.72032	D	0.01	-10.8918	10.4299	0.44400	0.9277:0.0:0.0723:0.0	.	391	Q99259	DCE1_HUMAN	Y	391	ENSP00000350928:N391Y	ENSP00000350928:N391Y	N	+	1	0	GAD1	171414093	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.416000	0.52707	2.186000	0.69663	0.533000	0.62120	AAC	.	.		0.572	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
PDE11A	50940	hgsc.bcm.edu	37	2	178528616	178528616	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:178528616C>T	ENST00000286063.6	-	19	2941	c.2624G>A	c.(2623-2625)aGc>aAc	p.S875N	PDE11A_ENST00000449286.2_Missense_Mutation_p.S517N|PDE11A_ENST00000358450.4_Missense_Mutation_p.S625N|PDE11A_ENST00000450799.2_Missense_Mutation_p.S66N|PDE11A_ENST00000409504.1_Missense_Mutation_p.S517N|PDE11A_ENST00000389683.3_Missense_Mutation_p.S431N	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	875	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.S875N(1)|p.S625N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CATGCAGATGCTATCAATCCA	0.448									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.S875N		Atlas-SNP	.											PDE11A_ENST00000358450,caecum,carcinoma,0,2	PDE11A	283	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2624A						.						121.0	103.0	109.0					2																	178528616		2203	4300	6503	SO:0001583	missense	50940	exon19	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	CAGATGCTATCAA	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.2624G>A	chr2.hg19:g.178528616C>T	ENSP00000286063:p.Ser875Asn	72.0	0.0		70.0	19.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	hg19	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932868	0.52866	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000450799;ENST00000409504;ENST00000389683;ENST00000449286	T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	6.07	6.07	0.98685	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.078860	0.85682	D	0.000000	T	0.60077	0.2241	N	0.08118	0	0.33734	D	0.618544	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.63107	-0.6711	10	0.30854	T	0.27	.	13.8057	0.63230	0.0:0.9305:0.0:0.0695	.	625;875	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	N	875;625;66;517;431;517	ENSP00000286063:S875N;ENSP00000351232:S625N;ENSP00000387964:S66N;ENSP00000386539:S517N;ENSP00000374333:S431N;ENSP00000390599:S517N	ENSP00000286063:S875N	S	-	2	0	PDE11A	178236862	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.863000	0.56016	2.885000	0.99019	0.655000	0.94253	AGC	.	.		0.448	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
CWC22	57703	hgsc.bcm.edu	37	2	180835257	180835257	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:180835257T>A	ENST00000410053.3	-	11	1480	c.1181A>T	c.(1180-1182)aAt>aTt	p.N394I	CWC22_ENST00000295749.6_Missense_Mutation_p.N394I	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	394					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						CTTCTCTTCATTCTCCATAAA	0.249																																					p.N394I		Atlas-SNP	.											.	CWC22	62	.	0			c.A1181T						.						26.0	23.0	24.0					2																	180835257		1570	3628	5198	SO:0001583	missense	57703	exon11			TCTTCATTCTCCA		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.1181A>T	chr2.hg19:g.180835257T>A	ENSP00000387006:p.Asn394Ile	218.0	0.0		251.0	52.0	NM_020943	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	ENST00000410053.3	hg19	CCDS46465.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635371	0.87760	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.26518	1.99;1.99;1.73	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60728	0.2291	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.69800	-0.5047	10	0.87932	D	0	-33.9824	15.9872	0.80168	0.0:0.0:0.0:1.0	.	394	Q9HCG8	CWC22_HUMAN	I	394	ENSP00000387006:N394I;ENSP00000295749:N394I;ENSP00000384159:N394I	ENSP00000295749:N394I	N	-	2	0	CWC22	180543502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.631000	0.83237	2.367000	0.80283	0.528000	0.53228	AAT	.	.		0.249	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
FRZB	2487	hgsc.bcm.edu	37	2	183699694	183699694	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:183699694T>A	ENST00000295113.4	-	6	1471		c.e6-2			NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein						brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			ATCCCAGCGCTGTGAAATTTA	0.418																																					.		Atlas-SNP	.											.	FRZB	42	.	0			c.862-2A>T						.						73.0	71.0	72.0					2																	183699694		2203	4300	6503	SO:0001630	splice_region_variant	2487	exon7			CAGCGCTGTGAAA	U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.862-2A>T	chr2.hg19:g.183699694T>A		66.0	0.0		73.0	30.0	NM_001463	O00181|Q99686	Splice_Site	SNP	ENST00000295113.4	hg19	CCDS2286.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.658416	0.67586	.	.	ENSG00000162998	ENST00000295113	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7981	0.78428	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FRZB	183407939	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.505000	0.66981	2.140000	0.66376	0.528000	0.53228	.	.	.		0.418	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255808.1	NM_001463	Intron
CCDC150	284992	hgsc.bcm.edu	37	2	197540923	197540923	+	Silent	SNP	A	A	T	rs367679012		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:197540923A>T	ENST00000389175.4	+	11	1329	c.1194A>T	c.(1192-1194)gcA>gcT	p.A398A	CCDC150_ENST00000423093.2_Silent_p.A66A|CCDC150_ENST00000472405.2_3'UTR|CCDC150_ENST00000272831.7_Silent_p.A66A	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	398										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TGCTGGATGCAGCCCATGCCA	0.393																																					p.A398A		Atlas-SNP	.											.	CCDC150	96	.	0			c.A1194T						.						135.0	135.0	135.0					2																	197540923		1921	4137	6058	SO:0001819	synonymous_variant	284992	exon11			GGATGCAGCCCAT		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1194A>T	chr2.hg19:g.197540923A>T		214.0	0.0		253.0	65.0	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	ENST00000389175.4	hg19	CCDS46478.1																																																																																			.	.		0.393	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
MAP2	4133	hgsc.bcm.edu	37	2	210560487	210560487	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:210560487A>T	ENST00000360351.4	+	7	4099	c.3593A>T	c.(3592-3594)cAg>cTg	p.Q1198L	MAP2_ENST00000447185.1_Missense_Mutation_p.Q1194L|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1198					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GAATTTATTCAGGGGCCAAAA	0.463																																					p.Q1198L	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											MAP2,NS,carcinoma,0,1	MAP2	372	.	0			c.A3593T						.						56.0	56.0	56.0					2																	210560487		2203	4300	6503	SO:0001583	missense	4133	exon7			TTATTCAGGGGCC		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3593A>T	chr2.hg19:g.210560487A>T	ENSP00000353508:p.Gln1198Leu	111.0	0.0		131.0	32.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	hg19	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	A	5.827	0.336906	0.11013	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.23147	1.92;1.92	5.76	4.58	0.56647	MAP2/Tau projection (1);	0.250035	0.29342	N	0.012430	T	0.27559	0.0677	L	0.54323	1.7	0.29457	N	0.858069	P;P	0.39717	0.634;0.684	B;B	0.40199	0.215;0.322	T	0.10314	-1.0635	10	0.41790	T	0.15	-6.1799	12.4616	0.55734	0.669:0.331:0.0:0.0	.	1194;1198	P11137-3;P11137	.;MAP2_HUMAN	L	1198;1194	ENSP00000353508:Q1198L;ENSP00000392164:Q1194L	ENSP00000353508:Q1198L	Q	+	2	0	MAP2	210268732	1.000000	0.71417	0.894000	0.35097	0.098000	0.18820	4.119000	0.57891	0.989000	0.38761	0.528000	0.53228	CAG	.	.		0.463	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
UNC80	285175	hgsc.bcm.edu	37	2	210778581	210778581	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:210778581T>A	ENST00000439458.1	+	30	4828	c.4748T>A	c.(4747-4749)cTg>cAg	p.L1583Q	UNC80_ENST00000272845.6_Missense_Mutation_p.L1578Q	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1583					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCACCAATTCTGACAGAGGAG	0.493																																					p.L1583Q		Atlas-SNP	.											.	UNC80	280	.	0			c.T4748A						.						162.0	118.0	131.0					2																	210778581		692	1591	2283	SO:0001583	missense	285175	exon30			CAATTCTGACAGA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4748T>A	chr2.hg19:g.210778581T>A	ENSP00000391088:p.Leu1583Gln	199.0	0.0		167.0	34.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620287	0.87460	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.57107	0.42;0.42	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000004	T	0.66713	0.2817	L	0.49778	1.585	0.80722	D	1	D	0.65815	0.995	D	0.66497	0.944	T	0.69544	-0.5117	10	0.87932	D	0	-10.8273	15.9266	0.79621	0.0:0.0:0.0:1.0	.	1583	Q8N2C7	UNC80_HUMAN	Q	1583;1578	ENSP00000391088:L1583Q;ENSP00000272845:L1578Q	ENSP00000272845:L1578Q	L	+	2	0	UNC80	210486826	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.825000	0.86693	2.179000	0.69175	0.477000	0.44152	CTG	.	.		0.493	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
UNC80	285175	hgsc.bcm.edu	37	2	210858068	210858068	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:210858068A>T	ENST00000439458.1	+	62	9308	c.9228A>T	c.(9226-9228)aaA>aaT	p.K3076N	UNC80_ENST00000272845.6_Missense_Mutation_p.K3052N	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	3076					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CACGTCAGAAAACTCAGACTG	0.473																																					p.K3076N		Atlas-SNP	.											.	UNC80	280	.	0			c.A9228T						.						118.0	103.0	107.0					2																	210858068		692	1591	2283	SO:0001583	missense	285175	exon62			TCAGAAAACTCAG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.9228A>T	chr2.hg19:g.210858068A>T	ENSP00000391088:p.Lys3076Asn	100.0	0.0		135.0	32.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.500709	0.64298	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.37411	1.21;1.2	5.49	2.67	0.31697	.	.	.	.	.	T	0.27313	0.0670	N	0.24115	0.695	0.80722	D	1	P;P	0.50819	0.939;0.728	P;B	0.45538	0.484;0.349	T	0.02533	-1.1145	9	0.62326	D	0.03	.	9.4358	0.38637	0.422:0.0:0.578:0.0	.	3052;3076	C9J1U3;Q8N2C7	.;UNC80_HUMAN	N	3076;3052	ENSP00000391088:K3076N;ENSP00000272845:K3052N	ENSP00000272845:K3052N	K	+	3	2	UNC80	210566313	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	1.172000	0.31908	0.266000	0.21894	-0.472000	0.04984	AAA	.	.		0.473	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
ABCA12	26154	hgsc.bcm.edu	37	2	215840627	215840627	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:215840627T>A	ENST00000272895.7	-	34	5482	c.5263A>T	c.(5263-5265)Atc>Ttc	p.I1755F	ABCA12_ENST00000389661.4_Missense_Mutation_p.I1437F	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1755					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACAAAGACGATGGGGAGGATA	0.493																																					p.I1755F	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.A5263T						.						179.0	164.0	169.0					2																	215840627		2203	4300	6503	SO:0001583	missense	26154	exon34			AGACGATGGGGAG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5263A>T	chr2.hg19:g.215840627T>A	ENSP00000272895:p.Ile1755Phe	136.0	0.0		199.0	61.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.640960	0.67244	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.90069	-2.61;-2.61	5.73	1.65	0.23941	.	0.244500	0.32357	N	0.006207	D	0.82549	0.5061	L	0.29908	0.895	0.80722	D	1	B;P	0.36048	0.25;0.534	B;B	0.44224	0.388;0.444	T	0.76547	-0.2919	10	0.56958	D	0.05	.	3.5686	0.07909	0.1825:0.4047:0.0:0.4129	.	1755;1437	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	F	1755;1437	ENSP00000272895:I1755F;ENSP00000374312:I1437F	ENSP00000272895:I1755F	I	-	1	0	ABCA12	215548872	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.164000	0.42387	0.507000	0.28148	0.533000	0.62120	ATC	.	.		0.493	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
RESP18	389075	hgsc.bcm.edu	37	2	220194381	220194381	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:220194381A>T	ENST00000333527.5	-	4	442	c.443T>A	c.(442-444)cTt>cAt	p.L148H	RESP18_ENST00000392083.1_Missense_Mutation_p.L24H	NM_001007089.3	NP_001007090.3	Q5W5W9	RES18_HUMAN	regulated endocrine-specific protein 18	106					in utero embryonic development (GO:0001701)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|rough endoplasmic reticulum lumen (GO:0048237)|secretory granule (GO:0030141)				endometrium(1)|prostate(1)	2						AGTGGGGAAAAGTGCCTTCCC	0.507																																					p.L148H		Atlas-SNP	.											.	RESP18	13	.	0			c.T443A						.						127.0	112.0	116.0					2																	220194381		692	1591	2283	SO:0001583	missense	389075	exon4			GGGAAAAGTGCCT	AF437883	CCDS33382.2	2q35	2012-12-07	2012-12-07		ENSG00000182698	ENSG00000182698			33762	protein-coding gene	gene with protein product		612721	"""regulated endocrine-specific protein 18 homolog (rat)"""			17951542, 7988462	Standard	NM_001007089		Approved		uc002vlc.4	Q5W5W9	OTTHUMG00000150223	ENST00000333527.5:c.443T>A	chr2.hg19:g.220194381A>T	ENSP00000330269:p.Leu148His	87.0	0.0		114.0	27.0	NM_001007089	A8MQ49|Q38I23|Q5W5X0	Missense_Mutation	SNP	ENST00000333527.5	hg19	CCDS33382.2	.	.	.	.	.	.	.	.	.	.	A	13.25	2.182546	0.38511	.	.	ENSG00000182698	ENST00000392083;ENST00000333527	.	.	.	3.49	-1.49	0.08718	.	1.258120	0.05966	N	0.641445	T	0.21307	0.0513	N	0.24115	0.695	0.09310	N	1	B;B	0.24317	0.101;0.01	B;B	0.11329	0.006;0.004	T	0.25502	-1.0130	9	0.59425	D	0.04	.	3.0653	0.06212	0.4276:0.0:0.3754:0.197	.	148;88	Q5W5W9-2;Q5W5W9-3	.;.	H	24;148	.	ENSP00000330269:L148H	L	-	2	0	RESP18	219902625	0.003000	0.15002	0.000000	0.03702	0.010000	0.07245	0.495000	0.22483	-0.281000	0.09141	-0.256000	0.11100	CTT	.	.		0.507	RESP18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316885.1	NM_001007089	
EPHA4	2043	hgsc.bcm.edu	37	2	222365815	222365815	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr2:222365815A>T	ENST00000281821.2	-	4	942	c.901T>A	c.(901-903)Tgg>Agg	p.W301R	EPHA4_ENST00000409854.1_Missense_Mutation_p.W301R|EPHA4_ENST00000409938.1_Missense_Mutation_p.W301R|EPHA4_ENST00000392071.4_Missense_Mutation_p.W250R	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	301	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GCTCCTTCCCAGACAGAGTAG	0.527																																					p.W301R		Atlas-SNP	.											.	EPHA4	263	.	0			c.T901A						.						109.0	95.0	100.0					2																	222365815		2203	4300	6503	SO:0001583	missense	2043	exon4			CTTCCCAGACAGA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.901T>A	chr2.hg19:g.222365815A>T	ENSP00000281821:p.Trp301Arg	55.0	0.0		66.0	10.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	A	11.10	1.539029	0.27475	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	6.07	6.07	0.98685	.	0.061060	0.85682	D	0.000000	T	0.28699	0.0711	N	0.00483	-1.445	0.41004	D	0.984953	B	0.02656	0.0	B	0.01281	0.0	T	0.30937	-0.9961	10	0.30078	T	0.28	.	10.8883	0.46981	0.9305:0.0:0.0695:0.0	.	301	P54764	EPHA4_HUMAN	R	301;301;301;250	ENSP00000281821:W301R;ENSP00000386276:W301R;ENSP00000386829:W301R;ENSP00000375923:W250R	ENSP00000281821:W301R	W	-	1	0	EPHA4	222074059	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.690000	0.54713	2.326000	0.78906	0.533000	0.62120	TGG	.	.		0.527	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
ITPR1	3708	hgsc.bcm.edu	37	3	4726008	4726008	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:4726008A>T	ENST00000443694.2	+	26	3497	c.3497A>T	c.(3496-3498)tAc>tTc	p.Y1166F	ITPR1_ENST00000456211.2_Missense_Mutation_p.Y1157F|ITPR1_ENST00000354582.6_Missense_Mutation_p.Y1181F|ITPR1_ENST00000302640.8_Missense_Mutation_p.Y1166F|ITPR1_ENST00000357086.4_Missense_Mutation_p.Y1172F|ITPR1_ENST00000423119.2_Missense_Mutation_p.Y1172F|ITPR1_ENST00000544951.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1181					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	ACCAGCAGCTACAACTACAGA	0.423																																					p.Y1172F		Atlas-SNP	.											.	ITPR1	659	.	0			c.A3515T						.						136.0	151.0	146.0					3																	4726008		1946	4127	6073	SO:0001583	missense	3708	exon29			GCAGCTACAACTA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.3497A>T	chr3.hg19:g.4726008A>T	ENSP00000401671:p.Tyr1166Phe	64.0	0.0		119.0	19.0	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	hg19	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	14.01	2.408966	0.42715	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48;-2.48	5.05	5.05	0.67936	.	0.061520	0.64402	D	0.000003	D	0.84220	0.5424	L	0.51422	1.61	0.80722	D	1	B;B	0.34372	0.318;0.451	B;B	0.32677	0.127;0.15	T	0.81464	-0.0921	10	0.10111	T	0.7	.	15.1175	0.72413	1.0:0.0:0.0:0.0	.	1181;1172	Q14643;G5E9P1	ITPR1_HUMAN;.	F	1181;1166;1181;1172;1172;1157;1166	ENSP00000306253:Y1166F;ENSP00000346595:Y1181F;ENSP00000405934:Y1172F;ENSP00000349597:Y1172F;ENSP00000397885:Y1157F;ENSP00000401671:Y1166F	ENSP00000306253:Y1166F	Y	+	2	0	ITPR1	4701008	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.825000	0.92029	2.017000	0.59298	0.455000	0.32223	TAC	.	.		0.423	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
BRPF1	7862	hgsc.bcm.edu	37	3	9784748	9784748	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:9784748A>T	ENST00000457855.1	+	6	2115	c.2104A>T	c.(2104-2106)Agc>Tgc	p.S702C	BRPF1_ENST00000424362.1_Missense_Mutation_p.S702C|BRPF1_ENST00000302054.3_Missense_Mutation_p.S702C|BRPF1_ENST00000433861.2_Missense_Mutation_p.S702C|BRPF1_ENST00000383829.2_Missense_Mutation_p.S708C			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	702	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.|Interaction with MEAF6 and ING5.|Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					CCTCATCGTCAGCAACTGCCT	0.537																																					p.S708C		Atlas-SNP	.											.	BRPF1	104	.	0			c.A2122T						.						97.0	83.0	88.0					3																	9784748		2203	4300	6503	SO:0001583	missense	7862	exon7			ATCGTCAGCAACT	M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.2104A>T	chr3.hg19:g.9784748A>T	ENSP00000410210:p.Ser702Cys	135.0	0.0		172.0	52.0	NM_001003694	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	hg19	CCDS2575.1	.	.	.	.	.	.	.	.	.	.	A	17.25	3.341200	0.60963	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	5.69	5.69	0.88448	Bromodomain (6);Bromodomain, conserved site (1);	0.189311	0.64402	D	0.000016	T	0.65026	0.2652	M	0.93507	3.425	0.40109	D	0.97646	D;P;P;P	0.56746	0.977;0.496;0.627;0.678	P;B;B;P	0.56127	0.792;0.396;0.396;0.532	T	0.76394	-0.2975	10	0.62326	D	0.03	.	15.9481	0.79809	1.0:0.0:0.0:0.0	.	702;702;708;702	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	C	702;702;708;702;702	ENSP00000402485:S702C;ENSP00000398863:S702C;ENSP00000373340:S708C;ENSP00000306297:S702C;ENSP00000410210:S702C	ENSP00000306297:S702C	S	+	1	0	BRPF1	9759748	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.238000	0.65366	2.153000	0.67306	0.533000	0.62120	AGC	.	.		0.537	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694	
ZNF619	285267	hgsc.bcm.edu	37	3	40529425	40529425	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:40529425A>T	ENST00000314686.5	+	6	1781	c.1376A>T	c.(1375-1377)cAg>cTg	p.Q459L	ZNF619_ENST00000429348.2_Missense_Mutation_p.Q475L|ZNF619_ENST00000522736.1_Missense_Mutation_p.Q466L|ZNF619_ENST00000456778.1_Missense_Mutation_p.Q431L|ZNF619_ENST00000432264.2_Missense_Mutation_p.Q475L|ZNF619_ENST00000447116.2_Missense_Mutation_p.Q515L|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000521353.1_Missense_Mutation_p.Q515L			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	459					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		ATCCAGCATCAGAAGTGGCAT	0.507																																					p.Q515L		Atlas-SNP	.											.	ZNF619	57	.	0			c.A1544T						.						117.0	94.0	102.0					3																	40529425		2203	4300	6503	SO:0001583	missense	285267	exon6			AGCATCAGAAGTG	AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.1376A>T	chr3.hg19:g.40529425A>T	ENSP00000322529:p.Gln459Leu	83.0	0.0		105.0	39.0	NM_001145082	B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	ENST00000314686.5	hg19		.	.	.	.	.	.	.	.	.	.	A	15.37	2.814170	0.50527	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000442066;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32;3.32	2.3	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10035	0.0246	L	0.29908	0.895	0.25467	N	0.987865	D;B;B;B;B;D	0.69078	0.997;0.235;0.235;0.393;0.235;0.98	P;B;B;B;B;P	0.56700	0.804;0.049;0.049;0.095;0.049;0.471	T	0.20438	-1.0275	9	0.62326	D	0.03	.	8.1652	0.31222	1.0:0.0:0.0:0.0	.	431;475;515;417;466;459	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	L	459;515;475;431;96;466;515;475	ENSP00000322529:Q459L;ENSP00000411132:Q515L;ENSP00000398024:Q475L;ENSP00000397232:Q431L;ENSP00000428004:Q466L;ENSP00000430705:Q515L;ENSP00000388710:Q475L	ENSP00000322529:Q459L	Q	+	2	0	ZNF619	40504429	0.909000	0.30893	0.837000	0.33122	0.876000	0.50452	1.489000	0.35562	1.071000	0.40834	0.379000	0.24179	CAG	.	.		0.507	ZNF619-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000254180.2	NM_173656	
NEK4	6787	hgsc.bcm.edu	37	3	52794925	52794925	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:52794925A>G	ENST00000233027.5	-	6	1051	c.849T>C	c.(847-849)aaT>aaC	p.N283N	NEK4_ENST00000535191.1_Silent_p.N194N|NEK4_ENST00000383721.4_Silent_p.N283N	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	283					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		GAGAGTCACCATTTTTAATGT	0.373																																					p.N283N		Atlas-SNP	.											.	NEK4	51	.	0			c.T849C						.						88.0	95.0	92.0					3																	52794925		2203	4300	6503	SO:0001819	synonymous_variant	6787	exon6			GTCACCATTTTTA	L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.849T>C	chr3.hg19:g.52794925A>G		61.0	0.0		75.0	20.0	NM_003157	A5YM70|B2R633|B7Z200|Q6P576	Silent	SNP	ENST00000233027.5	hg19	CCDS2863.1																																																																																			.	.		0.373	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	NM_003157	
SPICE1	152185	hgsc.bcm.edu	37	3	113218394	113218394	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:113218394T>A	ENST00000295872.4	-	4	442	c.183A>T	c.(181-183)agA>agT	p.R61S		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	61					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GTACTAATGCTCTATTCTTCG	0.358																																					p.R61S		Atlas-SNP	.											.	SPICE1	130	.	0			c.A183T						.						99.0	91.0	94.0					3																	113218394		2203	4300	6503	SO:0001583	missense	152185	exon4			TAATGCTCTATTC	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.183A>T	chr3.hg19:g.113218394T>A	ENSP00000295872:p.Arg61Ser	74.0	0.0		103.0	43.0	NM_144718	D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	hg19	CCDS2973.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.910635	0.72983	.	.	ENSG00000163611	ENST00000295872;ENST00000495812;ENST00000480527	T	0.33438	1.41	6.03	4.88	0.63580	.	0.116162	0.64402	D	0.000008	T	0.51176	0.1659	M	0.67953	2.075	0.40944	D	0.984496	D;D	0.76494	0.974;0.999	P;D	0.83275	0.647;0.996	T	0.54193	-0.8330	10	0.72032	D	0.01	-19.1278	10.0131	0.41999	0.0:0.0772:0.0:0.9228	.	73;61	B4DJN7;Q8N0Z3	.;SPICE_HUMAN	S	61	ENSP00000295872:R61S	ENSP00000295872:R61S	R	-	3	2	SPICE1	114701084	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	1.172000	0.31908	1.100000	0.41517	0.455000	0.32223	AGA	.	.		0.358	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
ARHGAP31	57514	hgsc.bcm.edu	37	3	119133709	119133709	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:119133709T>A	ENST00000264245.4	+	12	3465	c.2933T>A	c.(2932-2934)cTt>cAt	p.L978H		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	978					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TGTGCTAATCTTGAAACAGAG	0.537																																					p.L978H	Pancreas(7;176 297 5394 51128 51241)	Atlas-SNP	.											.	ARHGAP31	175	.	0			c.T2933A						.						93.0	92.0	92.0					3																	119133709		1909	4126	6035	SO:0001583	missense	57514	exon12			CTAATCTTGAAAC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2933T>A	chr3.hg19:g.119133709T>A	ENSP00000264245:p.Leu978His	66.0	0.0		107.0	32.0	NM_020754	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	hg19	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	T	9.904	1.207740	0.22205	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.09445	2.98	4.74	3.51	0.40186	.	0.298369	0.24301	N	0.039734	T	0.18593	0.0446	L	0.34521	1.04	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.01587	-1.1318	10	0.87932	D	0	.	7.1066	0.25366	0.1298:0.0:0.249:0.6213	.	978	Q2M1Z3	RHG31_HUMAN	H	978	ENSP00000264245:L978H	ENSP00000264245:L978H	L	+	2	0	ARHGAP31	120616399	0.004000	0.15560	0.277000	0.24703	0.398000	0.30690	0.365000	0.20348	1.979000	0.57680	0.379000	0.24179	CTT	.	.		0.537	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
TMEM39A	55254	hgsc.bcm.edu	37	3	119156670	119156670	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:119156670T>A	ENST00000319172.5	-	6	1276	c.856A>T	c.(856-858)Aag>Tag	p.K286*	TMEM39A_ENST00000486159.1_5'Flank	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	286						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		AGAACCTCCTTGATTCTGTGG	0.443																																					p.K286X		Atlas-SNP	.											.	TMEM39A	36	.	0			c.A856T						.						137.0	118.0	124.0					3																	119156670		2203	4300	6503	SO:0001587	stop_gained	55254	exon6			CCTCCTTGATTCT	BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.856A>T	chr3.hg19:g.119156670T>A	ENSP00000326063:p.Lys286*	107.0	0.0		173.0	36.0	NM_018266	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Nonsense_Mutation	SNP	ENST00000319172.5	hg19	CCDS2987.1	.	.	.	.	.	.	.	.	.	.	T	39	7.906291	0.98554	.	.	ENSG00000176142	ENST00000319172;ENST00000491685	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6791	14.7932	0.69857	0.0:0.0:0.0:1.0	.	.	.	.	X	286;132	.	ENSP00000326063:K286X	K	-	1	0	TMEM39A	120639360	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.974000	0.70465	2.090000	0.63153	0.528000	0.53228	AAG	.	.		0.443	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266	
POLQ	10721	hgsc.bcm.edu	37	3	121208682	121208682	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:121208682T>A	ENST00000264233.5	-	16	3224	c.3096A>T	c.(3094-3096)tcA>tcT	p.S1032S		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1032					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCATCTTTTCTGAATTGAAAT	0.423								DNA polymerases (catalytic subunits)																													p.S1032S	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.A3096T						.						66.0	74.0	72.0					3																	121208682		2202	4300	6502	SO:0001819	synonymous_variant	10721	exon16			CTTTTCTGAATTG	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3096A>T	chr3.hg19:g.121208682T>A		57.0	0.0		89.0	15.0	NM_199420	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	hg19	CCDS33833.1																																																																																			.	.		0.423	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
IGSF10	285313	hgsc.bcm.edu	37	3	151171236	151171236	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:151171236A>T	ENST00000282466.3	-	3	650	c.651T>A	c.(649-651)caT>caA	p.H217Q		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	217					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATGGGTTTCCATGCAGGTAAA	0.418																																					p.H217Q		Atlas-SNP	.											.	IGSF10	279	.	0			c.T651A						.						106.0	106.0	106.0					3																	151171236		2203	4300	6503	SO:0001583	missense	285313	exon3			GTTTCCATGCAGG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.651T>A	chr3.hg19:g.151171236A>T	ENSP00000282466:p.His217Gln	148.0	0.0		177.0	32.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	hg19	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	A	18.55	3.648957	0.67358	.	.	ENSG00000152580	ENST00000282466	T	0.51817	0.69	5.1	-3.11	0.05299	.	0.000000	0.47455	D	0.000230	T	0.51890	0.1701	L	0.38692	1.165	0.33480	D	0.587312	D	0.89917	1.0	D	0.71414	0.973	T	0.60276	-0.7295	10	0.87932	D	0	.	12.5991	0.56487	0.5541:0.0:0.4459:0.0	.	217	Q6WRI0	IGS10_HUMAN	Q	217	ENSP00000282466:H217Q	ENSP00000282466:H217Q	H	-	3	2	IGSF10	152653926	0.887000	0.30362	0.954000	0.39281	0.951000	0.60555	0.174000	0.16743	-0.907000	0.03862	-0.256000	0.11100	CAT	.	.		0.418	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
PLCH1	23007	hgsc.bcm.edu	37	3	155198967	155198967	+	Silent	SNP	A	A	T	rs201081912	byFrequency	TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:155198967A>T	ENST00000340059.7	-	23	4871	c.4872T>A	c.(4870-4872)ccT>ccA	p.P1624P	PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Silent_p.P1586P|PLCH1_ENST00000414191.1_Silent_p.P1586P|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Silent_p.P1586P	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1624					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GATTCACTGCAGGGGTGGGTG	0.582																																					p.P1624P		Atlas-SNP	.											.	PLCH1	406	.	0			c.T4872A						.						101.0	103.0	102.0					3																	155198967		2203	4300	6503	SO:0001819	synonymous_variant	23007	exon23			CACTGCAGGGGTG	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4872T>A	chr3.hg19:g.155198967A>T		117.0	0.0		163.0	62.0	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Silent	SNP	ENST00000340059.7	hg19	CCDS46939.1																																																																																			.	A|0.999;G|0.001		0.582	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
GMPS	8833	hgsc.bcm.edu	37	3	155640020	155640020	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:155640020A>G	ENST00000496455.2	+	11	1698	c.1363A>G	c.(1363-1365)Att>Gtt	p.I455V	GMPS_ENST00000295920.7_Missense_Mutation_p.I356V	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	455					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	AGAACCTTATATTTGTAAGGA	0.289			T	MLL	AML																																p.I455V	Ovarian(153;896 1876 4149 15499 28134)	Atlas-SNP	.		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	.	GMPS	70	.	0			c.A1363G						.						34.0	32.0	33.0					3																	155640020		1799	4056	5855	SO:0001583	missense	8833	exon11			CCTTATATTTGTA	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1363A>G	chr3.hg19:g.155640020A>G	ENSP00000419851:p.Ile455Val	357.0	0.0		539.0	179.0	NM_003875	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	hg19	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	A	11.02	1.516799	0.27123	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.78	4.65	0.58169	.	0.372923	0.27331	N	0.019854	T	0.28466	0.0704	N	0.16567	0.415	0.42271	D	0.99205	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.19386	-1.0307	9	0.14656	T	0.56	-9.6857	3.3371	0.07105	0.6703:0.0:0.3297:0.0	.	356;455	F8W720;P49915	.;GUAA_HUMAN	V	455;356;404;455	.	ENSP00000295920:I356V	I	+	1	0	GMPS	157122714	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.783000	0.55409	2.191000	0.70037	0.528000	0.53228	ATT	.	.		0.289	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2		
OPA1	4976	hgsc.bcm.edu	37	3	193353249	193353249	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:193353249A>T	ENST00000392438.3	+	7	955	c.721A>T	c.(721-723)Aaa>Taa	p.K241*	OPA1_ENST00000361908.3_Nonsense_Mutation_p.K278*|OPA1_ENST00000361828.2_Nonsense_Mutation_p.K259*|OPA1_ENST00000361150.2_Nonsense_Mutation_p.K242*|OPA1_ENST00000361510.2_Nonsense_Mutation_p.K296*|OPA1_ENST00000361715.2_Nonsense_Mutation_p.K260*	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	241					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AAAGGAGAACAAAGAATTGAG	0.284																																					p.K296X		Atlas-SNP	.											.	OPA1	79	.	0			c.A886T						.						93.0	105.0	101.0					3																	193353249		2202	4297	6499	SO:0001587	stop_gained	4976	exon9			GAGAACAAAGAAT	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.721A>T	chr3.hg19:g.193353249A>T	ENSP00000376233:p.Lys241*	230.0	0.0		340.0	89.0	NM_130837	D3DNW4	Nonsense_Mutation	SNP	ENST00000392438.3	hg19	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	A	39	7.583455	0.98371	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	.	.	.	5.72	5.72	0.89469	.	0.125406	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.946	15.2015	0.73142	1.0:0.0:0.0:0.0	.	.	.	.	X	278;241;296;260;259;242	.	ENSP00000354781:K242X	K	+	1	0	OPA1	194835943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.310000	0.96267	2.174000	0.68829	0.533000	0.62120	AAA	.	.		0.284	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
UBXN7	26043	hgsc.bcm.edu	37	3	196096315	196096315	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:196096315A>G	ENST00000296328.4	-	7	757	c.683T>C	c.(682-684)gTt>gCt	p.V228A	UBXN7_ENST00000535858.1_Missense_Mutation_p.V80A|UBXN7_ENST00000428095.1_Missense_Mutation_p.V66A	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	228						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CAATATGGAAACATAGGGGAA	0.333																																					p.V228A		Atlas-SNP	.											.	UBXN7	43	.	0			c.T683C						.						93.0	91.0	92.0					3																	196096315		1822	4087	5909	SO:0001583	missense	26043	exon7			ATGGAAACATAGG	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.683T>C	chr3.hg19:g.196096315A>G	ENSP00000296328:p.Val228Ala	54.0	0.0		94.0	20.0	NM_015562	D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	hg19	CCDS43191.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.183091	0.78677	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	T;T;T	0.46819	0.86;0.86;0.86	5.45	5.45	0.79879	UAS (1);	0.053561	0.85682	D	0.000000	T	0.58438	0.2122	M	0.79614	2.46	0.58432	D	0.999996	B	0.25563	0.129	B	0.37387	0.248	T	0.61816	-0.6985	10	0.72032	D	0.01	-15.1313	15.6711	0.77274	1.0:0.0:0.0:0.0	.	228	O94888	UBXN7_HUMAN	A	228;66;80	ENSP00000296328:V228A;ENSP00000397256:V66A;ENSP00000440716:V80A	ENSP00000296328:V228A	V	-	2	0	UBXN7	197580712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.874000	0.92363	2.285000	0.76669	0.477000	0.44152	GTT	.	.		0.333	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353	
FBXO45	200933	hgsc.bcm.edu	37	3	196296086	196296086	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:196296086G>C	ENST00000311630.6	+	1	528	c.231G>C	c.(229-231)gaG>gaC	p.E77D	WDR53_ENST00000433160.1_5'Flank|WDR53_ENST00000429115.1_5'Flank|FBXO45_ENST00000440469.1_Intron|WDR53_ENST00000332629.5_5'Flank	NM_001105573.1	NP_001099043.1	P0C2W1	FBSP1_HUMAN	F-box protein 45	77	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				anterior commissure morphogenesis (GO:0021960)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|corticospinal tract morphogenesis (GO:0021957)|neuron migration (GO:0001764)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|synapse assembly involved in innervation (GO:0060386)	cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	7	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		AGAACAGCGAGGTGTGGCGGA	0.647																																					p.E77D		Atlas-SNP	.											.	FBXO45	18	.	0			c.G231C						.						9.0	13.0	12.0					3																	196296086		2133	4262	6395	SO:0001583	missense	200933	exon1			CAGCGAGGTGTGG	AK025697	CCDS46985.1	3q29	2008-02-05			ENSG00000174013	ENSG00000174013		"""F-boxes /  ""other"""""	29148	protein-coding gene	gene with protein product		609112					Standard	NM_001105573		Approved	Fbx45	uc010iai.3	P0C2W1	OTTHUMG00000155571	ENST00000311630.6:c.231G>C	chr3.hg19:g.196296086G>C	ENSP00000310332:p.Glu77Asp	59.0	0.0		84.0	19.0	NM_001105573	A6NF90|D3DXB5	Missense_Mutation	SNP	ENST00000311630.6	hg19	CCDS46985.1	.	.	.	.	.	.	.	.	.	.	g	13.08	2.131818	0.37630	.	.	ENSG00000174013	ENST00000311630	T	0.45276	0.9	5.17	5.17	0.71159	Concanavalin A-like lectin/glucanase (1);F-box domain, cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.22859	0.0552	N	0.12471	0.22	0.58432	D	0.999997	B	0.09022	0.002	B	0.10450	0.005	T	0.09143	-1.0688	10	0.08381	T	0.77	-7.3865	12.1856	0.54236	0.0781:0.0:0.9219:0.0	.	77	P0C2W1	FBSP1_HUMAN	D	77	ENSP00000310332:E77D	ENSP00000310332:E77D	E	+	3	2	FBXO45	197780483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.794000	0.69067	2.427000	0.82271	0.533000	0.62120	GAG	.	.		0.647	FBXO45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340687.2		
IQCG	84223	hgsc.bcm.edu	37	3	197640825	197640825	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:197640825T>A	ENST00000265239.6	-	8	1239	c.815A>T	c.(814-816)aAt>aTt	p.N272I	IQCG_ENST00000455191.1_Missense_Mutation_p.N272I|IQCG_ENST00000453254.1_Missense_Mutation_p.N272I	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	272						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CAGCTCGGTATTGGTTTTCAT	0.443																																					p.N272I		Atlas-SNP	.											.	IQCG	44	.	0			c.A815T						.						366.0	342.0	350.0					3																	197640825		2203	4300	6503	SO:0001583	missense	84223	exon8			TCGGTATTGGTTT	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.815A>T	chr3.hg19:g.197640825T>A	ENSP00000265239:p.Asn272Ile	114.0	0.0		127.0	34.0	NM_032263	Q9BST2|Q9HAG8	Missense_Mutation	SNP	ENST00000265239.6	hg19	CCDS3331.1	.	.	.	.	.	.	.	.	.	.	T	9.511	1.105764	0.20632	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254	T;T;T	0.47528	0.84;0.84;0.97	5.92	3.53	0.40419	.	0.201209	0.42294	N	0.000736	T	0.38532	0.1044	L	0.56769	1.78	0.09310	N	0.999999	P;B	0.40332	0.713;0.141	B;B	0.36845	0.234;0.04	T	0.28299	-1.0048	10	0.39692	T	0.17	-21.1296	6.8248	0.23876	0.1365:0.0739:0.0:0.7896	.	272;272	C9JKX8;Q9H095	.;IQCG_HUMAN	I	272	ENSP00000265239:N272I;ENSP00000407736:N272I;ENSP00000389897:N272I	ENSP00000265239:N272I	N	-	2	0	IQCG	199125222	0.890000	0.30428	0.096000	0.21009	0.416000	0.31233	1.529000	0.35996	1.038000	0.40049	0.519000	0.50382	AAT	.	.		0.443	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1	NM_032263	
OTOP1	133060	hgsc.bcm.edu	37	4	4228281	4228281	+	Missense_Mutation	SNP	A	A	T	rs111245977|rs75328065		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:4228281A>T	ENST00000296358.4	-	1	335	c.311T>A	c.(310-312)cTg>cAg	p.L104Q		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CATCCACAGCAGCTGCAGCAG	0.721																																					p.L104Q		Atlas-SNP	.											.	OTOP1	118	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.T311A						.						10.0	11.0	11.0					4																	4228281		2088	4090	6178	SO:0001583	missense	133060	exon1			CACAGCAGCTGCA	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.311T>A	chr4.hg19:g.4228281A>T	ENSP00000296358:p.Leu104Gln	39.0	0.0		44.0	11.0	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	hg19	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403491	0.83230	.	.	ENSG00000163982	ENST00000296358	T	0.11385	2.78	3.55	3.55	0.40652	.	0.088508	0.47455	U	0.000238	T	0.17492	0.0420	L	0.34521	1.04	0.54753	D	0.999988	D	0.58620	0.983	P	0.58660	0.843	T	0.01390	-1.1367	10	0.59425	D	0.04	.	12.2771	0.54741	1.0:0.0:0.0:0.0	.	104	Q7RTM1	OTOP1_HUMAN	Q	104	ENSP00000296358:L104Q	ENSP00000296358:L104Q	L	-	2	0	OTOP1	4279182	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.287000	0.78681	1.490000	0.48466	0.352000	0.21897	CTG	.	.		0.721	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
ATP10D	57205	hgsc.bcm.edu	37	4	47548881	47548881	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:47548881T>C	ENST00000273859.3	+	10	1904		c.e10+2		ATP10D_ENST00000504445.1_Missense_Mutation_p.V531A	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						AGCCCCATTGTAAGTATGAAT	0.438																																					.		Atlas-SNP	.											.	ATP10D	168	.	0			c.1635+2T>C						.						45.0	46.0	46.0					4																	47548881		2203	4300	6503	SO:0001630	splice_region_variant	57205	exon10			CCATTGTAAGTAT	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1635+2T>C	chr4.hg19:g.47548881T>C		76.0	0.0		88.0	10.0	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Splice_Site	SNP	ENST00000273859.3	hg19	CCDS3476.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.81|15.81	2.943060|2.943060	0.53079|0.53079	.|.	.|.	ENSG00000145246|ENSG00000145246	ENST00000273859|ENST00000504445	.|T	.|0.03065	.|4.06	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|.	.|.	.|.	.|.	.|T	.|0.15912	.|0.0383	.|.	.|.	.|.	0.30792|0.30792	N|N	0.740796|0.740796	.|D	.|0.76494	.|0.999	.|D	.|0.78314	.|0.991	.|T	.|0.01045	.|-1.1470	.|7	.|.	.|.	.|.	.|.	14.0599|14.0599	0.64793|0.64793	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|531	.|Q6PEW3	.|.	.|A	-1|531	.|ENSP00000420909:V531A	.|.	.|V	+|+	.|2	.|0	ATP10D|ATP10D	47243638|47243638	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.535000|0.535000	0.34838|0.34838	7.310000|7.310000	0.78947|0.78947	2.113000|2.113000	0.64589|0.64589	0.402000|0.402000	0.26972|0.26972	.|GTA	.	.		0.438	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	Intron
UGT2B17	7367	hgsc.bcm.edu	37	4	69434019	69434019	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:69434019T>A	ENST00000317746.2	-	1	226	c.184A>T	c.(184-186)Att>Ttt	p.I62F		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	62					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	TTGACAAGAATAGAAGCCGAA	0.358																																					p.I62F	Melanoma(18;649 833 28984 37818 38500)	Atlas-SNP	.											.	UGT2B17	34	.	0			c.A184T						.						129.0	131.0	130.0					4																	69434019		2091	3964	6055	SO:0001583	missense	7367	exon1			CAAGAATAGAAGC	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.184A>T	chr4.hg19:g.69434019T>A	ENSP00000320401:p.Ile62Phe	203.0	0.0		219.0	103.0	NM_001077		Missense_Mutation	SNP	ENST00000317746.2	hg19	CCDS3523.1	.	.	.	.	.	.	.	.	.	.	t	6.938	0.542774	0.13250	.	.	ENSG00000197888	ENST00000317746	T	0.60920	0.15	2.66	-5.33	0.02713	.	0.257987	0.29692	U	0.011453	T	0.40272	0.1110	L	0.35854	1.095	0.09310	N	1	.	.	.	.	.	.	T	0.35226	-0.9797	8	0.36615	T	0.2	.	5.1473	0.14991	0.154:0.4519:0.0:0.3941	.	.	.	.	F	62	ENSP00000320401:I62F	ENSP00000320401:I62F	I	-	1	0	UGT2B17	69116614	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.169000	0.03120	-1.056000	0.03205	0.409000	0.27619	ATT	.	.		0.358	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	DSPP_ENST00000399271.1_Silent_p.S874S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2622T						.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	chr4.hg19:g.88536436C>T		205.0	0.0		188.0	19.0	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
MMRN1	22915	hgsc.bcm.edu	37	4	90857648	90857648	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:90857648A>T	ENST00000394980.1	+	7	3136	c.2817A>T	c.(2815-2817)tcA>tcT	p.S939S	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000508372.1_Silent_p.S681S|MMRN1_ENST00000264790.2_Silent_p.S939S			Q13201	MMRN1_HUMAN	multimerin 1	939					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CAAGTGTGTCAGAACTGAATG	0.358																																					p.S939S		Atlas-SNP	.											.	MMRN1	174	.	0			c.A2817T						.						72.0	71.0	72.0					4																	90857648		2203	4299	6502	SO:0001819	synonymous_variant	22915	exon6			TGTGTCAGAACTG	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2817A>T	chr4.hg19:g.90857648A>T		95.0	0.0		81.0	15.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	hg19	CCDS3635.1																																																																																			.	.		0.358	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
EGF	1950	hgsc.bcm.edu	37	4	110882063	110882063	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:110882063T>A	ENST00000265171.5	+	7	1552	c.1107T>A	c.(1105-1107)ctT>ctA	p.L369L	EGF_ENST00000509793.1_Silent_p.L327L|EGF_ENST00000503392.1_Silent_p.L369L	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	369	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GCTGTACTCTTGGGTGTAAAA	0.393																																					p.L369L		Atlas-SNP	.											.	EGF	113	.	0			c.T1107A						.						254.0	224.0	234.0					4																	110882063		2203	4300	6503	SO:0001819	synonymous_variant	1950	exon7			TACTCTTGGGTGT	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1107T>A	chr4.hg19:g.110882063T>A		116.0	0.0		108.0	30.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Silent	SNP	ENST00000265171.5	hg19	CCDS3689.1																																																																																			.	.		0.393	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
MYOZ2	51778	hgsc.bcm.edu	37	4	120072181	120072181	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:120072181T>A	ENST00000307128.5	+	3	444	c.231T>A	c.(229-231)tcT>tcA	p.S77S		NM_016599.4	NP_057683.1			myozenin 2											endometrium(1)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						AGTATCAATCTAGAGCACAAA	0.338																																					p.S77S		Atlas-SNP	.											.	MYOZ2	34	.	0			c.T231A						.						87.0	84.0	85.0					4																	120072181		2203	4300	6503	SO:0001819	synonymous_variant	51778	exon3			TCAATCTAGAGCA	AF249873	CCDS3711.1	4q26-q27	2014-09-17	2002-01-07	2002-01-11	ENSG00000172399	ENSG00000172399			1330	protein-coding gene	gene with protein product		605602	"""chromosome 4 open reading frame 5"""	C4orf5		8619474, 9110174	Standard	NM_016599		Approved	CS-1	uc003icp.4	Q9NPC6	OTTHUMG00000132968	ENST00000307128.5:c.231T>A	chr4.hg19:g.120072181T>A		95.0	0.0		77.0	14.0	NM_016599		Silent	SNP	ENST00000307128.5	hg19	CCDS3711.1																																																																																			.	.		0.338	MYOZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256526.2		
BBS7	55212	hgsc.bcm.edu	37	4	122789150	122789150	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:122789150T>A	ENST00000264499.4	-	2	271	c.88A>T	c.(88-90)Aga>Tga	p.R30*	RP11-63B13.1_ENST00000567769.1_lincRNA|BBS7_ENST00000506636.1_Nonsense_Mutation_p.R30*	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	30					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TGTGTAGCTCTGTGTCTTGAG	0.373									Bardet-Biedl syndrome																												p.R30X		Atlas-SNP	.											.	BBS7	61	.	0			c.A88T						.						163.0	154.0	157.0					4																	122789150		2203	4300	6503	SO:0001587	stop_gained	55212	exon2	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TAGCTCTGTGTCT	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.88A>T	chr4.hg19:g.122789150T>A	ENSP00000264499:p.Arg30*	80.0	0.0		89.0	27.0	NM_018190	Q4W5P8|Q8N581|Q9NVI4	Nonsense_Mutation	SNP	ENST00000264499.4	hg19	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	T	37	6.436395	0.97564	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	.	.	.	5.56	4.35	0.52113	.	0.197163	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-6.7128	11.5063	0.50468	0.0:0.0:0.2858:0.7142	.	.	.	.	X	30	.	ENSP00000264499:R30X	R	-	1	2	BBS7	123008600	1.000000	0.71417	0.324000	0.25361	0.905000	0.53344	4.325000	0.59234	0.902000	0.36520	0.533000	0.62120	AGA	.	.		0.373	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1		
PCDH18	54510	hgsc.bcm.edu	37	4	138442493	138442493	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:138442493T>A	ENST00000344876.4	-	4	3484	c.3098A>T	c.(3097-3099)aAc>aTc	p.N1033I	PCDH18_ENST00000507846.1_Missense_Mutation_p.N812I|PCDH18_ENST00000511115.1_Missense_Mutation_p.N213I|PCDH18_ENST00000510305.1_Missense_Mutation_p.N244I|PCDH18_ENST00000412923.2_Missense_Mutation_p.N1032I	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	1033	Interaction with DAB1. {ECO:0000250}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CTCCAGGGAGTTGGACCGATC	0.562																																					p.N1033I		Atlas-SNP	.											.	PCDH18	229	.	0			c.A3098T						.						61.0	58.0	59.0					4																	138442493		2203	4300	6503	SO:0001583	missense	54510	exon4			AGGGAGTTGGACC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.3098A>T	chr4.hg19:g.138442493T>A	ENSP00000355082:p.Asn1033Ile	98.0	0.0		97.0	30.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	hg19	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.679730	0.29783	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305;ENST00000511115	T;T;T;T;T	0.54071	0.68;0.69;0.59;1.5;1.51	4.77	2.36	0.29203	.	0.000000	0.46758	D	0.000265	T	0.35393	0.0930	N	0.22421	0.69	0.37443	D	0.914523	P;B;B;B	0.36249	0.545;0.309;0.231;0.309	B;B;B;B	0.36289	0.221;0.109;0.159;0.109	T	0.37888	-0.9686	10	0.72032	D	0.01	.	7.8874	0.29659	0.0:0.2394:0.0:0.7606	.	213;812;1032;1033	B4DLR6;D6RIG4;Q9HCL0-2;Q9HCL0	.;.;.;PCD18_HUMAN	I	1033;1032;812;244;213	ENSP00000355082:N1033I;ENSP00000390688:N1032I;ENSP00000425903:N812I;ENSP00000424269:N244I;ENSP00000425647:N213I	ENSP00000355082:N1033I	N	-	2	0	PCDH18	138661943	1.000000	0.71417	0.988000	0.46212	0.896000	0.52359	1.184000	0.32053	0.682000	0.31407	0.482000	0.46254	AAC	.	.		0.562	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
DCHS2	54798	hgsc.bcm.edu	37	4	155156629	155156629	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:155156629T>A	ENST00000357232.4	-	25	7809	c.7810A>T	c.(7810-7812)Agt>Tgt	p.S2604C		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2604					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACCTCGTTACTGCAGTCGTCA	0.458																																					p.S2604C		Atlas-SNP	.											.	DCHS2	594	.	0			c.A7810T						.						124.0	125.0	125.0					4																	155156629		2203	4300	6503	SO:0001583	missense	54798	exon25			CGTTACTGCAGTC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7810A>T	chr4.hg19:g.155156629T>A	ENSP00000349768:p.Ser2604Cys	80.0	0.0		62.0	20.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	hg19	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.348529	0.24426	.	.	ENSG00000197410	ENST00000357232	T	0.55588	0.51	5.82	-2.84	0.05751	.	1.239470	0.05135	N	0.493223	T	0.41604	0.1166	N	0.22421	0.69	0.09310	N	1	D	0.56287	0.975	B	0.43103	0.408	T	0.51980	-0.8636	10	0.51188	T	0.08	.	13.3492	0.60593	0.0:0.5699:0.0:0.4301	.	2604	Q6V1P9	PCD23_HUMAN	C	2604	ENSP00000349768:S2604C	ENSP00000349768:S2604C	S	-	1	0	DCHS2	155376079	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.569000	0.05902	-0.337000	0.08426	0.383000	0.25322	AGT	.	.		0.458	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
MARCH1	55016	hgsc.bcm.edu	37	4	165118291	165118291	+	Intron	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr4:165118291C>A	ENST00000503008.1	-	2	864				MARCH1_ENST00000514618.1_Intron|MARCH1_ENST00000508725.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				caccttcctcctcctcctcct	0.552																																					p.E191D		Atlas-SNP	.											.	ANP32C	59	.	0			c.G573T						.						175.0	137.0	150.0					4																	165118291		2203	4300	6503	SO:0001627	intron_variant	23520	exon1			TTCCTCCTCCTCC	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85477G>T	chr4.hg19:g.165118291C>A		71.0	0.0		72.0	25.0	NM_012403	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	hg19	CCDS54814.1																																																																																			.	.		0.552	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
ADCY2	108	hgsc.bcm.edu	37	5	7707845	7707845	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:7707845T>A	ENST00000338316.4	+	9	1384	c.1295T>A	c.(1294-1296)cTg>cAg	p.L432Q	ADCY2_ENST00000537121.1_Missense_Mutation_p.L252Q|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	432					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCTGTCACCCTGGAGCACTTG	0.398																																					p.L432Q		Atlas-SNP	.											.	ADCY2	337	.	0			c.T1295A						.						122.0	121.0	121.0					5																	7707845		2203	4300	6503	SO:0001583	missense	108	exon9			TCACCCTGGAGCA	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1295T>A	chr5.hg19:g.7707845T>A	ENSP00000342952:p.Leu432Gln	97.0	0.0		118.0	24.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	hg19	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	T	31	5.095374	0.94197	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.85411	-1.98;-1.98	5.85	5.85	0.93711	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000002	D	0.91277	0.7250	M	0.64567	1.98	0.49299	D	0.999772	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.991	D	0.92078	0.5670	10	0.87932	D	0	.	16.2378	0.82389	0.0:0.0:0.0:1.0	.	252;432	B7Z2C1;Q08462	.;ADCY2_HUMAN	Q	432;283;252	ENSP00000342952:L432Q;ENSP00000444803:L252Q	ENSP00000342952:L432Q	L	+	2	0	ADCY2	7760845	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.704000	0.84595	2.228000	0.72767	0.528000	0.53228	CTG	.	.		0.398	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
CTNND2	1501	hgsc.bcm.edu	37	5	11385034	11385034	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:11385034A>T	ENST00000304623.8	-	7	1109	c.920T>A	c.(919-921)cTg>cAg	p.L307Q	CTNND2_ENST00000458100.2_Intron|CTNND2_ENST00000503622.1_Intron|CTNND2_ENST00000511377.1_Missense_Mutation_p.L216Q|CTNND2_ENST00000359640.2_Missense_Mutation_p.L307Q|CTNND2_ENST00000495388.2_5'Flank	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	307					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGACTTGGCCAGGCGGCTGGG	0.746																																					p.L307Q		Atlas-SNP	.											.	CTNND2	289	.	0			c.T920A						.						46.0	53.0	51.0					5																	11385034		2194	4296	6490	SO:0001583	missense	1501	exon7			TTGGCCAGGCGGC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.920T>A	chr5.hg19:g.11385034A>T	ENSP00000307134:p.Leu307Gln	24.0	0.0		39.0	6.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	hg19	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378929	0.82682	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377	T;T;T	0.79352	-1.19;-1.26;-1.16	3.61	3.61	0.41365	.	0.472817	0.15959	U	0.236371	T	0.81866	0.4913	L	0.40543	1.245	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.78455	-0.2197	10	0.35671	T	0.21	-4.8029	11.8549	0.52431	1.0:0.0:0.0:0.0	.	307	Q9UQB3	CTND2_HUMAN	Q	307;307;216	ENSP00000307134:L307Q;ENSP00000352661:L307Q;ENSP00000426510:L216Q	ENSP00000307134:L307Q	L	-	2	0	CTNND2	11438034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.016000	0.64041	1.249000	0.43950	0.379000	0.24179	CTG	.	.		0.746	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
DNAH5	1767	hgsc.bcm.edu	37	5	13716756	13716756	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:13716756T>A	ENST00000265104.4	-	74	12853	c.12749A>T	c.(12748-12750)cAa>cTa	p.Q4250L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4250					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCTCCATATTGAATCTCTCC	0.383									Kartagener syndrome																												p.Q4250L		Atlas-SNP	.											.	DNAH5	868	.	0			c.A12749T						.						101.0	87.0	92.0					5																	13716756		2203	4300	6503	SO:0001583	missense	1767	exon74	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CCATATTGAATCT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12749A>T	chr5.hg19:g.13716756T>A	ENSP00000265104:p.Gln4250Leu	64.0	0.0		86.0	24.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.056780	0.76074	.	.	ENSG00000039139	ENST00000265104	T	0.07216	3.21	5.53	5.53	0.82687	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	M	0.89658	3.05	0.80722	D	1	P	0.51057	0.941	P	0.51742	0.678	T	0.20907	-1.0261	10	0.72032	D	0.01	.	15.682	0.77376	0.0:0.0:0.0:1.0	.	4250	Q8TE73	DYH5_HUMAN	L	4250	ENSP00000265104:Q4250L	ENSP00000265104:Q4250L	Q	-	2	0	DNAH5	13769756	1.000000	0.71417	0.844000	0.33320	0.427000	0.31564	8.020000	0.88740	2.112000	0.64535	0.528000	0.53228	CAA	.	.		0.383	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
CDH18	1016	hgsc.bcm.edu	37	5	19483513	19483513	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:19483513T>G	ENST00000507958.1	-	14	2769	c.1779A>C	c.(1777-1779)agA>agC	p.R593S	CDH18_ENST00000502796.1_Missense_Mutation_p.E557A|CDH18_ENST00000382275.1_Missense_Mutation_p.R593S|CDH18_ENST00000274170.4_Missense_Mutation_p.R593S|CDH18_ENST00000506372.1_Missense_Mutation_p.E558A			Q13634	CAD18_HUMAN	cadherin 18, type 2	593	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CACGCCCATCTCTCTCGCATG	0.522																																					p.R593S		Atlas-SNP	.											.	CDH18	561	.	0			c.A1779C						.						82.0	71.0	74.0					5																	19483513		2203	4300	6503	SO:0001583	missense	1016	exon12			CCCATCTCTCTCG	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1779A>C	chr5.hg19:g.19483513T>G	ENSP00000425093:p.Arg593Ser	133.0	0.0		171.0	43.0	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.260|6.260	0.416029|0.416029	0.11870|0.11870	.|.	.|.	ENSG00000145526|ENSG00000145526	ENST00000506372;ENST00000502796;ENST00000515257|ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T|T;T;T	0.60040|0.56444	0.22;0.22;0.54|0.46;0.46;0.46	5.54|5.54	4.39|4.39	0.52855|0.52855	.|Cadherin (2);	.|0.052910	.|0.64402	.|D	.|0.000001	T|T	0.29389|0.29389	0.0732|0.0732	N|N	0.10760|0.10760	0.04|0.04	0.49299|0.49299	D|D	0.999777|0.999777	B|B	0.02656|0.11235	0.0|0.004	B|B	0.01281|0.10450	0.0|0.005	T|T	0.06041|0.06041	-1.0849|-1.0849	8|9	.|.	.|.	.|.	.|.	9.9917|9.9917	0.41874|0.41874	0.0:0.0796:0.0:0.9204|0.0:0.0796:0.0:0.9204	.|.	557|593	B4DHG6|Q13634	.|CAD18_HUMAN	A|S	558;557;424|593	ENSP00000424931:E558A;ENSP00000422138:E557A;ENSP00000427383:E424A|ENSP00000371710:R593S;ENSP00000425093:R593S;ENSP00000274170:R593S	.|.	E|R	-|-	2|3	0|2	CDH18|CDH18	19519270|19519270	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.310000|1.310000	0.33551|0.33551	0.962000|0.962000	0.38057|0.38057	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.	.		0.522	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
CDH6	1004	hgsc.bcm.edu	37	5	31322954	31322954	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:31322954C>T	ENST00000265071.2	+	12	2177	c.1912C>T	c.(1912-1914)Cgg>Tgg	p.R638W		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	638					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AGCTCTGAGGCGGCAGCGAAA	0.458																																					p.R638W		Atlas-SNP	.											.	CDH6	175	.	0			c.C1912T						.						77.0	78.0	78.0					5																	31322954		2203	4300	6503	SO:0001583	missense	1004	exon12			CTGAGGCGGCAGC	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1912C>T	chr5.hg19:g.31322954C>T	ENSP00000265071:p.Arg638Trp	73.0	0.0		114.0	27.0	NM_004932	A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	hg19	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950394	0.73787	.	.	ENSG00000113361	ENST00000265071	T	0.80033	-1.33	5.42	4.54	0.55810	Cadherin, cytoplasmic domain (1);	0.050614	0.85682	D	0.000000	D	0.92110	0.7499	M	0.93808	3.46	0.54753	D	0.999984	D	0.89917	1.0	D	0.91635	0.999	D	0.94208	0.7456	10	0.87932	D	0	.	15.7166	0.77672	0.138:0.862:0.0:0.0	.	638	P55285	CADH6_HUMAN	W	638	ENSP00000265071:R638W	ENSP00000265071:R638W	R	+	1	2	CDH6	31358711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.766000	0.38491	1.387000	0.46486	0.591000	0.81541	CGG	.	.		0.458	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
DROSHA	29102	hgsc.bcm.edu	37	5	31472271	31472271	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:31472271C>G	ENST00000511367.2	-	16	2384	c.2140G>C	c.(2140-2142)Gtg>Ctg	p.V714L	DROSHA_ENST00000442743.1_Missense_Mutation_p.V677L|DROSHA_ENST00000513349.1_Missense_Mutation_p.V677L|DROSHA_ENST00000344624.3_Missense_Mutation_p.V714L	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	714	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TCCTCAGGCACCAGGGCTTTG	0.517																																					p.V714L		Atlas-SNP	.											.	DROSHA	130	.	0			c.G2140C						.						128.0	126.0	126.0					5																	31472271		2041	4191	6232	SO:0001583	missense	29102	exon16			CAGGCACCAGGGC	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.2140G>C	chr5.hg19:g.31472271C>G	ENSP00000425979:p.Val714Leu	136.0	0.0		184.0	42.0	NM_013235	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	hg19	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300245	0.81136	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	T;T;T;T	0.52057	1.29;1.29;0.68;0.68	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.52208	0.1720	M	0.71581	2.175	0.80722	D	1	P;B	0.42357	0.777;0.131	B;B	0.38803	0.282;0.119	T	0.60403	-0.7270	10	0.72032	D	0.01	-20.8766	19.7815	0.96417	0.0:1.0:0.0:0.0	.	677;714	E7EMP9;Q9NRR4	.;RNC_HUMAN	L	714;714;677;677;639;670	ENSP00000425979:V714L;ENSP00000339845:V714L;ENSP00000409335:V677L;ENSP00000424161:V677L	ENSP00000265075:V639L	V	-	1	0	DROSHA	31508028	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.352000	0.79404	2.746000	0.94184	0.655000	0.94253	GTG	.	.		0.517	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	
NIPBL	25836	hgsc.bcm.edu	37	5	37049313	37049313	+	Silent	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:37049313G>A	ENST00000282516.8	+	40	7363	c.6864G>A	c.(6862-6864)gaG>gaA	p.E2288E	NIPBL_ENST00000448238.2_Silent_p.E2288E	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2288					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGGTGCTTGAGGCATTTTTTC	0.413																																					p.E2288E		Atlas-SNP	.											.	NIPBL	513	.	0			c.G6864A						.						220.0	209.0	213.0					5																	37049313		2203	4300	6503	SO:0001819	synonymous_variant	25836	exon40			GCTTGAGGCATTT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6864G>A	chr5.hg19:g.37049313G>A		92.0	0.0		136.0	30.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.		0.413	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
MOCS2	4338	hgsc.bcm.edu	37	5	52404403	52404403	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:52404403T>A	ENST00000361377.4	-	2	130	c.89A>T	c.(88-90)cAa>cTa	p.Q30L	MOCS2_ENST00000527216.1_Missense_Mutation_p.Q25L|CTD-2366F13.1_ENST00000502171.2_RNA|MOCS2_ENST00000450852.3_Missense_Mutation_p.Q30L|MOCS2_ENST00000396954.3_5'UTR|MOCS2_ENST00000584946.1_Missense_Mutation_p.Q30L|CTD-2366F13.1_ENST00000512301.1_RNA|MOCS2_ENST00000510818.2_Missense_Mutation_p.Q30L|MOCS2_ENST00000508922.1_Missense_Mutation_p.Q30L|CTD-2366F13.1_ENST00000499459.2_RNA|MOCS2_ENST00000582677.1_Missense_Mutation_p.Q30L					molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				TTTTATTTCTTGAGGCACAGA	0.343																																					p.Q30L		Atlas-SNP	.											.	MOCS2	28	.	0			c.A89T						.						125.0	112.0	116.0					5																	52404403		1849	4108	5957	SO:0001583	missense	4338	exon2			ATTTCTTGAGGCA	AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000361377.4:c.89A>T	chr5.hg19:g.52404403T>A	ENSP00000355160:p.Gln30Leu	51.0	0.0		87.0	20.0	NM_176806		Missense_Mutation	SNP	ENST00000361377.4	hg19	CCDS47205.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.435026	0.43224	.	.	ENSG00000164172	ENST00000361377;ENST00000510818;ENST00000450852;ENST00000508922	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.86	5.86	0.93980	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	.	.	.	.	T	0.73984	0.3657	.	.	.	0.28643	N	0.907059	D	0.61697	0.99	D	0.64042	0.921	T	0.68014	-0.5521	8	0.27082	T	0.32	.	15.9403	0.79747	0.0:0.0:0.0:1.0	.	30	O96033	MOC2A_HUMAN	L	30	ENSP00000355160:Q30L;ENSP00000424267:Q30L;ENSP00000411022:Q30L;ENSP00000426274:Q30L	ENSP00000355160:Q30L	Q	-	2	0	MOCS2	52440160	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	1.466000	0.35310	2.240000	0.73641	0.533000	0.62120	CAA	.	.		0.343	MOCS2-004	KNOWN	alternative_3_UTR|NMD_exception|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000367796.3	NM_183418	
IPO11	51194	hgsc.bcm.edu	37	5	61833050	61833050	+	Silent	SNP	T	T	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:61833050T>G	ENST00000325324.6	+	24	2353	c.2184T>G	c.(2182-2184)ggT>ggG	p.G728G	KIF2A_ENST00000509663.2_3'UTR|IPO11_ENST00000409296.3_Silent_p.G768G	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11	728					ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ACGCAGTAGGTCTATGCCAGT	0.284																																					p.G768G		Atlas-SNP	.											.	IPO11	76	.	0			c.T2304G						.						77.0	85.0	82.0					5																	61833050		2203	4298	6501	SO:0001819	synonymous_variant	51194	exon24			AGTAGGTCTATGC	AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.2184T>G	chr5.hg19:g.61833050T>G		172.0	0.0		198.0	40.0	NM_001134779	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Silent	SNP	ENST00000325324.6	hg19	CCDS34167.1																																																																																			.	.		0.284	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335062.1	NM_016338	
ELL2	22936	hgsc.bcm.edu	37	5	95249476	95249476	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:95249476T>A	ENST00000237853.4	-	4	829	c.480A>T	c.(478-480)gtA>gtT	p.V160V	ELL2_ENST00000431061.2_Intron|ELL2_ENST00000506628.1_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	160					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TATACAAACCTACATATGGTC	0.398																																					p.V160V		Atlas-SNP	.											.	ELL2	63	.	0			c.A480T						.						159.0	163.0	161.0					5																	95249476		2203	4300	6503	SO:0001630	splice_region_variant	22936	exon4			CAAACCTACATAT	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.481+1A>T	chr5.hg19:g.95249476T>A		77.0	0.0		71.0	20.0	NM_012081	B4DNK7	Silent	SNP	ENST00000237853.4	hg19	CCDS4080.1																																																																																			.	.		0.398	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	Silent
PPP2CA	5515	hgsc.bcm.edu	37	5	133534792	133534792	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:133534792G>T	ENST00000481195.1	-	6	1122	c.842C>A	c.(841-843)aCt>aAt	p.T281N	CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	281					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	GTATTTTAGAGTATCGTCAAG	0.363																																					p.T281N		Atlas-SNP	.											.	PPP2CA	29	.	0			c.C842A						.						109.0	98.0	102.0					5																	133534792		2203	4300	6503	SO:0001583	missense	5515	exon6			TTTAGAGTATCGT		CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.842C>A	chr5.hg19:g.133534792G>T	ENSP00000418447:p.Thr281Asn	65.0	0.0		85.0	18.0	NM_002715	P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	hg19	CCDS4173.1	.	.	.	.	.	.	.	.	.	.	G	9.952	1.220389	0.22457	.	.	ENSG00000113575	ENST00000481195	T	0.04275	3.66	5.56	5.56	0.83823	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.85682	D	0.000000	T	0.01835	0.0058	N	0.00605	-1.335	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46652	-0.9176	10	0.02654	T	1	-10.847	19.5159	0.95165	0.0:0.0:1.0:0.0	.	281	P67775	PP2AA_HUMAN	N	281	ENSP00000418447:T281N	ENSP00000418447:T281N	T	-	2	0	PPP2CA	133562691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.464000	0.97655	2.621000	0.88768	0.655000	0.94253	ACT	.	.		0.363	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715	
SAR1B	51128	hgsc.bcm.edu	37	5	133945262	133945262	+	Splice_Site	SNP	T	T	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:133945262T>G	ENST00000402673.2	-	5	625	c.347A>C	c.(346-348)gAt>gCt	p.D116A	SAR1B_ENST00000507419.1_Splice_Site_p.D48A|SAR1B_ENST00000502539.1_Splice_Site_p.D48A|SAR1B_ENST00000509937.1_Splice_Site_p.D48A|SAR1B_ENST00000439578.1_Splice_Site_p.D116A	NM_016103.3	NP_057187.1	Q9Y6B6	SAR1B_HUMAN	secretion associated, Ras related GTPase 1B	116					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|GTP catabolic process (GO:0006184)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			kidney(2)|lung(2)|urinary_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTAACTTACATCAAGTTCTTC	0.403																																					p.D116A		Atlas-SNP	.											.	SAR1B	19	.	0			c.A347C						.						108.0	96.0	101.0					5																	133945262		2203	4300	6503	SO:0001630	splice_region_variant	51128	exon6			CTTACATCAAGTT	AF092130	CCDS4177.1	5q31.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000152700	ENSG00000152700			10535	protein-coding gene	gene with protein product		607690	"""SAR1a gene homolog (S. cerevisiae) 2"", ""SAR1a gene homolog 2 (S. cerevisiae)"", ""SAR1 homolog B (S. cerevisiae)"""	SARA2			Standard	NM_001033503		Approved		uc003kzr.3	Q9Y6B6	OTTHUMG00000129114	ENST00000402673.2:c.348+1A>C	chr5.hg19:g.133945262T>G		67.0	0.0		107.0	21.0	NM_001033503	D3DQA4|Q567T4	Missense_Mutation	SNP	ENST00000402673.2	hg19	CCDS4177.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.857878	0.91433	.	.	ENSG00000152700	ENST00000394992;ENST00000402673;ENST00000507419;ENST00000502539;ENST00000439578;ENST00000509937;ENST00000509730;ENST00000505758	T;T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01;0.01	5.46	5.46	0.80206	Small GTP-binding protein domain (1);	0.094859	0.64402	D	0.000001	T	0.66257	0.2771	M	0.76838	2.35	0.80722	D	1	B	0.17268	0.021	B	0.23275	0.045	T	0.66416	-0.5929	10	0.66056	D	0.02	-18.9555	15.8338	0.78782	0.0:0.0:0.0:1.0	.	116	Q9Y6B6	SAR1B_HUMAN	A	48;116;48;48;116;48;48;116	ENSP00000385432:D116A;ENSP00000425339:D48A;ENSP00000426335:D48A;ENSP00000404997:D116A;ENSP00000424673:D48A;ENSP00000423197:D48A;ENSP00000425466:D116A	ENSP00000378443:D48A	D	-	2	0	SAR1B	133973161	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.242000	0.72376	2.205000	0.71048	0.482000	0.46254	GAT	.	.		0.403	SAR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251158.2	NM_016103	Missense_Mutation
TRPC7	57113	hgsc.bcm.edu	37	5	135651458	135651458	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:135651458T>A	ENST00000513104.1	-	3	1072	c.790A>T	c.(790-792)Agg>Tgg	p.R264W	TRPC7_ENST00000355180.3_Intron|TRPC7_ENST00000426057.2_Intron|TRPC7-AS2_ENST00000513958.1_RNA	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	264					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GATAACTTCCTGTAATCGTTC	0.478																																					p.R264W		Atlas-SNP	.											.	TRPC7	126	.	0			c.A790T						.						59.0	60.0	59.0					5																	135651458		2053	4223	6276	SO:0001583	missense	57113	exon3			ACTTCCTGTAATC	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.790A>T	chr5.hg19:g.135651458T>A	ENSP00000426070:p.Arg264Trp	100.0	0.0		89.0	24.0	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	hg19	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.6|22.6	4.309628|4.309628	0.81247|0.81247	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000502753|ENST00000513104;ENST00000265193	.|T	.|0.64803	.|-0.12	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62270|0.62270	0.2414|0.2414	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|B;B	.|0.22541	.|0.032;0.071	.|B;B	.|0.25987	.|0.041;0.065	T|T	0.62072|0.62072	-0.6931|-0.6931	5|10	.|0.72032	.|D	.|0.01	-23.9142|-23.9142	16.0238|16.0238	0.80522|0.80522	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|264;264	.|Q70T25;Q9HCX4	.|.;TRPC7_HUMAN	L|W	263|264	.|ENSP00000426070:R264W	.|ENSP00000265193:R264W	Q|R	-|-	2|1	0|2	TRPC7|TRPC7	135679357|135679357	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.991000|0.991000	0.29654|0.29654	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	CAG|AGG	.	.		0.478	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHA1	56147	hgsc.bcm.edu	37	5	140165998	140165998	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:140165998C>A	ENST00000504120.2	+	1	123	c.123C>A	c.(121-123)caC>caA	p.H41Q	PCDHA1_ENST00000394633.3_Missense_Mutation_p.H41Q|PCDHA1_ENST00000378133.3_Missense_Mutation_p.H41Q	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	41	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCCAAACACGGCACCTTCG	0.657																																					p.H41Q		Atlas-SNP	.											.	PCDHA1	387	.	0			c.C123A						.						48.0	55.0	53.0					5																	140165998		2203	4300	6503	SO:0001583	missense	56147	exon1			CAAACACGGCACC	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.123C>A	chr5.hg19:g.140165998C>A	ENSP00000420840:p.His41Gln	93.0	0.0		117.0	22.0	NM_031411	O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	hg19	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	14.44	2.535543	0.45176	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.26373	1.74;1.74;1.74	4.53	4.53	0.55603	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.45361	U	0.000361	T	0.50120	0.1597	M	0.82517	2.595	0.31959	N	0.608694	D;D;D	0.58620	0.983;0.983;0.971	P;D;P	0.64144	0.793;0.922;0.746	T	0.63739	-0.6569	10	0.72032	D	0.01	.	12.1585	0.54091	0.0:0.9156:0.0:0.0844	.	41;41;41	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	Q	41	ENSP00000420840:H41Q;ENSP00000378129:H41Q;ENSP00000367373:H41Q	ENSP00000367373:H41Q	H	+	3	2	PCDHA1	140146182	0.000000	0.05858	1.000000	0.80357	0.545000	0.35147	-0.429000	0.06982	2.246000	0.74042	0.650000	0.86243	CAC	.	.		0.657	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
PCDHA2	56146	hgsc.bcm.edu	37	5	140175983	140175983	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:140175983A>T	ENST00000526136.1	+	1	1434	c.1434A>T	c.(1432-1434)tcA>tcT	p.S478S	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Silent_p.S478S|PCDHA2_ENST00000378132.1_Silent_p.S478S|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACGGTGTCAGCGTGGGATG	0.652																																					p.S478S		Atlas-SNP	.											.	PCDHA2	404	.	0			c.A1434T						.						72.0	76.0	74.0					5																	140175983		2203	4300	6503	SO:0001819	synonymous_variant	56146	exon1			GGTGTCAGCGTGG	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1434A>T	chr5.hg19:g.140175983A>T		175.0	0.0		185.0	36.0	NM_031495	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	hg19	CCDS54914.1																																																																																			.	.		0.652	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHA6	56142	hgsc.bcm.edu	37	5	140208516	140208516	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:140208516T>A	ENST00000529310.1	+	1	954	c.840T>A	c.(838-840)tcT>tcA	p.S280S	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Silent_p.S280S|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	280	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCATATTCTTTTAATAGCC	0.388																																					p.S280S		Atlas-SNP	.											.	PCDHA6	442	.	0			c.T840A						.						108.0	108.0	108.0					5																	140208516		2203	4300	6503	SO:0001819	synonymous_variant	56142	exon1			ATATTCTTTTAAT	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.840T>A	chr5.hg19:g.140208516T>A		353.0	0.0		478.0	112.0	NM_018909	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	hg19	CCDS47281.1																																																																																			.	.		0.388	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHB5	26167	hgsc.bcm.edu	37	5	140515388	140515388	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:140515388A>T	ENST00000231134.5	+	1	589	c.372A>T	c.(370-372)acA>acT	p.T124T		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	124	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCAGCTCACAGATATAAATG	0.478																																					p.T124T		Atlas-SNP	.											.	PCDHB5	184	.	0			c.A372T						.						65.0	72.0	70.0					5																	140515388		2203	4300	6503	SO:0001819	synonymous_variant	26167	exon1			GCTCACAGATATA	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.372A>T	chr5.hg19:g.140515388A>T		126.0	0.0		147.0	37.0	NM_015669	Q549F4|Q9UFU9	Silent	SNP	ENST00000231134.5	hg19	CCDS4247.1																																																																																			.	.		0.478	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB6	56130	hgsc.bcm.edu	37	5	140530514	140530514	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:140530514G>A	ENST00000231136.1	+	1	676	c.676G>A	c.(676-678)Gag>Aag	p.E226K	PCDHB6_ENST00000543635.1_Missense_Mutation_p.E90K	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	226	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGGACCTCCGAGATTCAGAT	0.592																																					p.E226K		Atlas-SNP	.											.	PCDHB6	161	.	0			c.G676A						.						42.0	46.0	45.0					5																	140530514		2203	4300	6503	SO:0001583	missense	56130	exon1			ACCTCCGAGATTC	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.676G>A	chr5.hg19:g.140530514G>A	ENSP00000231136:p.Glu226Lys	116.0	0.0		143.0	30.0	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	hg19	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	1.555	-0.538242	0.04082	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.01767	4.65;4.65	4.85	-3.64	0.04515	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01092	0.0036	L	0.28014	0.82	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.49072	-0.8977	9	0.07325	T	0.83	.	3.3639	0.07197	0.4685:0.1528:0.2881:0.0906	.	226	Q9Y5E3	PCDB6_HUMAN	K	90;226;11	ENSP00000438466:E90K;ENSP00000231136:E226K	ENSP00000231136:E226K	E	+	1	0	PCDHB6	140510698	0.000000	0.05858	0.001000	0.08648	0.337000	0.28794	-1.859000	0.01657	-0.369000	0.08028	0.561000	0.74099	GAG	.	.		0.592	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHGA8	9708	hgsc.bcm.edu	37	5	140773294	140773294	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:140773294A>T	ENST00000398604.2	+	1	914	c.914A>T	c.(913-915)aAa>aTa	p.K305I	PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	305	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAATAGCAAAAAGTCTAGAT	0.373																																					p.K305I		Atlas-SNP	.											.	PCDHGA8	146	.	0			c.A914T						.						95.0	101.0	99.0					5																	140773294		1817	4081	5898	SO:0001583	missense	9708	exon1			TAGCAAAAAGTCT	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.914A>T	chr5.hg19:g.140773294A>T	ENSP00000381605:p.Lys305Ile	191.0	0.0		260.0	54.0	NM_014004	A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	hg19	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	14.59	2.580299	0.46006	.	.	ENSG00000253767	ENST00000398604	T	0.57436	0.4	5.41	-2.51	0.06365	Cadherin (4);Cadherin-like (1);	0.271764	0.18119	U	0.151118	T	0.60222	0.2252	M	0.76574	2.34	0.09310	N	1	P;P	0.44690	0.841;0.809	P;B	0.51550	0.673;0.35	T	0.62215	-0.6901	10	0.66056	D	0.02	.	13.3165	0.60409	0.4132:0.0:0.5868:0.0	.	305;305	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	I	305	ENSP00000381605:K305I	ENSP00000381605:K305I	K	+	2	0	PCDHGA8	140753478	0.000000	0.05858	0.017000	0.16124	0.963000	0.63663	0.288000	0.18939	-0.189000	0.10482	0.533000	0.62120	AAA	.	.		0.373	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
FAT2	2196	hgsc.bcm.edu	37	5	150905451	150905451	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:150905451A>T	ENST00000261800.5	-	17	10396	c.10384T>A	c.(10384-10386)Tac>Aac	p.Y3462N		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3462	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGAAACGAGTAGGGGGGGCCA	0.582																																					p.Y3462N		Atlas-SNP	.											.,2	FAT2	465	.	0			c.T10384A						.						58.0	54.0	55.0					5																	150905451		2203	4300	6503	SO:0001583	missense	2196	exon17			ACGAGTAGGGGGG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.10384T>A	chr5.hg19:g.150905451A>T	ENSP00000261800:p.Tyr3462Asn	51.0	0.0		73.0	14.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.3|23.3	4.397548|4.397548	0.83120|0.83120	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.60920	.|0.15	5.09|5.09	5.09|5.09	0.68999|0.68999	.|Cadherin (4);Cadherin-like (1);	.|0.214974	.|0.33075	.|N	.|0.005319	T|T	0.74581|0.74581	0.3735|0.3735	M|M	0.71296|0.71296	2.17|2.17	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.76071	.|0.987;0.98	T|T	0.78028|0.78028	-0.2364|-0.2364	5|10	.|0.72032	.|D	.|0.01	.|.	15.1694|15.1694	0.72858|0.72858	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|3462;653	.|Q9NYQ8;E9PDJ8	.|FAT2_HUMAN;.	Q|N	320|3462	.|ENSP00000261800:Y3462N	.|ENSP00000261800:Y3462N	L|Y	-|-	2|1	0|0	FAT2|FAT2	150885644|150885644	1.000000|1.000000	0.71417|0.71417	0.845000|0.845000	0.33349|0.33349	0.803000|0.803000	0.45373|0.45373	8.832000|8.832000	0.92079|0.92079	2.046000|2.046000	0.60703|0.60703	0.445000|0.445000	0.29226|0.29226	CTA|TAC	.	.		0.582	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
DOCK2	1794	hgsc.bcm.edu	37	5	169482326	169482326	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr5:169482326G>A	ENST00000256935.8	+	42	4311	c.4231G>A	c.(4231-4233)Gtc>Atc	p.V1411I	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.V472I|DOCK2_ENST00000520908.1_Missense_Mutation_p.V903I	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1411	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGCTTCACTGTCCAGCCTGT	0.473																																					p.V1411I		Atlas-SNP	.											.	DOCK2	389	.	0			c.G4231A						.						87.0	84.0	85.0					5																	169482326		2203	4300	6503	SO:0001583	missense	1794	exon42			TTCACTGTCCAGC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4231G>A	chr5.hg19:g.169482326G>A	ENSP00000256935:p.Val1411Ile	75.0	0.0		96.0	24.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	34	5.396535	0.96009	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.19669	2.9;2.4;2.13	5.07	5.07	0.68467	.	0.066924	0.64402	D	0.000015	T	0.45696	0.1355	M	0.83012	2.62	0.52501	D	0.999958	B;P	0.48834	0.035;0.916	B;P	0.54664	0.039;0.758	T	0.50825	-0.8782	10	0.54805	T	0.06	.	18.4485	0.90695	0.0:0.0:1.0:0.0	.	903;1411	E7ERW7;Q92608	.;DOCK2_HUMAN	I	1411;903;472	ENSP00000256935:V1411I;ENSP00000429283:V903I;ENSP00000438827:V472I	ENSP00000256935:V1411I	V	+	1	0	DOCK2	169414904	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.864000	0.99589	2.343000	0.79666	0.655000	0.94253	GTC	.	.		0.473	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
LY86	9450	hgsc.bcm.edu	37	6	6589096	6589096	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:6589096G>C	ENST00000379953.2	+	2	481	c.129G>C	c.(127-129)caG>caC	p.Q43H	LY86-AS1_ENST00000429345.1_RNA|LY86-AS1_ENST00000435641.1_RNA|LY86-AS1_ENST00000447858.1_RNA|LY86_ENST00000230568.4_Missense_Mutation_p.Q43H			O95711	LY86_HUMAN	lymphocyte antigen 86	43					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				large_intestine(2)|lung(6)	8	Ovarian(93;0.0377)					TGCTCTACCAGAGTTGCGGTA	0.582																																					p.Q43H		Atlas-SNP	.											.	LY86	18	.	0			c.G129C						.						79.0	75.0	76.0					6																	6589096		2203	4300	6503	SO:0001583	missense	9450	exon1			CTACCAGAGTTGC	AF057178	CCDS4498.1	6p24.3	2010-07-08			ENSG00000112799	ENSG00000112799			16837	protein-coding gene	gene with protein product		605241				9763566	Standard	NM_004271		Approved	MD-1, dJ80N2.1	uc003mwy.1	O95711	OTTHUMG00000014190	ENST00000379953.2:c.129G>C	chr6.hg19:g.6589096G>C	ENSP00000369286:p.Gln43His	49.0	0.0		65.0	9.0	NM_004271	Q9UQC4	Missense_Mutation	SNP	ENST00000379953.2	hg19	CCDS4498.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597521	0.66332	.	.	ENSG00000112799	ENST00000379953;ENST00000230568	T;T	0.52057	0.68;0.68	5.3	5.3	0.74995	MD-2-related lipid-recognition (2);Immunoglobulin E-set (1);	0.486350	0.17954	N	0.156407	T	0.52933	0.1765	L	0.59436	1.845	0.38078	D	0.93657	D	0.63880	0.993	P	0.59825	0.864	T	0.57051	-0.7877	10	0.66056	D	0.02	-1.9443	14.4667	0.67490	0.0:0.0:1.0:0.0	.	43	O95711	LY86_HUMAN	H	43	ENSP00000369286:Q43H;ENSP00000230568:Q43H	ENSP00000230568:Q43H	Q	+	3	2	LY86	6534095	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	4.189000	0.58358	2.478000	0.83669	0.491000	0.48974	CAG	.	.		0.582	LY86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039762.2		
HIST1H4C	8364	hgsc.bcm.edu	37	6	26104224	26104224	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:26104224A>T	ENST00000377803.2	+	1	121	c.49A>T	c.(49-51)Aag>Tag	p.K17*		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	17					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GGGTGGTGCTAAGCGCCATCG	0.537																																					p.K17X		Atlas-SNP	.											.	HIST1H4C	14	.	0			c.A49T						.						64.0	64.0	64.0					6																	26104224		2203	4300	6503	SO:0001587	stop_gained	8364	exon1			GGTGCTAAGCGCC	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.49A>T	chr6.hg19:g.26104224A>T	ENSP00000367034:p.Lys17*	92.0	0.0		72.0	18.0	NM_003542	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Nonsense_Mutation	SNP	ENST00000377803.2	hg19	CCDS4583.1	.	.	.	.	.	.	.	.	.	.	.	17.49	3.401834	0.62288	.	.	ENSG00000197061	ENST00000377803	.	.	.	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5543	0.61751	1.0:0.0:0.0:0.0	.	.	.	.	X	17	.	ENSP00000367034:K17X	K	+	1	0	HIST1H4C	26212203	1.000000	0.71417	0.997000	0.53966	0.049000	0.14656	9.125000	0.94402	2.052000	0.61016	0.459000	0.35465	AAG	.	.		0.537	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542	
HIST1H2BL	8340	hgsc.bcm.edu	37	6	27775503	27775503	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:27775503C>A	ENST00000377401.2	-	1	206	c.182G>T	c.(181-183)gGa>gTa	p.G61V	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2AI_ENST00000358739.3_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	61					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						GTTCATGATTCCCATGGCCTT	0.587																																					p.G61V		Atlas-SNP	.											.	HIST1H2BL	48	.	0			c.G182T						.						198.0	187.0	191.0					6																	27775503		2203	4300	6503	SO:0001583	missense	8340	exon1			ATGATTCCCATGG	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.182G>T	chr6.hg19:g.27775503C>A	ENSP00000366618:p.Gly61Val	119.0	0.0		142.0	27.0	NM_003519	B2R5A3|Q52LW9	Missense_Mutation	SNP	ENST00000377401.2	hg19	CCDS4625.1	.	.	.	.	.	.	.	.	.	.	.	18.15	3.560481	0.65538	.	.	ENSG00000185130	ENST00000377401	T	0.21543	2.0	4.35	4.35	0.52113	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.43743	0.1261	M	0.88377	2.95	0.58432	D	0.999999	P	0.44877	0.845	P	0.60173	0.87	T	0.51849	-0.8653	9	0.66056	D	0.02	.	16.7577	0.85504	0.0:1.0:0.0:0.0	.	61	Q99880	H2B1L_HUMAN	V	61	ENSP00000366618:G61V	ENSP00000366618:G61V	G	-	2	0	HIST1H2BL	27883482	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.429000	0.66495	2.335000	0.79485	0.655000	0.94253	GGA	.	.		0.587	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519	
OR2H1	26716	hgsc.bcm.edu	37	6	29429803	29429803	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:29429803C>A	ENST00000377136.1	+	4	722	c.257C>A	c.(256-258)cCa>cAa	p.P86Q	OR2H1_ENST00000377133.1_Missense_Mutation_p.P86Q|OR2H1_ENST00000396792.2_Missense_Mutation_p.P86Q|OR2H1_ENST00000442615.1_Missense_Mutation_p.P86Q|OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000377132.1_Missense_Mutation_p.P86Q			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						CTCTGGGGCCCAAAGAAGACC	0.537																																					p.P86Q		Atlas-SNP	.											.	OR2H1	38	.	0			c.C257A						.						96.0	97.0	96.0					6																	29429803		1511	2709	4220	SO:0001583	missense	26716	exon3			GGGGCCCAAAGAA	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.257C>A	chr6.hg19:g.29429803C>A	ENSP00000366340:p.Pro86Gln	80.0	0.0		74.0	18.0	NM_030883	B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	ENST00000377136.1	hg19	CCDS4660.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.267445	0.40095	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.01902	4.57;4.57;4.57;4.57;4.57	2.74	2.74	0.32292	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40302	N	0.001139	T	0.01421	0.0046	N	0.10837	0.055	0.09310	N	1	D	0.71674	0.998	D	0.67725	0.953	T	0.53781	-0.8390	10	0.51188	T	0.08	.	7.4508	0.27237	0.1808:0.6417:0.1775:0.0	.	86	Q9GZK4	OR2H1_HUMAN	Q	86	ENSP00000366340:P86Q;ENSP00000366337:P86Q;ENSP00000393254:P86Q;ENSP00000366336:P86Q;ENSP00000380010:P86Q	ENSP00000366336:P86Q	P	+	2	0	OR2H1	29537782	0.000000	0.05858	0.831000	0.32960	0.993000	0.82548	-1.904000	0.01593	1.847000	0.53656	0.603000	0.83216	CCA	.	.		0.537	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3		
GABBR1	2550	hgsc.bcm.edu	37	6	29574219	29574219	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:29574219T>A	ENST00000377034.4	-	19	2595	c.2260A>T	c.(2260-2262)Att>Ttt	p.I754F	GABBR1_ENST00000377016.4_Missense_Mutation_p.I692F|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000355973.3_Missense_Mutation_p.I637F|GABBR1_ENST00000377012.4_Missense_Mutation_p.I637F	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	754					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TGGGGCAGAATAGAGACGTCA	0.527																																					p.I754F		Atlas-SNP	.											.	GABBR1	95	.	0			c.A2260T						.						206.0	199.0	202.0					6																	29574219		1511	2709	4220	SO:0001583	missense	2550	exon19			GCAGAATAGAGAC	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2260A>T	chr6.hg19:g.29574219T>A	ENSP00000366233:p.Ile754Phe	76.0	0.0		89.0	21.0	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.55|19.55	3.847941|3.847941	0.71603|0.71603	.|.	.|.	ENSG00000204681|ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034|ENST00000485026	D;D;D;D|.	0.87809|.	-2.3;-2.3;-2.3;-2.3|.	4.3|4.3	4.3|4.3	0.51218|0.51218	GPCR, family 3, C-terminal (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60715|0.60715	0.2290|0.2290	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	P;P;B|.	0.50369|.	0.813;0.934;0.317|.	P;P;B|.	0.52909|.	0.576;0.713;0.224|.	T|T	0.62501|0.62501	-0.6841|-0.6841	10|5	0.59425|.	D|.	0.04|.	-4.5873|-4.5873	12.0438|12.0438	0.53469|0.53469	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	692;754;637|.	Q9UBS5-3;Q9UBS5;Q5SUJ9|.	.;GABR1_HUMAN;.|.	F|F	637;692;637;754|134	ENSP00000348248:I637F;ENSP00000366215:I692F;ENSP00000366211:I637F;ENSP00000366233:I754F|.	ENSP00000348248:I637F|.	I|Y	-|-	1|2	0|0	GABBR1|GABBR1	29682198|29682198	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.986000|0.986000	0.74619|0.74619	7.355000|7.355000	0.79434|0.79434	1.872000|1.872000	0.54250|0.54250	0.533000|0.533000	0.62120|0.62120	ATT|TAT	.	.		0.527	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
GABBR1	2550	hgsc.bcm.edu	37	6	29574242	29574242	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:29574242G>A	ENST00000377034.4	-	19	2572	c.2237C>T	c.(2236-2238)cCt>cTt	p.P746L	GABBR1_ENST00000377016.4_Missense_Mutation_p.P684L|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000355973.3_Missense_Mutation_p.P629L|GABBR1_ENST00000377012.4_Missense_Mutation_p.P629L	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	746					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	ATCTTCCTTAGGTTCCTCCTT	0.522																																					p.P746L		Atlas-SNP	.											.	GABBR1	95	.	0			c.C2237T						.						172.0	163.0	167.0					6																	29574242		1511	2709	4220	SO:0001583	missense	2550	exon19			TCCTTAGGTTCCT	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2237C>T	chr6.hg19:g.29574242G>A	ENSP00000366233:p.Pro746Leu	77.0	0.0		89.0	18.0	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923601	0.73213	.	.	ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;T	0.84442	-1.85;-1.74;-1.85;-0.61	4.59	4.59	0.56863	GPCR, family 3, C-terminal (2);	0.123004	0.56097	D	0.000036	D	0.83059	0.5172	M	0.61703	1.905	0.80722	D	1	P;P;B	0.43231	0.554;0.801;0.117	B;P;B	0.46629	0.373;0.522;0.268	D	0.86234	0.1639	10	0.72032	D	0.01	-10.4866	15.268	0.73678	0.0:0.0:1.0:0.0	.	684;746;629	Q9UBS5-3;Q9UBS5;Q5SUJ9	.;GABR1_HUMAN;.	L	629;684;629;746	ENSP00000348248:P629L;ENSP00000366215:P684L;ENSP00000366211:P629L;ENSP00000366233:P746L	ENSP00000348248:P629L	P	-	2	0	GABBR1	29682221	1.000000	0.71417	0.980000	0.43619	0.831000	0.47069	7.290000	0.78711	2.239000	0.73571	0.563000	0.77884	CCT	.	.		0.522	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
GRM4	2914	hgsc.bcm.edu	37	6	34003952	34003952	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:34003952A>T	ENST00000538487.2	-	9	2378	c.1935T>A	c.(1933-1935)gcT>gcA	p.A645A	GRM4_ENST00000374181.4_Silent_p.A645A|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Silent_p.A512A|GRM4_ENST00000374177.3_Silent_p.A529A|GRM4_ENST00000455714.2_Silent_p.A505A|GRM4_ENST00000609222.1_Silent_p.A512A|GRM4_ENST00000544773.2_Silent_p.A476A	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	645					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GGTCGGGCTCAGCGATCATGA	0.602																																					p.A645A		Atlas-SNP	.											.	GRM4	317	.	0			c.T1935A						.						100.0	87.0	92.0					6																	34003952		2203	4300	6503	SO:0001819	synonymous_variant	2914	exon9			GGGCTCAGCGATC	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1935T>A	chr6.hg19:g.34003952A>T		74.0	0.0		82.0	18.0	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	ENST00000538487.2	hg19	CCDS4787.1																																																																																			.	.		0.602	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
DNAH8	1769	hgsc.bcm.edu	37	6	38749117	38749117	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:38749117C>T	ENST00000359357.3	+	14	1830	c.1576C>T	c.(1576-1578)Cgc>Tgc	p.R526C	DNAH8_ENST00000449981.2_Missense_Mutation_p.R743C|DNAH8_ENST00000441566.1_Missense_Mutation_p.R526C			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	526					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCAGCTCTATCGCCGGATAAG	0.368																																					p.R743C		Atlas-SNP	.											.	DNAH8	1239	.	0			c.C2227T						.						61.0	63.0	62.0					6																	38749117		2203	4300	6503	SO:0001583	missense	1769	exon16			CTCTATCGCCGGA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1576C>T	chr6.hg19:g.38749117C>T	ENSP00000352312:p.Arg526Cys	192.0	0.0		240.0	65.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	C	19.69	3.873768	0.72180	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.57907	0.37;0.37;0.37	5.66	3.78	0.43462	Dynein heavy chain, domain-1 (1);	0.061470	0.64402	D	0.000011	T	0.52565	0.1742	M	0.64997	1.995	0.53005	D	0.999967	D	0.76494	0.999	D	0.64877	0.93	T	0.57394	-0.7819	10	0.54805	T	0.06	.	6.9773	0.24683	0.2611:0.6526:0.0:0.0863	.	526	Q96JB1	DYH8_HUMAN	C	731;731;526;526	ENSP00000333363:R731C;ENSP00000352312:R526C;ENSP00000402294:R526C	ENSP00000333363:R731C	R	+	1	0	DNAH8	38857095	0.999000	0.42202	0.984000	0.44739	0.998000	0.95712	2.292000	0.43549	1.401000	0.46761	0.543000	0.68304	CGC	.	.		0.368	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TREML2	79865	hgsc.bcm.edu	37	6	41162396	41162396	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:41162396A>T	ENST00000483722.1	-	3	737	c.552T>A	c.(550-552)ccT>ccA	p.P184P		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	184					T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCTTGGAGGCAGGTCTGGTGG	0.602																																					p.P184P		Atlas-SNP	.											.	TREML2	41	.	0			c.T552A						.						127.0	94.0	105.0					6																	41162396		2203	4300	6503	SO:0001819	synonymous_variant	79865	exon3			GGAGGCAGGTCTG	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.552T>A	chr6.hg19:g.41162396A>T		124.0	0.0		138.0	30.0	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Silent	SNP	ENST00000483722.1	hg19	CCDS4853.2																																																																																			.	.		0.602	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
NCR2	9436	hgsc.bcm.edu	37	6	41309624	41309624	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:41309624A>T	ENST00000373089.5	+	3	575	c.487A>T	c.(487-489)Aga>Tga	p.R163*	NCR2_ENST00000373083.4_Nonsense_Mutation_p.R163*|NCR2_ENST00000373086.3_Nonsense_Mutation_p.R163*	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	163					cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					TGCAGGAGCCAGACAAGCCCC	0.642																																					p.R163X		Atlas-SNP	.											.	NCR2	44	.	0			c.A487T						.						92.0	85.0	88.0					6																	41309624		2203	4300	6503	SO:0001587	stop_gained	9436	exon3			GGAGCCAGACAAG	AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.487A>T	chr6.hg19:g.41309624A>T	ENSP00000362181:p.Arg163*	44.0	0.0		81.0	19.0	NM_004828	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Nonsense_Mutation	SNP	ENST00000373089.5	hg19	CCDS4855.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805501	0.50315	.	.	ENSG00000096264	ENST00000373083;ENST00000373089;ENST00000373086	.	.	.	1.78	0.582	0.17412	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.6097	0.08055	0.7885:0.0:0.2115:0.0	.	.	.	.	X	163	.	ENSP00000362175:R163X	R	+	1	2	NCR2	41417602	0.001000	0.12720	0.007000	0.13788	0.007000	0.05969	0.754000	0.26390	0.163000	0.19507	0.383000	0.25322	AGA	.	.		0.642	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040511.3		
KLC4	89953	hgsc.bcm.edu	37	6	43038459	43038459	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:43038459A>T	ENST00000394056.2	+	9	1506	c.1011A>T	c.(1009-1011)gcA>gcT	p.A337A	KLC4_ENST00000259708.3_Silent_p.A355A|KLC4_ENST00000453940.2_Silent_p.A260A|KLC4_ENST00000479388.1_Silent_p.A337A|KLC4_ENST00000347162.5_Silent_p.A337A|KLC4_ENST00000394058.1_Silent_p.A337A			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	337						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			CAGATGTGGCAAAACAGCTGA	0.527																																					p.A355A		Atlas-SNP	.											.	KLC4	89	.	0			c.A1065T						.						90.0	80.0	83.0					6																	43038459		2203	4300	6503	SO:0001819	synonymous_variant	89953	exon8			TGTGGCAAAACAG	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1011A>T	chr6.hg19:g.43038459A>T		141.0	0.0		154.0	37.0	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Silent	SNP	ENST00000394056.2	hg19	CCDS4883.1																																																																																			.	.		0.527	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
TDRD6	221400	hgsc.bcm.edu	37	6	46661686	46661686	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:46661686A>T	ENST00000316081.6	+	1	5821	c.5821A>T	c.(5821-5823)Aga>Tga	p.R1941*	TDRD6_ENST00000544460.1_Nonsense_Mutation_p.R1941*	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1941					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TGAGGACATGAGAAAGTCAAG	0.413																																					p.R1941X		Atlas-SNP	.											.	TDRD6	205	.	0			c.A5821T						.						159.0	152.0	154.0					6																	46661686		2203	4300	6503	SO:0001587	stop_gained	221400	exon1			GACATGAGAAAGT	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.5821A>T	chr6.hg19:g.46661686A>T	ENSP00000346065:p.Arg1941*	156.0	0.0		237.0	60.0	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Nonsense_Mutation	SNP	ENST00000316081.6	hg19	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	44	11.056824	0.99509	.	.	ENSG00000180113	ENST00000544460;ENST00000316081;ENST00000371334	.	.	.	5.56	0.0233	0.14136	.	0.433239	0.22340	N	0.061352	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0756	9.2958	0.37815	0.6595:0.0:0.3405:0.0	.	.	.	.	X	1941;1941;2	.	ENSP00000346065:R1941X	R	+	1	2	TDRD6	46769645	0.002000	0.14202	0.000000	0.03702	0.019000	0.09904	0.237000	0.17985	0.084000	0.17077	-0.379000	0.06801	AGA	.	.		0.413	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
IL17F	112744	hgsc.bcm.edu	37	6	52103728	52103728	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:52103728C>T	ENST00000336123.4	-	2	161	c.54G>A	c.(52-54)tcG>tcA	p.S18S		NM_052872.3	NP_443104.1	Q96PD4	IL17F_HUMAN	interleukin 17F	18					cartilage development (GO:0051216)|cytokine biosynthetic process (GO:0042089)|inflammatory response (GO:0006954)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045423)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of interleukin-8 biosynthetic process (GO:0045414)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine binding (GO:0019955)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)	14	Lung NSC(77;0.116)					GCCCCAATATCGACAGCAGCA	0.512																																					p.S18S		Atlas-SNP	.											.	IL17F	28	.	0			c.G54A						.						54.0	57.0	56.0					6																	52103728		2203	4300	6503	SO:0001819	synonymous_variant	112744	exon2			CAATATCGACAGC	AF384857	CCDS4938.1	6p12	2014-09-17			ENSG00000112116	ENSG00000112116		"""Interleukins and interleukin receptors"""	16404	protein-coding gene	gene with protein product		606496				11591732, 11591768	Standard	NM_052872		Approved	IL-17F, ML-1, ML1	uc003pam.1	Q96PD4	OTTHUMG00000014845	ENST00000336123.4:c.54G>A	chr6.hg19:g.52103728C>T		105.0	0.0		129.0	25.0	NM_052872	Q6NSI0|Q7Z6P4|Q96PI8|Q9NUE6	Silent	SNP	ENST00000336123.4	hg19	CCDS4938.1																																																																																			.	.		0.512	IL17F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040901.3	NM_052872	
COL9A1	1297	hgsc.bcm.edu	37	6	70942395	70942395	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:70942395A>T	ENST00000357250.6	-	36	2552	c.2394T>A	c.(2392-2394)ccT>ccA	p.P798P	COL9A1_ENST00000370499.4_Silent_p.P555P|RP1-149L1.1_ENST00000522264.1_RNA|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000320755.7_Silent_p.P555P	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	798	Collagen-like 9.|Triple-helical region (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CGGGGGGACCAGGAGGGCCAG	0.572																																					p.P798P		Atlas-SNP	.											.	COL9A1	228	.	0			c.T2394A						.						36.0	41.0	39.0					6																	70942395		2203	4300	6503	SO:0001819	synonymous_variant	1297	exon36			GGGACCAGGAGGG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2394T>A	chr6.hg19:g.70942395A>T		268.0	0.0		323.0	67.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	hg19	CCDS4971.1																																																																																			.	.		0.572	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
RIMS1	22999	hgsc.bcm.edu	37	6	72968769	72968769	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:72968769A>T	ENST00000521978.1	+	18	3008	c.3008A>T	c.(3007-3009)cAt>cTt	p.H1003L	RIMS1_ENST00000538414.1_5'UTR|RIMS1_ENST00000518273.1_Missense_Mutation_p.H1003L|RIMS1_ENST00000522291.1_Missense_Mutation_p.H1002L|RIMS1_ENST00000523963.1_Missense_Mutation_p.H477L|RIMS1_ENST00000517827.1_Missense_Mutation_p.H462L|RIMS1_ENST00000517960.1_Missense_Mutation_p.H1002L|RIMS1_ENST00000520567.1_Missense_Mutation_p.H1002L|RIMS1_ENST00000401910.3_Missense_Mutation_p.H476L|RIMS1_ENST00000264839.7_Missense_Mutation_p.H1003L|RIMS1_ENST00000491071.2_Missense_Mutation_p.H1003L|RIMS1_ENST00000348717.5_Missense_Mutation_p.H1002L|RIMS1_ENST00000425662.2_Missense_Mutation_p.H396L	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1003					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCAGTTGATCATAGAACCAGA	0.348																																					p.H1003L		Atlas-SNP	.											.	RIMS1	278	.	0			c.A3008T						.						119.0	119.0	119.0					6																	72968769		1920	4124	6044	SO:0001583	missense	22999	exon18			TTGATCATAGAAC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3008A>T	chr6.hg19:g.72968769A>T	ENSP00000428417:p.His1003Leu	89.0	0.0		99.0	22.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.88|10.88	1.475676|1.475676	0.26511|0.26511	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420|ENST00000522211	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.18502|.	2.49;2.64;2.59;2.65;2.67;2.64;2.57;2.62;2.64;2.66;2.67;2.41;2.67;2.21|.	5.71|5.71	3.23|3.23	0.37069|0.37069	.|.	0.482718|.	0.20514|.	N|.	0.090827|.	T|T	0.26085|0.26085	0.0636|0.0636	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B;P;B;B;B;B;B|.	0.52842|.	0.0;0.0;0.004;0.0;0.0;0.021;0.956;0.035;0.002;0.02;0.007;0.0|.	B;B;B;B;B;B;B;B;B;B;B;B|.	0.44224|.	0.001;0.0;0.002;0.0;0.001;0.012;0.444;0.008;0.001;0.028;0.002;0.0|.	T|T	0.09796|0.09796	-1.0658|-1.0658	10|5	0.11794|.	T|.	0.64|.	-6.5828|-6.5828	4.4541|4.4541	0.11635|0.11635	0.656:0.0:0.2101:0.1339|0.656:0.0:0.2101:0.1339	.|.	462;477;1003;462;476;1002;255;1003;1002;256;1003;1003|.	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	L|L	1003;1003;1003;1002;1003;1002;1003;1002;1003;1002;1002;1003;476;477;396;396;462;228|94	ENSP00000430101:H1003L;ENSP00000275037:H1002L;ENSP00000264839:H1003L;ENSP00000429959:H1002L;ENSP00000430408:H1003L;ENSP00000430502:H1002L;ENSP00000430932:H1002L;ENSP00000428417:H1003L;ENSP00000385649:H476L;ENSP00000428328:H477L;ENSP00000411235:H396L;ENSP00000389503:H396L;ENSP00000428367:H462L;ENSP00000359448:H228L|.	ENSP00000264839:H1003L|.	H|I	+|+	2|1	0|0	RIMS1|RIMS1	73025490|73025490	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.268000|0.268000	0.26511|0.26511	2.055000|2.055000	0.41345|0.41345	1.005000|1.005000	0.39183|0.39183	-0.371000|-0.371000	0.07208|0.07208	CAT|ATA	.	.		0.348	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
COL12A1	1303	hgsc.bcm.edu	37	6	75893246	75893246	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:75893246C>A	ENST00000322507.8	-	10	1720	c.1411G>T	c.(1411-1413)Gaa>Taa	p.E471*	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Nonsense_Mutation_p.E471*|COL12A1_ENST00000483888.2_Nonsense_Mutation_p.E471*	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	471	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GGTGAAATTTCAAAACTTTTT	0.353																																					p.E471X		Atlas-SNP	.											.	COL12A1	385	.	0			c.G1411T						.						64.0	61.0	62.0					6																	75893246		1820	4074	5894	SO:0001587	stop_gained	1303	exon10			AAATTTCAAAACT	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1411G>T	chr6.hg19:g.75893246C>A	ENSP00000325146:p.Glu471*	254.0	0.0		311.0	75.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Nonsense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	37	6.583815	0.97684	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	.	.	.	5.49	5.49	0.81192	.	0.237476	0.36374	N	0.002627	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	19.7404	0.96228	0.0:1.0:0.0:0.0	.	.	.	.	X	471	.	ENSP00000325146:E471X	E	-	1	0	COL12A1	75949966	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.734000	0.93682	0.655000	0.94253	GAA	.	.		0.353	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
HTR1E	3354	hgsc.bcm.edu	37	6	87725224	87725224	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:87725224A>T	ENST00000305344.5	+	2	875	c.172A>T	c.(172-174)Aac>Tac	p.N58Y		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	58					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CCAGCCTGCCAACTACCTAAT	0.547																																					p.N58Y		Atlas-SNP	.											.	HTR1E	89	.	0			c.A172T						.						172.0	134.0	147.0					6																	87725224		2203	4300	6503	SO:0001583	missense	3354	exon2			CCTGCCAACTACC		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.172A>T	chr6.hg19:g.87725224A>T	ENSP00000307766:p.Asn58Tyr	123.0	0.0		152.0	30.0	NM_000865	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	hg19	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	A	18.51	3.639580	0.67244	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.37058	1.22;1.22	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000005	T	0.60090	0.2242	M	0.91612	3.225	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.71388	-0.4608	10	0.72032	D	0.01	.	13.8983	0.63787	1.0:0.0:0.0:0.0	.	58	P28566	5HT1E_HUMAN	Y	58	ENSP00000307766:N58Y;ENSP00000358597:N58Y	ENSP00000307766:N58Y	N	+	1	0	HTR1E	87781943	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.677000	0.91203	1.746000	0.51805	0.416000	0.27883	AAC	.	.		0.547	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865	
RNGTT	8732	hgsc.bcm.edu	37	6	89600237	89600237	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:89600237T>A	ENST00000369485.4	-	8	1059	c.873A>T	c.(871-873)gtA>gtT	p.V291V	RNGTT_ENST00000369475.3_Silent_p.V291V|RNGTT_ENST00000265607.6_Silent_p.V291V|RNGTT_ENST00000538899.1_Silent_p.V231V	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	291	GTase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		CTTTCCAGCTTACTTTGTATG	0.343																																					p.V291V		Atlas-SNP	.											.	RNGTT	52	.	0			c.A873T						.						105.0	94.0	98.0					6																	89600237		2203	4300	6503	SO:0001819	synonymous_variant	8732	exon8			CCAGCTTACTTTG	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.873A>T	chr6.hg19:g.89600237T>A		61.0	0.0		77.0	21.0	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Silent	SNP	ENST00000369485.4	hg19	CCDS5017.1																																																																																			.	.		0.343	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
PNISR	25957	hgsc.bcm.edu	37	6	99849420	99849420	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:99849420T>A	ENST00000369239.5	-	12	1618	c.1414A>T	c.(1414-1416)Aga>Tga	p.R472*	PNISR_ENST00000438806.1_Nonsense_Mutation_p.R472*	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	472						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCTGCTTCTCTTGCTTCTAGT	0.323																																					p.R472X		Atlas-SNP	.											.	PNISR	74	.	0			c.A1414T						.						106.0	110.0	109.0					6																	99849420		2203	4300	6503	SO:0001587	stop_gained	25957	exon11			CTTCTCTTGCTTC	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1414A>T	chr6.hg19:g.99849420T>A	ENSP00000358242:p.Arg472*	86.0	0.0		70.0	13.0	NM_015491	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Nonsense_Mutation	SNP	ENST00000369239.5	hg19	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	T	37	6.077775	0.97262	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.46	5.46	0.80206	.	0.184779	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	15.83	0.78743	0.0:0.0:0.0:1.0	.	.	.	.	X	472	.	ENSP00000358242:R472X	R	-	1	2	PNISR	99956141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.018000	0.76406	2.203000	0.70933	0.472000	0.43445	AGA	.	.		0.323	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
DSE	29940	hgsc.bcm.edu	37	6	116757981	116757981	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:116757981A>T	ENST00000331677.3	+	7	2794	c.2350A>T	c.(2350-2352)Aga>Tga	p.R784*	DSE_ENST00000537543.1_Nonsense_Mutation_p.R803*|DSE_ENST00000359564.2_Nonsense_Mutation_p.R784*|DSE_ENST00000452085.3_Nonsense_Mutation_p.R784*			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	784					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TTCAGATAAGAGACAGACTGA	0.483																																					p.R784X		Atlas-SNP	.											.	DSE	98	.	0			c.A2350T						.						73.0	76.0	75.0					6																	116757981		2203	4300	6503	SO:0001587	stop_gained	29940	exon6			GATAAGAGACAGA	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2350A>T	chr6.hg19:g.116757981A>T	ENSP00000332151:p.Arg784*	130.0	0.0		153.0	33.0	NM_001080976	Q5R3K6	Nonsense_Mutation	SNP	ENST00000331677.3	hg19	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	A	39	7.312940	0.98203	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	.	.	.	6.16	4.94	0.65067	.	0.045192	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.7989	13.2493	0.60041	0.8678:0.1322:0.0:0.0	.	.	.	.	X	784;803;784;784	.	ENSP00000332151:R784X	R	+	1	2	DSE	116864674	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.040000	0.76551	2.367000	0.80283	0.528000	0.53228	AGA	.	.		0.483	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
CTGF	1490	hgsc.bcm.edu	37	6	132270673	132270673	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:132270673T>A	ENST00000367976.3	-	5	981	c.781A>T	c.(781-783)Aaa>Taa	p.K261*	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	261	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.|Heparin-binding.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		TTGGAGATTTTGGGAGTACGG	0.458																																					p.K261X	Esophageal Squamous(127;510 1660 12817 24400 38449)	Atlas-SNP	.											.	CTGF	36	.	0			c.A781T						.						243.0	253.0	250.0					6																	132270673		2203	4300	6503	SO:0001587	stop_gained	1490	exon5			AGATTTTGGGAGT	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.781A>T	chr6.hg19:g.132270673T>A	ENSP00000356954:p.Lys261*	83.0	0.0		92.0	19.0	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Nonsense_Mutation	SNP	ENST00000367976.3	hg19	CCDS5151.1	.	.	.	.	.	.	.	.	.	.	T	37	6.508108	0.97624	.	.	ENSG00000118523	ENST00000367976	.	.	.	5.64	5.64	0.86602	.	0.096735	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1617	0.81721	0.0:0.0:0.0:1.0	.	.	.	.	X	261	.	ENSP00000356954:K261X	K	-	1	0	CTGF	132312366	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.035000	0.57297	2.275000	0.75901	0.528000	0.53228	AAA	.	.		0.458	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
TAGAP	117289	hgsc.bcm.edu	37	6	159459160	159459160	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:159459160T>A	ENST00000367066.3	-	9	1215	c.884A>T	c.(883-885)cAc>cTc	p.H295L	TAGAP_ENST00000326965.6_Missense_Mutation_p.H117L|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	295					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		ACTGTCAGTGTGCTCCAGGGA	0.418																																					p.H295L		Atlas-SNP	.											.	TAGAP	75	.	0			c.A884T						.						142.0	130.0	134.0					6																	159459160		2203	4300	6503	SO:0001583	missense	117289	exon9			TCAGTGTGCTCCA	AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.884A>T	chr6.hg19:g.159459160T>A	ENSP00000356033:p.His295Leu	85.0	0.0		106.0	20.0	NM_054114	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	hg19	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.549849	0.45383	.	.	ENSG00000164691	ENST00000367066;ENST00000326965	T;T	0.19532	2.14;2.37	6.17	6.17	0.99709	.	0.209190	0.42821	D	0.000660	T	0.13200	0.0320	L	0.59436	1.845	0.80722	D	1	B	0.30824	0.296	B	0.23419	0.046	T	0.01729	-1.1286	10	0.45353	T	0.12	-38.3706	16.4837	0.84171	0.0:0.0:0.0:1.0	.	295	Q8N103	TAGAP_HUMAN	L	295;117	ENSP00000356033:H295L;ENSP00000322650:H117L	ENSP00000322650:H117L	H	-	2	0	TAGAP	159379148	1.000000	0.71417	0.997000	0.53966	0.207000	0.24258	2.898000	0.48672	2.371000	0.80710	0.533000	0.62120	CAC	.	.		0.418	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114	
C6orf118	168090	hgsc.bcm.edu	37	6	165715248	165715248	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr6:165715248T>A	ENST00000230301.8	-	2	583	c.563A>T	c.(562-564)cAg>cTg	p.Q188L	C6orf118_ENST00000543069.1_Missense_Mutation_p.Q84L	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	188										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CCCGGCCTCCTGGTAGCACAG	0.637																																					p.Q188L		Atlas-SNP	.											.	C6orf118	116	.	0			c.A563T						.						41.0	45.0	44.0					6																	165715248		2203	4300	6503	SO:0001583	missense	168090	exon2			GCCTCCTGGTAGC		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.563A>T	chr6.hg19:g.165715248T>A	ENSP00000230301:p.Gln188Leu	89.0	0.0		72.0	19.0	NM_144980	Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	hg19	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.891640	0.33442	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.12774	2.65;2.65	4.76	-4.35	0.03656	.	1.202810	0.05844	N	0.619937	T	0.03390	0.0098	L	0.44542	1.39	0.09310	N	1	P	0.38370	0.628	B	0.33254	0.16	T	0.31447	-0.9943	10	0.42905	T	0.14	.	8.6853	0.34234	0.0:0.5359:0.1436:0.3206	.	188	Q5T5N4	CF118_HUMAN	L	188;84	ENSP00000230301:Q188L;ENSP00000439288:Q84L	ENSP00000230301:Q188L	Q	-	2	0	C6orf118	165635238	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.839000	0.04368	-1.037000	0.03283	0.459000	0.35465	CAG	.	.		0.637	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	
SDK1	221935	hgsc.bcm.edu	37	7	3658710	3658710	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:3658710A>T	ENST00000404826.2	+	2	437		c.e2-1		SDK1_ENST00000389531.3_Splice_Site	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTAATATTTCAGATGATGTTG	0.383																																					.		Atlas-SNP	.											.	SDK1	361	.	0			c.299-2A>T						.						28.0	22.0	24.0					7																	3658710		2202	4299	6501	SO:0001630	splice_region_variant	221935	exon2			TATTTCAGATGAT	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.299-1A>T	chr7.hg19:g.3658710A>T		142.0	0.0		125.0	30.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Splice_Site	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.198762	0.38806	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0546	0.80788	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SDK1	3625236	1.000000	0.71417	0.996000	0.52242	0.376000	0.30014	8.688000	0.91260	2.191000	0.70037	0.528000	0.53228	.	.	.		0.383	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	Intron
KLHL7	55975	hgsc.bcm.edu	37	7	23164366	23164366	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:23164366A>T	ENST00000339077.5	+	3	526	c.283A>T	c.(283-285)Att>Ttt	p.I95F	KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000545771.1_Missense_Mutation_p.I73F|KLHL7_ENST00000410047.1_Missense_Mutation_p.I73F|KLHL7_ENST00000539124.1_Missense_Mutation_p.I19F|KLHL7_ENST00000479288.1_Intron|KLHL7_ENST00000322275.5_Missense_Mutation_p.I95F|KLHL7_ENST00000545443.1_Missense_Mutation_p.I73F|KLHL7_ENST00000409689.1_Missense_Mutation_p.I47F|KLHL7_ENST00000322231.7_Missense_Mutation_p.I73F	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	95	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ACCTGATATTATTGAACAACT	0.348																																					p.I95F		Atlas-SNP	.											.	KLHL7	102	.	0			c.A283T						.						123.0	116.0	118.0					7																	23164366		2203	4300	6503	SO:0001583	missense	55975	exon3			GATATTATTGAAC		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.283A>T	chr7.hg19:g.23164366A>T	ENSP00000343273:p.Ile95Phe	86.0	0.0		84.0	33.0	NM_001172428	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	hg19	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121105	0.77436	.	.	ENSG00000122550	ENST00000536369;ENST00000322231;ENST00000339077;ENST00000322275;ENST00000539124;ENST00000409689;ENST00000410047;ENST00000545771;ENST00000545443	T;T;T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17;0.17;0.17	5.77	5.77	0.91146	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	N	0.02876	-0.465	0.80722	D	1	D;P;P;D;D	0.76494	0.999;0.802;0.867;0.999;0.999	D;B;B;D;D	0.80764	0.994;0.337;0.354;0.994;0.994	T	0.70396	-0.4883	10	0.87932	D	0	.	16.383	0.83481	1.0:0.0:0.0:0.0	.	73;95;73;95;73	F5GYE2;Q8IXQ5;Q8IXQ5-2;Q8IXQ5-3;Q8IXQ5-4	.;KLHL7_HUMAN;.;.;.	F	95;73;95;95;19;47;73;73;73	ENSP00000322958:I73F;ENSP00000343273:I95F;ENSP00000323270:I95F;ENSP00000441136:I19F;ENSP00000386263:I47F;ENSP00000386999:I73F;ENSP00000446445:I73F;ENSP00000442366:I73F	ENSP00000322958:I73F	I	+	1	0	KLHL7	23130891	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.414000	0.90238	2.326000	0.78906	0.533000	0.62120	ATT	.	.		0.348	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
HOXA10	3206	hgsc.bcm.edu	37	7	27211677	27211677	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:27211677A>G	ENST00000283921.4	-	2	1073	c.1074T>C	c.(1072-1074)aaT>aaC	p.N358N	HOXA10_ENST00000396344.4_Silent_p.N42N|RP1-170O19.20_ENST00000465941.1_Intron|MIR196B_ENST00000384852.1_RNA|HOXA-AS4_ENST00000519694.1_RNA|HOXA9_ENST00000497089.1_5'Flank|HOXA10_ENST00000521421.1_5'UTR|HOXA-AS4_ENST00000523790.1_RNA|RP1-170O19.20_ENST00000470747.4_Intron|HOXA-AS4_ENST00000519935.1_RNA	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	358					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						TAAGGTACATATTGAACAGAA	0.532																																					p.N358N		Atlas-SNP	.											.	HOXA10	55	.	0			c.T1074C						.						115.0	110.0	112.0					7																	27211677		2203	4300	6503	SO:0001819	synonymous_variant	3206	exon2			GTACATATTGAAC		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.1074T>C	chr7.hg19:g.27211677A>G		124.0	0.0		146.0	38.0	NM_018951	O43370|O43605|Q15949|Q504T1	Silent	SNP	ENST00000283921.4	hg19	CCDS5410.2																																																																																			.	.		0.532	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2		
NPSR1	387129	hgsc.bcm.edu	37	7	34889208	34889208	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:34889208T>G	ENST00000360581.1	+	9	1185	c.1057T>G	c.(1057-1059)Ttc>Gtc	p.F353V	NPSR1_ENST00000359791.1_Intron|NPSR1_ENST00000531252.1_Intron|NPSR1_ENST00000381542.1_Missense_Mutation_p.F287V|NPSR1_ENST00000381539.3_Missense_Mutation_p.V386G	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	353						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)	p.F353I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CAGAATGACGTTCCGGGAGAG	0.468																																					p.F353V		Atlas-SNP	.											NPSR1,NS,carcinoma,0,1	NPSR1	134	.	1	Substitution - Missense(1)	lung(1)	c.T1057G						.						134.0	125.0	128.0					7																	34889208		2203	4300	6503	SO:0001583	missense	387129	exon9			ATGACGTTCCGGG	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.1057T>G	chr7.hg19:g.34889208T>G	ENSP00000353788:p.Phe353Val	145.0	0.0		144.0	36.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	hg19	CCDS5444.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.43|11.43	1.635227|1.635227	0.29068|0.29068	.|.	.|.	ENSG00000187258|ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000334481|ENST00000381539	T;T|T	0.36340|0.73789	1.26;1.26|-0.78	5.24|5.24	2.84|2.84	0.33178|0.33178	.|.	.|4.249060	.|0.00166	.|N	.|0.000016	T|T	0.63022|0.63022	0.2476|0.2476	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B|B	0.19706|0.21905	0.038;0.009|0.062	B;B|B	0.21708|0.18561	0.036;0.004|0.022	T|T	0.45101|0.45101	-0.9284|-0.9284	9|10	0.17369|0.35671	T|T	0.5|0.21	7.4597|7.4597	2.8287|2.8287	0.05492|0.05492	0.1455:0.078:0.1518:0.6248|0.1455:0.078:0.1518:0.6248	.|.	287;353|386	Q6W5P4-2;Q6W5P4|Q6W5P4-3	.;NPSR1_HUMAN|.	V|G	353;287;156|386	ENSP00000353788:F353V;ENSP00000370953:F287V|ENSP00000370950:V386G	ENSP00000334093:F156V|ENSP00000370950:V386G	F|V	+|+	1|2	0|0	NPSR1|NPSR1	34855733|34855733	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.337000|0.337000	0.28794|0.28794	1.264000|1.264000	0.33015|0.33015	0.443000|0.443000	0.26582|0.26582	0.454000|0.454000	0.30748|0.30748	TTC|GTT	.	.		0.468	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
ABCA13	154664	hgsc.bcm.edu	37	7	48550698	48550698	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:48550698G>C	ENST00000435803.1	+	51	13567	c.13543G>C	c.(13543-13545)Gtc>Ctc	p.V4515L	ABCA13_ENST00000544596.1_Missense_Mutation_p.V245L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4515					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTTGGTTTCCGTCTGCCTGTG	0.433																																					p.V4515L		Atlas-SNP	.											.	ABCA13	1192	.	0			c.G13543C						.						107.0	104.0	105.0					7																	48550698		1919	4124	6043	SO:0001583	missense	154664	exon51			GTTTCCGTCTGCC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13543G>C	chr7.hg19:g.48550698G>C	ENSP00000411096:p.Val4515Leu	62.0	0.0		79.0	18.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.095348|4.095348	0.76870|0.76870	.|.	.|.	ENSG00000179869|ENSG00000179869	ENST00000435451|ENST00000435803;ENST00000411975;ENST00000544596	.|T;T;T	.|0.78246	.|-1.16;-1.16;-1.16	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.000000	.|0.43260	.|D	.|0.000584	D|D	0.85647|0.85647	0.5745|0.5745	L|L	0.60067|0.60067	1.865|1.865	0.43617|0.43617	D|D	0.995995|0.995995	.|D;D;D	.|0.89917	.|0.961;0.999;1.0	.|P;D;D	.|0.74023	.|0.814;0.978;0.982	D|D	0.86504|0.86504	0.1805|0.1805	5|10	.|0.62326	.|D	.|0.03	.|.	16.1838|16.1838	0.81934|0.81934	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|245;2217;4515	.|F5H7B7;Q86UQ4-3;Q86UQ4	.|.;.;ABCAD_HUMAN	P|L	35|4515;288;245	.|ENSP00000411096:V4515L;ENSP00000391042:V288L;ENSP00000442634:V245L	.|ENSP00000391042:V288L	R|V	+|+	2|1	0|0	ABCA13|ABCA13	48521244|48521244	0.957000|0.957000	0.32711|0.32711	0.996000|0.996000	0.52242|0.52242	0.913000|0.913000	0.54294|0.54294	3.561000|3.561000	0.53770|0.53770	2.535000|2.535000	0.85469|0.85469	0.563000|0.563000	0.77884|0.77884	CGT|GTC	.	.		0.433	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
COBL	23242	hgsc.bcm.edu	37	7	51095925	51095925	+	Silent	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:51095925G>C	ENST00000265136.7	-	10	3033	c.2868C>G	c.(2866-2868)ggC>ggG	p.G956G	COBL_ENST00000395542.2_Silent_p.G1038G	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	956					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TCCTGTGTGGGCCAATGACCT	0.567																																					p.G956G	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-SNP	.											.	COBL	167	.	0			c.C2868G						.						73.0	68.0	70.0					7																	51095925		2203	4300	6503	SO:0001819	synonymous_variant	23242	exon10			GTGTGGGCCAATG	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2868C>G	chr7.hg19:g.51095925G>C		108.0	0.0		135.0	25.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	hg19	CCDS34637.1																																																																																			.	.		0.567	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
ZNF107	51427	hgsc.bcm.edu	37	7	64167010	64167010	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:64167010A>T	ENST00000395391.1	+	4	1703	c.328A>T	c.(328-330)Agc>Tgc	p.S110C	ZNF107_ENST00000344930.3_Missense_Mutation_p.S110C|ZNF107_ENST00000423627.1_Missense_Mutation_p.S110C			Q9UII5	ZN107_HUMAN	zinc finger protein 107	110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TAAAGAATGTAGCAAATCATT	0.308																																					p.S110C		Atlas-SNP	.											.	ZNF107	107	.	0			c.A328T						.						31.0	31.0	31.0					7																	64167010		2201	4300	6501	SO:0001583	missense	51427	exon7			GAATGTAGCAAAT	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.328A>T	chr7.hg19:g.64167010A>T	ENSP00000378789:p.Ser110Cys	151.0	0.0		178.0	29.0	NM_016220		Missense_Mutation	SNP	ENST00000395391.1	hg19	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	13.44	2.236636	0.39498	.	.	ENSG00000196247	ENST00000541526;ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.30714	1.52;1.52;1.52	0.916	-1.83	0.07833	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32102	0.0818	L	0.35341	1.055	0.21604	N	0.999622	D	0.58268	0.982	P	0.61275	0.886	T	0.17018	-1.0383	8	.	.	.	.	4.0134	0.09632	0.5373:0.0:0.4627:0.0	.	110	Q9UII5	ZN107_HUMAN	C	110	ENSP00000343443:S110C;ENSP00000400037:S110C;ENSP00000378789:S110C	.	S	+	1	0	ZNF107	63804445	0.998000	0.40836	0.127000	0.21898	0.126000	0.20510	1.464000	0.35288	-0.721000	0.04929	-0.718000	0.03613	AGC	.	.		0.308	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
LAT2	7462	hgsc.bcm.edu	37	7	73639059	73639059	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:73639059C>A	ENST00000460943.1	+	13	1608	c.719C>A	c.(718-720)gCc>gAc	p.A240D	LAT2_ENST00000344995.5_Missense_Mutation_p.A240D|LAT2_ENST00000275635.7_Missense_Mutation_p.A240D|LAT2_ENST00000398475.1_Missense_Mutation_p.A240D	NM_032464.2	NP_115853.2	Q9UHI5	LAT2_HUMAN	linker for activation of T cells family, member 2	0					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6					L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GAGGTGGCAGCCACAGAAGCC	0.622																																					p.A240D		Atlas-SNP	.											.	LAT2	24	.	0			c.C719A						.						21.0	25.0	23.0					7																	73639059		2011	4181	6192	SO:0001583	missense	7462	exon13			TGGCAGCCACAGA	AF257135	CCDS5566.2	7q11.23	2011-11-01	2005-04-26	2005-04-26	ENSG00000086730	ENSG00000086730			12749	protein-coding gene	gene with protein product	"""linker for activation of B cells"", ""non-T cell activation linker"", ""linker for activation of T cells, transmembrane adaptor 2"""	605719	"""Williams-Beuren syndrome chromosome region 5"""	WBSCR15, WBSCR5		8812460, 12514734	Standard	NM_032464		Approved	WSCR5, HSPC046, LAB, NTAL	uc003uai.3	Q9GZY6	OTTHUMG00000130151	ENST00000460943.1:c.719C>A	chr7.hg19:g.73639059C>A	ENSP00000420494:p.Ala240Asp	56.0	0.0		85.0	23.0	NM_032464	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000460943.1	hg19	CCDS5566.2	.	.	.	.	.	.	.	.	.	.	c	14.18	2.458036	0.43634	.	.	ENSG00000086730	ENST00000344995;ENST00000460943;ENST00000398475;ENST00000275635	.	.	.	3.31	0.407	0.16371	.	2.940010	0.00958	N	0.003078	T	0.38214	0.1032	L	0.29908	0.895	0.09310	N	1	P	0.48503	0.911	P	0.52481	0.7	T	0.16988	-1.0384	9	0.72032	D	0.01	-0.9253	3.613	0.08067	0.0:0.5464:0.2096:0.244	.	240	Q9GZY6	NTAL_HUMAN	D	240	.	ENSP00000275635:A240D	A	+	2	0	LAT2	73276995	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.132000	0.15891	0.068000	0.16574	-0.451000	0.05528	GCC	.	.		0.622	LAT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277062.1		
PTPN12	5782	hgsc.bcm.edu	37	7	77256052	77256052	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:77256052A>C	ENST00000248594.6	+	13	1328	c.1056A>C	c.(1054-1056)gaA>gaC	p.E352D	PTPN12_ENST00000415482.2_Missense_Mutation_p.E233D|PTPN12_ENST00000435495.2_Missense_Mutation_p.E222D	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	352	Interaction with TGFB1I1. {ECO:0000250}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						CTAAAGAAGAAATACTGCAGC	0.428																																					p.E352D		Atlas-SNP	.											.	PTPN12	83	.	0			c.A1056C						.						83.0	79.0	80.0					7																	77256052		2203	4300	6503	SO:0001583	missense	5782	exon13			AGAAGAAATACTG		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1056A>C	chr7.hg19:g.77256052A>C	ENSP00000248594:p.Glu352Asp	76.0	0.0		93.0	25.0	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	hg19	CCDS5592.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.520142	0.64747	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;T;T	0.32515	1.45;1.45;1.45	6.17	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	L	0.55103	1.725	0.47994	D	0.999561	D	0.89917	1.0	D	0.80764	0.994	T	0.47761	-0.9092	10	0.59425	D	0.04	.	12.5474	0.56208	0.9349:0.0:0.0651:0.0	.	352	Q05209	PTN12_HUMAN	D	352;233;233;222	ENSP00000248594:E352D;ENSP00000392429:E233D;ENSP00000397991:E222D	ENSP00000248594:E352D	E	+	3	2	PTPN12	77093988	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.885000	0.56182	1.119000	0.41883	0.533000	0.62120	GAA	.	.		0.428	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
GNAT3	346562	hgsc.bcm.edu	37	7	80117908	80117908	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:80117908T>A	ENST00000398291.3	-	3	339	c.246A>T	c.(244-246)ctA>ctT	p.L82L	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	82					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						TCACAATAGCTAGGATGGATT	0.363																																					p.L82L		Atlas-SNP	.											.	GNAT3	65	.	0			c.A246T						.						129.0	115.0	119.0					7																	80117908		1899	4112	6011	SO:0001819	synonymous_variant	346562	exon3			AATAGCTAGGATG		CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.246A>T	chr7.hg19:g.80117908T>A		72.0	0.0		80.0	18.0	NM_001102386	A4D1B2|A4D1B3|B9EJG5	Silent	SNP	ENST00000398291.3	hg19	CCDS47625.1																																																																																			.	.		0.363	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339909.3	XM_294370	
HGF	3082	hgsc.bcm.edu	37	7	81331975	81331975	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:81331975A>T	ENST00000222390.5	-	18	2335	c.2109T>A	c.(2107-2109)ccT>ccA	p.P703P	HGF_ENST00000457544.2_Silent_p.P698P	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	703	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						CAAAAATACCAGGACGATTTG	0.403																																					p.P703P		Atlas-SNP	.											.	HGF	171	.	0			c.T2109A						.						133.0	126.0	128.0					7																	81331975		2203	4299	6502	SO:0001819	synonymous_variant	3082	exon18			AATACCAGGACGA		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.2109T>A	chr7.hg19:g.81331975A>T		280.0	0.0		357.0	78.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Silent	SNP	ENST00000222390.5	hg19	CCDS5597.1																																																																																			.	.		0.403	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
PCLO	27445	hgsc.bcm.edu	37	7	82595396	82595396	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:82595396T>A	ENST00000333891.9	-	4	4045	c.3708A>T	c.(3706-3708)ctA>ctT	p.L1236L	PCLO_ENST00000423517.2_Silent_p.L1236L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTTTTCTTCTAGGAGTGGCT	0.388																																					p.L1236L		Atlas-SNP	.											.	PCLO	1506	.	0			c.A3708T						.						229.0	222.0	224.0					7																	82595396		1801	4074	5875	SO:0001819	synonymous_variant	27445	exon4			TTCTTCTAGGAGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3708A>T	chr7.hg19:g.82595396T>A		127.0	0.0		179.0	41.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.388	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
COL1A2	1278	hgsc.bcm.edu	37	7	94053728	94053728	+	Silent	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:94053728T>C	ENST00000297268.6	+	41	3117	c.2646T>C	c.(2644-2646)cgT>cgC	p.R882R		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	882					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GAGGTGAACGTGGTCTACCAG	0.473										HNSCC(75;0.22)																											p.R882R		Atlas-SNP	.											.	COL1A2	240	.	0			c.T2646C						.						159.0	148.0	152.0					7																	94053728		2203	4300	6503	SO:0001819	synonymous_variant	1278	exon41			TGAACGTGGTCTA	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2646T>C	chr7.hg19:g.94053728T>C		72.0	0.0		95.0	18.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	hg19	CCDS34682.1																																																																																			.	.		0.473	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000424859.1_5'UTR|LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000401970.2_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A		Atlas-SNP	.											LHFPL3,NS,carcinoma,0,1	LHFPL3	24	.	1	Substitution - coding silent(1)	kidney(1)	c.C24T						.						11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	chr7.hg19:g.103969251C>T		31.0	1.0		45.0	2.0	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	hg19																																																																																				.	.		0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding		NM_199000	
CDHR3	222256	hgsc.bcm.edu	37	7	105653379	105653379	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:105653379A>T	ENST00000317716.9	+	9	1206	c.1126A>T	c.(1126-1128)Agt>Tgt	p.S376C	CDHR3_ENST00000478080.1_Missense_Mutation_p.S288C|CDHR3_ENST00000343407.5_Missense_Mutation_p.S93C|CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000542731.1_Missense_Mutation_p.S376C|CDHR3_ENST00000541203.1_3'UTR	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	376	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						TGATGATGACAGTGAGGCACC	0.478																																					p.S376C		Atlas-SNP	.											.	CDHR3	153	.	0			c.A1126T						.						233.0	222.0	225.0					7																	105653379		2009	4199	6208	SO:0001583	missense	222256	exon9			GATGACAGTGAGG	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.1126A>T	chr7.hg19:g.105653379A>T	ENSP00000325954:p.Ser376Cys	99.0	0.0		135.0	37.0	NM_152750	Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	hg19	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.575601	0.65878	.	.	ENSG00000128536	ENST00000542731;ENST00000343407;ENST00000317716;ENST00000478080;ENST00000466045	T;T;T;T;T	0.61859	0.21;0.41;0.21;0.07;0.41	5.23	1.4	0.22301	Cadherin (3);Cadherin-like (1);	0.327119	0.28958	N	0.013592	T	0.53658	0.1810	L	0.57536	1.79	0.30839	N	0.735842	P;D;P;P	0.61080	0.904;0.989;0.947;0.947	P;P;P;P	0.50192	0.634;0.608;0.527;0.527	T	0.58148	-0.7687	10	0.87932	D	0	-8.7428	2.9229	0.05774	0.4106:0.2503:0.3391:0.0	.	93;363;376;288	Q6ZTQ4-2;B3KYA0;Q6ZTQ4;B7Z8X2	.;.;CDHR3_HUMAN;.	C	376;93;376;288;134	ENSP00000439766:S376C;ENSP00000341510:S93C;ENSP00000325954:S376C;ENSP00000417771:S288C;ENSP00000419017:S134C	ENSP00000325954:S376C	S	+	1	0	CDHR3	105440615	0.912000	0.30974	0.992000	0.48379	0.922000	0.55478	1.126000	0.31344	0.295000	0.22570	-0.514000	0.04452	AGT	.	.		0.478	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
WNT2	7472	hgsc.bcm.edu	37	7	116960675	116960675	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:116960675T>A	ENST00000265441.3	-	2	555	c.256A>T	c.(256-258)Aat>Tat	p.N86Y	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	86					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GTGTTGCAATTCCAGCGGTGC	0.587																																					p.N86Y		Atlas-SNP	.											.	WNT2	56	.	0			c.A256T						.						80.0	62.0	68.0					7																	116960675		2203	4300	6503	SO:0001583	missense	7472	exon2			TGCAATTCCAGCG	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.256A>T	chr7.hg19:g.116960675T>A	ENSP00000265441:p.Asn86Tyr	63.0	0.0		91.0	20.0	NM_003391	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	hg19	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.234526	0.79800	.	.	ENSG00000105989	ENST00000265441;ENST00000491214	D;D	0.83837	-1.77;-1.77	5.28	5.28	0.74379	.	0.045054	0.85682	D	0.000000	D	0.94079	0.8102	H	0.98769	4.325	0.52501	D	0.999954	D	0.89917	1.0	D	0.81914	0.995	D	0.94839	0.8003	10	0.87932	D	0	.	9.166	0.37052	0.0:0.0903:0.0:0.9097	.	86	P09544	WNT2_HUMAN	Y	86	ENSP00000265441:N86Y;ENSP00000419466:N86Y	ENSP00000265441:N86Y	N	-	1	0	WNT2	116747911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.014000	0.49590	2.105000	0.64084	0.533000	0.62120	AAT	.	.		0.587	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
NDUFA5	4698	hgsc.bcm.edu	37	7	123190558	123190558	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:123190558T>A	ENST00000355749.2	-	3	608	c.149A>T	c.(148-150)cAg>cTg	p.Q50L	NDUFA5_ENST00000471770.1_Missense_Mutation_p.Q50L|NDUFA5_ENST00000467117.1_5'UTR	NM_001282419.1|NM_005000.2	NP_001269348.1|NP_004991.1	Q16718	NDUA5_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5	50					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			large_intestine(1)|urinary_tract(1)	2						ATTTGTAATCTGTTCTGTATA	0.328																																					p.Q50L		Atlas-SNP	.											.	NDUFA5	6	.	0			c.A149T						.						112.0	119.0	117.0					7																	123190558		2203	4299	6502	SO:0001583	missense	4698	exon3			GTAATCTGTTCTG		CCDS5788.1, CCDS64760.1, CCDS75655.1, CCDS75656.1	7q31.33	2013-06-19	2013-06-19		ENSG00000128609	ENSG00000128609		"""Mitochondrial respiratory chain complex / Complex I"""	7688	protein-coding gene	gene with protein product	"""complex I 13kDa subunit B"", ""ubiquinone reductase"", ""type I dehydrogenase"", ""NADH-ubiquinone oxidoreductase 13 kDa-B subunit"""	601677	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (13kD, B13)"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa"""			9763677, 9021153	Standard	XM_005250371		Approved	B13, NUFM, CI-13KD-B, UQOR13, CI-13kB	uc003vks.3	Q16718	OTTHUMG00000157348	ENST00000355749.2:c.149A>T	chr7.hg19:g.123190558T>A	ENSP00000347988:p.Gln50Leu	46.0	0.0		76.0	19.0	NM_005000	B2RD98|Q5H9R2|Q6IRX7	Missense_Mutation	SNP	ENST00000355749.2	hg19	CCDS5788.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.409625	0.83340	.	.	ENSG00000128609	ENST00000471770;ENST00000355749;ENST00000470123	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	T	0.76793	0.4037	M	0.78049	2.395	0.80722	D	1	D	0.57257	0.979	P	0.60886	0.88	T	0.78615	-0.2135	8	0.49607	T	0.09	.	14.9406	0.70992	0.0:0.0:0.0:1.0	.	50	Q16718	NDUA5_HUMAN	L	50;50;60	.	ENSP00000347988:Q50L	Q	-	2	0	NDUFA5	122977794	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.448000	0.60027	2.220000	0.72140	0.533000	0.62120	CAG	.	.		0.328	NDUFA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348533.1	NM_005000	
METTL2B	55798	hgsc.bcm.edu	37	7	128141930	128141930	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:128141930A>T	ENST00000262432.8	+	9	1134	c.1097A>T	c.(1096-1098)cAg>cTg	p.Q366L	METTL2B_ENST00000480046.1_Missense_Mutation_p.Q301L	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	366					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GTTTGGATTCAGTGCAAATAC	0.502																																					p.Q366L		Atlas-SNP	.											.	METTL2B	34	.	0			c.A1097T						.						154.0	157.0	156.0					7																	128141930		2203	4300	6503	SO:0001583	missense	55798	exon9			GGATTCAGTGCAA	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.1097A>T	chr7.hg19:g.128141930A>T	ENSP00000262432:p.Gln366Leu	126.0	0.0		194.0	36.0	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	ENST00000262432.8	hg19	CCDS5803.2	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022651	0.75275	.	.	ENSG00000165055	ENST00000262432;ENST00000480046	T;T	0.03717	3.83;3.83	3.44	3.44	0.39384	.	0.000000	0.85682	D	0.000000	T	0.21550	0.0519	H	0.94886	3.595	0.80722	D	1	D;D	0.64830	0.994;0.99	D;P	0.63877	0.919;0.847	T	0.05178	-1.0901	10	0.87932	D	0	-0.129	10.1503	0.42788	1.0:0.0:0.0:0.0	.	301;366	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	L	366;301	ENSP00000262432:Q366L;ENSP00000418402:Q301L	ENSP00000262432:Q366L	Q	+	2	0	METTL2B	127929166	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	8.496000	0.90485	1.548000	0.49413	0.164000	0.16699	CAG	.	.		0.502	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
PLXNA4	91584	hgsc.bcm.edu	37	7	131833393	131833393	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:131833393C>T	ENST00000359827.3	-	26	5635	c.4673G>A	c.(4672-4674)gGa>gAa	p.G1558E	PLXNA4_ENST00000321063.4_Missense_Mutation_p.G1558E			Q9HCM2	PLXA4_HUMAN	plexin A4	1558					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGCCCCACTTCCTTGTCGCCA	0.547																																					p.G1558E		Atlas-SNP	.											.	PLXNA4	873	.	0			c.G4673A						.						124.0	122.0	122.0					7																	131833393		2150	4285	6435	SO:0001583	missense	91584	exon26			CCACTTCCTTGTC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4673G>A	chr7.hg19:g.131833393C>T	ENSP00000352882:p.Gly1558Glu	53.0	0.0		42.0	8.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943076	0.73672	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.13196	2.61;2.61	4.62	4.62	0.57501	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.217226	0.48286	D	0.000197	T	0.35248	0.0925	M	0.80982	2.52	0.58432	D	0.999997	D	0.62365	0.991	D	0.64237	0.923	T	0.09530	-1.0670	10	0.54805	T	0.06	.	12.1193	0.53883	0.0:0.6759:0.3241:0.0	.	1558	Q9HCM2	PLXA4_HUMAN	E	1558	ENSP00000323194:G1558E;ENSP00000352882:G1558E	ENSP00000323194:G1558E	G	-	2	0	PLXNA4	131483933	0.972000	0.33761	1.000000	0.80357	0.985000	0.73830	1.945000	0.40273	2.401000	0.81631	0.561000	0.74099	GGA	.	.		0.547	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
EXOC4	60412	hgsc.bcm.edu	37	7	133749242	133749242	+	Silent	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:133749242C>A	ENST00000253861.4	+	18	2915	c.2886C>A	c.(2884-2886)atC>atA	p.I962I	EXOC4_ENST00000539845.1_Silent_p.I861I|EXOC4_ENST00000545148.1_Silent_p.I572I|EXOC4_ENST00000541309.1_Silent_p.I250I	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	962					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AGGCTGCCATCAAGCAAGCCA	0.572																																					p.I962I		Atlas-SNP	.											.	EXOC4	118	.	0			c.C2886A						.						87.0	78.0	81.0					7																	133749242		2203	4300	6503	SO:0001819	synonymous_variant	60412	exon18			TGCCATCAAGCAA	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2886C>A	chr7.hg19:g.133749242C>A		32.0	0.0		32.0	8.0	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Silent	SNP	ENST00000253861.4	hg19	CCDS5829.1																																																																																			.	.		0.572	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
WDR91	29062	hgsc.bcm.edu	37	7	134894482	134894482	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:134894482T>A	ENST00000354475.4	-	2	180	c.149A>T	c.(148-150)cAg>cTg	p.Q50L	WDR91_ENST00000485942.1_5'Flank|WDR91_ENST00000423565.1_Missense_Mutation_p.Q15L|WDR91_ENST00000344400.5_Missense_Mutation_p.Q50L	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	50										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						CATTAACTGCTGCAGCTGGTC	0.502																																					p.Q50L		Atlas-SNP	.											.	WDR91	82	.	0			c.A149T						.						93.0	93.0	93.0					7																	134894482		2203	4300	6503	SO:0001583	missense	29062	exon2			AACTGCTGCAGCT	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.149A>T	chr7.hg19:g.134894482T>A	ENSP00000346466:p.Gln50Leu	74.0	0.0		98.0	24.0	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	hg19	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	T	6.376	0.437569	0.12104	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	T;T;T	0.61742	1.63;0.08;0.68	6.04	6.04	0.98038	.	0.055875	0.64402	D	0.000001	T	0.39332	0.1074	L	0.28694	0.88	0.58432	D	0.999999	B	0.13145	0.007	B	0.06405	0.002	T	0.28235	-1.0050	10	0.02654	T	1	-5.3735	10.3312	0.43823	0.2528:0.0:0.0:0.7472	.	50	A4D1P6	WDR91_HUMAN	L	50;50;15	ENSP00000340877:Q50L;ENSP00000346466:Q50L;ENSP00000392555:Q15L	ENSP00000340877:Q50L	Q	-	2	0	WDR91	134545022	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.954000	0.49113	2.317000	0.78254	0.459000	0.35465	CAG	.	.		0.502	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
PRSS58	136541	hgsc.bcm.edu	37	7	141952124	141952124	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:141952124A>T	ENST00000552471.1	-	5	962	c.643T>A	c.(643-645)Tgt>Agt	p.C215S	PRSS58_ENST00000547058.2_Missense_Mutation_p.C215S			Q8IYP2	PRS58_HUMAN	protease, serine, 58	215	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						CTCAAAACACATCCATCCGCA	0.408																																					p.C215S		Atlas-SNP	.											.	PRSS58	41	.	0			c.T643A						.						61.0	65.0	64.0					7																	141952124		2203	4300	6503	SO:0001583	missense	136541	exon6			AAACACATCCATC		CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.643T>A	chr7.hg19:g.141952124A>T	ENSP00000446916:p.Cys215Ser	131.0	0.0		149.0	42.0	NM_001001317	B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	hg19	CCDS5871.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.571396	0.86542	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.86627	-2.15;-2.15	5.24	5.24	0.73138	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.92061	0.7484	M	0.88512	2.96	0.53005	D	0.99996	P	0.48162	0.906	P	0.53593	0.73	D	0.93167	0.6563	9	0.87932	D	0	.	11.4549	0.50176	1.0:0.0:0.0:0.0	.	215	Q8IYP2	PRS58_HUMAN	S	215	ENSP00000447588:C215S;ENSP00000446916:C215S	ENSP00000307206:C215S	C	-	1	0	PRSS58	141598602	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	6.520000	0.73773	2.199000	0.70637	0.533000	0.62120	TGT	.	.		0.408	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317	
CSMD1	64478	hgsc.bcm.edu	37	8	3266978	3266978	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:3266978T>A	ENST00000520002.1	-	14	2269	c.1714A>T	c.(1714-1716)Aat>Tat	p.N572Y	CSMD1_ENST00000400186.3_Missense_Mutation_p.N572Y|CSMD1_ENST00000537824.1_Missense_Mutation_p.N571Y|CSMD1_ENST00000539096.1_Missense_Mutation_p.N571Y|CSMD1_ENST00000602723.1_Missense_Mutation_p.N572Y|CSMD1_ENST00000542608.1_Missense_Mutation_p.N571Y|CSMD1_ENST00000602557.1_Missense_Mutation_p.N572Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	572	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GACCACTGATTGTTCTGCTGA	0.547																																					p.N571Y		Atlas-SNP	.											.	CSMD1	1469	.	0			c.A1711T						.						52.0	52.0	52.0					8																	3266978		1968	4162	6130	SO:0001583	missense	64478	exon13			ACTGATTGTTCTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1714A>T	chr8.hg19:g.3266978T>A	ENSP00000430733:p.Asn572Tyr	84.0	0.0		92.0	14.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.520691|4.520691	0.85495|0.85495	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.64803|.	-0.12;-0.12;-0.12;-0.12;-0.12|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75532|0.75532	0.3862|0.3862	M|M	0.78049|0.78049	2.395|2.395	0.53688|0.53688	D|D	0.999971|0.999971	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	T|T	0.77062|0.77062	-0.2727|-0.2727	10|5	0.56958|.	D|.	0.05|.	.|.	15.1739|15.1739	0.72896|0.72896	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	572|.	E5RIG2|.	.|.	Y|L	572;572;434;571;571;571|51	ENSP00000383047:N572Y;ENSP00000430733:N572Y;ENSP00000441462:N571Y;ENSP00000446243:N571Y;ENSP00000441675:N571Y|.	ENSP00000320445:N434Y|.	N|Q	-|-	1|2	0|0	CSMD1|CSMD1	3254385|3254385	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.787000|7.787000	0.85759|0.85759	1.978000|1.978000	0.57642|0.57642	0.467000|0.467000	0.42956|0.42956	AAT|CAA	.	.		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
MCPH1	79648	hgsc.bcm.edu	37	8	6266840	6266840	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:6266840A>T	ENST00000344683.5	+	2	139	c.63A>T	c.(61-63)acA>acT	p.T21T	MCPH1_ENST00000519480.1_Silent_p.T21T|RP11-115C21.2_ENST00000523225.1_RNA|RP11-115C21.2_ENST00000500118.2_RNA|RP11-115C21.2_ENST00000606853.1_RNA|MCPH1_ENST00000522905.1_Silent_p.T21T	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	21	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CCAATGGAACAGAAAATTATT	0.378																																					p.T21T	Colon(95;1448 1467 8277 34473 35819)	Atlas-SNP	.											.	MCPH1	65	.	0			c.A63T						.						160.0	150.0	153.0					8																	6266840		1882	4113	5995	SO:0001819	synonymous_variant	79648	exon2			TGGAACAGAAAAT	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.63A>T	chr8.hg19:g.6266840A>T		74.0	0.0		102.0	17.0	NM_001172575	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	hg19	CCDS43689.1																																																																																			.	.		0.378	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
PTK2B	2185	hgsc.bcm.edu	37	8	27294711	27294711	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:27294711A>G	ENST00000397501.1	+	21	2222	c.1414A>G	c.(1414-1416)Atg>Gtg	p.M472V	PTK2B_ENST00000346049.5_Missense_Mutation_p.M472V|PTK2B_ENST00000544172.1_Missense_Mutation_p.M472V|PTK2B_ENST00000338238.4_Missense_Mutation_p.M472V|PTK2B_ENST00000517339.1_Missense_Mutation_p.M472V|PTK2B_ENST00000397497.4_Missense_Mutation_p.M218V|PTK2B_ENST00000420218.2_Missense_Mutation_p.M472V	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	472	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GGAGAAGTTCATGAGCGAGGC	0.537																																					p.M472V		Atlas-SNP	.											.	PTK2B	304	.	0			c.A1414G						.						121.0	111.0	114.0					8																	27294711		2203	4300	6503	SO:0001583	missense	2185	exon21			AAGTTCATGAGCG	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1414A>G	chr8.hg19:g.27294711A>G	ENSP00000380638:p.Met472Val	85.0	0.0		83.0	21.0	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	hg19	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.238444	0.39598	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.47	1.67	0.24075	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.156962	0.64402	D	0.000001	T	0.59797	0.2220	N	0.04669	-0.19	0.49582	D	0.9998	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.47586	-0.9106	10	0.62326	D	0.03	.	3.6008	0.08024	0.6562:0.1373:0.0749:0.1315	.	218;472;472	E9PBI4;Q14289-2;Q14289	.;.;FAK2_HUMAN	V	472;477;472;472;472;472;472;218	ENSP00000380638:M472V;ENSP00000342242:M472V;ENSP00000440926:M472V;ENSP00000332816:M472V;ENSP00000391995:M472V;ENSP00000427931:M472V;ENSP00000380634:M218V	ENSP00000342242:M472V	M	+	1	0	PTK2B	27350628	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.459000	0.45023	0.113000	0.18004	0.528000	0.53228	ATG	.	.		0.537	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
EXTL3	2137	hgsc.bcm.edu	37	8	28574021	28574021	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:28574021A>T	ENST00000220562.4	+	3	1347	c.445A>T	c.(445-447)Aac>Tac	p.N149Y	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	149					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CATGGCCCAGAACCAGCCCAA	0.607																																					p.N149Y		Atlas-SNP	.											.	EXTL3	83	.	0			c.A445T						.						50.0	45.0	47.0					8																	28574021		2203	4300	6503	SO:0001583	missense	2137	exon3			GCCCAGAACCAGC	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.445A>T	chr8.hg19:g.28574021A>T	ENSP00000220562:p.Asn149Tyr	57.0	0.0		66.0	16.0	NM_001440	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	hg19	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	A	17.82	3.482091	0.63849	.	.	ENSG00000012232	ENST00000220562	D	0.96427	-4.01	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.96830	0.8965	L	0.52573	1.65	0.80722	D	1	D	0.71674	0.998	D	0.64506	0.926	D	0.96486	0.9360	9	.	.	.	-24.3	14.7977	0.69889	1.0:0.0:0.0:0.0	.	149	O43909	EXTL3_HUMAN	Y	149	ENSP00000220562:N149Y	.	N	+	1	0	EXTL3	28629940	1.000000	0.71417	0.995000	0.50966	0.864000	0.49448	9.339000	0.96797	1.903000	0.55091	0.397000	0.26171	AAC	.	.		0.607	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
DUSP4	1846	hgsc.bcm.edu	37	8	29195843	29195843	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:29195843T>A	ENST00000240100.2	-	3	1144	c.755A>T	c.(754-756)aAg>aTg	p.K252M	DUSP4_ENST00000240101.2_Missense_Mutation_p.K161M	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	252	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		GATGTCGGCCTTGTGGTTATC	0.557																																					p.K252M		Atlas-SNP	.											.	DUSP4	58	.	0			c.A755T						.						184.0	154.0	164.0					8																	29195843		2203	4300	6503	SO:0001583	missense	1846	exon3			TCGGCCTTGTGGT	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.755A>T	chr8.hg19:g.29195843T>A	ENSP00000240100:p.Lys252Met	107.0	0.0		115.0	19.0	NM_001394	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	ENST00000240100.2	hg19	CCDS6072.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.294922	0.60086	.	.	ENSG00000120875	ENST00000240100;ENST00000240101	D;D	0.86097	-2.07;-2.07	4.93	4.93	0.64822	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.86360	0.5914	N	0.25890	0.77	0.80722	D	1	D;B	0.76494	0.999;0.03	D;B	0.79784	0.993;0.074	D	0.85404	0.1133	10	0.34782	T	0.22	.	13.1578	0.59527	0.0:0.0:0.0:1.0	.	252;161	Q13115;G5E930	DUS4_HUMAN;.	M	252;161	ENSP00000240100:K252M;ENSP00000240101:K161M	ENSP00000240100:K252M	K	-	2	0	DUSP4	29251762	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	6.074000	0.71253	2.143000	0.66587	0.460000	0.39030	AAG	.	.		0.557	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257249.1	NM_001394	
KCNU1	157855	hgsc.bcm.edu	37	8	36768468	36768468	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:36768468A>T	ENST00000399881.3	+	22	2389	c.2352A>T	c.(2350-2352)ggA>ggT	p.G784G		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	784					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TTTATTCTGGAGACCTCCATG	0.522																																					p.G784G		Atlas-SNP	.											.	KCNU1	359	.	0			c.A2352T						.						89.0	93.0	92.0					8																	36768468		2000	4173	6173	SO:0001819	synonymous_variant	157855	exon22			TTCTGGAGACCTC	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2352A>T	chr8.hg19:g.36768468A>T		32.0	0.0		38.0	13.0	NM_001031836		Silent	SNP	ENST00000399881.3	hg19	CCDS55220.1																																																																																			.	.		0.522	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
ST18	9705	hgsc.bcm.edu	37	8	53044593	53044593	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:53044593T>A	ENST00000276480.7	-	22	3274	c.2591A>T	c.(2590-2592)cAa>cTa	p.Q864L		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	864					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGGTAGCTCTTGTTTGTTCAG	0.493																																					p.Q864L		Atlas-SNP	.											.	ST18	212	.	0			c.A2591T						.						155.0	137.0	143.0					8																	53044593		2203	4300	6503	SO:0001583	missense	9705	exon22			AGCTCTTGTTTGT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2591A>T	chr8.hg19:g.53044593T>A	ENSP00000276480:p.Gln864Leu	114.0	0.0		135.0	34.0	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	hg19	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132554	0.77662	.	.	ENSG00000147488	ENST00000276480	T	0.44881	0.91	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.60495	0.2273	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.57394	-0.7819	10	0.29301	T	0.29	-17.8825	15.4931	0.75629	0.0:0.0:0.0:1.0	.	864	O60284	ST18_HUMAN	L	864	ENSP00000276480:Q864L	ENSP00000276480:Q864L	Q	-	2	0	ST18	53207146	1.000000	0.71417	0.949000	0.38748	0.951000	0.60555	6.099000	0.71466	2.103000	0.63969	0.482000	0.46254	CAA	.	.		0.493	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
SULF1	23213	hgsc.bcm.edu	37	8	70501222	70501222	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:70501222T>A	ENST00000260128.4	+	8	1297	c.580T>A	c.(580-582)Tta>Ata	p.L194I	SULF1_ENST00000402687.4_Missense_Mutation_p.L194I|SULF1_ENST00000419716.3_Missense_Mutation_p.L194I|SULF1_ENST00000458141.2_Missense_Mutation_p.L194I	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	194					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CTTCACAGACTTAATCACTAA	0.418																																					p.L194I		Atlas-SNP	.											.	SULF1	153	.	0			c.T580A						.						87.0	83.0	84.0					8																	70501222		2203	4300	6503	SO:0001583	missense	23213	exon8			ACAGACTTAATCA	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.580T>A	chr8.hg19:g.70501222T>A	ENSP00000260128:p.Leu194Ile	141.0	0.0		157.0	28.0	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	hg19	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.749362	0.49257	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98	5.54	5.54	0.83059	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.96087	0.8725	L	0.39467	1.215	0.58432	D	0.999999	B	0.29212	0.237	B	0.33846	0.171	D	0.94592	0.7788	10	0.54805	T	0.06	.	10.6705	0.45755	0.0:0.0807:0.0:0.9193	.	194	Q8IWU6	SULF1_HUMAN	I	194	ENSP00000403040:L194I;ENSP00000260128:L194I;ENSP00000385704:L194I;ENSP00000390315:L194I	ENSP00000260128:L194I	L	+	1	2	SULF1	70663776	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.338000	0.52128	2.231000	0.72958	0.533000	0.62120	TTA	.	.		0.418	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110439372	110439372	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:110439372A>T	ENST00000378402.5	+	25	3091	c.2987A>T	c.(2986-2988)cAg>cTg	p.Q996L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	996					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGCGGAAAGCAGAATCTTCTA	0.483										HNSCC(38;0.096)																											p.Q996L		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.A2987T						.						44.0	47.0	46.0					8																	110439372		1865	4110	5975	SO:0001583	missense	93035	exon25			GAAAGCAGAATCT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2987A>T	chr8.hg19:g.110439372A>T	ENSP00000367655:p.Gln996Leu	103.0	0.0		84.0	25.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.078200	0.76528	.	.	ENSG00000205038	ENST00000378402	D	0.86164	-2.08	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000001	D	0.89602	0.6762	L	0.43923	1.385	0.31919	N	0.613629	D	0.89917	1.0	D	0.71184	0.972	D	0.89490	0.3756	10	0.38643	T	0.18	.	11.9127	0.52747	1.0:0.0:0.0:0.0	.	996	Q86WI1	PKHL1_HUMAN	L	996	ENSP00000367655:Q996L	ENSP00000367655:Q996L	Q	+	2	0	PKHD1L1	110508548	1.000000	0.71417	0.978000	0.43139	0.909000	0.53808	4.985000	0.63845	2.066000	0.61787	0.482000	0.46254	CAG	.	.		0.483	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CSMD3	114788	hgsc.bcm.edu	37	8	113585883	113585884	+	Missense_Mutation	DNP	AA	AA	TT			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:113585883_113585884AA>TT	ENST00000297405.5	-	24	4132_4133	c.3888_3889TT>AA	c.(3886-3891)atTTat>atAAat	p.Y1297N	CSMD3_ENST00000352409.3_Missense_Mutation_p.Y1297N|CSMD3_ENST00000455883.2_Missense_Mutation_p.Y1193N|CSMD3_ENST00000343508.3_Missense_Mutation_p.Y1257N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1297	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTTCCATCATAAATCTGCaaaa	0.317										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.Y1297N|p.I1296I		Atlas-SNP	.											.	CSMD3	2325	.	0			c.T3889A|c.T3888A						.																																			SO:0001583	missense	114788	exon24			CATCATAAATCTG|ATCATAAATCTGC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3888_3889delinsTT	chr8.hg19:g.113585883_113585884delinsTT	ENSP00000297405:p.Tyr1297Asn	56.0	0.0		81.0|80.0	12.0	NM_198123	Q96PZ3	Missense_Mutation|Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.		0.317	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TAF2	6873	hgsc.bcm.edu	37	8	120809963	120809963	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:120809963T>A	ENST00000378164.2	-	7	1214	c.916A>T	c.(916-918)Act>Tct	p.T306S		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	306					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATGAAGACAGTCTTAAAACAG	0.353																																					p.T306S		Atlas-SNP	.											.	TAF2	204	.	0			c.A916T						.						115.0	109.0	111.0					8																	120809963		2203	4300	6503	SO:0001583	missense	6873	exon7			AGACAGTCTTAAA	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.916A>T	chr8.hg19:g.120809963T>A	ENSP00000367406:p.Thr306Ser	67.0	0.0		108.0	37.0	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	hg19	CCDS34937.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.21|18.21	3.573165|3.573165	0.65765|0.65765	.|.	.|.	ENSG00000064313|ENSG00000064313	ENST00000523904|ENST00000378164	.|T	.|0.04706	.|3.57	6.07|6.07	6.07|6.07	0.98685|0.98685	.|Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	.|0.049676	.|0.85682	.|N	.|0.000000	T|T	0.06280|0.06280	0.0162|0.0162	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|P	.|0.42993	.|0.797	.|B	.|0.43052	.|0.406	T|T	0.39820|0.39820	-0.9595|-0.9595	5|10	.|0.52906	.|T	.|0.07	-15.5069|-15.5069	16.6407|16.6407	0.85098|0.85098	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|306	.|Q6P1X5	.|TAF2_HUMAN	S|S	36|306	.|ENSP00000367406:T306S	.|ENSP00000367406:T306S	R|T	-|-	3|1	2|0	TAF2|TAF2	120879144|120879144	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.997000|7.997000	0.88414|0.88414	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	AGA|ACT	.	.		0.353	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
GSDMC	56169	hgsc.bcm.edu	37	8	130774950	130774950	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:130774950C>G	ENST00000276708.4	-	5	1479	c.598G>C	c.(598-600)Gtg>Ctg	p.V200L		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	200						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TTCTTCTTCACTCTGAGACTC	0.463																																					p.V200L		Atlas-SNP	.											.	GSDMC	71	.	0			c.G598C						.						201.0	179.0	187.0					8																	130774950		2203	4300	6503	SO:0001583	missense	56169	exon5			TCTTCACTCTGAG	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.598G>C	chr8.hg19:g.130774950C>G	ENSP00000276708:p.Val200Leu	41.0	0.0		79.0	11.0	NM_031415	Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	hg19	CCDS6360.1	.	.	.	.	.	.	.	.	.	.	C	8.629	0.893315	0.17613	.	.	ENSG00000147697	ENST00000276708	T	0.22539	1.95	4.13	-3.91	0.04168	.	1.622190	0.03789	N	0.262515	T	0.14787	0.0357	L	0.27053	0.805	0.09310	N	1	P	0.49559	0.925	B	0.40864	0.342	T	0.34551	-0.9824	10	0.28530	T	0.3	.	10.6398	0.45586	0.0:0.3687:0.0:0.6313	.	200	Q9BYG8	GSDMC_HUMAN	L	200	ENSP00000276708:V200L	ENSP00000276708:V200L	V	-	1	0	GSDMC	130844132	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.558000	0.05978	-0.868000	0.04058	-0.658000	0.03865	GTG	.	.		0.463	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
ADCY8	114	hgsc.bcm.edu	37	8	131896933	131896933	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:131896933A>T	ENST00000286355.5	-	8	4078	c.1986T>A	c.(1984-1986)tcT>tcA	p.S662S	ADCY8_ENST00000377928.3_Silent_p.S662S	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	662					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCTCAGGCCCAGACTGGACAT	0.433										HNSCC(32;0.087)																											p.S662S		Atlas-SNP	.											.	ADCY8	291	.	0			c.T1986A						.						153.0	146.0	148.0					8																	131896933		2203	4300	6503	SO:0001819	synonymous_variant	114	exon8			AGGCCCAGACTGG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1986T>A	chr8.hg19:g.131896933A>T		118.0	0.0		153.0	23.0	NM_001115		Silent	SNP	ENST00000286355.5	hg19	CCDS6363.1																																																																																			.	.		0.433	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
GLI4	2738	hgsc.bcm.edu	37	8	144358897	144358897	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr8:144358897G>T	ENST00000523522.1	+	3	1093	c.1054G>T	c.(1054-1056)Gcg>Tcg	p.A352S	GLI4_ENST00000523812.1_3'UTR|GLI4_ENST00000340042.1_Missense_Mutation_p.A352S			P10075	GLI4_HUMAN	GLI family zinc finger 4	352					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GAAGCCCTTCGCGTGTGGCGC	0.711																																					p.A352S		Atlas-SNP	.											.	GLI4	28	.	0			c.G1054T						.						10.0	12.0	11.0					8																	144358897		2195	4280	6475	SO:0001583	missense	2738	exon4			CCCTTCGCGTGTG		CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.1054G>T	chr8.hg19:g.144358897G>T	ENSP00000430987:p.Ala352Ser	87.0	0.0		86.0	25.0	NM_138465	Q96CK9	Missense_Mutation	SNP	ENST00000523522.1	hg19	CCDS6398.1	.	.	.	.	.	.	.	.	.	.	G	5.610	0.297317	0.10622	.	.	ENSG00000250571	ENST00000340042;ENST00000523522	T;T	0.17854	2.25;2.25	3.92	-1.47	0.08772	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04952	0.0133	N	0.02169	-0.655	0.09310	N	1	B	0.14438	0.01	B	0.16289	0.015	T	0.37502	-0.9703	9	0.27785	T	0.31	.	2.9903	0.05981	0.3997:0.0:0.276:0.3243	.	352	P10075	GLI4_HUMAN	S	352	ENSP00000345024:A352S;ENSP00000430987:A352S	ENSP00000345024:A352S	A	+	1	0	GLI4	144430272	0.000000	0.05858	0.013000	0.15412	0.026000	0.11368	-1.963000	0.01513	-0.651000	0.05415	0.563000	0.77884	GCG	.	.		0.711	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381128.2		
SLC24A2	25769	hgsc.bcm.edu	37	9	19786279	19786279	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:19786279C>A	ENST00000341998.2	-	1	647	c.586G>T	c.(586-588)Gta>Tta	p.V196L	SLC24A2_ENST00000286344.3_Missense_Mutation_p.V196L	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	196					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GCGATAAATACCCCTATGAGA	0.468																																					p.V196L		Atlas-SNP	.											.	SLC24A2	93	.	0			c.G586T						.						82.0	81.0	81.0					9																	19786279		2203	4300	6503	SO:0001583	missense	25769	exon1			TAAATACCCCTAT	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.586G>T	chr9.hg19:g.19786279C>A	ENSP00000344801:p.Val196Leu	49.0	0.0		86.0	17.0	NM_001193288	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	hg19	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553177	0.86127	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.63255	-0.03;-0.03	5.76	5.76	0.90799	Sodium/calcium exchanger membrane region (1);	0.057766	0.64402	D	0.000002	T	0.76271	0.3964	L	0.59967	1.855	0.80722	D	1	P;D	0.71674	0.87;0.998	P;D	0.66084	0.612;0.941	T	0.73474	-0.3971	9	.	.	.	.	19.967	0.97274	0.0:1.0:0.0:0.0	.	196;196	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	L	196	ENSP00000344801:V196L;ENSP00000286344:V196L	.	V	-	1	0	SLC24A2	19776279	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	7.814000	0.86154	2.714000	0.92807	0.655000	0.94253	GTA	.	.		0.468	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
ANKRD18B	441459	hgsc.bcm.edu	37	9	33550549	33550549	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:33550549A>T	ENST00000290943.6	+	10	2099	c.2003A>T	c.(2002-2004)aAg>aTg	p.K668M		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	668										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						TGGACTTCAAAGAAGAAATTA	0.338																																					p.K667M		Atlas-SNP	.											.	ANKRD18B	46	.	0			c.A2000T						.																																			SO:0001583	missense	441459	exon10			CTTCAAAGAAGAA			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.2003A>T	chr9.hg19:g.33550549A>T	ENSP00000290943:p.Lys668Met	242.0	0.0		271.0	68.0	NM_001244752		Missense_Mutation	SNP	ENST00000290943.6	hg19		.	.	.	.	.	.	.	.	.	.	a	9.246	1.039517	0.19669	.	.	ENSG00000230453	ENST00000290943;ENST00000357927	T;T	0.32753	1.44;2.86	1.5	1.5	0.22942	.	.	.	.	.	T	0.35068	0.0919	.	.	.	0.27964	N	0.93668	.	.	.	.	.	.	T	0.49476	-0.8936	5	0.87932	D	0	.	7.0263	0.24942	1.0:0.0:0.0:0.0	.	.	.	.	M	668;49	ENSP00000290943:K668M;ENSP00000350607:K49M	ENSP00000290943:K668M	K	+	2	0	ANKRD18B	33540549	1.000000	0.71417	0.357000	0.25798	0.087000	0.18053	3.730000	0.55006	0.929000	0.37192	0.254000	0.18369	AAG	.	.		0.338	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
UBAP2	55833	hgsc.bcm.edu	37	9	33927030	33927030	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:33927030T>C	ENST00000379238.1	-	21	2537	c.2420A>G	c.(2419-2421)aAc>aGc	p.N807S	UBAP2_ENST00000360802.1_Missense_Mutation_p.N807S|UBAP2_ENST00000449054.1_Missense_Mutation_p.N807S|UBAP2_ENST00000379239.4_Missense_Mutation_p.N540S|UBAP2_ENST00000379235.1_Missense_Mutation_p.N46S|UBAP2_ENST00000539807.1_Missense_Mutation_p.N562S					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GAGGTACTGGTTGTGCAGCAG	0.592																																					p.N807S		Atlas-SNP	.											.	UBAP2	82	.	0			c.A2420G						.						49.0	51.0	50.0					9																	33927030		2203	4300	6503	SO:0001583	missense	55833	exon21			TACTGGTTGTGCA	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.2420A>G	chr9.hg19:g.33927030T>C	ENSP00000368540:p.Asn807Ser	52.0	0.0		40.0	12.0	NM_018449		Missense_Mutation	SNP	ENST00000379238.1	hg19	CCDS6547.1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.284675	0.59867	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379235;ENST00000379239;ENST00000539807;ENST00000351580	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	6.17	3.82	0.43975	.	0.039579	0.85682	N	0.000000	T	0.34308	0.0893	L	0.49350	1.555	0.80722	D	1	B;B;B;B;B	0.25235	0.121;0.121;0.121;0.121;0.074	B;B;B;B;B	0.23419	0.029;0.046;0.046;0.029;0.013	T	0.07849	-1.0751	10	0.31617	T	0.26	-15.1683	8.4862	0.33074	0.0:0.1673:0.0:0.8327	.	732;562;540;716;807	F5H4D5;F5H2U4;A6NCA8;F5H2C8;Q5T6F2	.;.;.;.;UBAP2_HUMAN	S	807;807;807;716;46;540;562;243	ENSP00000368540:N807S;ENSP00000416932:N807S;ENSP00000354039:N807S;ENSP00000368537:N46S;ENSP00000368541:N540S;ENSP00000439329:N562S	ENSP00000259602:N243S	N	-	2	0	UBAP2	33917030	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.758000	0.62220	0.552000	0.29026	0.533000	0.62120	AAC	.	.		0.592	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449	
AGTPBP1	23287	hgsc.bcm.edu	37	9	88247600	88247600	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:88247600T>A	ENST00000357081.3	-	14	2136	c.1992A>T	c.(1990-1992)ttA>ttT	p.L664F	AGTPBP1_ENST00000376109.3_Missense_Mutation_p.L676F|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.L502F|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.L624F			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	664					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						AAGGCCTTTCTAAAATAGGCT	0.378																																					p.L624F		Atlas-SNP	.											.	AGTPBP1	128	.	0			c.A1872T						.						54.0	55.0	55.0					9																	88247600		2203	4300	6503	SO:0001583	missense	23287	exon14			CCTTTCTAAAATA	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1992A>T	chr9.hg19:g.88247600T>A	ENSP00000349592:p.Leu664Phe	84.0	0.0		124.0	30.0	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	hg19		.	.	.	.	.	.	.	.	.	.	T	18.02	3.529970	0.64860	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.53206	2.06;2.06;2.04;0.63	6.03	-0.142	0.13448	.	0.065519	0.64402	D	0.000006	T	0.59662	0.2210	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	0.961;0.983;1.0;0.979	P;P;D;P	0.87578	0.808;0.762;0.998;0.864	T	0.56086	-0.8037	10	0.22109	T	0.4	-11.7842	8.102	0.30863	0.1452:0.5828:0.0:0.2719	.	676;664;502;624	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	F	664;624;676;502	ENSP00000349592:L664F;ENSP00000365251:L624F;ENSP00000365277:L676F;ENSP00000402804:L502F	ENSP00000349592:L664F	L	-	3	2	AGTPBP1	87437420	0.998000	0.40836	0.998000	0.56505	0.813000	0.45954	0.410000	0.21098	-0.037000	0.13646	-0.256000	0.11100	TTA	.	.		0.378	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
ROR2	4920	hgsc.bcm.edu	37	9	94486744	94486744	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:94486744A>T	ENST00000375708.3	-	9	2230	c.2032T>A	c.(2032-2034)Tac>Aac	p.Y678N	ROR2_ENST00000375715.1_Missense_Mutation_p.Y538N|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	678	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ACCACACCGTAGGACCAGATG	0.592																																					p.Y678N		Atlas-SNP	.											.	ROR2	167	.	0			c.T2032A						.						74.0	61.0	65.0					9																	94486744		2203	4300	6503	SO:0001583	missense	4920	exon9			CACCGTAGGACCA	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2032T>A	chr9.hg19:g.94486744A>T	ENSP00000364860:p.Tyr678Asn	64.0	0.0		74.0	17.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	hg19	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124611	0.56613	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.86097	-2.07;-2.07	4.86	4.86	0.63082	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38381	N	0.001703	D	0.93769	0.8008	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.989	D	0.95200	0.8316	10	0.87932	D	0	.	14.6483	0.68777	1.0:0.0:0.0:0.0	.	678;538	Q01974;B1APY4	ROR2_HUMAN;.	N	538;678	ENSP00000364867:Y538N;ENSP00000364860:Y678N	ENSP00000364860:Y678N	Y	-	1	0	ROR2	93526565	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	7.242000	0.78210	2.044000	0.60594	0.459000	0.35465	TAC	.	.		0.592	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
ROR2	4920	hgsc.bcm.edu	37	9	94495465	94495465	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:94495465A>T	ENST00000375708.3	-	6	1074	c.876T>A	c.(874-876)ccT>ccA	p.P292P	ROR2_ENST00000375715.1_Silent_p.P152P|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	292	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CGGGGCTCTCAGGCATGGGCA	0.701																																					p.P292P		Atlas-SNP	.											.	ROR2	167	.	0			c.T876A						.						25.0	23.0	24.0					9																	94495465		2200	4298	6498	SO:0001819	synonymous_variant	4920	exon6			GCTCTCAGGCATG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.876T>A	chr9.hg19:g.94495465A>T		88.0	0.0		104.0	27.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	hg19	CCDS6691.1																																																																																			.	.		0.701	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
OR1J1	347168	hgsc.bcm.edu	37	9	125240200	125240200	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:125240200G>T	ENST00000259357.2	-	1	35	c.6C>A	c.(4-6)agC>agA	p.S2R	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						GGTTCTCAGGGCTCATGTTTA	0.502																																					p.S2R		Atlas-SNP	.											.	OR1J1	46	.	0			c.C6A						.						80.0	84.0	83.0					9																	125240200		2203	4300	6503	SO:0001583	missense	347168	exon1			CTCAGGGCTCATG	AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.6C>A	chr9.hg19:g.125240200G>T	ENSP00000259357:p.Ser2Arg	88.0	0.0		121.0	24.0	NM_001004451	A3KFL8|Q6IF10|Q96R88	Missense_Mutation	SNP	ENST00000259357.2	hg19	CCDS35120.1	.	.	.	.	.	.	.	.	.	.	G	0.024	-1.390446	0.01185	.	.	ENSG00000136834	ENST00000259357	T	0.00580	6.43	4.06	-1.53	0.08611	.	0.708561	0.13409	N	0.390017	T	0.00271	0.0008	N	0.02275	-0.615	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41805	-0.9488	10	0.40728	T	0.16	.	1.558	0.02589	0.1534:0.3449:0.3101:0.1916	.	2	Q8NGS3	OR1J1_HUMAN	R	2	ENSP00000259357:S2R	ENSP00000259357:S2R	S	-	3	2	OR1J1	124280021	0.000000	0.05858	0.008000	0.14137	0.103000	0.19146	-1.891000	0.01611	-0.255000	0.09486	-0.717000	0.03617	AGC	.	.		0.502	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053931.1		
RALGDS	5900	hgsc.bcm.edu	37	9	135977865	135977865	+	Silent	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr9:135977865G>A	ENST00000372050.3	-	14	2028	c.2007C>T	c.(2005-2007)agC>agT	p.S669S	RALGDS_ENST00000372047.3_Silent_p.S657S|RALGDS_ENST00000393160.3_Silent_p.S614S|RALGDS_ENST00000372062.3_Silent_p.S640S|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000542690.1_Silent_p.S740S|RALGDS_ENST00000393157.3_Silent_p.S668S	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	669					neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		GCCCTTACTCGCTCCAGCGCT	0.627			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																p.S669S	Melanoma(189;762 2088 15384 21931 52515)	Atlas-SNP	.		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	.	RALGDS	75	.	0			c.C2007T						.						79.0	72.0	74.0					9																	135977865		2203	4300	6503	SO:0001819	synonymous_variant	5900	exon14			TTACTCGCTCCAG	AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.2007C>T	chr9.hg19:g.135977865G>A		28.0	0.0		26.0	4.0	NM_006266	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Silent	SNP	ENST00000372050.3	hg19	CCDS6959.1																																																																																			.	.		0.627	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1	NM_006266	
PTER	9317	hgsc.bcm.edu	37	10	16547129	16547129	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:16547129A>G	ENST00000378000.1	+	5	1055	c.809A>G	c.(808-810)gAc>gGc	p.D270G	PTER_ENST00000535784.2_Missense_Mutation_p.D270G|PTER_ENST00000298942.3_Missense_Mutation_p.D270G|PTER_ENST00000423462.2_Intron	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related	270					catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						CCAGATATTGACATGCCTGAT	0.398																																					p.D270G	Ovarian(2;46 150 15648 38137 47908)	Atlas-SNP	.											.	PTER	40	.	0			c.A809G						.						153.0	149.0	150.0					10																	16547129		2203	4300	6503	SO:0001583	missense	9317	exon5			ATATTGACATGCC	BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.809A>G	chr10.hg19:g.16547129A>G	ENSP00000367239:p.Asp270Gly	85.0	0.0		108.0	26.0	NM_030664	B0YJ77|B3KTF5|D3DRU0|Q9BY46	Missense_Mutation	SNP	ENST00000378000.1	hg19	CCDS7111.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753566	0.69648	.	.	ENSG00000165983	ENST00000343656;ENST00000535784;ENST00000378000;ENST00000298942	T;T;T	0.46451	0.87;0.87;0.87	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.59115	0.2170	M	0.80746	2.51	0.80722	D	1	P	0.36535	0.557	P	0.49637	0.617	T	0.58064	-0.7702	10	0.29301	T	0.29	-30.4121	15.2599	0.73613	1.0:0.0:0.0:0.0	.	270	Q96BW5	PTER_HUMAN	G	270	ENSP00000439485:D270G;ENSP00000367239:D270G;ENSP00000298942:D270G	ENSP00000298942:D270G	D	+	2	0	PTER	16587135	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	8.640000	0.91028	2.078000	0.62432	0.454000	0.30748	GAC	.	.		0.398	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047001.2	NM_030664	
ANKRD26	22852	hgsc.bcm.edu	37	10	27306542	27306542	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:27306542T>A	ENST00000376087.4	-	30	4560	c.4395A>T	c.(4393-4395)atA>atT	p.I1465I	ANKRD26_ENST00000436985.2_Silent_p.I1481I|ANKRD26_ENST00000376070.3_Silent_p.I1022I	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1464					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TATTCCTTTCTATATGACTTC	0.323																																					p.I1465I		Atlas-SNP	.											.	ANKRD26	179	.	0			c.A4395T						.						133.0	120.0	124.0					10																	27306542		1826	4082	5908	SO:0001819	synonymous_variant	22852	exon30			CCTTTCTATATGA	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.4395A>T	chr10.hg19:g.27306542T>A		74.0	0.0		133.0	33.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Silent	SNP	ENST00000376087.4	hg19	CCDS41499.1																																																																																			.	.		0.323	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
ANKRD26	22852	hgsc.bcm.edu	37	10	27337852	27337852	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:27337852T>A	ENST00000376087.4	-	17	1857	c.1692A>T	c.(1690-1692)atA>atT	p.I564I	ANKRD26_ENST00000436985.2_Silent_p.I580I|ANKRD26_ENST00000376070.3_Silent_p.I121I	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	564					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						caccatcatGTATGTTTGCTG	0.328																																					p.I564I		Atlas-SNP	.											.	ANKRD26	179	.	0			c.A1692T						.						157.0	148.0	151.0					10																	27337852		1943	4150	6093	SO:0001819	synonymous_variant	22852	exon17			ATCATGTATGTTT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1692A>T	chr10.hg19:g.27337852T>A		53.0	0.0		76.0	20.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Silent	SNP	ENST00000376087.4	hg19	CCDS41499.1																																																																																			.	.		0.328	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
ADAMTS14	140766	hgsc.bcm.edu	37	10	72434384	72434384	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:72434384T>A	ENST00000373207.1	+	2	155	c.155T>A	c.(154-156)tTc>tAc	p.F52Y	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.F52Y	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	52					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CGGGGACGCTTCCTCTCCCAC	0.587																																					p.F52Y		Atlas-SNP	.											.	ADAMTS14	148	.	0			c.T155A						.						69.0	64.0	65.0					10																	72434384		2203	4300	6503	SO:0001583	missense	140766	exon2			GACGCTTCCTCTC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.155T>A	chr10.hg19:g.72434384T>A	ENSP00000362303:p.Phe52Tyr	35.0	0.0		35.0	10.0	NM_080722	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	hg19	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	T	13.23	2.175293	0.38413	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.64085	-0.08;-0.06	4.95	4.95	0.65309	Peptidase M12B, propeptide (1);	0.074832	0.56097	D	0.000027	T	0.50034	0.1592	L	0.34521	1.04	0.31554	N	0.658421	B;B	0.30326	0.276;0.083	B;B	0.36092	0.217;0.156	T	0.53641	-0.8410	10	0.15952	T	0.53	.	9.7286	0.40348	0.1545:0.0:0.0:0.8455	.	52;52	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	Y	52	ENSP00000362304:F52Y;ENSP00000362303:F52Y	ENSP00000362303:F52Y	F	+	2	0	ADAMTS14	72104390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.719000	0.61937	1.878000	0.54408	0.397000	0.26171	TTC	.	.		0.587	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
ZSWIM8	23053	hgsc.bcm.edu	37	10	75551724	75551724	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:75551724G>T	ENST00000605216.1	+	10	1644	c.1427G>T	c.(1426-1428)cGg>cTg	p.R476L	ZSWIM8_ENST00000604729.1_Missense_Mutation_p.R476L|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.R476L|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.R476L|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.R476L	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	476							zinc ion binding (GO:0008270)										CCCGGCTTCCGGCCAGCGGTG	0.617																																					p.R476L		Atlas-SNP	.											.	.	.	.	0			c.G1427T						.						8.0	10.0	9.0					10																	75551724		1793	3840	5633	SO:0001583	missense	23053	exon10			GCTTCCGGCCAGC	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.1427G>T	chr10.hg19:g.75551724G>T	ENSP00000474748:p.Arg476Leu	90.0	0.0		139.0	29.0	NM_001242488	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.41	3.381691	0.61845	.	.	ENSG00000214655	ENST00000398706	T	0.73363	-0.74	5.55	5.55	0.83447	.	0.127555	0.30752	U	0.008941	T	0.43411	0.1246	N	0.02539	-0.55	0.38515	D	0.948583	P;P;P	0.38455	0.632;0.491;0.632	B;B;B	0.32211	0.142;0.142;0.142	T	0.51364	-0.8715	10	0.37606	T	0.19	-7.746	6.7079	0.23260	0.1984:0.0:0.8016:0.0	.	476;476;476	A7E2V4;A7E2V4-5;A7E2V4-4	K0913_HUMAN;.;.	L	476	ENSP00000381693:R476L	ENSP00000381693:R476L	R	+	2	0	KIAA0913	75221730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.338000	0.79269	2.894000	0.99253	0.655000	0.94253	CGG	.	.		0.617	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
KCNMA1	3778	hgsc.bcm.edu	37	10	79397295	79397295	+	Silent	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:79397295G>A	ENST00000286628.8	-	1	105	c.106C>T	c.(106-108)Cta>Tta	p.L36L	KCNMA1_ENST00000404857.1_Silent_p.L36L|KCNMA1_ENST00000406533.3_Silent_p.L36L|KCNMA1_ENST00000354353.5_Silent_p.L36L|KCNMA1_ENST00000480683.1_Silent_p.L36L|KCNMA1_ENST00000372440.1_Silent_p.L36L|KCNMA1_ENST00000404771.3_Silent_p.L36L|KCNMA1_ENST00000372443.1_Silent_p.L36L|KCNMA1_ENST00000481070.1_Silent_p.L36L|KCNMA1_ENST00000286627.5_Silent_p.L36L	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	36					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	gaCGCGTCTAGGCTGAGATGG	0.637																																					p.L36L		Atlas-SNP	.											.	KCNMA1	370	.	0			c.C106T						.						18.0	16.0	17.0					10																	79397295		2201	4291	6492	SO:0001819	synonymous_variant	3778	exon1			CGTCTAGGCTGAG	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.106C>T	chr10.hg19:g.79397295G>A		247.0	0.0		352.0	79.0	NM_001161352	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	hg19		.	.	.	.	.	.	.	.	.	.	G	11.23	1.576066	0.28092	.	.	ENSG00000156113	ENST00000372421	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	T	0.59238	0.2179	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56980	-0.7889	4	.	.	.	-1.6146	9.1609	0.37021	0.0:0.0:0.7643:0.2357	.	.	.	.	L	24	.	.	P	-	2	0	KCNMA1	79067301	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.938000	0.56583	1.915000	0.55452	0.455000	0.32223	CCT	.	.		0.637	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
OPN4	94233	hgsc.bcm.edu	37	10	88414684	88414684	+	Splice_Site	SNP	A	A	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:88414684A>C	ENST00000241891.5	+	1	311	c.144A>C	c.(142-144)acA>acC	p.T48T	OPN4_ENST00000372071.2_Splice_Site_p.T48T	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	48					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						TCAGTCCCACAGTAAGCCTGG	0.627																																					p.T48T		Atlas-SNP	.											.	OPN4	61	.	0			c.A144C						.						55.0	49.0	51.0					10																	88414684		2203	4300	6503	SO:0001630	splice_region_variant	94233	exon1			TCCCACAGTAAGC	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.144+1A>C	chr10.hg19:g.88414684A>C		45.0	0.0		61.0	13.0	NM_033282	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Silent	SNP	ENST00000241891.5	hg19	CCDS7376.1																																																																																			.	.		0.627	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	Silent
IDE	3416	hgsc.bcm.edu	37	10	94267964	94267964	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:94267964T>A	ENST00000265986.6	-	8	1117		c.e8-2			NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme						beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TAACCCAGCCTGCAACATTCA	0.363																																					.		Atlas-SNP	.											.	IDE	77	.	0			c.1061-2A>T						.						127.0	135.0	132.0					10																	94267964		2203	4300	6503	SO:0001630	splice_region_variant	3416	exon9			CCAGCCTGCAACA	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1061-2A>T	chr10.hg19:g.94267964T>A		211.0	0.0		283.0	57.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Splice_Site	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.390257	0.82902	.	.	ENSG00000119912	ENST00000265986	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4411	0.75184	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	IDE	94257944	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.857000	0.86963	2.114000	0.64651	0.455000	0.32223	.	.	.		0.363	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	Intron
NOC3L	64318	hgsc.bcm.edu	37	10	96116932	96116932	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:96116932T>A	ENST00000371361.3	-	4	607	c.507A>T	c.(505-507)ccA>ccT	p.P169P	NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Splice_Site_p.P169P	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	169					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TAGACTCACCTGGCTTCTCCC	0.338																																					p.P169P		Atlas-SNP	.											.	NOC3L	67	.	0			c.A507T						.						134.0	129.0	131.0					10																	96116932		2203	4300	6503	SO:0001630	splice_region_variant	64318	exon4			CTCACCTGGCTTC	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.508+1A>T	chr10.hg19:g.96116932T>A		87.0	0.0		132.0	24.0	NM_022451	Q9H5M6|Q9H9D8	Silent	SNP	ENST00000371361.3	hg19	CCDS7433.1																																																																																			.	.		0.338	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	Silent
BTRC	8945	hgsc.bcm.edu	37	10	103296339	103296339	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:103296339A>T	ENST00000370187.3	+	12	1624	c.1506A>T	c.(1504-1506)ttA>ttT	p.L502F	BTRC_ENST00000393441.4_Missense_Mutation_p.L461F|BTRC_ENST00000493877.1_3'UTR|BTRC_ENST00000408038.2_Missense_Mutation_p.L466F	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	502					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TACGAGTGTTAGAAGGCCATG	0.398																																					p.L502F		Atlas-SNP	.											.	BTRC	64	.	0			c.A1506T						.						251.0	237.0	242.0					10																	103296339		2203	4300	6503	SO:0001583	missense	8945	exon12			AGTGTTAGAAGGC	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1506A>T	chr10.hg19:g.103296339A>T	ENSP00000359206:p.Leu502Phe	96.0	0.0		111.0	21.0	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	hg19	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293073	0.80914	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.63744	-0.06;-0.06;-0.06	5.69	-1.46	0.08800	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000018	T	0.67505	0.2900	L	0.39147	1.195	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.961;1.0	T	0.66540	-0.5898	10	0.54805	T	0.06	-8.213	13.2336	0.59957	0.3825:0.0:0.6175:0.0	.	476;466;502	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	F	502;461;466	ENSP00000359206:L502F;ENSP00000377088:L461F;ENSP00000385339:L466F	ENSP00000359206:L502F	L	+	3	2	BTRC	103286329	1.000000	0.71417	0.973000	0.42090	0.997000	0.91878	0.889000	0.28282	-0.145000	0.11294	0.529000	0.55759	TTA	.	.		0.398	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
FAM204A	63877	hgsc.bcm.edu	37	10	120070409	120070409	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:120070409T>C	ENST00000369183.4	-	9	921	c.662A>G	c.(661-663)aAg>aGg	p.K221R	FAM204A_ENST00000469758.1_5'UTR|FAM204A_ENST00000369172.4_Missense_Mutation_p.K221R	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	221										kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						CCATCTCTTCTTTGCTTCAAA	0.323																																					p.K221R		Atlas-SNP	.											.	FAM204A	20	.	0			c.A662G						.						119.0	108.0	112.0					10																	120070409		2203	4300	6503	SO:0001583	missense	63877	exon8			CTCTTCTTTGCTT	AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.662A>G	chr10.hg19:g.120070409T>C	ENSP00000358183:p.Lys221Arg	38.0	0.0		56.0	11.0	NM_001134672	D3DRC6|Q5T373|Q9H5V5	Missense_Mutation	SNP	ENST00000369183.4	hg19	CCDS7605.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.676304	0.88445	.	.	ENSG00000165669	ENST00000369183;ENST00000369172	.	.	.	6.08	6.08	0.98989	.	0.040549	0.85682	D	0.000000	T	0.67896	0.2942	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68988	-0.5264	9	0.52906	T	0.07	-21.6781	16.643	0.85134	0.0:0.0:0.0:1.0	.	221	Q9H8W3	F204A_HUMAN	R	221	.	ENSP00000358170:K221R	K	-	2	0	FAM204A	120060399	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.483000	0.81158	2.330000	0.79161	0.533000	0.62120	AAG	.	.		0.323	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050596.2	NM_022063	
RGS10	6001	hgsc.bcm.edu	37	10	121275042	121275042	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:121275042C>T	ENST00000369101.3	-	3	381	c.354G>A	c.(352-354)atG>atA	p.M118I	RGS10_ENST00000369103.2_Missense_Mutation_p.M126I|RGS10_ENST00000469575.1_Intron|RGS10_ENST00000392865.1_Missense_Mutation_p.M112I			O43665	RGS10_HUMAN	regulator of G-protein signaling 10	118	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|large_intestine(1)|lung(3)	6		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)		GTTTCTGGAACATCAGAGGGT	0.512																																					p.M126I		Atlas-SNP	.											.	RGS10	14	.	0			c.G378A						.						173.0	145.0	155.0					10																	121275042		2203	4300	6503	SO:0001583	missense	6001	exon4			CTGGAACATCAGA	AF045229	CCDS31294.1, CCDS41572.1	10q25	2007-08-14	2007-08-14		ENSG00000148908	ENSG00000148908		"""Regulators of G-protein signaling"""	9992	protein-coding gene	gene with protein product		602856	"""regulator of G-protein signalling 10"""			8774883	Standard	NM_002925		Approved		uc001leg.3	O43665	OTTHUMG00000019150	ENST00000369101.3:c.354G>A	chr10.hg19:g.121275042C>T	ENSP00000358097:p.Met118Ile	119.0	0.0		153.0	38.0	NM_001005339	A8K408|B1AMR8|Q6IAZ6|Q96GN0	Missense_Mutation	SNP	ENST00000369101.3	hg19		.	.	.	.	.	.	.	.	.	.	C	26.1	4.707212	0.89018	.	.	ENSG00000148908	ENST00000392865;ENST00000369103;ENST00000369101	T;T;T	0.01787	4.64;4.64;4.64	5.35	5.35	0.76521	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.05547	0.0146	L	0.31752	0.955	0.58432	D	0.999998	P;P;P	0.52577	0.954;0.889;0.909	D;D;D	0.70716	0.966;0.95;0.97	T	0.64385	-0.6420	10	0.16896	T	0.51	-9.6124	18.6828	0.91553	0.0:1.0:0.0:0.0	.	126;112;118	O43665-3;O43665-2;O43665	.;.;RGS10_HUMAN	I	112;126;118	ENSP00000376605:M112I;ENSP00000358099:M126I;ENSP00000358097:M118I	ENSP00000358097:M118I	M	-	3	0	RGS10	121265032	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.344000	0.72991	2.492000	0.84095	0.455000	0.32223	ATG	.	.		0.512	RGS10-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050655.1	NM_002925	
WDR11	55717	hgsc.bcm.edu	37	10	122650234	122650234	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:122650234A>C	ENST00000263461.6	+	19	2596	c.2350A>C	c.(2350-2352)Atg>Ctg	p.M784L	WDR11_ENST00000604509.1_Intron	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GAAGGTTCAGATGGTGAGCAG	0.418																																					p.M784L		Atlas-SNP	.											.	WDR11	95	.	0			c.A2350C						.						234.0	211.0	219.0					10																	122650234		2203	4300	6503	SO:0001583	missense	55717	exon19			GTTCAGATGGTGA	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.2350A>C	chr10.hg19:g.122650234A>C	ENSP00000263461:p.Met784Leu	77.0	0.0		93.0	15.0	NM_018117	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	hg19	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	A	12.83	2.055125	0.36277	.	.	ENSG00000120008	ENST00000263461	D	0.90069	-2.61	5.79	5.79	0.91817	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84719	0.5534	N	0.05441	-0.05	0.80722	D	1	P;P;B;B	0.40970	0.734;0.734;0.015;0.025	P;P;B;B	0.50825	0.651;0.651;0.01;0.008	D	0.84070	0.0379	10	0.23891	T	0.37	-35.6176	16.1354	0.81481	1.0:0.0:0.0:0.0	.	784;784;75;313	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	L	784	ENSP00000263461:M784L	ENSP00000263461:M784L	M	+	1	0	WDR11	122640224	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.792000	0.91856	2.207000	0.71202	0.533000	0.62120	ATG	.	.		0.418	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
STK32C	282974	hgsc.bcm.edu	37	10	134022595	134022595	+	Missense_Mutation	SNP	T	T	C	rs374006685		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr10:134022595T>C	ENST00000368622.1	-	11	1292	c.911A>G	c.(910-912)tAt>tGt	p.Y304C	STK32C_ENST00000368625.4_Missense_Mutation_p.Y434C					serine/threonine kinase 32C											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GTCTTGAAGATAGTCATTCTC	0.567																																					p.Y421C		Atlas-SNP	.											.	STK32C	61	.	0			c.A1262G						.	T	CYS/TYR	1,4403	2.1+/-5.4	0,1,2201	218.0	170.0	186.0		1262	4.0	1.0	10		186	0,8596		0,0,4298	no	missense	STK32C	NM_173575.2	194	0,1,6499	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging	421/487	134022595	1,12999	2202	4298	6500	SO:0001583	missense	282974	exon11			TGAAGATAGTCAT	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.911A>G	chr10.hg19:g.134022595T>C	ENSP00000357611:p.Tyr304Cys	77.0	0.0		95.0	22.0	NM_173575		Missense_Mutation	SNP	ENST00000368622.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.11	2.140345	0.37825	2.27E-4	0.0	ENSG00000165752	ENST00000368622;ENST00000298630;ENST00000368625	T;T;T	0.68479	-0.33;-0.2;-0.26	4.04	4.04	0.47022	.	0.000000	0.53938	U	0.000057	T	0.75664	0.3880	L	0.54323	1.7	0.52501	D	0.999954	D;D;D	0.89917	0.998;0.998;1.0	D;P;D	0.87578	0.912;0.865;0.998	T	0.74794	-0.3544	10	0.39692	T	0.17	.	11.7648	0.51924	0.0:0.0:0.0:1.0	.	434;421;304	B7Z7J1;Q86UX6;Q86UX6-2	.;ST32C_HUMAN;.	C	304;421;434	ENSP00000357611:Y304C;ENSP00000298630:Y421C;ENSP00000357614:Y434C	ENSP00000298630:Y421C	Y	-	2	0	STK32C	133872585	1.000000	0.71417	0.997000	0.53966	0.066000	0.16364	4.304000	0.59104	1.720000	0.51447	0.529000	0.55759	TAT	.	.		0.567	STK32C-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051068.2	NM_173575	
B4GALNT4	338707	hgsc.bcm.edu	37	11	379652	379652	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:379652A>T	ENST00000329962.6	+	15	2439	c.2439A>T	c.(2437-2439)ccA>ccT	p.P813P		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	813					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCTGCCGGCCACTGCGCCTGG	0.721																																					p.P813P		Atlas-SNP	.											.	B4GALNT4	83	.	0			c.A2439T						.						5.0	6.0	6.0					11																	379652		1954	4009	5963	SO:0001819	synonymous_variant	338707	exon15			CCGGCCACTGCGC	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2439A>T	chr11.hg19:g.379652A>T		55.0	0.0		75.0	19.0	NM_178537	Q96LV2	Silent	SNP	ENST00000329962.6	hg19	CCDS7694.1																																																																																			.	.		0.721	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537	
OR51E1	143503	hgsc.bcm.edu	37	11	4674516	4674516	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:4674516T>A	ENST00000396952.5	+	2	1410	c.760T>A	c.(760-762)Tat>Aat	p.Y254N	OR51E1_ENST00000530215.1_Intron	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTTCATATTCTATGTACCTTT	0.493																																					p.Y254N		Atlas-SNP	.											.	OR51E1	67	.	0			c.T760A						.						235.0	224.0	228.0					11																	4674516		2201	4298	6499	SO:0001583	missense	143503	exon2			ATATTCTATGTAC	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.760T>A	chr11.hg19:g.4674516T>A	ENSP00000380155:p.Tyr254Asn	52.0	0.0		63.0	19.0	NM_152430	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	ENST00000396952.5	hg19	CCDS31358.2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.983493	0.74474	.	.	ENSG00000180785	ENST00000396952	T	0.72394	-0.65	4.89	4.89	0.63831	GPCR, rhodopsin-like superfamily (1);	0.130327	0.35262	N	0.003328	D	0.90109	0.6910	H	0.98951	4.38	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93626	0.6952	10	0.87932	D	0	.	13.7621	0.62973	0.0:0.0:0.0:1.0	.	253	Q8TCB6	O51E1_HUMAN	N	254	ENSP00000380155:Y254N	ENSP00000380155:Y254N	Y	+	1	0	OR51E1	4631092	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	4.106000	0.57804	2.188000	0.69820	0.533000	0.62120	TAT	.	.		0.493	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347136.2	NM_152430	
FAR1	84188	hgsc.bcm.edu	37	11	13721881	13721881	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:13721881A>T	ENST00000354817.3	+	3	351	c.207A>T	c.(205-207)agA>agT	p.R69S		NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	69					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						ACAGATTGAGAGATGAAAATC	0.343																																					p.R69S		Atlas-SNP	.											.	FAR1	40	.	0			c.A207T						.						54.0	57.0	56.0					11																	13721881		2200	4293	6493	SO:0001583	missense	84188	exon3			ATTGAGAGATGAA	AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.207A>T	chr11.hg19:g.13721881A>T	ENSP00000346874:p.Arg69Ser	229.0	0.0		322.0	71.0	NM_032228	D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	hg19	CCDS7813.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.557581	0.86231	.	.	ENSG00000197601	ENST00000354817;ENST00000532701;ENST00000355107	T;T	0.40225	1.04;1.04	5.6	5.6	0.85130	Male sterility, NAD-binding (1);	0.096756	0.64402	D	0.000001	T	0.66694	0.2815	M	0.89414	3.03	0.80722	D	1	P;P	0.44478	0.741;0.836	P;P	0.56216	0.72;0.794	T	0.73088	-0.4093	10	0.72032	D	0.01	-11.7547	15.723	0.77728	1.0:0.0:0.0:0.0	.	69;69	E7ETC1;Q8WVX9	.;FACR1_HUMAN	S	69	ENSP00000346874:R69S;ENSP00000437111:R69S	ENSP00000346874:R69S	R	+	3	2	FAR1	13678457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.666000	0.37460	2.252000	0.74401	0.533000	0.62120	AGA	.	.		0.343	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2	NM_032228	
MRGPRX1	259249	hgsc.bcm.edu	37	11	18955672	18955672	+	Silent	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:18955672G>T	ENST00000302797.3	-	1	884	c.660C>A	c.(658-660)ctC>ctA	p.L220L	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'Flank	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	220					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CCAGTACTGTGAGCAGGATGG	0.507																																					p.L220L		Atlas-SNP	.											.	MRGPRX1	84	.	0			c.C660A						.						98.0	82.0	87.0					11																	18955672		2194	4285	6479	SO:0001819	synonymous_variant	259249	exon1			TACTGTGAGCAGG		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.660C>A	chr11.hg19:g.18955672G>T		62.0	0.0		70.0	9.0	NM_147199	Q4V9L2|Q8TDD8|Q8TDD9	Silent	SNP	ENST00000302797.3	hg19	CCDS7846.1																																																																																			.	.		0.507	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199	
CD44	960	hgsc.bcm.edu	37	11	35223290	35223290	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:35223290A>T	ENST00000428726.2	+	9	1232	c.1109A>T	c.(1108-1110)cAt>cTt	p.H370L	CD44_ENST00000434472.2_Intron|CD44_ENST00000433892.2_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000526669.2_Intron|CD44_ENST00000415148.2_Missense_Mutation_p.H327L|CD44_ENST00000263398.6_Intron|CD44_ENST00000433354.2_Missense_Mutation_p.H371L|CD44_ENST00000278386.6_Intron|CD44_ENST00000449691.2_Missense_Mutation_p.H370L|CD44_ENST00000352818.4_Intron|CD44_ENST00000437706.2_Missense_Mutation_p.H370L	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	370	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	CTCATTCACCATGAGCATCAT	0.458																																					p.H370L		Atlas-SNP	.											.	CD44	48	.	0			c.A1109T						.						160.0	132.0	142.0					11																	35223290		2202	4298	6500	SO:0001583	missense	960	exon9			TTCACCATGAGCA	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1109A>T	chr11.hg19:g.35223290A>T	ENSP00000398632:p.His370Leu	91.0	0.0		131.0	31.0	NM_000610	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Missense_Mutation	SNP	ENST00000428726.2	hg19	CCDS7897.1	.	.	.	.	.	.	.	.	.	.	A	11.54	1.669701	0.29693	.	.	ENSG00000026508	ENST00000415148;ENST00000433354;ENST00000449691;ENST00000437706;ENST00000428726;ENST00000528672	T;T;T;T;T;T	0.29917	2.92;2.89;1.94;2.89;2.91;1.55	5.3	0.277	0.15668	.	0.821686	0.10860	N	0.626240	T	0.26991	0.0661	M	0.62723	1.935	0.19300	N	0.999976	B;B	0.18968	0.032;0.019	B;B	0.18561	0.022;0.01	T	0.30563	-0.9974	10	0.48119	T	0.1	-18.6779	4.2355	0.10623	0.561:0.1688:0.2702:0.0	.	327;370	P16070-4;P16070	.;CD44_HUMAN	L	327;371;370;370;370;22	ENSP00000389830:H327L;ENSP00000414567:H371L;ENSP00000391008:H370L;ENSP00000403990:H370L;ENSP00000398632:H370L;ENSP00000431860:H22L	ENSP00000389830:H327L	H	+	2	0	CD44	35179866	0.125000	0.22332	0.297000	0.24988	0.005000	0.04900	-0.035000	0.12205	0.014000	0.14944	-0.441000	0.05720	CAT	.	.		0.458	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610	
RAG1	5896	hgsc.bcm.edu	37	11	36595110	36595110	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:36595110A>T	ENST00000299440.5	+	2	368	c.256A>T	c.(256-258)Aag>Tag	p.K86*		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	86	Interaction with importin alpha-1.				adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AGCCCACCCTAAGTTTTCAAA	0.488									Familial Hemophagocytic Lymphohistiocytosis																												p.K86X	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	Atlas-SNP	.											.	RAG1	151	.	0			c.A256T	GRCh37	CD982919	RAG1	D		.						78.0	85.0	82.0					11																	36595110		2202	4298	6500	SO:0001587	stop_gained	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	CACCCTAAGTTTT	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.256A>T	chr11.hg19:g.36595110A>T	ENSP00000299440:p.Lys86*	151.0	0.0		149.0	40.0	NM_000448	E9PPC4|Q8IY72|Q8NER2	Nonsense_Mutation	SNP	ENST00000299440.5	hg19	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799495	0.70567	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	.	.	.	6.14	6.14	0.99180	.	0.241604	0.41712	D	0.000838	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	12.1018	0.53788	0.7491:0.2509:0.0:0.0	.	.	.	.	X	86	.	ENSP00000299440:K86X	K	+	1	0	RAG1	36551686	0.991000	0.36638	0.822000	0.32727	0.519000	0.34347	3.003000	0.49505	2.367000	0.80283	0.529000	0.55759	AAG	.	.		0.488	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
RAG2	5897	hgsc.bcm.edu	37	11	36615073	36615073	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:36615073T>A	ENST00000311485.3	-	2	807	c.646A>T	c.(646-648)Atc>Ttc	p.I216F	C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|RAG2_ENST00000528428.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	216					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				AAAATATAGATGGTGTCATTT	0.428									Familial Hemophagocytic Lymphohistiocytosis																												p.I216F		Atlas-SNP	.											.	RAG2	92	.	0			c.A646T						.						91.0	93.0	92.0					11																	36615073		2202	4298	6500	SO:0001583	missense	5897	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	TATAGATGGTGTC	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.646A>T	chr11.hg19:g.36615073T>A	ENSP00000308620:p.Ile216Phe	54.0	0.0		86.0	12.0	NM_001243785	A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	hg19	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.033200	0.35893	.	.	ENSG00000175097	ENST00000311485	T	0.77098	-1.07	5.7	-4.54	0.03452	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.382274	0.27100	N	0.020921	T	0.78272	0.4257	M	0.80847	2.515	0.30621	N	0.758531	P	0.40619	0.724	P	0.45610	0.487	T	0.78375	-0.2228	10	0.87932	D	0	-0.0801	12.0096	0.53280	0.0:0.5675:0.1115:0.321	.	216	P55895	RAG2_HUMAN	F	216	ENSP00000308620:I216F	ENSP00000308620:I216F	I	-	1	0	RAG2	36571649	0.001000	0.12720	0.904000	0.35570	0.504000	0.33889	-0.198000	0.09505	-0.899000	0.03901	-0.256000	0.11100	ATC	.	.		0.428	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536	
CKAP5	9793	hgsc.bcm.edu	37	11	46819392	46819392	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:46819392T>A	ENST00000529230.1	-	11	1347	c.1301A>T	c.(1300-1302)aAg>aTg	p.K434M	CKAP5_ENST00000312055.5_Missense_Mutation_p.K434M|CKAP5_ENST00000415402.1_Missense_Mutation_p.K434M|CKAP5_ENST00000532321.1_5'Flank|CKAP5_ENST00000354558.3_Missense_Mutation_p.K434M			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	434					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TAGCAAGCTCTTTGGCAGGGT	0.408																																					p.K434M	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.A1301T						.						144.0	145.0	144.0					11																	46819392		2201	4299	6500	SO:0001583	missense	9793	exon11			AAGCTCTTTGGCA		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1301A>T	chr11.hg19:g.46819392T>A	ENSP00000432768:p.Lys434Met	213.0	0.0		280.0	53.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	hg19	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.006193	0.93287	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81413	0.4817	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	0.992;0.997;1.0	D;D;D	0.79108	0.983;0.989;0.992	D	0.83749	0.0208	10	0.72032	D	0.01	-7.0972	15.6381	0.76970	0.0:0.0:0.0:1.0	.	434;434;434	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	M	434	ENSP00000432768:K434M;ENSP00000395302:K434M;ENSP00000310227:K434M;ENSP00000346566:K434M	ENSP00000310227:K434M	K	-	2	0	CKAP5	46775968	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.280000	0.72626	2.102000	0.63906	0.528000	0.53228	AAG	.	.		0.408	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
FNBP4	23360	hgsc.bcm.edu	37	11	47744591	47744591	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:47744591A>T	ENST00000263773.5	-	15	2754	c.2742T>A	c.(2740-2742)ccT>ccA	p.P914P		NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	914	Pro-rich.					nucleus (GO:0005634)		p.P914P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						gtggtggtggaggaggaggag	0.463																																					p.P914P		Atlas-SNP	.											FNBP4,NS,carcinoma,0,1	FNBP4	99	.	1	Substitution - coding silent(1)	endometrium(1)	c.T2742A						.						15.0	15.0	15.0					11																	47744591		1997	4159	6156	SO:0001819	synonymous_variant	23360	exon15			TGGTGGAGGAGGA	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2742T>A	chr11.hg19:g.47744591A>T		46.0	0.0		34.0	4.0	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	hg19	CCDS41644.1																																																																																			.	.		0.463	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
OR5D13	390142	hgsc.bcm.edu	37	11	55541071	55541071	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:55541071T>A	ENST00000361760.1	+	1	158	c.158T>A	c.(157-159)cTc>cAc	p.L53H		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				ATCATCAGACTCAATTCAAAA	0.403																																					p.L53H		Atlas-SNP	.											.	OR5D13	96	.	0			c.T158A						.						175.0	162.0	166.0					11																	55541071		2200	4296	6496	SO:0001583	missense	390142	exon1			TCAGACTCAATTC	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.158T>A	chr11.hg19:g.55541071T>A	ENSP00000354800:p.Leu53His	138.0	0.0		121.0	35.0	NM_001001967	Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	hg19	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.029479	0.35797	.	.	ENSG00000198877	ENST00000361760	T	0.03065	4.06	3.52	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	1.214740	0.06546	U	0.744161	T	0.09335	0.0230	M	0.83384	2.64	0.09310	N	1	P	0.40376	0.715	B	0.42653	0.394	T	0.33317	-0.9873	10	0.87932	D	0	-10.5256	5.291	0.15727	0.1695:0.0:0.1734:0.6571	.	53	Q8NGL4	OR5DD_HUMAN	H	53	ENSP00000354800:L53H	ENSP00000354800:L53H	L	+	2	0	OR5D13	55297647	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.905000	0.04075	1.626000	0.50381	0.398000	0.26397	CTC	.	.		0.403	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967	
OR5T2	219464	hgsc.bcm.edu	37	11	56000215	56000215	+	Silent	SNP	T	T	A	rs369632317		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:56000215T>A	ENST00000313264.4	-	1	522	c.447A>T	c.(445-447)acA>acT	p.T149T		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					GAAAGCATTCTGTGGTTCCAA	0.418																																					p.T149T		Atlas-SNP	.											.	OR5T2	107	.	0			c.A447T						.						173.0	150.0	158.0					11																	56000215		2201	4296	6497	SO:0001819	synonymous_variant	219464	exon1			GCATTCTGTGGTT	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.447A>T	chr11.hg19:g.56000215T>A		93.0	0.0		102.0	27.0	NM_001004746	B9EGX5|Q6IFC8	Silent	SNP	ENST00000313264.4	hg19	CCDS31523.1																																																																																			.	.		0.418	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57076311	57076311	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:57076311G>A	ENST00000532437.1	-	5	4185	c.3874C>T	c.(3874-3876)Cca>Tca	p.P1292S	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.P1292S|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1292	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				ACTGCCCCTGGGGCCATGTTT	0.582																																					p.P1292S		Atlas-SNP	.											.	TNKS1BP1	148	.	0			c.C3874T						.						100.0	104.0	103.0					11																	57076311		2201	4296	6497	SO:0001583	missense	85456	exon6			CCCCTGGGGCCAT	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3874C>T	chr11.hg19:g.57076311G>A	ENSP00000437271:p.Pro1292Ser	45.0	0.0		40.0	6.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	hg19	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	1.957	-0.439753	0.04636	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.27890	1.64;1.64	4.56	-0.763	0.11030	.	0.648565	0.13545	N	0.379893	T	0.21145	0.0509	L	0.51422	1.61	0.09310	N	1	B	0.16396	0.017	B	0.15052	0.012	T	0.30446	-0.9978	10	0.62326	D	0.03	-4.8043	0.7367	0.00967	0.2932:0.1859:0.3598:0.1611	.	1292	Q9C0C2	TB182_HUMAN	S	1292	ENSP00000350990:P1292S;ENSP00000437271:P1292S	ENSP00000350990:P1292S	P	-	1	0	TNKS1BP1	56832887	0.000000	0.05858	0.002000	0.10522	0.046000	0.14306	-0.430000	0.06973	-0.194000	0.10399	-0.361000	0.07541	CCA	.	.		0.582	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
DTX4	23220	hgsc.bcm.edu	37	11	58940270	58940270	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:58940270C>G	ENST00000227451.3	+	1	306	c.202C>G	c.(202-204)Caa>Gaa	p.Q68E	DTX4_ENST00000532982.1_Intron	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	68	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				CCAGTTCCGCCAAGACACGGG	0.711																																					p.Q68E		Atlas-SNP	.											.	DTX4	84	.	0			c.C202G						.						14.0	17.0	16.0					11																	58940270		2182	4285	6467	SO:0001583	missense	23220	exon1			TTCCGCCAAGACA	AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.202C>G	chr11.hg19:g.58940270C>G	ENSP00000227451:p.Gln68Glu	106.0	0.0		127.0	33.0	NM_015177	Q0VF38	Missense_Mutation	SNP	ENST00000227451.3	hg19	CCDS44612.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340849	0.60963	.	.	ENSG00000110042	ENST00000227451	T	0.40225	1.04	4.07	3.14	0.36123	WWE domain (2);WWE domain, subgroup (1);	.	.	.	.	T	0.36991	0.0987	L	0.33792	1.035	0.48975	D	0.999735	P	0.35033	0.481	B	0.42030	0.373	T	0.11743	-1.0575	9	0.30854	T	0.27	.	12.6732	0.56878	0.1672:0.8328:0.0:0.0	.	68	Q9Y2E6	DTX4_HUMAN	E	68	ENSP00000227451:Q68E	ENSP00000227451:Q68E	Q	+	1	0	DTX4	58696846	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.946000	0.75953	0.962000	0.38057	0.655000	0.94253	CAA	.	.		0.711	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394228.1	XM_166213	
MS4A3	932	hgsc.bcm.edu	37	11	59828780	59828780	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:59828780A>C	ENST00000278865.3	+	2	220	c.147A>C	c.(145-147)caA>caC	p.Q49H	MS4A3_ENST00000395032.2_Intron|MS4A3_ENST00000358152.2_Missense_Mutation_p.Q49H|MS4A3_ENST00000534744.1_Missense_Mutation_p.Q49H|MS4A3_ENST00000526199.1_3'UTR	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	49						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				CAAAATTACAAGTTCTTGGGG	0.433																																					p.Q49H		Atlas-SNP	.											.	MS4A3	47	.	0			c.A147C						.						107.0	102.0	104.0					11																	59828780		2201	4295	6496	SO:0001583	missense	932	exon2			ATTACAAGTTCTT	L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.147A>C	chr11.hg19:g.59828780A>C	ENSP00000278865:p.Gln49His	70.0	0.0		89.0	16.0	NM_001031809	A8MTP8|Q8NHW2	Missense_Mutation	SNP	ENST00000278865.3	hg19	CCDS31567.1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.277820	0.23307	.	.	ENSG00000149516	ENST00000358152;ENST00000278865;ENST00000534744	T;T;T	0.38722	1.12;3.07;1.12	4.21	0.678	0.17969	.	0.391986	0.25944	N	0.027291	T	0.43897	0.1268	L	0.29908	0.895	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.70935	0.971;0.936	T	0.19128	-1.0315	10	0.87932	D	0	-9.0683	5.822	0.18532	0.6552:0.0:0.3448:0.0	.	49;49	Q96HJ5-2;Q96HJ5	.;MS4A3_HUMAN	H	49	ENSP00000350872:Q49H;ENSP00000278865:Q49H;ENSP00000434117:Q49H	ENSP00000278865:Q49H	Q	+	3	2	MS4A3	59585356	0.000000	0.05858	0.275000	0.24674	0.054000	0.15201	-0.488000	0.06497	0.263000	0.21812	0.460000	0.39030	CAA	.	.		0.433	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394417.1		
MS4A14	84689	hgsc.bcm.edu	37	11	60170383	60170383	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:60170383A>T	ENST00000300187.6	+	4	595		c.e4-1		MS4A14_ENST00000531787.1_Splice_Site|MS4A14_ENST00000531783.1_Splice_Site|MS4A14_ENST00000395005.2_Splice_Site|MS4A14_ENST00000395001.1_Splice_Site	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14							integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						ACTATCTTTCAGGGTCAAGGT	0.353																																					.		Atlas-SNP	.											.	MS4A14	120	.	0			c.319-2A>T						.						179.0	168.0	172.0					11																	60170383		2203	4300	6503	SO:0001630	splice_region_variant	84689	exon4			TCTTTCAGGGTCA	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.319-1A>T	chr11.hg19:g.60170383A>T		54.0	0.0		87.0	15.0	NM_001261828	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Splice_Site	SNP	ENST00000300187.6	hg19	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	A	8.253	0.809407	0.16537	.	.	ENSG00000166928	ENST00000300187;ENST00000395005;ENST00000526375;ENST00000531783;ENST00000534688	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4078	0.44274	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MS4A14	59926959	1.000000	0.71417	0.986000	0.45419	0.021000	0.10359	3.397000	0.52572	2.223000	0.72356	0.528000	0.53228	.	.	.		0.353	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		Intron
HRASLS5	117245	hgsc.bcm.edu	37	11	63235905	63235905	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:63235905A>T	ENST00000301790.4	-	4	567	c.408T>A	c.(406-408)atT>atA	p.I136I	HRASLS5_ENST00000539221.1_Silent_p.I136I|HRASLS5_ENST00000540857.1_Silent_p.I126I			Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	136							transferase activity, transferring acyl groups (GO:0016746)			endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14						GAAAAATCTCAATCAGGTCTC	0.423																																					p.I136I		Atlas-SNP	.											.	HRASLS5	28	.	0			c.T408A						.						128.0	125.0	126.0					11																	63235905		2201	4298	6499	SO:0001819	synonymous_variant	117245	exon4			AATCTCAATCAGG	AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004			24978	protein-coding gene	gene with protein product		611474					Standard	NM_001146729		Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000301790.4:c.408T>A	chr11.hg19:g.63235905A>T		46.0	0.0		80.0	9.0	NM_001146728	B7X6T1|F5GZ87|F5H4Y9	Silent	SNP	ENST00000301790.4	hg19	CCDS8044.1																																																																																			.	.		0.423	HRASLS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396375.1	NM_054108	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73066957	73066957	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:73066957A>T	ENST00000263674.3	+	5	3972	c.3622A>T	c.(3622-3624)Aag>Tag	p.K1208*	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1208	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CCTCATGATCAAGCCTGTGCA	0.572																																					p.K1208X		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.A3622T						.						153.0	142.0	146.0					11																	73066957		2200	4293	6493	SO:0001587	stop_gained	9828	exon5			ATGATCAAGCCTG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.3622A>T	chr11.hg19:g.73066957A>T	ENSP00000263674:p.Lys1208*	59.0	0.0		76.0	15.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Nonsense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	A	46	12.552663	0.99677	.	.	ENSG00000110237	ENST00000263674	.	.	.	5.68	5.68	0.88126	.	0.047372	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.1042	14.7721	0.69688	1.0:0.0:0.0:0.0	.	.	.	.	X	1208	.	ENSP00000263674:K1208X	K	+	1	0	ARHGEF17	72744605	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.170000	0.68504	0.460000	0.39030	AAG	.	.		0.572	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
NAALAD2	10003	hgsc.bcm.edu	37	11	89911262	89911262	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:89911262T>A	ENST00000534061.1	+	16	2065	c.1835T>A	c.(1834-1836)tTg>tAg	p.L612*	NAALAD2_ENST00000321955.4_Nonsense_Mutation_p.L579*|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	612					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GATCAACAATTGACAGACCAT	0.308																																					p.L612X		Atlas-SNP	.											.	NAALAD2	113	.	0			c.T1835A						.						88.0	93.0	91.0					11																	89911262		2201	4296	6497	SO:0001587	stop_gained	10003	exon16			AACAATTGACAGA	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1835T>A	chr11.hg19:g.89911262T>A	ENSP00000432481:p.Leu612*	123.0	0.0		127.0	26.0	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Nonsense_Mutation	SNP	ENST00000534061.1	hg19	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	T	39	7.586059	0.98374	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	.	.	.	5.63	4.49	0.54785	.	0.425440	0.21786	N	0.069125	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.2761	12.9185	0.58218	0.0:0.0:0.1357:0.8643	.	.	.	.	X	612;579	.	.	L	+	2	0	NAALAD2	89550910	0.877000	0.30153	0.002000	0.10522	0.838000	0.47535	4.510000	0.60455	0.956000	0.37904	0.524000	0.50904	TTG	.	.		0.308	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
MMP20	9313	hgsc.bcm.edu	37	11	102479781	102479781	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:102479781C>A	ENST00000260228.2	-	5	710	c.698G>T	c.(697-699)gGc>gTc	p.G233V	MMP20_ENST00000544938.1_5'Flank|RP11-817J15.2_ENST00000544115.1_RNA|RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	240					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	ATGGGCCAGGCCCAGGGCATG	0.428																																					p.G233V		Atlas-SNP	.											.	MMP20	52	.	0			c.G698T						.						102.0	96.0	98.0					11																	102479781		2203	4299	6502	SO:0001583	missense	9313	exon5			GCCAGGCCCAGGG	Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.698G>T	chr11.hg19:g.102479781C>A	ENSP00000260228:p.Gly233Val	92.0	0.0		109.0	29.0	NM_004771	D3DUA8|Q9H3Q0	Missense_Mutation	SNP	ENST00000260228.2	hg19	CCDS8318.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.885304	0.91814	.	.	ENSG00000137674	ENST00000260228	D	0.91894	-2.93	5.38	5.38	0.77491	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98160	0.9392	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99372	1.0920	10	0.87932	D	0	.	18.9412	0.92605	0.0:1.0:0.0:0.0	.	233	O60882	MMP20_HUMAN	V	233	ENSP00000260228:G233V	ENSP00000260228:G233V	G	-	2	0	MMP20	101984991	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.376000	0.79658	2.793000	0.96121	0.655000	0.94253	GGC	.	.		0.428	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1		
GRIA4	2893	hgsc.bcm.edu	37	11	105768993	105768993	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:105768993A>T	ENST00000530497.1	+	6	726		c.e6-1		GRIA4_ENST00000282499.5_Splice_Site|GRIA4_ENST00000428631.2_Splice_Site|GRIA4_ENST00000393127.2_Splice_Site|GRIA4_ENST00000525187.1_Splice_Site|GRIA4_ENST00000393125.2_Splice_Site			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TAATTTTTATAGGGATTCAAG	0.279																																					.		Atlas-SNP	.											.	GRIA4	380	.	0			c.727-2A>T						.						33.0	37.0	35.0					11																	105768993		2201	4294	6495	SO:0001630	splice_region_variant	2893	exon7			TTTTATAGGGATT	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.727-1A>T	chr11.hg19:g.105768993A>T		130.0	0.0		165.0	35.0	NM_001077243	Q86XE8	Splice_Site	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.079267	0.76528	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0037	0.80327	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA4	105274203	1.000000	0.71417	0.997000	0.53966	0.818000	0.46254	8.926000	0.92839	2.184000	0.69523	0.533000	0.62120	.	.	.		0.279	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		Intron
ANKK1	255239	hgsc.bcm.edu	37	11	113270966	113270966	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:113270966C>A	ENST00000303941.3	+	8	2369	c.2275C>A	c.(2275-2277)Cca>Aca	p.P759T		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	759							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		TGGTTCTAAGCCAGGAGCCGA	0.587																																					p.P759T		Atlas-SNP	.											.	ANKK1	83	.	0			c.C2275A						.						7.0	9.0	8.0					11																	113270966		1783	3859	5642	SO:0001583	missense	255239	exon8			TCTAAGCCAGGAG	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.2275C>A	chr11.hg19:g.113270966C>A	ENSP00000306678:p.Pro759Thr	99.0	0.0		98.0	26.0	NM_178510		Missense_Mutation	SNP	ENST00000303941.3	hg19	CCDS44734.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.436234	0.25813	.	.	ENSG00000170209	ENST00000303941	T	0.74737	-0.87	4.94	0.403	0.16350	Ankyrin repeat-containing domain (1);	0.242926	0.20916	U	0.083367	T	0.52058	0.1711	N	0.19112	0.55	0.09310	N	1	B	0.23377	0.084	B	0.20767	0.031	T	0.44544	-0.9321	10	0.66056	D	0.02	-0.3747	2.9286	0.05792	0.1968:0.4703:0.0:0.333	.	759	Q8NFD2	ANKK1_HUMAN	T	759	ENSP00000306678:P759T	ENSP00000306678:P759T	P	+	1	0	ANKK1	112776176	0.006000	0.16342	0.006000	0.13384	0.003000	0.03518	0.198000	0.17217	0.516000	0.28340	-0.290000	0.09829	CCA	.	.		0.587	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510	
DRD2	1813	hgsc.bcm.edu	37	11	113295219	113295219	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:113295219T>A	ENST00000362072.3	-	2	499	c.155A>T	c.(154-156)aAc>aTc	p.N52I	DRD2_ENST00000346454.3_Missense_Mutation_p.N52I|DRD2_ENST00000535984.1_5'UTR|DRD2_ENST00000542968.1_Missense_Mutation_p.N52I|DRD2_ENST00000355319.2_Missense_Mutation_p.N52I|DRD2_ENST00000538967.1_Missense_Mutation_p.N52I|DRD2_ENST00000544518.1_Missense_Mutation_p.N52I	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	52					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CACCAGCACGTTGCCGAAGAC	0.622																																					p.N52I		Atlas-SNP	.											.	DRD2	98	.	0			c.A155T						.						246.0	185.0	206.0					11																	113295219		2201	4296	6497	SO:0001583	missense	1813	exon2			AGCACGTTGCCGA	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.155A>T	chr11.hg19:g.113295219T>A	ENSP00000354859:p.Asn52Ile	98.0	0.0		85.0	17.0	NM_016574	Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	hg19	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.030105	0.93575	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967;ENST00000543292	D;D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.52	5.52	0.82312	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99118	0.9696	H	0.99732	4.735	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98740	1.0716	10	0.87932	D	0	.	15.6343	0.76937	0.0:0.0:0.0:1.0	.	52;52;52;52	F8VUV1;P14416-3;P14416-2;P14416	.;.;.;DRD2_HUMAN	I	52	ENSP00000347474:N52I;ENSP00000278597:N52I;ENSP00000354859:N52I;ENSP00000441068:N52I;ENSP00000442172:N52I;ENSP00000438215:N52I;ENSP00000438419:N52I	ENSP00000278597:N52I	N	-	2	0	DRD2	112800429	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.979000	0.88103	2.091000	0.63221	0.459000	0.35465	AAC	.	.		0.622	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
DSCAML1	57453	hgsc.bcm.edu	37	11	117299320	117299320	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:117299320A>T	ENST00000321322.6	-	33	6067	c.6066T>A	c.(6064-6066)gcT>gcA	p.A2022A	DSCAML1_ENST00000527706.1_Silent_p.A1752A	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1962					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGAGGCGGCAGCGGGGGCCC	0.721																																					p.A2022A		Atlas-SNP	.											.	DSCAML1	286	.	0			c.T6066A						.						11.0	13.0	12.0					11																	117299320		2190	4281	6471	SO:0001819	synonymous_variant	57453	exon33			GGCGGCAGCGGGG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.6066T>A	chr11.hg19:g.117299320A>T		79.0	0.0		128.0	24.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	hg19	CCDS8384.1																																																																																			.	.		0.721	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
DSCAML1	57453	hgsc.bcm.edu	37	11	117375751	117375751	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:117375751A>T	ENST00000321322.6	-	10	2251	c.2250T>A	c.(2248-2250)ccT>ccA	p.P750P	DSCAML1_ENST00000527706.1_Silent_p.P480P	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	690	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CCACAAATCGAGGGGGCACTG	0.562																																					p.P750P		Atlas-SNP	.											.	DSCAML1	286	.	0			c.T2250A						.						93.0	82.0	86.0					11																	117375751		2201	4296	6497	SO:0001819	synonymous_variant	57453	exon10			AAATCGAGGGGGC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2250T>A	chr11.hg19:g.117375751A>T		66.0	0.0		70.0	10.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	hg19	CCDS8384.1																																																																																			.	.		0.562	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
FOXR1	283150	hgsc.bcm.edu	37	11	118851924	118851924	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr11:118851924T>A	ENST00000317011.3	+	6	1082	c.857T>A	c.(856-858)aTg>aAg	p.M286K		NM_181721.2	NP_859072.1	Q6PIV2	FOXR1_HUMAN	forkhead box R1	286					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		ACAGATGTGATGCCCTTCCTC	0.448																																					p.M286K		Atlas-SNP	.											.	FOXR1	30	.	0			c.T857A						.						257.0	240.0	246.0					11																	118851924		2200	4295	6495	SO:0001583	missense	283150	exon6			ATGTGATGCCCTT	AB094092	CCDS31688.1	11q23.3	2008-02-05			ENSG00000176302	ENSG00000176302		"""Forkhead boxes"""	29980	protein-coding gene	gene with protein product		615755				15067358	Standard	XM_005271514		Approved	DLNB13, FOXN5	uc001pui.3	Q6PIV2	OTTHUMG00000166347	ENST00000317011.3:c.857T>A	chr11.hg19:g.118851924T>A	ENSP00000314806:p.Met286Lys	129.0	0.0		119.0	21.0	NM_181721	B0YJ15|Q08AS8|Q86UT9|Q8IXX2	Missense_Mutation	SNP	ENST00000317011.3	hg19	CCDS31688.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.032635	0.54790	.	.	ENSG00000176302	ENST00000317011	D	0.95171	-3.63	5.59	5.59	0.84812	.	0.226336	0.45126	D	0.000387	D	0.91181	0.7222	N	0.25647	0.755	0.42761	D	0.993808	P	0.48911	0.917	P	0.46049	0.502	D	0.91854	0.5494	10	0.56958	D	0.05	.	12.4511	0.55677	0.0:0.0:0.0:1.0	.	286	Q6PIV2	FOXR1_HUMAN	K	286	ENSP00000314806:M286K	ENSP00000314806:M286K	M	+	2	0	FOXR1	118357134	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.013000	0.57138	2.254000	0.74563	0.533000	0.62120	ATG	.	.		0.448	FOXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389312.1	NM_181721	
CACNA1C	775	hgsc.bcm.edu	37	12	2800241	2800241	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:2800241T>A	ENST00000347598.4	+	49	6437	c.6437T>A	c.(6436-6438)gTg>gAg	p.V2146E	CACNA1C_ENST00000399629.1_Missense_Mutation_p.V2115E|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V2126E|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V2133E|CACNA1C_ENST00000335762.5_Missense_Mutation_p.V2123E|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V2117E|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V2139E|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V2106E|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V2118E|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V2098E|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V2169E|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V2098E|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V2098E|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V2117E|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V2098E|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V2117E|CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V2104E|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V2169E|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V2098E|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V2098E|CACNA1C_ENST00000327702.7_Missense_Mutation_p.V2133E|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V2106E	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2181					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTACCCTTTGTGAACTGCAGG	0.692																																					p.V2181E		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.T6542A						.						13.0	16.0	15.0					12																	2800241		1901	4090	5991	SO:0001583	missense	775	exon50			CCTTTGTGAACTG	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6437T>A	chr12.hg19:g.2800241T>A	ENSP00000266376:p.Val2146Glu	117.0	0.0		143.0	30.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	hg19	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620520	0.46736	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2	4.49	2.11	0.27256	.	0.462954	0.21481	N	0.073824	T	0.40956	0.1138	N	0.25647	0.755	0.24399	N	0.994716	B;P;B;B;B;B;B;B;B;B;B;B;B;P;B;P;B;B;B;B;B;P;B;B;B	0.37663	0.167;0.546;0.13;0.046;0.374;0.328;0.145;0.374;0.214;0.082;0.328;0.007;0.066;0.604;0.016;0.469;0.066;0.321;0.328;0.029;0.145;0.515;0.328;0.277;0.007	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.36845	0.066;0.234;0.055;0.028;0.156;0.116;0.079;0.156;0.139;0.034;0.116;0.015;0.036;0.156;0.007;0.075;0.036;0.075;0.116;0.047;0.079;0.156;0.116;0.079;0.015	T	0.27502	-1.0072	10	0.59425	D	0.04	.	8.1687	0.31241	0.0:0.3378:0.0:0.6622	.	789;2139;2095;2181;2133;2117;2098;2115;2126;2098;2118;2098;2129;2146;2098;2133;2169;2106;2104;2106;2087;2117;2117;2098;2098	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	E	2123;2098;2098;2126;2098;2117;2117;2106;2098;2146;2118;2098;2139;2115;2133;2104;2117;2098;2169;2133;2169;2106;1999	ENSP00000336982:V2123E;ENSP00000382563:V2098E;ENSP00000382552:V2098E;ENSP00000382547:V2126E;ENSP00000382506:V2098E;ENSP00000382530:V2117E;ENSP00000382546:V2117E;ENSP00000382500:V2106E;ENSP00000382549:V2098E;ENSP00000266376:V2146E;ENSP00000382515:V2118E;ENSP00000382510:V2098E;ENSP00000341092:V2139E;ENSP00000382537:V2115E;ENSP00000329877:V2133E;ENSP00000382557:V2104E;ENSP00000385724:V2117E;ENSP00000382512:V2098E;ENSP00000382542:V2169E;ENSP00000382526:V2133E;ENSP00000385896:V2169E;ENSP00000382504:V2106E	ENSP00000323129:V1999E	V	+	2	0	CACNA1C	2670502	0.988000	0.35896	0.938000	0.37757	0.984000	0.73092	1.181000	0.32017	0.346000	0.23899	-0.353000	0.07706	GTG	.	.		0.692	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
MFAP5	8076	hgsc.bcm.edu	37	12	8813492	8813492	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:8813492A>T	ENST00000359478.2	-	3	248	c.61T>A	c.(61-63)Tgg>Agg	p.W21R	MFAP5_ENST00000543369.1_Intron|MFAP5_ENST00000433590.2_Missense_Mutation_p.W21R|MFAP5_ENST00000535336.1_Missense_Mutation_p.W21R|MFAP5_ENST00000396549.2_Missense_Mutation_p.W21R|MFAP5_ENST00000538107.1_5'UTR|MFAP5_ENST00000540087.1_Missense_Mutation_p.W21R	NM_003480.2	NP_003471.1	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	21					extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|skin(1)	13	Lung SC(5;0.184)					AGGGGTATCCAGTCTATAGCA	0.428																																					p.W21R		Atlas-SNP	.											.	MFAP5	34	.	0			c.T61A						.						88.0	89.0	89.0					12																	8813492		2203	4300	6503	SO:0001583	missense	8076	exon3			GTATCCAGTCTAT	AK124368	CCDS8595.1, CCDS73437.1	12p13.1-p12.3	2004-04-05				ENSG00000197614			29673	protein-coding gene	gene with protein product		601103				9792630, 8557636	Standard	XM_005253485		Approved	MAGP2, MP25	uc001qut.1	Q13361		ENST00000359478.2:c.61T>A	chr12.hg19:g.8813492A>T	ENSP00000352455:p.Trp21Arg	135.0	0.0		149.0	31.0	NM_003480	B0AZL6|D3DUV1|Q7Z490	Missense_Mutation	SNP	ENST00000359478.2	hg19	CCDS8595.1	.	.	.	.	.	.	.	.	.	.	A	6.246	0.413525	0.11812	.	.	ENSG00000197614	ENST00000359478;ENST00000433590;ENST00000396549;ENST00000535336;ENST00000540087;ENST00000544889	.	.	.	4.81	2.43	0.29744	.	0.142496	0.34178	N	0.004199	T	0.29914	0.0748	L	0.38838	1.175	0.26858	N	0.968011	B;B;B	0.24258	0.014;0.1;0.1	B;B;B	0.26202	0.025;0.067;0.067	T	0.19289	-1.0310	9	0.48119	T	0.1	-6.3481	6.5106	0.22220	0.8067:0.0:0.1933:0.0	.	21;21;21	B3KW70;Q13361;Q7Z490	.;MFAP5_HUMAN;.	R	21	.	ENSP00000352455:W21R	W	-	1	0	MFAP5	8704759	0.936000	0.31750	0.438000	0.26821	0.038000	0.13279	1.918000	0.40006	0.417000	0.25871	0.533000	0.62120	TGG	.	.		0.428	MFAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400656.2	NM_003480	
CNTN1	1272	hgsc.bcm.edu	37	12	41374784	41374784	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:41374784T>A	ENST00000551295.2	+	16	1995	c.1878T>A	c.(1876-1878)cgT>cgA	p.R626R	CNTN1_ENST00000347616.1_Silent_p.R626R|CNTN1_ENST00000348761.2_Silent_p.R615R	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	626	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CTTGGAGCCGTGGTTCAGACA	0.428																																					p.R626R		Atlas-SNP	.											.	CNTN1	207	.	0			c.T1878A						.						133.0	135.0	135.0					12																	41374784		2203	4300	6503	SO:0001819	synonymous_variant	1272	exon16			GAGCCGTGGTTCA	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1878T>A	chr12.hg19:g.41374784T>A		71.0	0.0		77.0	17.0	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	hg19	CCDS8737.1																																																																																			.	.		0.428	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
KRT81	3887	hgsc.bcm.edu	37	12	52680125	52680125	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:52680125A>T	ENST00000327741.5	-	9	1500	c.1432T>A	c.(1432-1434)Tgc>Agc	p.C478S	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	478	Tail.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCCCCTCCGCAGGTGGTGTTC	0.662																																					p.C478S		Atlas-SNP	.											.	KRT81	46	.	0			c.T1432A						.						27.0	25.0	25.0					12																	52680125		2162	4230	6392	SO:0001583	missense	3887	exon9			CTCCGCAGGTGGT	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1432T>A	chr12.hg19:g.52680125A>T	ENSP00000369349:p.Cys478Ser	136.0	0.0		128.0	26.0	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	hg19	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.700306	0.30142	.	.	ENSG00000205426	ENST00000327741	T	0.80653	-1.4	3.0	3.0	0.34707	.	.	.	.	.	T	0.66386	0.2784	N	0.22421	0.69	0.09310	N	1	B	0.27853	0.191	B	0.25759	0.063	T	0.53711	-0.8400	9	0.29301	T	0.29	.	8.8019	0.34914	1.0:0.0:0.0:0.0	.	478	Q14533	KRT81_HUMAN	S	478	ENSP00000369349:C478S	ENSP00000369349:C478S	C	-	1	0	KRT81	50966392	0.014000	0.17966	0.004000	0.12327	0.011000	0.07611	0.717000	0.25851	1.150000	0.42419	0.379000	0.24179	TGC	.	.		0.662	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
KRT6A	3853	hgsc.bcm.edu	37	12	52883809	52883809	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:52883809A>T	ENST00000330722.6	-	6	1189	c.1121T>A	c.(1120-1122)cTg>cAg	p.L374Q		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	374	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGTGTTGCGCAGGTCGTCCCC	0.562																																					p.L374Q		Atlas-SNP	.											.	KRT6A	89	.	0			c.T1121A						.						107.0	85.0	93.0					12																	52883809		2202	4279	6481	SO:0001583	missense	3853	exon6			TTGCGCAGGTCGT	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1121T>A	chr12.hg19:g.52883809A>T	ENSP00000369317:p.Leu374Gln	106.0	0.0		106.0	21.0	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	hg19	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	a	28.5	4.922238	0.92319	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.81908	-1.55	5.3	5.3	0.74995	Filament (1);	0.000000	0.46442	D	0.000283	D	0.93923	0.8055	H	0.96518	3.835	0.52099	D	0.99994	D	0.89917	1.0	D	0.91635	0.999	D	0.95755	0.8795	10	0.87932	D	0	.	15.5563	0.76196	1.0:0.0:0.0:0.0	.	374	P02538	K2C6A_HUMAN	Q	374;330	ENSP00000369317:L374Q	ENSP00000369317:L374Q	L	-	2	0	KRT6A	51170076	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.197000	0.94985	2.148000	0.66965	0.459000	0.35465	CTG	.	.		0.562	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
AGAP2	116986	hgsc.bcm.edu	37	12	58127876	58127876	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:58127876A>T	ENST00000547588.1	-	5	1481	c.1482T>A	c.(1480-1482)caT>caA	p.H494Q	AGAP2_ENST00000257897.3_Missense_Mutation_p.H158Q	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	494	G domain.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TCAGCTGCCCATGGAGACGGC	0.597																																					p.H494Q		Atlas-SNP	.											.	AGAP2	167	.	0			c.T1482A						.						62.0	50.0	54.0					12																	58127876		2203	4300	6503	SO:0001583	missense	116986	exon5			CTGCCCATGGAGA	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1482T>A	chr12.hg19:g.58127876A>T	ENSP00000449241:p.His494Gln	69.0	0.0		62.0	14.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	hg19	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.5|20.5	3.998442|3.998442	0.74818|0.74818	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000257897;ENST00000547588|ENST00000328568	T;T|.	0.21932|.	1.98;1.98|.	5.43|5.43	-3.88|-3.88	0.04205|0.04205	Mitochondrial Rho-like (1);|.	0.088804|.	0.46442|.	D|.	0.000293|.	T|T	0.57125|0.57125	0.2032|0.2032	L|L	0.49350|0.49350	1.555|1.555	0.39558|0.39558	D|D	0.969081|0.969081	D;D;D|.	0.57571|.	0.98;0.972;0.978|.	P;P;P|.	0.56751|.	0.527;0.705;0.805|.	T|T	0.58476|0.58476	-0.7630|-0.7630	10|5	0.87932|.	D|.	0|.	.|.	14.0267|14.0267	0.64590|0.64590	0.429:0.0:0.571:0.0|0.429:0.0:0.571:0.0	.|.	158;494;494|.	Q99490-2;F8VVT9;Q99490|.	.;.;AGAP2_HUMAN|.	Q|R	158;494|358	ENSP00000257897:H158Q;ENSP00000449241:H494Q|.	ENSP00000257897:H158Q|.	H|W	-|-	3|1	2|0	AGAP2|AGAP2	56414143|56414143	0.156000|0.156000	0.22821|0.22821	0.975000|0.975000	0.42487|0.42487	0.975000|0.975000	0.68041|0.68041	0.406000|0.406000	0.21032|0.21032	-0.647000|-0.647000	0.05444|0.05444	-0.379000|-0.379000	0.06801|0.06801	CAT|TGG	.	.		0.597	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
PTPRB	5787	hgsc.bcm.edu	37	12	70965670	70965670	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:70965670A>T	ENST00000261266.5	-	10	2415	c.2386T>A	c.(2386-2388)Tac>Aac	p.Y796N	PTPRB_ENST00000538708.1_Missense_Mutation_p.Y796N|PTPRB_ENST00000551525.1_Missense_Mutation_p.Y1013N|PTPRB_ENST00000550857.1_Missense_Mutation_p.Y706N|PTPRB_ENST00000550358.1_Missense_Mutation_p.Y926N|PTPRB_ENST00000334414.6_Missense_Mutation_p.Y1014N|PTPRB_ENST00000451516.2_Missense_Mutation_p.Y706N	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	796	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GTGACACTGTACAACCGTCCA	0.383																																					p.Y1014N		Atlas-SNP	.											.	PTPRB	676	.	0			c.T3040A						.						194.0	191.0	192.0					12																	70965670		1905	4132	6037	SO:0001583	missense	5787	exon12			CACTGTACAACCG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2386T>A	chr12.hg19:g.70965670A>T	ENSP00000261266:p.Tyr796Asn	92.0	0.0		112.0	20.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.367254	0.82463	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	D;D;D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	6.17	6.17	0.99709	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94918	0.8357	M	0.85630	2.765	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D;D	0.87578	0.997;0.998;0.998;0.987;0.997;0.997;0.997	D	0.95421	0.8507	10	0.87932	D	0	.	15.3933	0.74767	1.0:0.0:0.0:0.0	.	706;796;893;1013;1014;796;926	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	N	1014;706;926;796;706;796;1013;893	ENSP00000334928:Y1014N;ENSP00000393028:Y706N;ENSP00000448058:Y926N;ENSP00000438927:Y796N;ENSP00000447302:Y706N;ENSP00000261266:Y796N;ENSP00000448349:Y1013N;ENSP00000446982:Y893N	ENSP00000261266:Y796N	Y	-	1	0	PTPRB	69251937	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.809000	0.91944	2.371000	0.80710	0.533000	0.62120	TAC	.	.		0.383	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PTPRB	5787	hgsc.bcm.edu	37	12	70989857	70989857	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:70989857A>T	ENST00000261266.5	-	3	605	c.576T>A	c.(574-576)tcT>tcA	p.S192S	PTPRB_ENST00000538708.1_Silent_p.S192S|PTPRB_ENST00000551525.1_Silent_p.S409S|PTPRB_ENST00000550857.1_Silent_p.S192S|PTPRB_ENST00000550358.1_Silent_p.S410S|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000334414.6_Silent_p.S410S|PTPRB_ENST00000451516.2_Silent_p.S192S	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	192	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AAACTGAAAAAGAACGTTTTC	0.323																																					p.S410S		Atlas-SNP	.											.	PTPRB	676	.	0			c.T1230A						.						46.0	44.0	44.0					12																	70989857		1828	4085	5913	SO:0001819	synonymous_variant	5787	exon5			TGAAAAAGAACGT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.576T>A	chr12.hg19:g.70989857A>T		96.0	0.0		105.0	20.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	hg19	CCDS44944.1																																																																																			.	.		0.323	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PTPRQ	374462	hgsc.bcm.edu	37	12	80943507	80943507	+	Missense_Mutation	SNP	G	G	C	rs141686707		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:80943507G>C	ENST00000266688.5	+	30	4267	c.4267G>C	c.(4267-4269)Gaa>Caa	p.E1423Q				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1469	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CACACTACCTGAAACAGGTAA	0.388																																					p.E1255Q		Atlas-SNP	.											.	PTPRQ	119	.	0			c.G3763C						.						61.0	44.0	49.0					12																	80943507		692	1590	2282	SO:0001583	missense	374462	exon22			CTACCTGAAACAG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4267G>C	chr12.hg19:g.80943507G>C	ENSP00000266688:p.Glu1423Gln	129.0	0.0		163.0	42.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.	.	.	.	.	.	.	.	.	.	G	20.9	4.074119	0.76415	.	.	ENSG00000139304	ENST00000266688	T	0.55760	0.5	5.58	5.58	0.84498	Fibronectin, type III (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68824	0.3043	.	.	.	0.52099	D	0.999945	D	0.89917	1.0	D	0.85130	0.997	T	0.60984	-0.7154	8	0.16420	T	0.52	.	19.5567	0.95351	0.0:0.0:1.0:0.0	.	1469	Q9UMZ3	PTPRQ_HUMAN	Q	1423	ENSP00000266688:E1423Q	ENSP00000266688:E1423Q	E	+	1	0	PTPRQ	79467638	1.000000	0.71417	0.885000	0.34714	0.862000	0.49288	6.963000	0.76055	2.641000	0.89580	0.650000	0.86243	GAA	.	.		0.388	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85466707	85466707	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:85466707A>G	ENST00000393217.2	+	11	2779	c.2718A>G	c.(2716-2718)gaA>gaG	p.E906E		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	906										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTCTGGAAGAAAAACTTGTTG	0.388																																					p.E906E		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.A2718G						.						68.0	59.0	62.0					12																	85466707		2203	4300	6503	SO:0001819	synonymous_variant	84125	exon11			GGAAGAAAAACTT	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2718A>G	chr12.hg19:g.85466707A>G		74.0	0.0		121.0	26.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Silent	SNP	ENST00000393217.2	hg19	CCDS41816.1																																																																																			.	.		0.388	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
KERA	11081	hgsc.bcm.edu	37	12	91449375	91449375	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:91449375T>A	ENST00000266719.3	-	2	931	c.684A>T	c.(682-684)atA>atT	p.I228I		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	228					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						AATTTTCTGGTATTCCTTCAA	0.383																																					p.I228I		Atlas-SNP	.											.	KERA	62	.	0			c.A684T						.						112.0	112.0	112.0					12																	91449375		2203	4299	6502	SO:0001819	synonymous_variant	11081	exon2			TTCTGGTATTCCT	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.684A>T	chr12.hg19:g.91449375T>A		103.0	0.0		109.0	33.0	NM_007035		Silent	SNP	ENST00000266719.3	hg19	CCDS9037.1																																																																																			.	.		0.383	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035	
UHRF1BP1L	23074	hgsc.bcm.edu	37	12	100453136	100453136	+	Missense_Mutation	SNP	T	T	A	rs538548609		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:100453136T>A	ENST00000279907.7	-	14	2131	c.1919A>T	c.(1918-1920)tAt>tTt	p.Y640F	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.Y290F	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	640										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GAAGCTGGTATATGTTTTACT	0.333																																					p.Y640F		Atlas-SNP	.											.	UHRF1BP1L	144	.	0			c.A1919T						.						45.0	50.0	48.0					12																	100453136		2202	4298	6500	SO:0001583	missense	23074	exon14			CTGGTATATGTTT		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1919A>T	chr12.hg19:g.100453136T>A	ENSP00000279907:p.Tyr640Phe	85.0	0.0		129.0	26.0	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	hg19	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	T	7.262	0.605358	0.14002	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.09538	2.99;2.97	5.56	4.42	0.53409	.	0.184331	0.46145	D	0.000310	T	0.04452	0.0122	N	0.04043	-0.29	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	T	0.41270	-0.9518	10	0.25751	T	0.34	-15.1681	5.3052	0.15799	0.2614:0.0822:0.0:0.6563	.	640	A0JNW5	UH1BL_HUMAN	F	640;290	ENSP00000279907:Y640F;ENSP00000444824:Y290F	ENSP00000279907:Y640F	Y	-	2	0	UHRF1BP1L	98977267	1.000000	0.71417	0.759000	0.31340	0.996000	0.88848	4.264000	0.58859	0.961000	0.38030	0.528000	0.53228	TAT	.	.		0.333	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
SLC17A8	246213	hgsc.bcm.edu	37	12	100813686	100813686	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:100813686C>G	ENST00000323346.5	+	12	1832	c.1519C>G	c.(1519-1521)Cag>Gag	p.Q507E	SLC17A8_ENST00000392989.3_Missense_Mutation_p.Q457E|SLC17A8_ENST00000552697.1_3'UTR	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	507					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						TGGGGAGAAACAGGAGTGGGC	0.473																																					p.Q507E		Atlas-SNP	.											.	SLC17A8	89	.	0			c.C1519G						.						68.0	74.0	72.0					12																	100813686		2203	4300	6503	SO:0001583	missense	246213	exon12			GAGAAACAGGAGT	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1519C>G	chr12.hg19:g.100813686C>G	ENSP00000316909:p.Gln507Glu	38.0	0.0		52.0	9.0	NM_139319	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	hg19	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.778828	0.90195	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.75477	-0.43;-0.94	5.18	5.18	0.71444	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.87237	0.6127	M	0.81802	2.56	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.983;0.991	D	0.88585	0.3139	10	0.72032	D	0.01	.	19.0814	0.93185	0.0:1.0:0.0:0.0	.	507;457	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	E	507;457	ENSP00000316909:Q507E;ENSP00000376715:Q457E	ENSP00000316909:Q507E	Q	+	1	0	SLC17A8	99337817	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.767000	0.85331	2.579000	0.87056	0.591000	0.81541	CAG	.	.		0.473	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
UTP20	27340	hgsc.bcm.edu	37	12	101711258	101711258	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:101711258A>G	ENST00000261637.4	+	22	2729	c.2555A>G	c.(2554-2556)aAt>aGt	p.N852S		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	852					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CACGGTAGCAATGAGTATTAC	0.478																																					p.N852S		Atlas-SNP	.											.	UTP20	222	.	0			c.A2555G						.						62.0	63.0	63.0					12																	101711258		2203	4300	6503	SO:0001583	missense	27340	exon22			GTAGCAATGAGTA	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.2555A>G	chr12.hg19:g.101711258A>G	ENSP00000261637:p.Asn852Ser	77.0	0.0		94.0	25.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	hg19	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	A	18.80	3.700633	0.68501	.	.	ENSG00000120800	ENST00000261637	T	0.62941	-0.01	5.36	5.36	0.76844	Armadillo-type fold (1);	0.046249	0.85682	D	0.000000	T	0.68339	0.2990	L	0.52011	1.625	0.80722	D	1	D	0.69078	0.997	P	0.61397	0.888	T	0.64089	-0.6489	10	0.07990	T	0.79	-18.9427	15.3488	0.74368	1.0:0.0:0.0:0.0	.	852	O75691	UTP20_HUMAN	S	852	ENSP00000261637:N852S	ENSP00000261637:N852S	N	+	2	0	UTP20	100235389	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	8.203000	0.89739	2.037000	0.60232	0.482000	0.46254	AAT	.	.		0.478	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
KIAA1033	23325	hgsc.bcm.edu	37	12	105540256	105540256	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:105540256A>T	ENST00000332180.5	+	23	2448	c.2361A>T	c.(2359-2361)agA>agT	p.R787S		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						AAATTATGAGAAACATTCATA	0.279																																					p.R787S		Atlas-SNP	.											.	KIAA1033	83	.	0			c.A2361T						.						93.0	89.0	90.0					12																	105540256		1786	4058	5844	SO:0001583	missense	23325	exon23			TATGAGAAACATT	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2361A>T	chr12.hg19:g.105540256A>T	ENSP00000328062:p.Arg787Ser	241.0	0.0		282.0	55.0	NM_015275		Missense_Mutation	SNP	ENST00000332180.5	hg19	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.459986	0.84317	.	.	ENSG00000136051	ENST00000332180	T	0.54071	0.59	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81348	-0.0973	10	0.87932	D	0	.	16.0952	0.81114	1.0:0.0:0.0:0.0	.	788;787	B7ZKT9;Q2M389	.;WASH7_HUMAN	S	787	ENSP00000328062:R787S	ENSP00000328062:R787S	R	+	3	2	KIAA1033	104064386	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.849000	0.62882	2.209000	0.71365	0.477000	0.44152	AGA	.	.		0.279	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
SSH1	54434	hgsc.bcm.edu	37	12	109186287	109186287	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:109186287C>T	ENST00000326495.5	-	14	1761	c.1668G>A	c.(1666-1668)caG>caA	p.Q556Q	SSH1_ENST00000551165.1_Silent_p.Q556Q|SSH1_ENST00000326470.5_Silent_p.Q567Q|SSH1_ENST00000360239.3_Silent_p.Q244Q	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	556					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTTGCTGGGGCTGTCTGGCCG	0.592																																					p.Q567Q		Atlas-SNP	.											.	SSH1	144	.	0			c.G1701A						.						92.0	98.0	96.0					12																	109186287		2203	4300	6503	SO:0001819	synonymous_variant	54434	exon13			CTGGGGCTGTCTG	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1668G>A	chr12.hg19:g.109186287C>T		60.0	0.0		73.0	13.0	NM_001161331	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Silent	SNP	ENST00000326495.5	hg19	CCDS9121.1																																																																																			.	.		0.592	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
UBE3B	89910	hgsc.bcm.edu	37	12	109968392	109968392	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:109968392A>T	ENST00000342494.3	+	26	3446	c.2851A>T	c.(2851-2853)Aga>Tga	p.R951*	UBE3B_ENST00000535089.1_Nonsense_Mutation_p.R38*|UBE3B_ENST00000434735.2_Nonsense_Mutation_p.R951*	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	951	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TGGAAGTCACAGAGTCATCAT	0.478																																					p.R951X		Atlas-SNP	.											.	UBE3B	116	.	0			c.A2851T						.						156.0	140.0	146.0					12																	109968392		2203	4300	6503	SO:0001587	stop_gained	89910	exon26			AGTCACAGAGTCA	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2851A>T	chr12.hg19:g.109968392A>T	ENSP00000340596:p.Arg951*	50.0	0.0		58.0	18.0	NM_130466	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Nonsense_Mutation	SNP	ENST00000342494.3	hg19	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	A	51	17.716017	0.99892	.	.	ENSG00000151148	ENST00000434735;ENST00000342494;ENST00000538070;ENST00000535089	.	.	.	5.56	2.98	0.34508	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.9151	12.2106	0.54377	0.5814:0.4186:0.0:0.0	.	.	.	.	X	951;951;246;38	.	ENSP00000340596:R951X	R	+	1	2	UBE3B	108452775	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.459000	0.45023	0.911000	0.36747	0.533000	0.62120	AGA	.	.		0.478	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
CCDC60	160777	hgsc.bcm.edu	37	12	119978503	119978503	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:119978503T>A	ENST00000327554.2	+	14	2101	c.1636T>A	c.(1636-1638)Tac>Aac	p.Y546N	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	546										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CATTGGGCCCTACAGCGCCCT	0.537																																					p.Y546N		Atlas-SNP	.											.	CCDC60	84	.	0			c.T1636A						.						102.0	94.0	97.0					12																	119978503		2203	4300	6503	SO:0001583	missense	160777	exon14			GGGCCCTACAGCG	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1636T>A	chr12.hg19:g.119978503T>A	ENSP00000333374:p.Tyr546Asn	58.0	0.0		45.0	8.0	NM_178499		Missense_Mutation	SNP	ENST00000327554.2	hg19	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	T	9.388	1.074744	0.20227	.	.	ENSG00000183273	ENST00000327554	T	0.22539	1.95	5.4	2.13	0.27403	.	1.076280	0.07121	N	0.843947	T	0.13670	0.0331	N	0.22421	0.69	0.09310	N	1	B	0.25904	0.137	B	0.21917	0.037	T	0.36744	-0.9735	9	.	.	.	-1.5606	6.6445	0.22927	0.0:0.6164:0.0:0.3836	.	546	Q8IWA6	CCD60_HUMAN	N	546	ENSP00000333374:Y546N	.	Y	+	1	0	CCDC60	118462886	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.070000	0.14573	0.221000	0.20879	0.533000	0.62120	TAC	.	.		0.537	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
DNAH10	196385	hgsc.bcm.edu	37	12	124284917	124284917	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:124284917A>T	ENST00000409039.3	+	14	2115	c.2090A>T	c.(2089-2091)cAg>cTg	p.Q697L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	697	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTTGCTCTCCAGGAAGACAAA	0.378																																					p.Q697L		Atlas-SNP	.											.	DNAH10	888	.	0			c.A2090T						.						49.0	51.0	50.0					12																	124284917		2203	4300	6503	SO:0001583	missense	196385	exon14			CTCTCCAGGAAGA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.2090A>T	chr12.hg19:g.124284917A>T	ENSP00000386770:p.Gln697Leu	140.0	0.0		167.0	31.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406878	0.83230	.	.	ENSG00000197653	ENST00000409039	T	0.57907	0.37	5.53	5.53	0.82687	Dynein heavy chain, domain-1 (1);	0.215065	0.28047	N	0.016809	T	0.71643	0.3364	M	0.84511	2.7	0.58432	D	0.999993	B;B;P	0.36535	0.206;0.376;0.557	B;P;P	0.51777	0.244;0.452;0.679	T	0.72609	-0.4241	10	0.42905	T	0.14	.	15.7102	0.77620	1.0:0.0:0.0:0.0	.	697;572;697	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	L	697	ENSP00000386770:Q697L	ENSP00000386770:Q697L	Q	+	2	0	DNAH10	122850870	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	8.850000	0.92190	2.112000	0.64535	0.529000	0.55759	CAG	.	.		0.378	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
CCDC92	80212	hgsc.bcm.edu	37	12	124427948	124427948	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:124427948T>A	ENST00000238156.3	-	3	481	c.127A>T	c.(127-129)Agc>Tgc	p.S43C	CCDC92_ENST00000545891.1_Missense_Mutation_p.S26C|CCDC92_ENST00000545135.1_Missense_Mutation_p.S26C|CCDC92_ENST00000544798.1_5'UTR	NM_025140.1	NP_079416.1	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	43						centriole (GO:0005814)				large_intestine(5)|lung(2)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		TTGAGCGTGCTGGCATGCTCC	0.652																																					p.S43C		Atlas-SNP	.											.	CCDC92	18	.	0			c.A127T						.						117.0	104.0	109.0					12																	124427948		2203	4300	6503	SO:0001583	missense	80212	exon3			GCGTGCTGGCATG	AK026124	CCDS9256.1	12q24.31	2011-09-02			ENSG00000119242	ENSG00000119242			29563	protein-coding gene	gene with protein product	"""limkain beta 2"""					12477932	Standard	NM_025140		Approved	FLJ22471	uc001ufw.1	Q53HC0	OTTHUMG00000168725	ENST00000238156.3:c.127A>T	chr12.hg19:g.124427948T>A	ENSP00000238156:p.Ser43Cys	37.0	0.0		28.0	7.0	NM_025140	B3KNQ0|Q9H697	Missense_Mutation	SNP	ENST00000238156.3	hg19	CCDS9256.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.570022	0.86542	.	.	ENSG00000119242	ENST00000238156;ENST00000545135;ENST00000545891;ENST00000539761;ENST00000535556;ENST00000539551	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.49	3.13	0.36017	.	0.451063	0.29260	N	0.012671	T	0.45538	0.1347	L	0.57536	1.79	0.27955	N	0.936988	D	0.55800	0.973	P	0.50192	0.634	T	0.40739	-0.9547	10	0.62326	D	0.03	-21.813	8.9374	0.35708	0.0:0.2111:0.0:0.7889	.	43	Q53HC0	CCD92_HUMAN	C	43;26;26;43;26;43	ENSP00000238156:S43C;ENSP00000439526:S26C;ENSP00000440024:S26C;ENSP00000439441:S43C;ENSP00000438281:S26C;ENSP00000442369:S43C	ENSP00000238156:S43C	S	-	1	0	CCDC92	122993901	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.376000	0.44292	0.384000	0.24942	0.459000	0.35465	AGC	.	.		0.652	CCDC92-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400780.2	NM_025140	
TMEM132B	114795	hgsc.bcm.edu	37	12	126138935	126138935	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr12:126138935A>T	ENST00000299308.3	+	9	2924	c.2916A>T	c.(2914-2916)atA>atT	p.I972I	TMEM132B_ENST00000535886.1_Silent_p.I484I	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	972						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CAACCATGATAGACAGGGGCC	0.498																																					p.I972I		Atlas-SNP	.											.	TMEM132B	207	.	0			c.A2916T						.						62.0	59.0	60.0					12																	126138935		1894	4114	6008	SO:0001819	synonymous_variant	114795	exon9			CATGATAGACAGG	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2916A>T	chr12.hg19:g.126138935A>T		62.0	0.0		119.0	40.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	ENST00000299308.3	hg19	CCDS41859.1																																																																																			.	.		0.498	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
RNF17	56163	hgsc.bcm.edu	37	13	25374648	25374648	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr13:25374648G>T	ENST00000255324.5	+	13	1786	c.1734G>T	c.(1732-1734)ttG>ttT	p.L578F	RNF17_ENST00000255325.6_Missense_Mutation_p.L578F|RNF17_ENST00000381921.1_Missense_Mutation_p.L578F	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	578					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CATGCTCATTGAAAGACATTG	0.343																																					p.L578F		Atlas-SNP	.											.	RNF17	259	.	0			c.G1734T						.						121.0	117.0	119.0					13																	25374648		2203	4300	6503	SO:0001583	missense	56163	exon13			CTCATTGAAAGAC	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1734G>T	chr13.hg19:g.25374648G>T	ENSP00000255324:p.Leu578Phe	35.0	0.0		37.0	11.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003656	0.54254	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325	T;T;T	0.24538	1.85;1.85;1.85	4.44	2.71	0.32032	.	0.574441	0.14662	N	0.305886	T	0.45115	0.1326	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.30851	-0.9964	10	0.87932	D	0	.	7.5753	0.27933	0.2729:0.0:0.7271:0.0	.	578;578	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	F	578;578;437;579	ENSP00000255324:L578F;ENSP00000371346:L578F;ENSP00000255325:L579F	ENSP00000255324:L578F	L	+	3	2	RNF17	24272648	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.487000	0.45268	0.623000	0.30267	0.462000	0.41574	TTG	.	.		0.343	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
CPB2	1361	hgsc.bcm.edu	37	13	46627758	46627758	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr13:46627758C>A	ENST00000181383.4	-	11	1279	c.1263G>T	c.(1261-1263)agG>agT	p.R421S	CPB2_ENST00000439329.3_3'UTR|CPB2-AS1_ENST00000606991.1_RNA|ZC3H13_ENST00000282007.3_5'Flank|CPB2-AS1_ENST00000606351.1_RNA|ZC3H13_ENST00000242848.4_5'Flank|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606243.1_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	421					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		ATTAAACATTCCTAATGACAT	0.383																																					p.R421S		Atlas-SNP	.											.	CPB2	60	.	0			c.G1263T						.						81.0	85.0	83.0					13																	46627758		2203	4300	6503	SO:0001583	missense	1361	exon11			AACATTCCTAATG	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.1263G>T	chr13.hg19:g.46627758C>A	ENSP00000181383:p.Arg421Ser	163.0	0.0		138.0	39.0	NM_001872	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	hg19	CCDS9401.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957491	0.53400	.	.	ENSG00000080618	ENST00000181383	T	0.30448	1.53	5.84	-0.436	0.12275	.	0.450845	0.27000	N	0.021429	T	0.13670	0.0331	N	0.16602	0.42	0.24278	N	0.995216	D	0.53885	0.963	B	0.39465	0.3	T	0.22556	-1.0213	10	0.59425	D	0.04	.	5.1158	0.14833	0.1653:0.2735:0.0:0.5612	.	421	Q96IY4	CBPB2_HUMAN	S	421	ENSP00000181383:R421S	ENSP00000181383:R421S	R	-	3	2	CPB2	45525759	0.001000	0.12720	0.206000	0.23566	0.990000	0.78478	-0.125000	0.10579	0.122000	0.18314	0.561000	0.74099	AGG	.	.		0.383	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872	
SLITRK1	114798	hgsc.bcm.edu	37	13	84453857	84453857	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr13:84453857T>A	ENST00000377084.2	-	1	2671	c.1786A>T	c.(1786-1788)Agc>Tgc	p.S596C		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	596					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		AACCCAGTGCTGTTTTTACTG	0.542																																					p.S596C		Atlas-SNP	.											.	SLITRK1	196	.	0			c.A1786T						.						100.0	87.0	92.0					13																	84453857		2203	4300	6503	SO:0001583	missense	114798	exon1			CAGTGCTGTTTTT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1786A>T	chr13.hg19:g.84453857T>A	ENSP00000366288:p.Ser596Cys	100.0	0.0		94.0	24.0	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	hg19	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.520453	0.64747	.	.	ENSG00000178235	ENST00000377084	T	0.60299	0.2	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.54191	0.1843	L	0.52573	1.65	0.58432	D	0.999997	B	0.28324	0.207	B	0.29716	0.106	T	0.56117	-0.8032	10	0.56958	D	0.05	-17.8047	14.5694	0.68202	0.0:0.0:0.0:1.0	.	596	Q96PX8	SLIK1_HUMAN	C	596	ENSP00000366288:S596C	ENSP00000366288:S596C	S	-	1	0	SLITRK1	83351858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.059000	0.57470	2.187000	0.69744	0.533000	0.62120	AGC	.	.		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
FGF14	2259	hgsc.bcm.edu	37	13	103053956	103053956	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr13:103053956A>G	ENST00000376131.4	-	1	168	c.73T>C	c.(73-75)Ttt>Ctt	p.F25L	RP11-811P12.3_ENST00000418923.2_RNA	NM_175929.2	NP_787125.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	0					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACCCTGAGAAAGAAGAGATCC	0.413																																					p.F25L		Atlas-SNP	.											.	FGF14	86	.	0			c.T73C						.						77.0	73.0	75.0					13																	103053956		2203	4300	6503	SO:0001583	missense	2259	exon1			TGAGAAAGAAGAG		CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376131.4:c.73T>C	chr13.hg19:g.103053956A>G	ENSP00000365301:p.Phe25Leu	91.0	0.0		106.0	8.0	NM_175929	Q86YN7|Q96QX6	Missense_Mutation	SNP	ENST00000376131.4	hg19	CCDS9500.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.320950	0.41096	.	.	ENSG00000102466	ENST00000376131	T	0.78481	-1.18	4.73	4.73	0.59995	.	1.151740	0.06111	N	0.667184	T	0.66228	0.2768	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49744	-0.8907	8	.	.	.	.	8.9819	0.35970	0.9173:0.0:0.0827:0.0	.	25	Q92915-2	.	L	25	ENSP00000365301:F25L	.	F	-	1	0	FGF14	101851957	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.994000	0.76251	1.984000	0.57885	0.533000	0.62120	TTT	.	.		0.413	FGF14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045680.5		
OR11H4	390442	hgsc.bcm.edu	37	14	20711318	20711318	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:20711318T>A	ENST00000315409.2	+	1	421	c.368T>A	c.(367-369)cTc>cAc	p.L123H		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		ACTGAATGTCTCTTTCTGGCA	0.468																																					p.L123H		Atlas-SNP	.											.	OR11H4	63	.	0			c.T368A						.						115.0	116.0	116.0					14																	20711318		2203	4300	6503	SO:0001583	missense	390442	exon1			AATGTCTCTTTCT		CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.368T>A	chr14.hg19:g.20711318T>A	ENSP00000318997:p.Leu123His	92.0	0.0		76.0	23.0	NM_001004479	B2RNQ4|Q6IF07	Missense_Mutation	SNP	ENST00000315409.2	hg19	CCDS32034.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.674083	0.47781	.	.	ENSG00000176198	ENST00000315409	T	0.01422	4.91	4.75	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.143965	0.29995	N	0.010667	T	0.05914	0.0154	M	0.80508	2.5	0.09310	N	1	D	0.58620	0.983	P	0.57846	0.828	T	0.10451	-1.0629	10	0.87932	D	0	-9.9763	8.5198	0.33268	0.0:0.0:0.1961:0.8039	.	123	Q8NGC9	O11H4_HUMAN	H	123	ENSP00000318997:L123H	ENSP00000318997:L123H	L	+	2	0	OR11H4	19781158	0.000000	0.05858	0.991000	0.47740	0.997000	0.91878	0.642000	0.24735	1.993000	0.58246	0.528000	0.53228	CTC	.	.		0.468	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410678.1		
EDDM3A	10876	hgsc.bcm.edu	37	14	21215986	21215986	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:21215986G>A	ENST00000326842.2	+	2	374	c.247G>A	c.(247-249)Gag>Aag	p.E83K		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	83					sperm displacement (GO:0007321)	extracellular space (GO:0005615)				breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						ATGCATCAATGAGAAGGGGAG	0.443																																					p.E83K		Atlas-SNP	.											.	EDDM3A	15	.	0			c.G247A						.						99.0	95.0	96.0					14																	21215986		2203	4300	6503	SO:0001583	missense	10876	exon2			ATCAATGAGAAGG	X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.247G>A	chr14.hg19:g.21215986G>A	ENSP00000315098:p.Glu83Lys	91.0	0.0		94.0	24.0	NM_006683	Q4KN33	Missense_Mutation	SNP	ENST00000326842.2	hg19	CCDS9556.1	.	.	.	.	.	.	.	.	.	.	G	6.445	0.450319	0.12223	.	.	ENSG00000181562	ENST00000326842	T	0.72505	-0.66	1.21	-0.646	0.11472	Ribonuclease A, domain (2);	.	.	.	.	T	0.48295	0.1492	L	0.36672	1.1	0.09310	N	1	B	0.32245	0.361	B	0.27500	0.08	T	0.31558	-0.9939	9	0.08381	T	0.77	.	3.4827	0.07609	0.5337:0.0:0.4663:0.0	.	83	Q14507	EP3A_HUMAN	K	83	ENSP00000315098:E83K	ENSP00000315098:E83K	E	+	1	0	EDDM3A	20285826	0.005000	0.15991	0.001000	0.08648	0.226000	0.24999	0.787000	0.26858	-0.204000	0.10235	0.313000	0.20887	GAG	.	.		0.443	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073742.3		
EFS	10278	hgsc.bcm.edu	37	14	23828142	23828142	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:23828142C>T	ENST00000216733.3	-	5	1801	c.1194G>A	c.(1192-1194)ccG>ccA	p.P398P	RP11-124D2.3_ENST00000554010.1_RNA|EFS_ENST00000429593.2_Silent_p.P229P|EFS_ENST00000351354.3_Silent_p.P305P	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	398					cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		AGGCCTGATCCGGGGGCCTAG	0.672																																					p.P398P		Atlas-SNP	.											.	EFS	37	.	0			c.G1194A						.						45.0	47.0	46.0					14																	23828142		2203	4300	6503	SO:0001819	synonymous_variant	10278	exon5			CTGATCCGGGGGC	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.1194G>A	chr14.hg19:g.23828142C>T		59.0	0.0		69.0	11.0	NM_005864	B2RAJ7|B4DJ56|E9PGU2|O43282	Silent	SNP	ENST00000216733.3	hg19	CCDS9595.1																																																																																			.	.		0.672	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2		
FANCM	57697	hgsc.bcm.edu	37	14	45645010	45645010	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:45645010A>T	ENST00000267430.5	+	14	3138	c.3053A>T	c.(3052-3054)gAg>gTg	p.E1018V	FANCM_ENST00000542564.2_Missense_Mutation_p.E992V	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1018					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ACTGCACTTGAGAATTTGCTT	0.398								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.E1018V		Atlas-SNP	.											.	FANCM	225	.	0			c.A3053T						.						46.0	43.0	44.0					14																	45645010		2203	4296	6499	SO:0001583	missense	57697	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CACTTGAGAATTT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3053A>T	chr14.hg19:g.45645010A>T	ENSP00000267430:p.Glu1018Val	105.0	0.0		94.0	24.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	A	8.151	0.787412	0.16258	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.19669	2.72;2.73;2.13	4.87	4.87	0.63330	.	1.383380	0.04051	N	0.304812	T	0.24774	0.0601	L	0.44542	1.39	0.09310	N	1	P;P	0.41041	0.671;0.736	B;B	0.38803	0.188;0.282	T	0.30736	-0.9968	10	0.39692	T	0.17	.	12.693	0.56985	1.0:0.0:0.0:0.0	.	992;1018	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	V	1018;992;534	ENSP00000267430:E1018V;ENSP00000442493:E992V;ENSP00000452033:E534V	ENSP00000267430:E1018V	E	+	2	0	FANCM	44714760	0.047000	0.20315	0.002000	0.10522	0.094000	0.18550	3.014000	0.49590	1.947000	0.56498	0.482000	0.46254	GAG	.	.		0.398	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
PLEK2	26499	hgsc.bcm.edu	37	14	67864480	67864480	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:67864480A>T	ENST00000216446.4	-	2	246	c.106T>A	c.(106-108)Tac>Aac	p.Y36N	PLEK2_ENST00000557388.1_5'UTR	NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	36	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.L33fs*8(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		TCAAGCTTGTAGTACACCAGC	0.597																																					p.Y36N		Atlas-SNP	.											.	PLEK2	23	.	1	Deletion - Frameshift(1)	prostate(1)	c.T106A						.						56.0	47.0	50.0					14																	67864480		2203	4300	6503	SO:0001583	missense	26499	exon2			GCTTGTAGTACAC	AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558		"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007				11911883, 17658464	Standard	NM_016445		Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.106T>A	chr14.hg19:g.67864480A>T	ENSP00000216446:p.Tyr36Asn	103.0	0.0		91.0	19.0	NM_016445	Q96JT0	Missense_Mutation	SNP	ENST00000216446.4	hg19	CCDS9782.1	.	.	.	.	.	.	.	.	.	.	A	32	5.112601	0.94339	.	.	ENSG00000100558	ENST00000216446	T	0.79352	-1.26	5.6	5.6	0.85130	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.176500	0.52532	D	0.000078	D	0.90776	0.7104	H	0.95470	3.675	0.58432	D	0.999998	D	0.69078	0.997	D	0.64877	0.93	D	0.93336	0.6705	10	0.87932	D	0	-27.6637	14.6491	0.68784	1.0:0.0:0.0:0.0	.	36	Q9NYT0	PLEK2_HUMAN	N	36	ENSP00000216446:Y36N	ENSP00000216446:Y36N	Y	-	1	0	PLEK2	66934233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.930000	0.92872	2.254000	0.74563	0.460000	0.39030	TAC	.	.		0.597	PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412547.2		
EML5	161436	hgsc.bcm.edu	37	14	89105158	89105158	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:89105158T>A	ENST00000380664.5	-	30	4306	c.4307A>T	c.(4306-4308)cAa>cTa	p.Q1436L	EML5_ENST00000554922.1_Missense_Mutation_p.Q1444L|EML5_ENST00000352093.5_Missense_Mutation_p.Q1398L			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1436						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CATACCTACTTGGCCAGTTGC	0.303																																					p.Q1444L		Atlas-SNP	.											.	EML5	141	.	0			c.A4331T						.						73.0	64.0	67.0					14																	89105158		1810	4066	5876	SO:0001583	missense	161436	exon31			CCTACTTGGCCAG	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4307A>T	chr14.hg19:g.89105158T>A	ENSP00000370039:p.Gln1436Leu	59.0	0.0		86.0	16.0	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.694837	0.88830	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.04917	3.61;3.53;3.61	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	M	0.87381	2.88	0.58432	D	0.999994	D;D	0.76494	0.999;0.995	D;D	0.91635	0.999;0.992	T	0.13629	-1.0502	10	0.87932	D	0	-13.7652	15.3849	0.74691	0.0:0.0:0.0:1.0	.	1444;1436	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	L	1444;1398;1436	ENSP00000451998:Q1444L;ENSP00000298315:Q1398L;ENSP00000370039:Q1436L	ENSP00000298315:Q1398L	Q	-	2	0	EML5	88174911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.049000	0.60858	0.482000	0.46254	CAA	.	.		0.303	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
FBLN5	10516	hgsc.bcm.edu	37	14	92403334	92403334	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:92403334T>A	ENST00000342058.4	-	4	929	c.336A>T	c.(334-336)atA>atT	p.I112I	FBLN5_ENST00000267620.10_Silent_p.I153I|FBLN5_ENST00000556154.1_Silent_p.I117I	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	112					cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				CAAAGCGGCATATAAGAGGCC	0.552																																					p.I112I		Atlas-SNP	.											.	FBLN5	60	.	0			c.A336T						.						133.0	129.0	130.0					14																	92403334		2203	4300	6503	SO:0001819	synonymous_variant	10516	exon4			GCGGCATATAAGA	AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.336A>T	chr14.hg19:g.92403334T>A		98.0	0.0		137.0	28.0	NM_006329	O75966|Q6IAL4|Q6UWA3	Silent	SNP	ENST00000342058.4	hg19	CCDS9898.1																																																																																			.	.		0.552	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411787.1		
APOPT1	84334	hgsc.bcm.edu	37	14	104029339	104029339	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr14:104029339A>T	ENST00000409074.2	+	1	41	c.40A>T	c.(40-42)Atg>Ttg	p.M14L	BAG5_ENST00000445922.2_5'Flank|APOPT1_ENST00000556253.2_Start_Codon_SNP_p.M1L|RP11-894P9.2_ENST00000556332.1_RNA|RP11-73M18.2_ENST00000472726.2_Missense_Mutation_p.M14L|APOPT1_ENST00000247618.4_Start_Codon_SNP_p.M1L|BAG5_ENST00000299204.4_5'Flank|BAG5_ENST00000337322.4_5'Flank	NM_032374.3	NP_115750.2	Q96IL0	APOP1_HUMAN	apoptogenic 1, mitochondrial	14					intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)	mitochondrion (GO:0005739)											GCGTGGGGCCATGGTGGTCTT	0.751																																					p.M14L		Atlas-SNP	.											.	.	.	.	0			c.A40T						.						6.0	9.0	8.0					14																	104029339		2121	4179	6300	SO:0001583	missense	84334	exon1			GGGGCCATGGTGG	BC007412	CCDS9983.2	14q32.33	2012-06-28	2012-06-28	2011-09-07	ENSG00000256053	ENSG00000256053			20492	protein-coding gene	gene with protein product	"""apoptogenic protein 1"""		"""chromosome 14 open reading frame 153"", ""apoptogenic 1"""	C14orf153		16782708, 18977203	Standard	NM_032374		Approved	MGC2562, APOP-1		Q96IL0	OTTHUMG00000153929	ENST00000409074.2:c.40A>T	chr14.hg19:g.104029339A>T	ENSP00000386485:p.Met14Leu	22.0	0.0		42.0	8.0	NM_032374	Q53G28	Missense_Mutation	SNP	ENST00000409074.2	hg19	CCDS9983.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.92|11.92	1.782100|1.782100	0.31502|0.31502	.|.	.|.	ENSG00000256053|ENSG00000256053;ENSG00000256500;ENSG00000256500	ENST00000440963|ENST00000409074;ENST00000472726;ENST00000247618	.|T;T;T	.|0.68025	.|1.56;-0.3;1.62	4.22|4.22	1.36|1.36	0.22044|0.22044	.|.	.|0.578247	.|0.16155	.|N	.|0.227056	T|T	0.53449|0.53449	0.1797|0.1797	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.0;0.001	T|T	0.43861|0.43861	-0.9365|-0.9365	5|10	.|0.41790	.|T	.|0.15	.|.	4.2324|4.2324	0.10610|0.10610	0.6617:0.2092:0.1291:0.0|0.6617:0.2092:0.1291:0.0	.|.	.|14;14	.|E7EVH7;Q96IL0	.|.;APOP1_HUMAN	L|L	13|14;14;1	.|ENSP00000386485:M14L;ENSP00000439065:M14L;ENSP00000247618:M1L	.|ENSP00000247618:M1L	H|M	+|+	2|1	0|0	C14orf153|C14orf153;RP11-73M18.2	103099092|103099092	0.621000|0.621000	0.27077|0.27077	0.113000|0.113000	0.21522|0.21522	0.010000|0.010000	0.07245|0.07245	0.841000|0.841000	0.27613|0.27613	0.472000|0.472000	0.27344|0.27344	0.533000|0.533000	0.62120|0.62120	CAT|ATG	.	.		0.751	APOPT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333060.2	NM_032374	
WDR76	79968	hgsc.bcm.edu	37	15	44120478	44120478	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr15:44120478A>T	ENST00000263795.6	+	2	446	c.376A>T	c.(376-378)Aag>Tag	p.K126*	WDR76_ENST00000381246.2_Nonsense_Mutation_p.K62*	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	126										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		GCTACAACCCAAGAGAACGGC	0.423																																					p.K126X		Atlas-SNP	.											.	WDR76	34	.	0			c.A376T						.						88.0	82.0	84.0					15																	44120478		2198	4298	6496	SO:0001587	stop_gained	79968	exon2			CAACCCAAGAGAA	AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.376A>T	chr15.hg19:g.44120478A>T	ENSP00000263795:p.Lys126*	108.0	0.0		89.0	31.0	NM_024908	A0MNP5|Q05CI4	Nonsense_Mutation	SNP	ENST00000263795.6	hg19	CCDS10106.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.272769	0.80580	.	.	ENSG00000092470	ENST00000263795;ENST00000381246;ENST00000452115	.	.	.	4.14	1.82	0.25136	.	0.522997	0.18547	N	0.138014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.9066	3.888	0.09107	0.6669:0.2198:0.1133:0.0	.	.	.	.	X	126;62;62	.	ENSP00000263795:K126X	K	+	1	0	WDR76	41907770	0.018000	0.18449	0.212000	0.23672	0.003000	0.03518	0.127000	0.15790	0.732000	0.32470	0.460000	0.39030	AAG	.	.		0.423	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133482.2	NM_024908	
UNC13C	440279	hgsc.bcm.edu	37	15	54919024	54919024	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr15:54919024A>T	ENST00000260323.11	+	32	6359		c.e32-1		UNC13C_ENST00000545554.1_Splice_Site|UNC13C_ENST00000537900.1_Splice_Site|UNC13C_ENST00000539562.2_Splice_Site	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)						exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TAATCCACACAGCATTCTCGG	0.373																																					.		Atlas-SNP	.											.	UNC13C	674	.	0			c.6360-2A>T						.						38.0	34.0	35.0					15																	54919024		1817	4070	5887	SO:0001630	splice_region_variant	440279	exon31			CCACACAGCATTC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6360-1A>T	chr15.hg19:g.54919024A>T		44.0	0.0		55.0	17.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Splice_Site	SNP	ENST00000260323.11	hg19	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731167	0.69189	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900;ENST00000539562	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2361	0.73432	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC13C	52706316	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.228000	0.95250	2.193000	0.70182	0.477000	0.44152	.	.	.		0.373	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	Intron
TSC2	7249	hgsc.bcm.edu	37	16	2104375	2104375	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr16:2104375A>T	ENST00000219476.3	+	5	1045	c.415A>T	c.(415-417)Agg>Tgg	p.R139W	TSC2_ENST00000439673.2_Missense_Mutation_p.R102W|TSC2_ENST00000382538.6_Missense_Mutation_p.R90W|TSC2_ENST00000350773.4_Missense_Mutation_p.R139W|TSC2_ENST00000401874.2_Missense_Mutation_p.R139W|TSC2_ENST00000568454.1_Missense_Mutation_p.R150W|TSC2_ENST00000353929.4_Missense_Mutation_p.R139W	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	139	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCTTCACGAAAGGCTGGAGGT	0.532			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.R139W		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.A415T	GRCh37	CD993486	TSC2	D	rs137854010	.						93.0	89.0	90.0					16																	2104375		2198	4300	6498	SO:0001583	missense	7249	exon5	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CACGAAAGGCTGG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.415A>T	chr16.hg19:g.2104375A>T	ENSP00000219476:p.Arg139Trp	84.0	0.0		79.0	25.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	.	14.89	2.669578	0.47677	.	.	ENSG00000103197	ENST00000219476;ENST00000432909;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773;ENST00000445113	T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	4.97	2.65	0.31530	Armadillo-like helical (1);Armadillo-type fold (1);Tuberin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86117	0.5856	M	0.72118	2.19	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.996;0.997;1.0;0.997	D	0.86016	0.1504	10	0.87932	D	0	-17.8573	13.5344	0.61639	0.3943:0.6057:0.0:0.0	.	90;102;139;139;139	B4DIL8;P49815-6;P49815-4;P49815-5;P49815	.;.;.;.;TSC2_HUMAN	W	139;90;139;139;102;90;139;150	ENSP00000219476:R139W;ENSP00000384468:R139W;ENSP00000248099:R139W;ENSP00000399232:R102W;ENSP00000371978:R90W;ENSP00000344383:R139W	ENSP00000219476:R139W	R	+	1	2	TSC2	2044376	0.898000	0.30612	0.741000	0.31004	0.468000	0.32798	1.956000	0.40382	0.231000	0.21079	0.379000	0.24179	AGG	.	.		0.532	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
COG7	91949	hgsc.bcm.edu	37	16	23436070	23436070	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr16:23436070G>A	ENST00000307149.5	-	7	1194	c.1009C>T	c.(1009-1011)Cat>Tat	p.H337Y		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	337					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		GAATGTTTACGTAGGTGGGGG	0.552																																					p.H337Y		Atlas-SNP	.											.	COG7	62	.	0			c.C1009T						.						95.0	102.0	100.0					16																	23436070		2197	4300	6497	SO:0001630	splice_region_variant	91949	exon7			GTTTACGTAGGTG	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1009+1C>T	chr16.hg19:g.23436070G>A		112.0	0.0		92.0	27.0	NM_153603	Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	hg19	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	G	0.429	-0.904390	0.02453	.	.	ENSG00000168434	ENST00000307149	T	0.41758	0.99	5.31	-0.321	0.12717	.	0.595355	0.18401	N	0.142353	T	0.13670	0.0331	N	0.03608	-0.345	0.33088	D	0.537524	B	0.02656	0.0	B	0.01281	0.0	T	0.14090	-1.0485	9	.	.	.	-0.4271	2.2485	0.04037	0.1404:0.3242:0.2924:0.243	.	337	P83436	COG7_HUMAN	Y	337	ENSP00000305442:H337Y	.	H	-	1	0	COG7	23343571	0.365000	0.25006	0.036000	0.18154	0.493000	0.33554	0.819000	0.27308	-0.268000	0.09312	-0.216000	0.12614	CAT	.	.		0.552	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1		Missense_Mutation
MYLK3	91807	hgsc.bcm.edu	37	16	46781875	46781875	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr16:46781875C>T	ENST00000394809.4	-	1	346	c.231G>A	c.(229-231)ggG>ggA	p.G77G	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	77					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCCCATCAGCCCCGCCCGGGC	0.692																																					p.G77G		Atlas-SNP	.											.	MYLK3	82	.	0			c.G231A						.						20.0	23.0	22.0					16																	46781875		2201	4295	6496	SO:0001819	synonymous_variant	91807	exon1			ATCAGCCCCGCCC	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.231G>A	chr16.hg19:g.46781875C>T		57.0	0.0		59.0	16.0	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	ENST00000394809.4	hg19	CCDS10723.2																																																																																			.	.		0.692	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
ZNF469	84627	hgsc.bcm.edu	37	16	88494260	88494260	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr16:88494260A>T	ENST00000437464.1	+	1	382	c.382A>T	c.(382-384)Agg>Tgg	p.R128W	ZNF469_ENST00000565624.1_Missense_Mutation_p.R128W	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	128	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGCCAGCTCGAGGACCAAGCC	0.697																																					p.R128W		Atlas-SNP	.											.	ZNF469	121	.	0			c.A382T						.						3.0	3.0	3.0					16																	88494260		624	1468	2092	SO:0001583	missense	84627	exon1			AGCTCGAGGACCA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.382A>T	chr16.hg19:g.88494260A>T	ENSP00000402343:p.Arg128Trp	78.0	0.0		65.0	23.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.029050	0.35797	.	.	ENSG00000225614	ENST00000437464	T	0.20598	2.06	3.76	1.34	0.21922	.	.	.	.	.	T	0.28863	0.0716	N	0.24115	0.695	0.09310	N	1	D	0.71674	0.998	D	0.72625	0.978	T	0.15122	-1.0448	9	0.87932	D	0	.	9.7342	0.40377	0.5393:0.4607:0.0:0.0	.	128	Q96JG9	ZN469_HUMAN	W	128	ENSP00000402343:R128W	ENSP00000402343:R128W	R	+	1	2	ZNF469	87021761	0.456000	0.25744	0.000000	0.03702	0.016000	0.09150	1.044000	0.30329	0.329000	0.23460	0.379000	0.24179	AGG	.	.		0.697	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
TP53	7157	hgsc.bcm.edu	37	17	7577569	7577569	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:7577569A>G	ENST00000269305.4	-	7	901	c.712T>C	c.(712-714)Tgt>Cgt	p.C238R	TP53_ENST00000445888.2_Missense_Mutation_p.C238R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.C238R|TP53_ENST00000420246.2_Missense_Mutation_p.C238R|TP53_ENST00000359597.4_Missense_Mutation_p.C238R|TP53_ENST00000455263.2_Missense_Mutation_p.C238R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238R(14)|p.C238S(12)|p.0?(8)|p.?(5)|p.C238G(4)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.C238fs*2(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.C145G(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.M237fs*1(1)|p.C238fs*9(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAACTGTTACACATGTAGTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C238R	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,colon,carcinoma,0,2	TP53	33396	.	60	Substitution - Missense(31)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(1)|Insertion - In frame(1)	ovary(11)|liver(7)|biliary_tract(6)|bone(5)|upper_aerodigestive_tract(4)|large_intestine(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|lung(2)|skin(2)|prostate(2)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	c.T712C	GRCh37	CM025271|CM056070	TP53	M		.						131.0	103.0	112.0					17																	7577569		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TGTTACACATGTA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.712T>C	chr17.hg19:g.7577569A>G	ENSP00000269305:p.Cys238Arg	85.0	0.0		63.0	27.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062565	0.76187	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95386	0.8477	10	0.87932	D	0	-18.536	11.6823	0.51466	1.0:0.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	R	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238R;ENSP00000352610:C238R;ENSP00000269305:C238R;ENSP00000398846:C238R;ENSP00000391127:C238R;ENSP00000391478:C238R;ENSP00000425104:C106R;ENSP00000423862:C145R	ENSP00000269305:C238R	C	-	1	0	TP53	7518294	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.021000	0.93673	2.074000	0.62210	0.379000	0.24179	TGT	.	.		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
FOXN1	8456	hgsc.bcm.edu	37	17	26861766	26861766	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:26861766G>C	ENST00000226247.2	+	7	1206	c.1177G>C	c.(1177-1179)Ggc>Cgc	p.G393R	FOXN1_ENST00000579795.1_Missense_Mutation_p.G393R	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	393					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					AGAAAAGCTGGGCTCCCCACT	0.632																																					p.G393R		Atlas-SNP	.											.	FOXN1	51	.	0			c.G1177C						.						15.0	18.0	17.0					17																	26861766		2203	4299	6502	SO:0001583	missense	8456	exon7			AAGCTGGGCTCCC	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.1177G>C	chr17.hg19:g.26861766G>C	ENSP00000226247:p.Gly393Arg	112.0	0.0		126.0	25.0	NM_003593	B2R9Q7|O15352	Missense_Mutation	SNP	ENST00000226247.2	hg19	CCDS11232.1	.	.	.	.	.	.	.	.	.	.	G	0.719	-0.784166	0.02907	.	.	ENSG00000109101	ENST00000226247	D	0.92699	-3.09	4.25	2.12	0.27331	.	0.200206	0.32987	N	0.005409	T	0.71022	0.3291	N	0.01352	-0.895	0.28908	N	0.89288	B	0.02656	0.0	B	0.01281	0.0	T	0.62982	-0.6738	10	0.10377	T	0.69	.	4.5257	0.11980	0.3129:0.2452:0.4419:0.0	.	393	O15353	FOXN1_HUMAN	R	393	ENSP00000226247:G393R	ENSP00000226247:G393R	G	+	1	0	FOXN1	23885893	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.530000	0.45641	1.006000	0.39211	0.561000	0.74099	GGC	.	.		0.632	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
PIGS	94005	hgsc.bcm.edu	37	17	26888503	26888503	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:26888503C>T	ENST00000308360.7	-	6	988	c.613G>A	c.(613-615)Gct>Act	p.A205T	PIGS_ENST00000543734.1_Missense_Mutation_p.A144T|PIGS_ENST00000395346.2_Missense_Mutation_p.A197T|PIGS_ENST00000465444.1_5'UTR	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	205					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					AGGTGGTCAGCCAGAGCAGCA	0.592																																					p.A205T		Atlas-SNP	.											PIGS,NS,carcinoma,0,1	PIGS	42	.	0			c.G613A						.						83.0	67.0	72.0					17																	26888503		2203	4300	6503	SO:0001583	missense	94005	exon6			GGTCAGCCAGAGC		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.613G>A	chr17.hg19:g.26888503C>T	ENSP00000309430:p.Ala205Thr	60.0	0.0		64.0	18.0	NM_033198	Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	hg19	CCDS11235.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.084781	0.36758	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.47869	0.84;0.83;0.88	5.68	4.71	0.59529	.	0.253846	0.46442	D	0.000281	T	0.38453	0.1041	L	0.28115	0.83	0.29611	N	0.846957	B;B	0.33022	0.394;0.342	B;B	0.40256	0.324;0.217	T	0.30966	-0.9960	10	0.14252	T	0.57	-7.461	13.424	0.61015	0.3922:0.6078:0.0:0.0	.	205;197	Q96S52;Q96S52-2	PIGS_HUMAN;.	T	197;205;144	ENSP00000378755:A197T;ENSP00000309430:A205T;ENSP00000438447:A144T	ENSP00000309430:A205T	A	-	1	0	PIGS	23912630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.525000	0.35953	1.388000	0.46506	0.655000	0.94253	GCT	.	.		0.592	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198	
SLC6A4	6532	hgsc.bcm.edu	37	17	28548654	28548654	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:28548654A>T	ENST00000401766.2	-	2	835	c.323T>A	c.(322-324)aTa>aAa	p.I108K	SLC6A4_ENST00000261707.3_Missense_Mutation_p.I108K			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	108					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	CTGGTAACATATGTAGGGGAA	0.592																																					p.I108K		Atlas-SNP	.											.	SLC6A4	60	.	0			c.T323A						.						123.0	116.0	118.0					17																	28548654		2203	4300	6503	SO:0001583	missense	6532	exon3			TAACATATGTAGG	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.323T>A	chr17.hg19:g.28548654A>T	ENSP00000385822:p.Ile108Lys	70.0	0.0		61.0	17.0	NM_001045	Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	hg19	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	A	31	5.064677	0.93898	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T;T	0.74947	-0.89;-0.88;-0.88	5.85	5.85	0.93711	.	0.040304	0.85682	D	0.000000	D	0.86053	0.5841	M	0.78801	2.425	0.80722	D	1	D	0.54772	0.968	D	0.70935	0.971	D	0.87699	0.2559	10	0.87932	D	0	.	15.4155	0.74962	1.0:0.0:0.0:0.0	.	108	P31645	SC6A4_HUMAN	K	150;108;108	ENSP00000378298:I150K;ENSP00000385822:I108K;ENSP00000261707:I108K	ENSP00000261707:I108K	I	-	2	0	SLC6A4	25572780	1.000000	0.71417	0.991000	0.47740	0.968000	0.65278	9.318000	0.96334	2.234000	0.73211	0.533000	0.62120	ATA	.	.		0.592	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	
SPACA3	124912	hgsc.bcm.edu	37	17	31322727	31322727	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:31322727T>A	ENST00000269053.3	+	2	405	c.335T>A	c.(334-336)cTg>cAg	p.L112Q	SPACA3_ENST00000394638.1_Intron|SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000580599.1_Missense_Mutation_p.L43Q	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	112					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			GGATACAGCCTGGCTGACTGT	0.607																																					p.L112Q		Atlas-SNP	.											.	SPACA3	35	.	0			c.T335A						.						74.0	50.0	58.0					17																	31322727		2203	4300	6503	SO:0001583	missense	124912	exon2			ACAGCCTGGCTGA	AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.335T>A	chr17.hg19:g.31322727T>A	ENSP00000269053:p.Leu112Gln	80.0	0.0		119.0	26.0	NM_173847	Q7Z4Y5	Missense_Mutation	SNP	ENST00000269053.3	hg19	CCDS11275.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	16.35|16.35	3.098594|3.098594	0.56183|0.56183	.|.	.|.	ENSG00000141316|ENSG00000141316	ENST00000269053;ENST00000394637|ENST00000411740	T|.	0.78126|.	-1.15|.	3.94|3.94	3.94|3.94	0.45596|0.45596	Lysozyme-like domain (1);|.	0.384395|.	0.21511|.	N|.	0.073362|.	T|T	0.76572|0.76572	0.4006|0.4006	M|M	0.87900|0.87900	2.915|2.915	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.79654|0.79654	-0.1713|-0.1713	10|6	0.87932|0.87932	D|D	0|0	-8.2128|-8.2128	9.49|9.49	0.38953|0.38953	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	112|.	Q8IXA5|.	SACA3_HUMAN|.	Q|R	112;113|13	ENSP00000269053:L112Q|.	ENSP00000269053:L112Q|ENSP00000392807:W13R	L|W	+|+	2|1	0|0	SPACA3|SPACA3	28346840|28346840	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.492000|0.492000	0.33523|0.33523	4.986000|4.986000	0.63851|0.63851	2.510000|2.510000	0.84645|0.84645	0.443000|0.443000	0.29094|0.29094	CTG|TGG	.	.		0.607	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256380.1	NM_173847	
FNDC8	54752	hgsc.bcm.edu	37	17	33454263	33454263	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:33454263G>T	ENST00000158009.5	+	2	527	c.412G>T	c.(412-414)Ggc>Tgc	p.G138C		NM_017559.2	NP_060029.1	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	138						nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	11		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		CCTGGCGCTCGGCCCCTGCCC	0.587																																					p.G138C		Atlas-SNP	.											.	FNDC8	28	.	0			c.G412T						.						106.0	114.0	111.0					17																	33454263		2203	4300	6503	SO:0001583	missense	54752	exon2			GCGCTCGGCCCCT	BC024002	CCDS11290.1	17q12	2013-02-11			ENSG00000073598	ENSG00000073598		"""Fibronectin type III domain containing"""	25286	protein-coding gene	gene with protein product						12477932	Standard	XM_005257993		Approved	DKFZp434H2215	uc002hix.3	Q8TC99	OTTHUMG00000132932	ENST00000158009.5:c.412G>T	chr17.hg19:g.33454263G>T	ENSP00000158009:p.Gly138Cys	64.0	0.0		115.0	17.0	NM_017559	B2R9G6|Q9UFC2	Missense_Mutation	SNP	ENST00000158009.5	hg19	CCDS11290.1	.	.	.	.	.	.	.	.	.	.	G	8.013	0.757960	0.15846	.	.	ENSG00000073598	ENST00000158009	T	0.32515	1.45	5.38	3.19	0.36642	.	.	.	.	.	T	0.15478	0.0373	N	0.08118	0	0.24912	N	0.992031	B	0.06786	0.001	B	0.04013	0.001	T	0.19451	-1.0305	9	0.66056	D	0.02	.	6.0482	0.19772	0.1573:0.0:0.1814:0.6612	.	138	Q8TC99	FNDC8_HUMAN	C	138	ENSP00000158009:G138C	ENSP00000158009:G138C	G	+	1	0	FNDC8	30478376	0.941000	0.31946	0.929000	0.37066	0.001000	0.01503	1.310000	0.33551	0.496000	0.27904	-1.104000	0.02111	GGC	.	.		0.587	FNDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256459.2	NM_017559	
KRTAP9-9	81870	hgsc.bcm.edu	37	17	39411680	39411680	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:39411680A>T	ENST00000394008.1	+	1	45	c.43A>T	c.(43-45)Agg>Tgg	p.R15W		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	15	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TACCTGCTGCAGGACCACCTG	0.607																																					p.R15W		Atlas-SNP	.											.	KRTAP9-9	24	.	0			c.A43T						.																																			SO:0001583	missense	81870	exon1			TGCTGCAGGACCA	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.43A>T	chr17.hg19:g.39411680A>T	ENSP00000377576:p.Arg15Trp	62.0	0.0		58.0	16.0	NM_030975	B5MDD6|Q9BYQ1	Missense_Mutation	SNP	ENST00000394008.1	hg19	CCDS54127.1	.	.	.	.	.	.	.	.	.	.	.	10.60	1.394937	0.25205	.	.	ENSG00000198083	ENST00000394008	T	0.00873	5.59	0.589	0.589	0.17452	.	.	.	.	.	T	0.02304	0.0071	L	0.38175	1.15	0.24849	N	0.992417	D	0.69078	0.997	D	0.69307	0.963	T	0.51309	-0.8722	8	0.72032	D	0.01	.	.	.	.	.	20	Q9BYP9	KRA99_HUMAN	W	15	ENSP00000377576:R15W	ENSP00000377576:R15W	R	+	1	2	KRTAP9-9	36665206	0.847000	0.29606	0.979000	0.43373	0.805000	0.45488	0.126000	0.15769	0.507000	0.28148	0.374000	0.22700	AGG	.	.		0.607	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257710.1	NM_030975	
KRT33B	3884	hgsc.bcm.edu	37	17	39525975	39525975	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:39525975G>T	ENST00000251646.3	-	1	77	c.28C>A	c.(28-30)Ctg>Atg	p.L10M		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	10	Head.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				CGGCAGCTCAGGCTGGGCAGG	0.617																																					p.L10M		Atlas-SNP	.											.	KRT33B	46	.	0			c.C28A						.						18.0	20.0	20.0					17																	39525975		2199	4292	6491	SO:0001583	missense	3884	exon1			AGCTCAGGCTGGG	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.28C>A	chr17.hg19:g.39525975G>T	ENSP00000251646:p.Leu10Met	145.0	0.0		150.0	33.0	NM_002279	O76010	Missense_Mutation	SNP	ENST00000251646.3	hg19	CCDS11389.1	.	.	.	.	.	.	.	.	.	.	g	9.460	1.092875	0.20471	.	.	ENSG00000131738	ENST00000251646	D	0.82619	-1.63	4.44	-4.99	0.03010	.	1.361320	0.04724	N	0.419971	T	0.73860	0.3641	L	0.47016	1.485	0.09310	N	1	B	0.19817	0.039	B	0.22386	0.039	T	0.58880	-0.7558	10	0.51188	T	0.08	.	3.4962	0.07655	0.3533:0.0:0.2401:0.4066	.	10	Q14525	KT33B_HUMAN	M	10	ENSP00000251646:L10M	ENSP00000251646:L10M	L	-	1	2	KRT33B	36779501	0.000000	0.05858	0.032000	0.17829	0.827000	0.46813	-2.497000	0.00969	-0.593000	0.05844	-0.157000	0.13467	CTG	.	.		0.617	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279	
DHX8	1659	hgsc.bcm.edu	37	17	41582192	41582192	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:41582192A>T	ENST00000262415.3	+	12	1799	c.1727A>T	c.(1726-1728)cAg>cTg	p.Q576L	DHX8_ENST00000540306.1_Splice_Site_p.Q576L	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	576	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CAATTGGTCCAGGTGAGAAGA	0.443																																					p.Q576L	NSCLC(56;1548 1661 49258 49987)	Atlas-SNP	.											.	DHX8	98	.	0			c.A1727T						.						72.0	69.0	70.0					17																	41582192		2203	4300	6503	SO:0001630	splice_region_variant	1659	exon12			TGGTCCAGGTGAG	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1728+1A>T	chr17.hg19:g.41582192A>T		103.0	0.0		160.0	29.0	NM_004941		Missense_Mutation	SNP	ENST00000262415.3	hg19	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494548	0.85069	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.06449	3.3;3.3	4.95	4.95	0.65309	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21801	0.0525	M	0.85777	2.775	0.80722	D	1	P;P	0.50528	0.936;0.797	P;P	0.53954	0.738;0.491	T	0.01819	-1.1267	10	0.72032	D	0.01	.	13.8026	0.63212	1.0:0.0:0.0:0.0	.	576;576	F5H658;Q14562	.;DHX8_HUMAN	L	576	ENSP00000437886:Q576L;ENSP00000262415:Q576L	ENSP00000262415:Q576L	Q	+	2	0	DHX8	38937718	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.237000	0.95368	1.855000	0.53841	0.454000	0.30748	CAG	.	.		0.443	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		Missense_Mutation
ASB16	92591	hgsc.bcm.edu	37	17	42249420	42249420	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:42249420G>C	ENST00000293414.1	+	2	392	c.308G>C	c.(307-309)tGg>tCg	p.W103S		NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	103					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTAGGGTTCTGGGTGCTGACC	0.607																																					p.W103S		Atlas-SNP	.											.	ASB16	34	.	0			c.G308C						.						36.0	32.0	33.0					17																	42249420		2203	4300	6503	SO:0001583	missense	92591	exon2			GGTTCTGGGTGCT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.308G>C	chr17.hg19:g.42249420G>C	ENSP00000293414:p.Trp103Ser	35.0	0.0		50.0	12.0	NM_080863	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	hg19	CCDS11478.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544241	0.86022	.	.	ENSG00000161664	ENST00000293414	T	0.50813	0.73	5.55	5.55	0.83447	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.60753	0.2293	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51020	-0.8758	10	0.26408	T	0.33	-19.1143	18.4386	0.90656	0.0:0.0:1.0:0.0	.	103	Q96NS5	ASB16_HUMAN	S	103	ENSP00000293414:W103S	ENSP00000293414:W103S	W	+	2	0	ASB16	39604946	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.721000	0.74728	2.894000	0.99253	0.655000	0.94253	TGG	.	.		0.607	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
SLC4A1	6521	hgsc.bcm.edu	37	17	42327879	42327879	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:42327879A>T	ENST00000262418.6	-	20	2838	c.2683T>A	c.(2683-2685)Ttt>Att	p.F895I	AC003102.1_ENST00000399246.2_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	895	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TCCTCATCAAAGGTTGCCTTG	0.627																																					p.F895I		Atlas-SNP	.											.	SLC4A1	104	.	0			c.T2683A						.						112.0	75.0	88.0					17																	42327879		2203	4300	6503	SO:0001583	missense	6521	exon20			CATCAAAGGTTGC		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2683T>A	chr17.hg19:g.42327879A>T	ENSP00000262418:p.Phe895Ile	62.0	0.0		53.0	12.0	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	hg19	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169256	0.38315	.	.	ENSG00000004939	ENST00000262418	T	0.74002	-0.8	4.66	2.37	0.29283	.	0.543240	0.20261	N	0.095871	T	0.69205	0.3085	M	0.74647	2.275	0.46927	D	0.999254	B	0.23249	0.082	B	0.25884	0.064	T	0.63310	-0.6666	10	0.49607	T	0.09	.	4.5964	0.12332	0.6607:0.1661:0.1732:0.0	.	895	P02730	B3AT_HUMAN	I	895	ENSP00000262418:F895I	ENSP00000262418:F895I	F	-	1	0	SLC4A1	39683405	0.979000	0.34478	0.084000	0.20598	0.323000	0.28346	2.848000	0.48278	0.369000	0.24510	0.459000	0.35465	TTT	.	.		0.627	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
SLC4A1	6521	hgsc.bcm.edu	37	17	42335828	42335828	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:42335828T>A	ENST00000262418.6	-	10	1195	c.1040A>T	c.(1039-1041)tAt>tTt	p.Y347F	SLC4A1_ENST00000471005.1_5'Flank|AC003043.1_ENST00000597382.1_Intron	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	347	Dimerization arm.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GCTGGACTGATAGCGCCTTCG	0.632																																					p.Y347F		Atlas-SNP	.											SLC4A1,NS,neuroblastoma,0,1	SLC4A1	104	.	0			c.A1040T						.						105.0	109.0	107.0					17																	42335828		2203	4300	6503	SO:0001583	missense	6521	exon10			GACTGATAGCGCC		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1040A>T	chr17.hg19:g.42335828T>A	ENSP00000262418:p.Tyr347Phe	96.0	0.0		129.0	31.0	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	hg19	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	N	3.348	-0.133095	0.06711	.	.	ENSG00000004939	ENST00000262418	T	0.79554	-1.28	4.68	4.68	0.58851	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.618725	0.15933	N	0.237572	D	0.83995	0.5375	M	0.67953	2.075	0.36133	D	0.846262	D;B	0.56968	0.978;0.001	P;B	0.56612	0.802;0.011	T	0.82625	-0.0365	10	0.11485	T	0.65	.	13.2439	0.60012	0.0:0.0:0.0:1.0	.	347;347	E2RVJ0;P02730	.;B3AT_HUMAN	F	347	ENSP00000262418:Y347F	ENSP00000262418:Y347F	Y	-	2	0	SLC4A1	39691354	0.992000	0.36948	0.552000	0.28243	0.058000	0.15608	2.729000	0.47327	1.963000	0.57068	0.255000	0.18592	TAT	.	.		0.632	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
KCNH6	81033	hgsc.bcm.edu	37	17	61623092	61623092	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:61623092T>A	ENST00000583023.1	+	14	2825	c.2814T>A	c.(2812-2814)ccT>ccA	p.P938P	KCNH6_ENST00000456941.2_Silent_p.P849P|KCNH6_ENST00000581784.1_Silent_p.P849P|KCNH6_ENST00000314672.5_Silent_p.P902P	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	938					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGGAACAGCCTGAGGGGCTCT	0.577																																					p.P938P		Atlas-SNP	.											.	KCNH6	122	.	0			c.T2814A						.						111.0	101.0	104.0					17																	61623092		2203	4300	6503	SO:0001819	synonymous_variant	81033	exon14			ACAGCCTGAGGGG	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2814T>A	chr17.hg19:g.61623092T>A		89.0	0.0		66.0	13.0	NM_030779	Q9BRD7	Silent	SNP	ENST00000583023.1	hg19	CCDS11638.1																																																																																			.	.		0.577	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
HELZ	9931	hgsc.bcm.edu	37	17	65186459	65186459	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:65186459T>A	ENST00000358691.5	-	10	736	c.570A>T	c.(568-570)caA>caT	p.Q190H	HELZ_ENST00000580168.1_Missense_Mutation_p.Q190H|HELZ_ENST00000580662.1_5'UTR	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	190						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TACAGATTCCTTGTTCTAAAA	0.368																																					p.Q190H		Atlas-SNP	.											.	HELZ	160	.	0			c.A570T						.						109.0	99.0	102.0					17																	65186459		1840	4087	5927	SO:0001583	missense	9931	exon10			GATTCCTTGTTCT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.570A>T	chr17.hg19:g.65186459T>A	ENSP00000351524:p.Gln190His	82.0	0.0		142.0	27.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	10.61	1.397691	0.25205	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	T;T	0.41400	1.0;1.0	5.38	5.38	0.77491	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.56761	0.2007	L	0.56769	1.78	0.58432	D	0.999998	D;D	0.71674	0.997;0.998	D;D	0.68765	0.96;0.955	T	0.59408	-0.7460	10	0.62326	D	0.03	-11.9044	9.8451	0.41021	0.0:0.0764:0.0:0.9236	.	190;190	B7ZLW2;P42694	.;HELZ_HUMAN	H	190	ENSP00000351524:Q190H;ENSP00000411144:Q190H	ENSP00000351524:Q190H	Q	-	3	2	HELZ	62616921	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.948000	0.49066	2.047000	0.60756	0.533000	0.62120	CAA	.	.		0.368	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
KCNJ2	3759	hgsc.bcm.edu	37	17	68171897	68171897	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:68171897A>T	ENST00000243457.3	+	2	1100	c.717A>T	c.(715-717)gaA>gaT	p.E239D	KCNJ2_ENST00000535240.1_Missense_Mutation_p.E239D	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	239					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					TTACTTCTGAAGGGGAGTATA	0.453																																					p.E239D		Atlas-SNP	.											.	KCNJ2	74	.	0			c.A717T						.						92.0	93.0	93.0					17																	68171897		2203	4300	6503	SO:0001583	missense	3759	exon2			TTCTGAAGGGGAG	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.717A>T	chr17.hg19:g.68171897A>T	ENSP00000243457:p.Glu239Asp	55.0	0.0		91.0	18.0	NM_000891	O15110|P48049	Missense_Mutation	SNP	ENST00000243457.3	hg19	CCDS11688.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301047	0.40694	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.96522	-4.04;-4.04	5.86	2.5	0.30297	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	M	0.86805	2.84	0.50467	D	0.999872	D	0.65815	0.995	D	0.91635	0.999	D	0.96680	0.9503	9	.	.	.	.	9.5361	0.39224	0.8021:0.0:0.1979:0.0	.	239	P63252	IRK2_HUMAN	D	239	ENSP00000441848:E239D;ENSP00000243457:E239D	.	E	+	3	2	KCNJ2	65683492	1.000000	0.71417	0.982000	0.44146	0.520000	0.34377	2.928000	0.48908	0.153000	0.19213	-0.250000	0.11733	GAA	.	.		0.453	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450889.1	NM_000891	
LLGL2	3993	hgsc.bcm.edu	37	17	73566301	73566301	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:73566301C>T	ENST00000392550.3	+	15	1956	c.1839C>T	c.(1837-1839)ctC>ctT	p.L613L	LLGL2_ENST00000167462.5_Silent_p.L613L|LLGL2_ENST00000577200.1_Silent_p.L613L	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	613					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GCTTTGGCCTCTTTGACCACC	0.672																																					p.L613L		Atlas-SNP	.											.	LLGL2	155	.	0			c.C1839T						.						17.0	16.0	17.0					17																	73566301		2196	4297	6493	SO:0001819	synonymous_variant	3993	exon15			TGGCCTCTTTGAC	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1839C>T	chr17.hg19:g.73566301C>T		64.0	0.0		63.0	21.0	NM_004524	Q14521|Q9BR62	Silent	SNP	ENST00000392550.3	hg19	CCDS32733.1																																																																																			.	.		0.672	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
EXOC7	23265	hgsc.bcm.edu	37	17	74087274	74087274	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr17:74087274T>A	ENST00000335146.7	-	7	904	c.851A>T	c.(850-852)cAg>cTg	p.Q284L	EXOC7_ENST00000607838.1_Missense_Mutation_p.Q284L|EXOC7_ENST00000411744.2_Intron|EXOC7_ENST00000332065.5_Intron|EXOC7_ENST00000467929.2_Missense_Mutation_p.Q243L|EXOC7_ENST00000589210.1_Missense_Mutation_p.Q284L|EXOC7_ENST00000405575.4_Missense_Mutation_p.Q284L			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	284					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			TAGACCATGCTGGGAATACTG	0.512																																					p.Q284L		Atlas-SNP	.											.	EXOC7	47	.	0			c.A851T						.						211.0	176.0	188.0					17																	74087274		2203	4300	6503	SO:0001583	missense	23265	exon7			CCATGCTGGGAAT	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.851A>T	chr17.hg19:g.74087274T>A	ENSP00000334100:p.Gln284Leu	106.0	0.0		87.0	27.0	NM_001013839	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	hg19	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042241	0.55003	.	.	ENSG00000182473	ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372	.	.	.	5.81	4.72	0.59763	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.39937	0.1097	L	0.34521	1.04	0.80722	D	1	B;B;P;B;B	0.37276	0.002;0.065;0.589;0.142;0.029	B;B;B;B;B	0.33392	0.025;0.01;0.163;0.098;0.017	T	0.16247	-1.0409	9	0.33940	T	0.23	-29.392	13.1099	0.59267	0.0:0.0:0.134:0.866	.	284;243;243;284;284	Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-1	.;.;.;EXOC7_HUMAN;.	L	284;284;284;243	.	ENSP00000334100:Q284L	Q	-	2	0	EXOC7	71598869	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.503000	0.81632	1.000000	0.39049	-0.313000	0.08912	CAG	.	.		0.512	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
SMCHD1	23347	hgsc.bcm.edu	37	18	2784472	2784472	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:2784472A>T	ENST00000320876.6	+	45	5910	c.5572A>T	c.(5572-5574)Aca>Tca	p.T1858S	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.T1858S	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1858					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						ACACTGTCCTACACTGCTGAC	0.368																																					p.T1858S		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A5572T						.						38.0	37.0	38.0					18																	2784472		1826	4082	5908	SO:0001583	missense	23347	exon45			TGTCCTACACTGC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5572A>T	chr18.hg19:g.2784472A>T	ENSP00000326603:p.Thr1858Ser	144.0	0.0		170.0	36.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.843766	0.91197	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	D;D	0.85702	-2.02;-2.02	5.29	5.29	0.74685	SMCs flexible hinge (1);	0.000000	0.85682	D	0.000000	D	0.91092	0.7196	M	0.65498	2.005	0.41310	D	0.9871	D	0.69078	0.997	D	0.75020	0.985	D	0.92240	0.5800	10	0.72032	D	0.01	-19.449	15.2314	0.73390	1.0:0.0:0.0:0.0	.	1858	A6NHR9	SMHD1_HUMAN	S	1858	ENSP00000326603:T1858S;ENSP00000261598:T1858S	ENSP00000261598:T1858S	T	+	1	0	SMCHD1	2774472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.213000	0.89758	1.985000	0.57927	0.482000	0.46254	ACA	.	.		0.368	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
LAMA3	3909	hgsc.bcm.edu	37	18	21422660	21422660	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:21422660A>T	ENST00000313654.9	+	29	3790	c.3549A>T	c.(3547-3549)tcA>tcT	p.S1183S	LAMA3_ENST00000399516.3_Silent_p.S1183S	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1183	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TTGACATCTCAGAGCCTGAAG	0.547																																					p.S1183S		Atlas-SNP	.											.	LAMA3	397	.	0			c.A3549T						.						127.0	139.0	135.0					18																	21422660		2015	4186	6201	SO:0001819	synonymous_variant	3909	exon29			CATCTCAGAGCCT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3549A>T	chr18.hg19:g.21422660A>T		142.0	0.0		129.0	33.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.		0.547	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
KLHL14	57565	hgsc.bcm.edu	37	18	30350114	30350114	+	Silent	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:30350114C>T	ENST00000359358.4	-	2	879	c.441G>A	c.(439-441)gtG>gtA	p.V147V	AC012123.1_ENST00000426194.1_Intron|KLHL14_ENST00000358095.4_Silent_p.V147V	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	147	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GGGACAGGGTCACGTTGGCCG	0.637																																					p.V147V		Atlas-SNP	.											.	KLHL14	92	.	0			c.G441A						.						99.0	95.0	96.0					18																	30350114		2203	4300	6503	SO:0001819	synonymous_variant	57565	exon2			CAGGGTCACGTTG	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.441G>A	chr18.hg19:g.30350114C>T		157.0	0.0		217.0	45.0	NM_020805	A6NNW1|B4DHA0|Q8WU41	Silent	SNP	ENST00000359358.4	hg19	CCDS32813.1																																																																																			.	.		0.637	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
ZBTB7C	201501	hgsc.bcm.edu	37	18	45566767	45566767	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:45566767T>A	ENST00000588982.1	-	3	1213	c.712A>T	c.(712-714)Aag>Tag	p.K238*	ZBTB7C_ENST00000586438.1_Nonsense_Mutation_p.K238*|ZBTB7C_ENST00000590800.1_Nonsense_Mutation_p.K238*|ZBTB7C_ENST00000535628.2_Nonsense_Mutation_p.K238*|ZBTB7C_ENST00000332053.2_Nonsense_Mutation_p.K238*			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	238							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ATGTTGGCCTTGGGGTACAGG	0.612																																					p.K238X		Atlas-SNP	.											.	ZBTB7C	73	.	0			c.A712T						.						43.0	46.0	45.0					18																	45566767		2203	4300	6503	SO:0001587	stop_gained	201501	exon2			TGGCCTTGGGGTA	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.712A>T	chr18.hg19:g.45566767T>A	ENSP00000468782:p.Lys238*	70.0	0.0		87.0	17.0	NM_001039360	O73453	Nonsense_Mutation	SNP	ENST00000588982.1	hg19	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	T	37	6.206122	0.97376	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	.	.	.	5.25	5.25	0.73442	.	0.114755	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1156	0.72397	0.0:0.0:0.0:1.0	.	.	.	.	X	238	.	ENSP00000328732:K238X	K	-	1	0	ZBTB7C	43820765	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.099000	0.64554	1.975000	0.57531	0.402000	0.26972	AAG	.	.		0.612	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
ZNF532	55205	hgsc.bcm.edu	37	18	56651265	56651265	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:56651265C>T	ENST00000336078.4	+	11	4249	c.3473C>T	c.(3472-3474)gCa>gTa	p.A1158V	ZNF532_ENST00000589288.1_Missense_Mutation_p.A1158V|ZNF532_ENST00000591083.1_Missense_Mutation_p.A1158V|ZNF532_ENST00000591230.1_Missense_Mutation_p.A1158V|ZNF532_ENST00000591808.1_Missense_Mutation_p.A1158V|ZNF532_ENST00000588956.1_3'UTR	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CCCCGAGGAGCAATCACTCAA	0.483																																					p.A1158V		Atlas-SNP	.											.	ZNF532	108	.	0			c.C3473T						.						73.0	74.0	74.0					18																	56651265		2203	4300	6503	SO:0001583	missense	55205	exon11			GAGGAGCAATCAC	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3473C>T	chr18.hg19:g.56651265C>T	ENSP00000338217:p.Ala1158Val	269.0	0.0		285.0	50.0	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	hg19	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624289	0.66901	.	.	ENSG00000074657	ENST00000336078	T	0.01665	4.7	5.84	5.84	0.93424	.	0.185708	0.46758	D	0.000267	T	0.08088	0.0202	L	0.49778	1.585	0.44834	D	0.997845	D;P	0.63880	0.993;0.736	D;B	0.68192	0.956;0.118	T	0.32640	-0.9899	10	0.34782	T	0.22	-0.1438	19.7382	0.96215	0.0:1.0:0.0:0.0	.	1158;1158	B3KXW2;Q9HCE3	.;ZN532_HUMAN	V	1158	ENSP00000338217:A1158V	ENSP00000338217:A1158V	A	+	2	0	ZNF532	54802245	1.000000	0.71417	0.517000	0.27799	0.667000	0.39255	7.347000	0.79356	2.769000	0.95229	0.561000	0.74099	GCA	.	.		0.483	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
CDH20	28316	hgsc.bcm.edu	37	18	59217403	59217403	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:59217403C>T	ENST00000262717.4	+	11	2239	c.1841C>T	c.(1840-1842)cCa>cTa	p.P614L	CDH20_ENST00000538374.1_Missense_Mutation_p.P614L|CDH20_ENST00000536675.2_Missense_Mutation_p.P614L			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	614					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TACATGCTCCCAGTCAGTTTG	0.602																																					p.P614L		Atlas-SNP	.											.	CDH20	117	.	0			c.C1841T						.						77.0	59.0	65.0					18																	59217403		2203	4300	6503	SO:0001583	missense	28316	exon10			TGCTCCCAGTCAG	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1841C>T	chr18.hg19:g.59217403C>T	ENSP00000262717:p.Pro614Leu	73.0	0.0		67.0	9.0	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	hg19	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449307	0.84101	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.57595	0.39;0.39;0.39	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	M	0.79123	2.44	0.80722	D	1	B	0.28820	0.224	B	0.38500	0.275	T	0.65199	-0.6226	10	0.72032	D	0.01	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	614	Q9HBT6	CAD20_HUMAN	L	614	ENSP00000444767:P614L;ENSP00000442226:P614L;ENSP00000262717:P614L	ENSP00000262717:P614L	P	+	2	0	CDH20	57368383	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.087000	0.71362	2.826000	0.97356	0.655000	0.94253	CCA	.	.		0.602	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
CDH19	28513	hgsc.bcm.edu	37	18	64172081	64172081	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:64172081T>A	ENST00000262150.2	-	12	2579	c.2287A>T	c.(2287-2289)Atg>Ttg	p.M763L		NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	3179	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GAACCAAACATGCATGCTAAT	0.388																																					p.M763L		Atlas-SNP	.											.	CDH19	141	.	0			c.A2287T						.						79.0	71.0	74.0					18																	64172081		2203	4300	6503	SO:0001583	missense	28513	exon12			CAAACATGCATGC	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2287A>T	chr18.hg19:g.64172081T>A	ENSP00000262150:p.Met763Leu	94.0	0.0		96.0	16.0	NM_021153	O15098	Missense_Mutation	SNP	ENST00000262150.2	hg19	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	T	1.362	-0.588385	0.03799	.	.	ENSG00000071991	ENST00000262150	T	0.74315	-0.83	4.99	3.73	0.42828	Cadherin, cytoplasmic domain (1);	0.170310	0.52532	D	0.000061	T	0.51534	0.1680	N	0.16708	0.43	0.80722	D	1	B	0.15141	0.012	B	0.18263	0.021	T	0.45716	-0.9242	10	0.05436	T	0.98	.	9.2923	0.37793	0.3398:0.0:0.0:0.6602	.	763	Q9H159	CAD19_HUMAN	L	763	ENSP00000262150:M763L	ENSP00000262150:M763L	M	-	1	0	CDH19	62323061	0.992000	0.36948	0.967000	0.41034	0.643000	0.38383	1.197000	0.32211	1.992000	0.58205	0.482000	0.46254	ATG	.	.		0.388	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153	
CDH19	28513	hgsc.bcm.edu	37	18	64172083	64172083	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:64172083C>A	ENST00000262150.2	-	12	2577	c.2285G>T	c.(2284-2286)tGc>tTc	p.C762F		NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	3178	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				ACCAAACATGCATGCTAATCT	0.383																																					p.C762F		Atlas-SNP	.											.	CDH19	141	.	0			c.G2285T						.						80.0	72.0	75.0					18																	64172083		2203	4300	6503	SO:0001583	missense	28513	exon12			AACATGCATGCTA	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2285G>T	chr18.hg19:g.64172083C>A	ENSP00000262150:p.Cys762Phe	94.0	0.0		96.0	16.0	NM_021153	O15098	Missense_Mutation	SNP	ENST00000262150.2	hg19	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	C	9.704	1.155376	0.21454	.	.	ENSG00000071991	ENST00000262150	T	0.76060	-0.99	4.99	2.18	0.27775	Cadherin, cytoplasmic domain (1);	0.718048	0.14317	N	0.327316	T	0.53786	0.1818	N	0.08118	0	0.09310	N	1	B	0.21821	0.061	B	0.21917	0.037	T	0.49283	-0.8956	10	0.87932	D	0	.	8.8185	0.35011	0.0:0.7053:0.0:0.2947	.	762	Q9H159	CAD19_HUMAN	F	762	ENSP00000262150:C762F	ENSP00000262150:C762F	C	-	2	0	CDH19	62323063	0.258000	0.24033	0.541000	0.28102	0.714000	0.41099	0.346000	0.19997	0.214000	0.20742	0.591000	0.81541	TGC	.	.		0.383	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153	
ZNF407	55628	hgsc.bcm.edu	37	18	72345386	72345386	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr18:72345386A>T	ENST00000299687.5	+	1	2411	c.2411A>T	c.(2410-2412)cAa>cTa	p.Q804L	ZNF407_ENST00000577538.1_Missense_Mutation_p.Q804L|ZNF407_ENST00000582337.1_Missense_Mutation_p.Q804L|ZNF407_ENST00000309902.6_Missense_Mutation_p.Q804L	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	804					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ATAGGTGTGCAATTACAAGAG	0.408																																					p.Q804L		Atlas-SNP	.											.	ZNF407	231	.	0			c.A2411T						.						174.0	172.0	173.0					18																	72345386		1974	4161	6135	SO:0001583	missense	55628	exon1			GTGTGCAATTACA	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.2411A>T	chr18.hg19:g.72345386A>T	ENSP00000299687:p.Gln804Leu	73.0	0.0		83.0	16.0	NM_001146190	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	hg19	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.601339	0.28534	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.10288	2.89;3.32	5.65	1.65	0.23941	.	.	.	.	.	T	0.07908	0.0198	L	0.34521	1.04	0.09310	N	1	P;P;P	0.37276	0.589;0.589;0.454	B;B;B	0.33454	0.164;0.164;0.053	T	0.27673	-1.0067	9	0.72032	D	0.01	.	6.4437	0.21865	0.5695:0.2947:0.1358:0.0	.	804;804;804	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	L	804	ENSP00000299687:Q804L;ENSP00000310359:Q804L	ENSP00000299687:Q804L	Q	+	2	0	ZNF407	70474374	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	0.171000	0.16685	-2.091000	0.00858	-0.379000	0.06801	CAA	.	.		0.408	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
NFIC	4782	hgsc.bcm.edu	37	19	3382056	3382056	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:3382056A>T	ENST00000443272.2	+	2	428	c.377A>T	c.(376-378)aAg>aTg	p.K126M	NFIC_ENST00000586919.1_Missense_Mutation_p.K117M|NFIC_ENST00000590282.1_Missense_Mutation_p.K126M|NFIC_ENST00000395111.3_Missense_Mutation_p.K117M|NFIC_ENST00000346156.5_Missense_Mutation_p.K117M|NFIC_ENST00000341919.3_Missense_Mutation_p.K126M|NFIC_ENST00000589123.1_Missense_Mutation_p.K117M	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	126					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CAGGCGGACAAGGTGTGGCGG	0.667																																					p.K126M		Atlas-SNP	.											.	NFIC	36	.	0			c.A377T						.						75.0	80.0	78.0					19																	3382056		2203	4298	6501	SO:0001583	missense	4782	exon2			CGGACAAGGTGTG	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.377A>T	chr19.hg19:g.3382056A>T	ENSP00000396843:p.Lys126Met	93.0	0.0		88.0	35.0	NM_001245004	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	hg19	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.060452	0.76074	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.80738	-1.41;-1.41;-1.41	3.88	3.88	0.44766	MAD homology 1, Dwarfin-type (2);CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.88097	0.6345	M	0.75777	2.31	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.998;0.998	D	0.89139	0.3515	10	0.87932	D	0	.	11.8626	0.52476	1.0:0.0:0.0:0.0	.	126;126;117;126;117	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	M	117;117;117;126;126;126	ENSP00000378543:K117M;ENSP00000301935:K117M;ENSP00000342194:K126M	ENSP00000269778:K126M	K	+	2	0	NFIC	3333056	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.967000	0.93402	1.533000	0.49186	0.383000	0.25322	AAG	.	.		0.667	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597	
MCEMP1	199675	hgsc.bcm.edu	37	19	7743420	7743420	+	Silent	SNP	C	C	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:7743420C>A	ENST00000333598.3	+	5	871	c.417C>A	c.(415-417)ggC>ggA	p.G139G	C19orf59_ENST00000597445.1_Silent_p.G96G|TRAPPC5_ENST00000317378.5_5'Flank|CTD-3214H19.16_ENST00000597959.1_Missense_Mutation_p.L12M|TRAPPC5_ENST00000596148.1_5'Flank|TRAPPC5_ENST00000426877.2_5'Flank	NM_174918.2	NP_777578.2	Q8IX19	MCEM1_HUMAN		139						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)|stomach(1)	5						AGAAGAGAGGCTGGGATTCCG	0.532											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G139G		Atlas-SNP	.											.	C19orf59	15	.	0			c.C417A						.						133.0	126.0	128.0					19																	7743420		2203	4300	6503	SO:0001819	synonymous_variant	199675	exon5			GAGAGGCTGGGAT																												ENST00000333598.3:c.417C>A	chr19.hg19:g.7743420C>A		94.0	0.0	644	104.0	31.0	NM_174918	Q8IX20	Silent	SNP	ENST00000333598.3	hg19	CCDS12183.1																																																																																			.	.		0.532	C19orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461248.1		
OR7E24	26648	hgsc.bcm.edu	37	19	9361792	9361792	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:9361792A>T	ENST00000456448.1	+	1	187	c.73A>T	c.(73-75)Aca>Tca	p.T25S		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						ACAGAATCTCACAGGTGTCTC	0.493																																					p.T25S		Atlas-SNP	.											.	OR7E24	48	.	0			c.A73T						.						36.0	38.0	37.0					19																	9361792		2114	4244	6358	SO:0001583	missense	26648	exon1			AATCTCACAGGTG	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.73A>T	chr19.hg19:g.9361792A>T	ENSP00000387523:p.Thr25Ser	36.0	0.0		43.0	9.0	NM_001079935	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	ENST00000456448.1	hg19	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	a	11.71	1.719833	0.30503	.	.	ENSG00000237521	ENST00000456448	T	0.36878	1.23	2.39	2.39	0.29439	.	.	.	.	.	T	0.25232	0.0613	N	0.21448	0.665	0.09310	N	1	B	0.25563	0.129	B	0.27076	0.076	T	0.22243	-1.0222	9	0.51188	T	0.08	.	9.2996	0.37838	1.0:0.0:0.0:0.0	.	25	Q6IFN5	O7E24_HUMAN	S	25	ENSP00000387523:T25S	ENSP00000387523:T25S	T	+	1	0	OR7E24	9222792	.	.	0.004000	0.12327	0.030000	0.12068	.	.	1.112000	0.41740	0.358000	0.22013	ACA	.	.		0.493	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
CD97	976	hgsc.bcm.edu	37	19	14507927	14507927	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:14507927A>T	ENST00000242786.5	+	6	597	c.517A>T	c.(517-519)Agc>Tgc	p.S173C	CD97_ENST00000587728.1_Intron|CD97_ENST00000358600.3_Intron|CD97_ENST00000357355.3_Intron	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	173	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CCCGTGCCACAGCTCCACCCA	0.617																																					p.S173C		Atlas-SNP	.											.	CD97	86	.	0			c.A517T						.						106.0	96.0	99.0					19																	14507927		2203	4300	6503	SO:0001583	missense	976	exon6			TGCCACAGCTCCA		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.517A>T	chr19.hg19:g.14507927A>T	ENSP00000242786:p.Ser173Cys	97.0	0.0		72.0	21.0	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	hg19	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	a	16.82	3.228517	0.58777	.	.	ENSG00000123146	ENST00000242786	D	0.88741	-2.42	3.53	0.187	0.15109	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.85906	0.5806	L	0.27053	0.805	0.09310	N	1	P	0.52316	0.952	P	0.58520	0.84	T	0.74677	-0.3585	9	0.56958	D	0.05	.	3.2061	0.06666	0.5129:0.2351:0.2521:0.0	.	173	P48960	CD97_HUMAN	C	173	ENSP00000242786:S173C	ENSP00000242786:S173C	S	+	1	0	CD97	14368927	0.252000	0.23972	0.083000	0.20561	0.415000	0.31203	0.607000	0.24209	-0.032000	0.13758	0.454000	0.30748	AGC	.	.		0.617	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
CYP4F12	66002	hgsc.bcm.edu	37	19	15794357	15794357	+	Silent	SNP	A	A	G	rs376069087		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:15794357A>G	ENST00000550308.1	+	7	1082	c.702A>G	c.(700-702)aaA>aaG	p.K234K	CYP4F12_ENST00000324632.10_Silent_p.K234K	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	234					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	TTGTAGAGAAAAGAAGCCAGC	0.537																																					p.K234K		Atlas-SNP	.											.	CYP4F12	89	.	0			c.A702G						.						73.0	74.0	74.0					19																	15794357		2202	4300	6502	SO:0001819	synonymous_variant	66002	exon7			AGAGAAAAGAAGC	AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.702A>G	chr19.hg19:g.15794357A>G		53.0	0.0		107.0	23.0	NM_023944	E7ET51|O60389|Q5JPJ7|Q9HCS1	Silent	SNP	ENST00000550308.1	hg19	CCDS42517.1																																																																																			.	.		0.537	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9		
COLGALT1	79709	hgsc.bcm.edu	37	19	17678227	17678227	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:17678227G>C	ENST00000252599.4	+	4	622	c.502G>C	c.(502-504)Gac>Cac	p.D168H	COLGALT1_ENST00000601354.1_3'UTR	NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	168					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										TGTAGATGCGGACAACCTGAT	0.587																																					p.D168H		Atlas-SNP	.											.	.	.	.	0			c.G502C						.						114.0	93.0	100.0					19																	17678227		2203	4300	6503	SO:0001583	missense	79709	exon4			GATGCGGACAACC	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.502G>C	chr19.hg19:g.17678227G>C	ENSP00000252599:p.Asp168His	45.0	0.0		91.0	16.0	NM_024656	Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	hg19	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717403	0.48622	.	.	ENSG00000130309	ENST00000252599	D	0.98090	-4.71	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.98927	0.9636	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99589	1.0975	10	0.87932	D	0	-14.0629	14.6789	0.69001	0.0:0.0:1.0:0.0	.	168	Q8NBJ5	GT251_HUMAN	H	168	ENSP00000252599:D168H	ENSP00000252599:D168H	D	+	1	0	GLT25D1	17539227	1.000000	0.71417	0.831000	0.32960	0.023000	0.10783	9.428000	0.97476	2.070000	0.61991	0.491000	0.48974	GAC	.	.		0.587	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656	
ATP13A1	57130	hgsc.bcm.edu	37	19	19766889	19766889	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:19766889G>A	ENST00000357324.6	-	8	1213	c.1187C>T	c.(1186-1188)cCa>cTa	p.P396L	ATP13A1_ENST00000496082.1_5'Flank|ATP13A1_ENST00000291503.5_Missense_Mutation_p.P278L	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	396						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGCTTTCTGTGGGGGGATGTG	0.637																																					p.P396L	Esophageal Squamous(142;920 1789 9047 14684 24777)	Atlas-SNP	.											.	ATP13A1	82	.	0			c.C1187T						.						68.0	65.0	66.0					19																	19766889		2203	4300	6503	SO:0001583	missense	57130	exon8			TTCTGTGGGGGGA	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1187C>T	chr19.hg19:g.19766889G>A	ENSP00000349877:p.Pro396Leu	32.0	0.0		39.0	7.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	hg19	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431237	0.62844	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.90504	-2.68;-2.68	4.47	4.47	0.54385	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.91164	0.7217	M	0.82056	2.57	0.80722	D	1	B;B	0.22080	0.064;0.044	B;B	0.29716	0.106;0.049	D	0.89697	0.3902	10	0.44086	T	0.13	-10.7803	14.9828	0.71324	0.0:0.0:1.0:0.0	.	396;278	Q9HD20;Q9HD20-2	AT131_HUMAN;.	L	278;396	ENSP00000291503:P278L;ENSP00000349877:P396L	ENSP00000291503:P278L	P	-	2	0	ATP13A1	19627889	1.000000	0.71417	0.558000	0.28319	0.278000	0.26855	9.209000	0.95087	2.193000	0.70182	0.491000	0.48974	CCA	.	.		0.637	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
ZFP14	57677	hgsc.bcm.edu	37	19	36832052	36832052	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:36832052T>A	ENST00000270001.7	-	5	791	c.676A>T	c.(676-678)Aaa>Taa	p.K226*		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TCATAGGGTTTCTCACCGGTG	0.428																																					p.K226X		Atlas-SNP	.											.	ZFP14	68	.	0			c.A676T						.						104.0	96.0	99.0					19																	36832052		2203	4300	6503	SO:0001587	stop_gained	57677	exon5			AGGGTTTCTCACC	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.676A>T	chr19.hg19:g.36832052T>A	ENSP00000270001:p.Lys226*	57.0	0.0		72.0	21.0	NM_020917	A7MD23	Nonsense_Mutation	SNP	ENST00000270001.7	hg19	CCDS33002.1	.	.	.	.	.	.	.	.	.	.	t	27.2	4.808752	0.90707	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	.	.	.	4.07	4.07	0.47477	.	0.000000	0.48286	D	0.000192	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4234	0.55532	0.0:0.0:0.0:1.0	.	.	.	.	X	226	.	ENSP00000270001:K226X	K	-	1	0	ZFP14	41523892	0.997000	0.39634	1.000000	0.80357	0.989000	0.77384	3.798000	0.55522	1.831000	0.53308	0.448000	0.29417	AAA	.	.		0.428	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
GGN	199720	hgsc.bcm.edu	37	19	38877316	38877316	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:38877316C>T	ENST00000334928.6	-	3	718	c.586G>A	c.(586-588)Gcc>Acc	p.A196T	AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank|SPRED3_ENST00000586301.1_5'Flank|GGN_ENST00000591809.1_Intron	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	196	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGGGTGAGGCGGGTGTGGCC	0.692																																					p.A196T		Atlas-SNP	.											.	GGN	50	.	0			c.G586A						.						10.0	13.0	12.0					19																	38877316		2149	4227	6376	SO:0001583	missense	199720	exon3			GTGAGGCGGGTGT	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.586G>A	chr19.hg19:g.38877316C>T	ENSP00000334940:p.Ala196Thr	76.0	0.0		78.0	20.0	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	hg19	CCDS12516.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.459|8.459	0.854812|0.854812	0.17106|0.17106	.|.	.|.	ENSG00000179168|ENSG00000179168	ENST00000392116|ENST00000334928	.|.	.|.	.|.	3.58|3.58	-3.68|-3.68	0.04463|0.04463	.|.	.|0.355912	.|0.20324	.|N	.|0.094573	.|T	.|0.13200	.|0.0320	N|N	0.17082|0.17082	0.46|0.46	0.09310|0.09310	N|N	1|1	.|B;B	.|0.12630	.|0.006;0.006	.|B;B	.|0.09377	.|0.004;0.004	.|T	.|0.10451	.|-1.0629	.|9	.|0.22109	.|T	.|0.4	.|-5.3675	0.3497|0.3497	0.00347|0.00347	0.3358:0.2765:0.1654:0.2222|0.3358:0.2765:0.1654:0.2222	.|.	.|113;196	.|Q86UU5-2;Q86UU5	.|.;GGN_HUMAN	.|T	-1|196	.|.	.|ENSP00000334940:A196T	.|A	-|-	.|1	.|0	GGN|GGN	43569156|43569156	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.186000|0.186000	0.23388|0.23388	-0.932000|-0.932000	0.03963|0.03963	-0.303000|-0.303000	0.08856|0.08856	-0.448000|-0.448000	0.05591|0.05591	.|GCC	.	.		0.692	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
DLL3	10683	hgsc.bcm.edu	37	19	39998581	39998581	+	Silent	SNP	A	A	T	rs199745659		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:39998581A>T	ENST00000205143.4	+	8	1792	c.1785A>T	c.(1783-1785)ctA>ctT	p.L595L	DLL3_ENST00000356433.5_Intron	NM_016941.3	NP_058637.1	Q9NYJ7	DLL3_HUMAN	delta-like 3 (Drosophila)	595					compartment pattern specification (GO:0007386)|negative regulation of neurogenesis (GO:0050768)|Notch signaling pathway (GO:0007219)|paraxial mesoderm development (GO:0048339)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)	integral component of membrane (GO:0016021)	Notch binding (GO:0005112)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)	19	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCCCCCCGCTACACACTGGGC	0.532																																					p.L595L		Atlas-SNP	.											.	DLL3	47	.	0			c.A1785T						.						60.0	51.0	54.0					19																	39998581		2203	4300	6503	SO:0001819	synonymous_variant	10683	exon8			CCCGCTACACACT	AF241373	CCDS12537.1, CCDS12538.1	19q13.2	2008-05-14	2001-12-03			ENSG00000090932			2909	protein-coding gene	gene with protein product		602768	"""delta (Drosophila)-like 3"""			10364530, 10742114	Standard	NM_203486		Approved	SCDO1	uc002olx.2	Q9NYJ7		ENST00000205143.4:c.1785A>T	chr19.hg19:g.39998581A>T		77.0	0.0		94.0	15.0	NM_016941	E9PFG2|Q8NBS4	Silent	SNP	ENST00000205143.4	hg19	CCDS12538.1																																																																																			.	A|0.999;G|0.001		0.532	DLL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464958.1		
CEACAM4	1089	hgsc.bcm.edu	37	19	42132079	42132079	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:42132079A>T	ENST00000221954.2	-	2	430	c.320T>A	c.(319-321)cTg>cAg	p.L107Q	CEACAM4_ENST00000600925.1_Missense_Mutation_p.L107Q	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	107	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						TTGGAACAGCAGGGATCCATT	0.512																																					p.L107Q		Atlas-SNP	.											.	CEACAM4	42	.	0			c.T320A						.						204.0	181.0	188.0					19																	42132079		2203	4300	6503	SO:0001583	missense	1089	exon2			AACAGCAGGGATC	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.320T>A	chr19.hg19:g.42132079A>T	ENSP00000221954:p.Leu107Gln	120.0	0.0		162.0	39.0	NM_001817	Q03715|Q7LDZ7	Missense_Mutation	SNP	ENST00000221954.2	hg19	CCDS33033.1	.	.	.	.	.	.	.	.	.	.	A	12.80	2.046558	0.36085	.	.	ENSG00000105352	ENST00000221954	T	0.09630	2.96	1.76	1.76	0.24704	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.39358	0.1075	H	0.95645	3.7	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.12682	-1.0538	9	0.87932	D	0	.	5.5316	0.16987	1.0:0.0:0.0:0.0	.	107;107	E7EMX3;O75871	.;CEAM4_HUMAN	Q	107	ENSP00000221954:L107Q	ENSP00000221954:L107Q	L	-	2	0	CEACAM4	46823919	0.289000	0.24334	0.031000	0.17742	0.038000	0.13279	0.282000	0.18829	1.053000	0.40415	0.172000	0.16884	CTG	.	.		0.512	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321148.1	NM_001817	
ZNF226	7769	hgsc.bcm.edu	37	19	44676286	44676286	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:44676286G>T	ENST00000590089.1	+	5	428	c.61G>T	c.(61-63)Gaa>Taa	p.E21*	ZNF226_ENST00000589160.1_Nonsense_Mutation_p.E21*|ZNF226_ENST00000413984.2_Nonsense_Mutation_p.E21*|ZNF226_ENST00000588742.1_Nonsense_Mutation_p.E21*|ZNF226_ENST00000588795.1_Nonsense_Mutation_p.E21*|ZNF226_ENST00000300823.6_Nonsense_Mutation_p.E21*|ZNF226_ENST00000337433.5_Nonsense_Mutation_p.E21*|ZNF226_ENST00000588883.1_Nonsense_Mutation_p.E21*|ZNF226_ENST00000454662.2_Nonsense_Mutation_p.E21*			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				CACGGAGGAGGAATTGGGGCT	0.537																																					p.E21X	Pancreas(115;581 1665 13228 19278 50070)	Atlas-SNP	.											.	.	.	.	0			c.G61T						.						155.0	155.0	155.0					19																	44676286		2203	4300	6503	SO:0001587	stop_gained	7769	exon4			GAGGAGGAATTGG	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.61G>T	chr19.hg19:g.44676286G>T	ENSP00000465121:p.Glu21*	74.0	0.0		74.0	12.0	NM_015919	Q8WWE6|Q96TE6|Q9NS44	Nonsense_Mutation	SNP	ENST00000590089.1	hg19	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	G	35	5.483631	0.96307	.	.	ENSG00000167380	ENST00000300823;ENST00000337433;ENST00000413984;ENST00000454662	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.7373	0.69424	0.0:0.0:1.0:0.0	.	.	.	.	X	21	.	ENSP00000300823:E21X	E	+	1	0	ZNF226	49368126	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	3.457000	0.53007	2.417000	0.82017	0.650000	0.86243	GAA	.	.		0.537	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
CBLC	23624	hgsc.bcm.edu	37	19	45303670	45303670	+	Silent	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:45303670G>T	ENST00000270279.3	+	10	1458	c.1395G>T	c.(1393-1395)gcG>gcT	p.A465A	CBLC_ENST00000341505.4_Silent_p.A419A	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	465	Interaction with RET.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				CTCCAGCTGCGCTGGGACCCC	0.622			M		AML						OREG0025543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A465A		Atlas-SNP	.		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	.	CBLC	41	.	0			c.G1395T						.						50.0	52.0	51.0					19																	45303670		2203	4300	6503	SO:0001819	synonymous_variant	23624	exon10			AGCTGCGCTGGGA	AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.1395G>T	chr19.hg19:g.45303670G>T		161.0	0.0	930	165.0	30.0	NM_012116	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Silent	SNP	ENST00000270279.3	hg19	CCDS12643.1																																																																																			.	.		0.622	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319732.2	NM_012116	
MYBPC2	4606	hgsc.bcm.edu	37	19	50962198	50962198	+	Missense_Mutation	SNP	C	C	A	rs202035202		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:50962198C>A	ENST00000357701.5	+	22	2581	c.2530C>A	c.(2530-2532)Cgc>Agc	p.R844S		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	844	Ig-like C2-type 6.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CCGGCTTCCCCGCCATCTCCG	0.682																																					p.R844S		Atlas-SNP	.											.	MYBPC2	103	.	0			c.C2530A						.						21.0	27.0	25.0					19																	50962198		2013	4220	6233	SO:0001583	missense	4606	exon22			CTTCCCCGCCATC		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2530C>A	chr19.hg19:g.50962198C>A	ENSP00000350332:p.Arg844Ser	104.0	0.0		106.0	31.0	NM_004533	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	hg19	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	c	23.3	4.398585	0.83120	.	.	ENSG00000086967	ENST00000357701	T	0.56444	0.46	4.01	2.88	0.33553	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.36167	U	0.002743	T	0.74876	0.3774	M	0.93939	3.475	0.45914	D	0.998752	P	0.41008	0.735	D	0.63793	0.918	T	0.75578	-0.3269	10	0.12103	T	0.63	.	12.4097	0.55459	0.1677:0.8323:0.0:0.0	.	844	Q14324	MYPC2_HUMAN	S	844	ENSP00000350332:R844S	ENSP00000350332:R844S	R	+	1	0	MYBPC2	55654010	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	5.209000	0.65208	1.967000	0.57214	0.457000	0.33378	CGC	.	.		0.682	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
SYT3	84258	hgsc.bcm.edu	37	19	51129240	51129240	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:51129240A>T	ENST00000338916.4	-	5	1949	c.1316T>A	c.(1315-1317)cTc>cAc	p.L439H	SYT3_ENST00000544769.1_Missense_Mutation_p.L439H|SYT3_ENST00000600079.1_Missense_Mutation_p.L439H|SYT3_ENST00000593901.1_Missense_Mutation_p.L439H	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	439	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGGTAGCAGAGTGAGAAGTT	0.557																																					p.L439H		Atlas-SNP	.											.	SYT3	85	.	0			c.T1316A						.						106.0	92.0	97.0					19																	51129240		2203	4300	6503	SO:0001583	missense	84258	exon5			TAGCAGAGTGAGA	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1316T>A	chr19.hg19:g.51129240A>T	ENSP00000340914:p.Leu439His	102.0	0.0		121.0	23.0	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	hg19	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.331634	0.81690	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.75704	-0.96;-0.96	4.13	4.13	0.48395	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.47852	U	0.000217	D	0.89976	0.6871	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92600	0.6090	10	0.87932	D	0	.	12.4368	0.55604	1.0:0.0:0.0:0.0	.	439	Q9BQG1	SYT3_HUMAN	H	439	ENSP00000340914:L439H;ENSP00000438883:L439H	ENSP00000340914:L439H	L	-	2	0	SYT3	55821052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.980000	0.93460	1.662000	0.50781	0.454000	0.30748	CTC	.	.		0.557	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
KLK6	5653	hgsc.bcm.edu	37	19	51470458	51470458	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:51470458A>T	ENST00000376851.3	-	3	603	c.164T>A	c.(163-165)cTg>cAg	p.L55Q	CTB-147C22.9_ENST00000594512.1_RNA|KLK6_ENST00000310157.2_Missense_Mutation_p.L55Q|KLK6_ENST00000424910.2_Intron|KLK6_ENST00000594641.1_Missense_Mutation_p.L55Q|KLK6_ENST00000376853.4_Missense_Mutation_p.L55Q|KLK6_ENST00000391808.1_5'UTR	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	55	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GAGGACCCACAGTGGATGGAT	0.552																																					p.L55Q		Atlas-SNP	.											.	KLK6	35	.	0			c.T164A						.						110.0	99.0	103.0					19																	51470458		2203	4300	6503	SO:0001583	missense	5653	exon3			ACCCACAGTGGAT	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.164T>A	chr19.hg19:g.51470458A>T	ENSP00000366047:p.Leu55Gln	92.0	0.0		135.0	27.0	NM_001012964	A6NJA1|A8MW09|Q6H301	Missense_Mutation	SNP	ENST00000376851.3	hg19	CCDS12811.1	.	.	.	.	.	.	.	.	.	.	A	0.759	-0.769808	0.02974	.	.	ENSG00000167755	ENST00000310157;ENST00000376851;ENST00000376853	D;D;D	0.87571	-2.27;-2.27;-2.27	4.31	1.91	0.25777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.643386	0.11908	N	0.517954	T	0.59252	0.2180	N	0.00389	-1.56	0.51767	D	0.999936	B;B	0.21905	0.062;0.003	B;B	0.27262	0.078;0.001	T	0.56092	-0.8036	10	0.02654	T	1	.	9.1095	0.36718	0.2317:0.0:0.0:0.7683	.	55;55	E7ETY0;Q92876	.;KLK6_HUMAN	Q	55	ENSP00000309148:L55Q;ENSP00000366047:L55Q;ENSP00000366049:L55Q	ENSP00000309148:L55Q	L	-	2	0	KLK6	56162270	0.001000	0.12720	0.450000	0.26969	0.918000	0.54935	0.787000	0.26858	0.128000	0.18479	0.454000	0.30748	CTG	.	.		0.552	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
VSIG10L	147645	hgsc.bcm.edu	37	19	51841247	51841247	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:51841247C>T	ENST00000335624.4	-	6	1944	c.1945G>A	c.(1945-1947)Gga>Aga	p.G649R	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	649						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						GAGTAATTTCCCAGGTCCCAA	0.602																																					p.G649R		Atlas-SNP	.											.	VSIG10L	40	.	0			c.G1945A						.						60.0	63.0	62.0					19																	51841247		692	1591	2283	SO:0001583	missense	147645	exon6			AATTTCCCAGGTC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.1945G>A	chr19.hg19:g.51841247C>T	ENSP00000335623:p.Gly649Arg	62.0	0.0		83.0	16.0	NM_001163922		Missense_Mutation	SNP	ENST00000335624.4	hg19	CCDS54300.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455765	0.84209	.	.	ENSG00000186806	ENST00000335624	T	0.27890	1.64	4.77	4.77	0.60923	Immunoglobulin-like fold (1);	0.129873	0.35805	N	0.002962	T	0.56834	0.2012	M	0.81497	2.545	0.41229	D	0.986565	D	0.89917	1.0	D	0.91635	0.999	T	0.63603	-0.6600	10	0.87932	D	0	-10.7112	13.2878	0.60253	0.0:1.0:0.0:0.0	.	649	Q86VR7	VS10L_HUMAN	R	649	ENSP00000335623:G649R	ENSP00000335623:G649R	G	-	1	0	VSIG10L	56533059	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.896000	0.56266	2.197000	0.70478	0.462000	0.41574	GGA	.	.		0.602	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	
HAS1	3036	hgsc.bcm.edu	37	19	52222631	52222631	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:52222631G>A	ENST00000222115.1	-	2	564	c.530C>T	c.(529-531)gCg>gTg	p.A177V	HAS1_ENST00000594621.1_Missense_Mutation_p.A31V|HAS1_ENST00000540069.2_Missense_Mutation_p.A176V|HAS1_ENST00000601714.1_Missense_Mutation_p.A184V	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	177					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ggcgcccaccgcgcccgccgc	0.711																																					p.A177V	NSCLC(132;636 2450 45807 47979)	Atlas-SNP	.											.	HAS1	61	.	0			c.C530T						.						7.0	8.0	8.0					19																	52222631		2116	4090	6206	SO:0001583	missense	3036	exon2			CCCACCGCGCCCG	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.530C>T	chr19.hg19:g.52222631G>A	ENSP00000222115:p.Ala177Val	106.0	0.0		107.0	25.0	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	hg19	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	.	11.16	1.557107	0.27827	.	.	ENSG00000105509	ENST00000540069;ENST00000222115;ENST00000376737;ENST00000376738	T;T	0.31769	1.48;1.48	3.83	-0.101	0.13618	.	1.113020	0.07042	N	0.830345	T	0.11580	0.0282	N	0.08118	0	0.20926	N	0.999825	P;B;P	0.42692	0.564;0.429;0.787	B;B;B	0.32677	0.061;0.028;0.15	T	0.14337	-1.0476	10	0.30854	T	0.27	-9.6168	4.1606	0.10282	0.1009:0.1538:0.5885:0.1569	.	176;177;176	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	V	176;177;31;31	ENSP00000445021:A176V;ENSP00000222115:A177V	ENSP00000222115:A177V	A	-	2	0	HAS1	56914443	0.000000	0.05858	0.053000	0.19242	0.756000	0.42949	-0.079000	0.11357	0.202000	0.20498	0.423000	0.28283	GCG	.	.		0.711	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
ZNF880	400713	hgsc.bcm.edu	37	19	52888535	52888535	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:52888535A>T	ENST00000422689.2	+	4	1717	c.1702A>T	c.(1702-1704)Aga>Tga	p.R568*		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	568					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						AAATCATCACAGAATCCATAC	0.383																																					p.R568X		Atlas-SNP	.											.	ZNF880	45	.	0			c.A1702T						.						73.0	66.0	68.0					19																	52888535		692	1591	2283	SO:0001587	stop_gained	400713	exon4			CATCACAGAATCC	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1702A>T	chr19.hg19:g.52888535A>T	ENSP00000406318:p.Arg568*	163.0	0.0		177.0	39.0	NM_001145434	B4DNA6	Nonsense_Mutation	SNP	ENST00000422689.2	hg19	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.596041	0.28445	.	.	ENSG00000221923	ENST00000422689	.	.	.	1.79	1.79	0.24919	.	.	.	.	.	.	.	.	.	.	.	0.25643	N	0.986184	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3334	0.32200	1.0:0.0:0.0:0.0	.	.	.	.	X	568	.	.	R	+	1	2	ZNF880	57580347	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-1.373000	0.02568	0.798000	0.33994	0.363000	0.22086	AGA	.	.		0.383	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
LENG8	114823	hgsc.bcm.edu	37	19	54965762	54965762	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:54965762A>T	ENST00000326764.5	+	6	1059	c.580A>T	c.(580-582)Agc>Tgc	p.S194C	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	157										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CACACAGCACAGCCAGGCGGG	0.672																																					p.S194C		Atlas-SNP	.											.	LENG8	73	.	0			c.A580T						.						14.0	14.0	14.0					19																	54965762		2186	4277	6463	SO:0001583	missense	114823	exon6			CAGCACAGCCAGG	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.580A>T	chr19.hg19:g.54965762A>T	ENSP00000318374:p.Ser194Cys	119.0	0.0		144.0	22.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	ENST00000326764.5	hg19	CCDS12894.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831047	0.71258	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000439657;ENST00000376526;ENST00000431846	T;T;T;T	0.52754	1.34;0.65;1.3;1.31	5.38	3.19	0.36642	.	0.336327	0.32093	N	0.006595	T	0.48732	0.1516	L	0.40543	1.245	0.80722	D	1	P;D	0.60575	0.896;0.988	P;P	0.56514	0.591;0.8	T	0.43782	-0.9370	10	0.49607	T	0.09	-22.7198	8.0119	0.30357	0.8152:0.0:0.1848:0.0	.	194;157	Q96PV6-2;F8W9Q9	.;.	C	194;157;194;157;194	ENSP00000318374:S194C;ENSP00000399507:S194C;ENSP00000365709:S157C;ENSP00000388053:S194C	ENSP00000301196:S157C	S	+	1	0	LENG8	59657574	0.996000	0.38824	1.000000	0.80357	0.990000	0.78478	0.988000	0.29616	0.985000	0.38656	0.533000	0.62120	AGC	.	.		0.672	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
NLRP13	126204	hgsc.bcm.edu	37	19	56413554	56413554	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:56413554A>T	ENST00000342929.3	-	9	2635	c.2636T>A	c.(2635-2637)cTg>cAg	p.L879Q	NLRP13_ENST00000588751.1_Missense_Mutation_p.L879Q	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	879							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GGGTGCTGCCAGCTGGCAAAA	0.597																																					p.L879Q		Atlas-SNP	.											.	NLRP13	220	.	0			c.T2636A						.						60.0	49.0	52.0					19																	56413554		2203	4300	6503	SO:0001583	missense	126204	exon9			GCTGCCAGCTGGC	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2636T>A	chr19.hg19:g.56413554A>T	ENSP00000343891:p.Leu879Gln	43.0	0.0		39.0	7.0	NM_176810	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	hg19	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201602	0.38905	.	.	ENSG00000173572	ENST00000342929	T	0.62364	0.03	2.52	2.52	0.30459	.	.	.	.	.	T	0.80401	0.4616	M	0.91140	3.18	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66642	-0.5872	9	0.87932	D	0	.	7.2153	0.25957	1.0:0.0:0.0:0.0	.	879	Q86W25	NAL13_HUMAN	Q	879	ENSP00000343891:L879Q	ENSP00000343891:L879Q	L	-	2	0	NLRP13	61105366	0.149000	0.22717	0.058000	0.19502	0.202000	0.24057	3.926000	0.56491	1.137000	0.42214	0.383000	0.25322	CTG	.	.		0.597	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
NLRP5	126206	hgsc.bcm.edu	37	19	56520164	56520164	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:56520164A>T	ENST00000390649.3	+	3	453	c.453A>T	c.(451-453)ccA>ccT	p.P151P		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	151					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GACATTCACCAGAAGATCCTG	0.463																																					p.P151P		Atlas-SNP	.											.	NLRP5	217	.	0			c.A453T						.						64.0	61.0	62.0					19																	56520164		1913	4133	6046	SO:0001819	synonymous_variant	126206	exon3			TTCACCAGAAGAT	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.453A>T	chr19.hg19:g.56520164A>T		78.0	0.0		105.0	21.0	NM_153447	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	hg19	CCDS12938.1																																																																																			.	.		0.463	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
ZNF835	90485	hgsc.bcm.edu	37	19	57176467	57176467	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:57176467A>T	ENST00000537055.2	-	2	331	c.100T>A	c.(100-102)Tgt>Agt	p.C34S		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	34					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GGCTCTGGACAGCTTTCCTGG	0.597																																					p.C34S		Atlas-SNP	.											.	ZNF835	106	.	0			c.T100A						.						75.0	80.0	79.0					19																	57176467		1989	4164	6153	SO:0001583	missense	90485	exon2			CTGGACAGCTTTC	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.100T>A	chr19.hg19:g.57176467A>T	ENSP00000444747:p.Cys34Ser	81.0	0.0		80.0	10.0	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	hg19	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	A	1.362	-0.588359	0.03799	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.05580	3.42	2.59	-3.39	0.04868	.	.	.	.	.	T	0.03011	0.0089	N	0.24115	0.695	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46911	-0.9157	9	0.21540	T	0.41	.	0.3145	0.00293	0.2899:0.1935:0.1361:0.3804	.	56	Q9Y2P0	ZN835_HUMAN	S	56;34	ENSP00000444747:C34S	ENSP00000341756:C56S	C	-	1	0	ZNF835	61868279	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.333000	0.07894	-0.577000	0.05967	-0.441000	0.05720	TGT	.	.		0.597	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
ZNF135	7694	hgsc.bcm.edu	37	19	58571397	58571397	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr19:58571397A>T	ENST00000313434.5	+	2	128	c.27A>T	c.(25-27)acA>acT	p.T9T	ZNF135_ENST00000511556.1_Silent_p.T9T|ZNF135_ENST00000439855.2_Silent_p.T9T|ZNF135_ENST00000506786.1_5'UTR|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000401053.4_Intron	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	9					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		GCGTCTCCACAGACCCGGTGA	0.701																																					p.T9T		Atlas-SNP	.											.	ZNF135	159	.	0			c.A27T						.						81.0	66.0	71.0					19																	58571397		2203	4300	6503	SO:0001819	synonymous_variant	7694	exon2			CTCCACAGACCCG	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.27A>T	chr19.hg19:g.58571397A>T		53.0	0.0		65.0	16.0	NM_003436	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Silent	SNP	ENST00000313434.5	hg19																																																																																				.	.		0.701	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
ADAM33	80332	hgsc.bcm.edu	37	20	3652923	3652923	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:3652923A>T	ENST00000356518.2	-	14	1696	c.1455T>A	c.(1453-1455)ccT>ccA	p.P485P	ADAM33_ENST00000350009.2_Silent_p.P485P|ADAM33_ENST00000379861.4_Silent_p.P485P|ADAM33_ENST00000466620.1_5'UTR	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	485	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						TGCAAAACTCAGGGAGGTCAC	0.657																																					p.P485P		Atlas-SNP	.											.	ADAM33	76	.	0			c.T1455A						.						70.0	68.0	69.0					20																	3652923		2203	4300	6503	SO:0001819	synonymous_variant	80332	exon14			AAACTCAGGGAGG	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1455T>A	chr20.hg19:g.3652923A>T		94.0	0.0		119.0	29.0	NM_025220	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	hg19	CCDS13058.1																																																																																			.	.		0.657	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
FERMT1	55612	hgsc.bcm.edu	37	20	6064810	6064810	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:6064810A>T	ENST00000217289.4	-	13	2383	c.1595T>A	c.(1594-1596)cTg>cAg	p.L532Q	FERMT1_ENST00000478194.1_5'UTR|FERMT1_ENST00000536936.1_Splice_Site_p.L275Q	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	532	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						CCGGGCGGCCAGCTGAACAGA	0.572																																					p.L532Q		Atlas-SNP	.											.	FERMT1	106	.	0			c.T1595A						.						38.0	29.0	32.0					20																	6064810		2203	4300	6503	SO:0001630	splice_region_variant	55612	exon13			GCGGCCAGCTGAA	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1594-1T>A	chr20.hg19:g.6064810A>T		33.0	0.0		41.0	11.0	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	hg19	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.433421	0.83776	.	.	ENSG00000101311	ENST00000217289;ENST00000536936;ENST00000339538	T;T	0.81415	-1.49;-1.49	4.68	4.68	0.58851	Band 4.1 domain (1);FERM central domain (2);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.075318	0.53938	D	0.000041	D	0.88385	0.6422	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.89877	0.4027	10	0.87932	D	0	-0.0175	14.4531	0.67399	1.0:0.0:0.0:0.0	.	532	Q9BQL6	FERM1_HUMAN	Q	532;275;532	ENSP00000217289:L532Q;ENSP00000441063:L275Q	ENSP00000217289:L532Q	L	-	2	0	FERMT1	6012810	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.220000	0.95180	1.869000	0.54173	0.459000	0.35465	CTG	.	.		0.572	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	Missense_Mutation
SEC23B	10483	hgsc.bcm.edu	37	20	18534971	18534971	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:18534971A>T	ENST00000336714.3	+	18	2517	c.2085A>T	c.(2083-2085)caA>caT	p.Q695H	SEC23B_ENST00000262544.2_Missense_Mutation_p.Q695H|SEC23B_ENST00000377475.3_Missense_Mutation_p.Q695H|SEC23B_ENST00000377465.1_Missense_Mutation_p.Q695H	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	695					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						ATGATGCTCAAGAAATTCTGC	0.522																																					p.Q695H		Atlas-SNP	.											.	SEC23B	70	.	0			c.A2085T						.						167.0	135.0	146.0					20																	18534971		2203	4300	6503	SO:0001583	missense	10483	exon18			TGCTCAAGAAATT	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.2085A>T	chr20.hg19:g.18534971A>T	ENSP00000338844:p.Gln695His	80.0	0.0		85.0	19.0	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	hg19	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	A	18.35	3.604778	0.66445	.	.	ENSG00000101310	ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465;ENST00000422877	D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36	4.69	-1.33	0.09172	Gelsolin domain (1);	0.103484	0.64402	D	0.000002	D	0.92424	0.7595	M	0.75085	2.285	0.58432	D	0.999999	P;P	0.37015	0.542;0.578	B;B	0.43018	0.309;0.405	D	0.89226	0.3574	10	0.72032	D	0.01	-14.3883	10.9766	0.47469	0.3191:0.0:0.6809:0.0	.	677;695	B4DJW8;Q15437	.;SC23B_HUMAN	H	695;695;695;695;174	ENSP00000338844:Q695H;ENSP00000262544:Q695H;ENSP00000366695:Q695H;ENSP00000366685:Q695H;ENSP00000409882:Q174H	ENSP00000262544:Q695H	Q	+	3	2	SEC23B	18482971	0.991000	0.36638	0.984000	0.44739	0.988000	0.76386	0.237000	0.17985	-0.136000	0.11475	-0.250000	0.11733	CAA	.	.		0.522	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
RALGAPA2	57186	hgsc.bcm.edu	37	20	20601245	20601245	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:20601245A>T	ENST00000202677.7	-	11	1270	c.1263T>A	c.(1261-1263)gcT>gcA	p.A421A		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	421					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						TTCTTGTTACAGCTATCTCAC	0.423																																					p.A421A		Atlas-SNP	.											.	RALGAPA2	274	.	0			c.T1263A						.						67.0	64.0	65.0					20																	20601245		1857	4116	5973	SO:0001819	synonymous_variant	57186	exon11			TGTTACAGCTATC	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.1263T>A	chr20.hg19:g.20601245A>T		102.0	0.0		101.0	25.0	NM_020343	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Silent	SNP	ENST00000202677.7	hg19	CCDS46584.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535094	0.27475	.	.	ENSG00000188559	ENST00000430436	.	.	.	5.5	1.72	0.24424	.	.	.	.	.	T	0.52677	0.1749	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45323	-0.9269	4	.	.	.	.	5.9768	0.19385	0.739:0.0:0.1391:0.1219	.	.	.	.	Q	238	.	.	L	-	2	0	RALGAPA2	20549245	0.908000	0.30866	1.000000	0.80357	0.995000	0.86356	0.236000	0.17967	0.922000	0.37019	0.482000	0.46254	CTG	.	.		0.423	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
ID1	3397	hgsc.bcm.edu	37	20	30193298	30193298	+	Silent	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:30193298T>C	ENST00000376112.3	+	1	213	c.108T>C	c.(106-108)tcT>tcC	p.S36S	ID1_ENST00000376105.3_Silent_p.S36S|MIR3193_ENST00000578262.1_RNA	NM_002165.3	NP_002156.2	P41134	ID1_HUMAN	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	36					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|collagen metabolic process (GO:0032963)|endothelial cell morphogenesis (GO:0001886)|heart development (GO:0007507)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein destabilization (GO:0031648)|regulation of angiogenesis (GO:0045765)|regulation of MAPK cascade (GO:0043408)|response to antibiotic (GO:0046677)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|ovary(1)|pancreas(1)	4	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			GCTGTCTGTCTGAGCAGAGCG	0.731																																					p.S36S	NSCLC(123;1618 1779 21803 28680 33854)	Atlas-SNP	.											.	ID1	12	.	0			c.T108C						.						11.0	12.0	12.0					20																	30193298		2168	4186	6354	SO:0001819	synonymous_variant	3397	exon1			TCTGTCTGAGCAG		CCDS13185.1, CCDS13186.1	20q11	2013-05-21			ENSG00000125968	ENSG00000125968		"""Basic helix-loop-helix proteins"""	5360	protein-coding gene	gene with protein product	"""DNA-binding protein inhibitor ID-1"""	600349				8294468	Standard	NM_002165		Approved	dJ857M17.1.2, bHLHb24	uc002wwg.2	P41134	OTTHUMG00000032181	ENST00000376112.3:c.108T>C	chr20.hg19:g.30193298T>C		76.0	0.0		76.0	20.0	NM_002165	A8K537|E1P5L4|O00651|O00652|Q16371|Q16377|Q5TE66|Q5TE67|Q969Z7|Q9H0Z5|Q9H109	Silent	SNP	ENST00000376112.3	hg19	CCDS13185.1																																																																																			.	.		0.731	ID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078550.1	NM_002165	
R3HDML	140902	hgsc.bcm.edu	37	20	42966048	42966048	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:42966048T>A	ENST00000217043.2	+	1	423	c.251T>A	c.(250-252)aTg>aAg	p.M84K		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	84	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			GCCGCCAACATGGAATACATG	0.582																																					p.M84K		Atlas-SNP	.											.	R3HDML	33	.	0			c.T251A						.						53.0	51.0	51.0					20																	42966048		2203	4300	6503	SO:0001583	missense	140902	exon1			CCAACATGGAATA	BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.251T>A	chr20.hg19:g.42966048T>A	ENSP00000217043:p.Met84Lys	108.0	0.0		130.0	34.0	NM_178491		Missense_Mutation	SNP	ENST00000217043.2	hg19	CCDS13329.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852875	0.71719	.	.	ENSG00000101074	ENST00000217043	T	0.22336	1.96	5.18	5.18	0.71444	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.65913	0.2737	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81810	-0.0762	10	0.87932	D	0	.	15.0238	0.71653	0.0:0.0:0.0:1.0	.	84	Q9H3Y0	CRSPL_HUMAN	K	84	ENSP00000217043:M84K	ENSP00000217043:M84K	M	+	2	0	R3HDML	42399462	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	5.389000	0.66255	1.958000	0.56883	0.317000	0.21355	ATG	.	.		0.582	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491	
WISP2	8839	hgsc.bcm.edu	37	20	43355869	43355869	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:43355869T>A	ENST00000372868.2	+	5	1017	c.674T>A	c.(673-675)cTg>cAg	p.L225Q	WISP2_ENST00000471629.1_3'UTR|WISP2_ENST00000190983.4_Missense_Mutation_p.L225Q|WISP2_ENST00000372865.4_Missense_Mutation_p.W143R|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	225	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				TTCTGCCGACTGGAGACCCAG	0.682																																					p.L225Q		Atlas-SNP	.											.	WISP2	28	.	0			c.T674A						.						34.0	36.0	35.0					20																	43355869		2203	4299	6502	SO:0001583	missense	8839	exon4			GCCGACTGGAGAC	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.674T>A	chr20.hg19:g.43355869T>A	ENSP00000361959:p.Leu225Gln	48.0	0.0		31.0	7.0	NM_003881	B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	ENST00000372868.2	hg19	CCDS13336.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.69|17.69	3.451746|3.451746	0.63290|0.63290	.|.	.|.	ENSG00000064205|ENSG00000064205	ENST00000372868;ENST00000190983|ENST00000372865	T;T|T	0.55930|0.63417	0.49;0.49|-0.04	4.05|4.05	4.05|4.05	0.47172|0.47172	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.73598|0.73598	0.3607|0.3607	L|L	0.58354|0.58354	1.805|1.805	0.58432|0.58432	D|D	0.999998|0.999998	D|D	0.89917|0.76494	1.0|0.999	D|D	0.87578|0.68765	0.998|0.96	T|T	0.77054|0.77054	-0.2730|-0.2730	10|9	0.51188|0.87932	T|D	0.08|0	-21.0299|-21.0299	13.1748|13.1748	0.59619|0.59619	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	225|143	O76076|Q6PEG3	WISP2_HUMAN|.	Q|R	225|143	ENSP00000361959:L225Q;ENSP00000190983:L225Q|ENSP00000361956:W143R	ENSP00000190983:L225Q|ENSP00000361956:W143R	L|W	+|+	2|1	0|0	WISP2|WISP2	42789283|42789283	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.336000|0.336000	0.28762|0.28762	7.752000|7.752000	0.85141|0.85141	1.700000|1.700000	0.51204|0.51204	0.459000|0.459000	0.35465|0.35465	CTG|TGG	.	.		0.682	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
SEMG1	6406	hgsc.bcm.edu	37	20	43836884	43836884	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:43836884A>T	ENST00000372781.3	+	2	1003	c.946A>T	c.(946-948)Agc>Tgc	p.S316C	SEMG1_ENST00000244069.6_Intron	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	316	2 X 60 AA tandem repeats, type 1.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CAGTATTTATAGCCAAACTGA	0.378																																					p.S316C		Atlas-SNP	.											.	SEMG1	71	.	0			c.A946T						.						72.0	68.0	70.0					20																	43836884		2203	4300	6503	SO:0001583	missense	6406	exon2			ATTTATAGCCAAA		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.946A>T	chr20.hg19:g.43836884A>T	ENSP00000361867:p.Ser316Cys	305.0	0.0		427.0	98.0	NM_003007	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	ENST00000372781.3	hg19	CCDS13345.1	.	.	.	.	.	.	.	.	.	.	A	11.55	1.673529	0.29693	.	.	ENSG00000124233	ENST00000372781	T	0.06933	3.24	1.69	0.403	0.16350	.	.	.	.	.	T	0.14098	0.0341	L	0.50333	1.59	0.09310	N	1	D;D	0.63880	0.992;0.993	P;P	0.57425	0.82;0.815	T	0.14783	-1.0460	9	0.62326	D	0.03	.	4.2989	0.10915	0.6399:0.3601:0.0:0.0	.	316;316	P04279;E7EPD3	SEMG1_HUMAN;.	C	316	ENSP00000361867:S316C	ENSP00000361867:S316C	S	+	1	0	SEMG1	43270298	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.004000	0.13106	0.078000	0.16900	0.455000	0.32223	AGC	.	.		0.378	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007	
PARD6B	84612	hgsc.bcm.edu	37	20	49366413	49366413	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr20:49366413A>T	ENST00000371610.2	+	3	750	c.507A>T	c.(505-507)ctA>ctT	p.L169L	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	169	Interaction with PARD3 and CDC42. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AGAAACCCCTAGGATTCTACA	0.488																																					p.L169L		Atlas-SNP	.											.	PARD6B	31	.	0			c.A507T						.						70.0	67.0	68.0					20																	49366413		2203	4300	6503	SO:0001819	synonymous_variant	84612	exon3			ACCCCTAGGATTC	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.507A>T	chr20.hg19:g.49366413A>T		158.0	0.0		195.0	52.0	NM_032521	A2A2A7|Q9Y510	Silent	SNP	ENST00000371610.2	hg19	CCDS33485.1																																																																																			.	.		0.488	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
TMPRSS15	5651	hgsc.bcm.edu	37	21	19666925	19666925	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr21:19666925T>A	ENST00000284885.3	-	20	2339	c.2306A>T	c.(2305-2307)cAt>cTt	p.H769L		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	769	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CTTACATTTATGGTTACACTG	0.289																																					p.H769L		Atlas-SNP	.											.	TMPRSS15	189	.	0			c.A2306T						.						79.0	82.0	81.0					21																	19666925		2203	4297	6500	SO:0001583	missense	5651	exon20			CATTTATGGTTAC		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2306A>T	chr21.hg19:g.19666925T>A	ENSP00000284885:p.His769Leu	271.0	0.0		348.0	80.0	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	hg19	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	T	6.401	0.442068	0.12164	.	.	ENSG00000154646	ENST00000284885	T	0.27256	1.68	5.42	1.72	0.24424	Speract/scavenger receptor (2);Speract/scavenger receptor-related (1);	0.460627	0.24625	N	0.036927	T	0.20373	0.0490	L	0.60455	1.87	0.34294	D	0.683583	B	0.25351	0.124	B	0.27500	0.08	T	0.12785	-1.0534	9	.	.	.	.	3.245	0.06794	0.138:0.0766:0.1442:0.6411	.	769	P98073	ENTK_HUMAN	L	769	ENSP00000284885:H769L	.	H	-	2	0	TMPRSS15	18588796	0.047000	0.20315	0.863000	0.33907	0.123000	0.20343	0.043000	0.13971	0.137000	0.18759	-1.204000	0.01649	CAT	.	.		0.289	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
LTN1	26046	hgsc.bcm.edu	37	21	30341864	30341864	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr21:30341864A>C	ENST00000361371.5	-	9	1314	c.1235T>G	c.(1234-1236)tTt>tGt	p.F412C	LTN1_ENST00000389194.2_Missense_Mutation_p.F458C|LTN1_ENST00000389195.2_Missense_Mutation_p.F458C			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	412					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						GCATTCAAAAAAAGCAGATAT	0.353																																					p.F458C		Atlas-SNP	.											.	LTN1	141	.	0			c.T1373G						.						96.0	96.0	96.0					21																	30341864		2202	4300	6502	SO:0001583	missense	26046	exon9			TCAAAAAAAGCAG	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1235T>G	chr21.hg19:g.30341864A>C	ENSP00000354977:p.Phe412Cys	71.0	0.0		81.0	18.0	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	hg19		.	.	.	.	.	.	.	.	.	.	A	16.13	3.034638	0.54896	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000446611;ENST00000389195	T;T;T	0.65178	3.61;3.61;-0.14	4.91	3.76	0.43208	Armadillo-type fold (1);	0.195954	0.45867	D	0.000322	T	0.64461	0.2600	L	0.42245	1.32	0.41031	D	0.98515	D	0.71674	0.998	P	0.57324	0.818	T	0.65573	-0.6135	10	0.62326	D	0.03	.	8.5886	0.33672	0.911:0.0:0.089:0.0	.	412	O94822	LTN1_HUMAN	C	458;412;414;458	ENSP00000373846:F458C;ENSP00000354977:F412C;ENSP00000373847:F458C	ENSP00000354977:F412C	F	-	2	0	LTN1	29263735	1.000000	0.71417	0.999000	0.59377	0.556000	0.35491	5.623000	0.67757	1.013000	0.39391	-0.256000	0.11100	TTT	.	.		0.353	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
SEZ6L	23544	hgsc.bcm.edu	37	22	26707784	26707784	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr22:26707784A>T	ENST00000248933.6	+	8	1827	c.1732A>T	c.(1732-1734)Act>Tct	p.T578S	SEZ6L_ENST00000343706.4_Missense_Mutation_p.T578S|SEZ6L_ENST00000529632.2_Missense_Mutation_p.T578S|SEZ6L_ENST00000360929.3_Missense_Mutation_p.T578S|SEZ6L_ENST00000404234.3_Missense_Mutation_p.T578S|SEZ6L_ENST00000403121.1_Missense_Mutation_p.T351S|SEZ6L_ENST00000402979.1_Missense_Mutation_p.T351S			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	578	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TGGGAACTTCACTACATCCGA	0.552																																					p.T578S		Atlas-SNP	.											.	SEZ6L	174	.	0			c.A1732T						.						222.0	212.0	216.0					22																	26707784		2203	4300	6503	SO:0001583	missense	23544	exon8			AACTTCACTACAT	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1732A>T	chr22.hg19:g.26707784A>T	ENSP00000248933:p.Thr578Ser	130.0	0.0		120.0	33.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	hg19	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	A	10.42	1.345602	0.24426	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	4.83	3.77	0.43336	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000019	T	0.48909	0.1526	N	0.16201	0.385	0.80722	D	1	P;P;B;P;P;P;P	0.52170	0.951;0.624;0.128;0.791;0.812;0.624;0.624	P;B;B;B;P;B;B	0.50754	0.649;0.329;0.099;0.332;0.481;0.329;0.329	T	0.32877	-0.9890	10	0.13853	T	0.58	.	10.1055	0.42530	0.85:0.0:0.0:0.15	.	578;578;351;578;578;578;578	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	S	578;578;578;578;578;351;351	ENSP00000384772:T578S;ENSP00000437037:T578S;ENSP00000354185:T578S;ENSP00000248933:T578S;ENSP00000342661:T578S;ENSP00000384838:T351S;ENSP00000384733:T351S	ENSP00000248933:T578S	T	+	1	0	SEZ6L	25037784	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	5.400000	0.66320	0.825000	0.34637	0.460000	0.39030	ACT	.	.		0.552	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SLC5A1	6523	hgsc.bcm.edu	37	22	32480985	32480985	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr22:32480985G>A	ENST00000266088.4	+	9	1234	c.984G>A	c.(982-984)atG>atA	p.M328I	SLC5A1_ENST00000543737.1_Missense_Mutation_p.M201I	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	328					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	TGTTCATCATGGTGATGCCAG	0.488																																					p.M328I		Atlas-SNP	.											.	SLC5A1	80	.	0			c.G984A						.						192.0	157.0	169.0					22																	32480985		2203	4300	6503	SO:0001583	missense	6523	exon9			CATCATGGTGATG		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.984G>A	chr22.hg19:g.32480985G>A	ENSP00000266088:p.Met328Ile	79.0	0.0		94.0	20.0	NM_000343	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	hg19	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	G	3.998	-0.003210	0.07773	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.86769	-2.17;-2.17	4.92	-2.79	0.05841	.	0.119935	0.85682	N	0.000000	T	0.70360	0.3215	L	0.31578	0.945	0.46654	D	0.999147	B	0.10296	0.003	B	0.17722	0.019	T	0.47560	-0.9108	10	0.13108	T	0.6	.	2.1713	0.03850	0.376:0.1174:0.3866:0.12	.	328	P13866	SC5A1_HUMAN	I	328;201	ENSP00000266088:M328I;ENSP00000444898:M201I	ENSP00000266088:M328I	M	+	3	0	SLC5A1	30810985	1.000000	0.71417	0.896000	0.35187	0.033000	0.12548	2.773000	0.47686	-0.590000	0.05866	-1.057000	0.02308	ATG	.	.		0.488	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343	
FAM227A	646851	hgsc.bcm.edu	37	22	39016298	39016298	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr22:39016298T>A	ENST00000535113.1	-	11	1562		c.e11-2		FAM227A_ENST00000406767.2_Splice_Site|FAM227A_ENST00000540952.1_Splice_Site|FAM227A_ENST00000355830.6_Splice_Site	NM_001013647.1	NP_001013669.1	F5H4B4	F227A_HUMAN	family with sequence similarity 227, member A																		ACTCTCTCCCTATAGAAGGGG	0.498																																					.		Atlas-SNP	.											.	.	.	.	0			c.959-2A>T						.						88.0	82.0	84.0					22																	39016298		692	1591	2283	SO:0001630	splice_region_variant	646851	exon12			TCTCCCTATAGAA			22q13.1	2012-07-04			ENSG00000184949	ENSG00000184949			44197	protein-coding gene	gene with protein product							Standard	NM_001013647		Approved		uc011anw.1	F5H4B4	OTTHUMG00000151133	ENST00000535113.1:c.959-2A>T	chr22.hg19:g.39016298T>A		53.0	0.0		69.0	13.0	NM_001013647	B0QY52|B7Z7C6|Q5TG08	Splice_Site	SNP	ENST00000535113.1	hg19		.	.	.	.	.	.	.	.	.	.	T	8.774	0.926571	0.18056	.	.	ENSG00000184949	ENST00000535113;ENST00000355830;ENST00000406767;ENST00000466655	.	.	.	3.12	3.12	0.35913	.	.	.	.	.	.	.	.	.	.	.	0.42584	D	0.993228	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0299	0.30459	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP1-199H16.5	37346244	0.616000	0.27035	0.045000	0.18777	0.002000	0.02628	2.790000	0.47821	1.677000	0.50941	0.533000	0.62120	.	.	.		0.498	FAM227A-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013647	Intron
TOMM22	56993	hgsc.bcm.edu	37	22	39078326	39078326	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr22:39078326A>T	ENST00000216034.4	+	2	148		c.e2-1		RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000412067.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA	NM_020243.4	NP_064628.1	Q9NS69	TOM22_HUMAN	translocase of outer mitochondrial membrane 22 homolog (yeast)						cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			large_intestine(1)|lung(2)	3	Melanoma(58;0.04)					ACTCCACCACAGCTAGATGAG	0.627																																					.		Atlas-SNP	.											.	TOMM22	10	.	0			c.118-2A>T						.						35.0	37.0	37.0					22																	39078326		2203	4300	6503	SO:0001630	splice_region_variant	56993	exon2			CACCACAGCTAGA	AB040119	CCDS13975.1	22q12-q13	2010-07-29			ENSG00000100216	ENSG00000100216			18002	protein-coding gene	gene with protein product		607046				10982837, 10900208	Standard	NM_020243		Approved	TOM22	uc003awe.3	Q9NS69	OTTHUMG00000150991	ENST00000216034.4:c.118-1A>T	chr22.hg19:g.39078326A>T		74.0	0.0		57.0	13.0	NM_020243		Splice_Site	SNP	ENST00000216034.4	hg19	CCDS13975.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.476747	0.84640	.	.	ENSG00000100216	ENST00000216034	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4157	0.74966	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TOMM22	37408272	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	8.367000	0.90113	2.037000	0.60232	0.460000	0.39030	.	.	.		0.627	TOMM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320842.1		Intron
TNRC6B	23112	hgsc.bcm.edu	37	22	40708618	40708618	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr22:40708618A>T	ENST00000454349.2	+	18	4756	c.4545A>T	c.(4543-4545)gtA>gtT	p.V1515V	TNRC6B_ENST00000402203.1_Silent_p.V711V|TNRC6B_ENST00000301923.9_Silent_p.V711V|TNRC6B_ENST00000335727.9_Silent_p.V1405V	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1515	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						CTCCCATTGTAGATACTGACC	0.483																																					p.V1515V		Atlas-SNP	.											.	TNRC6B	195	.	0			c.A4545T						.						155.0	149.0	151.0					22																	40708618		2020	4188	6208	SO:0001819	synonymous_variant	23112	exon18			CATTGTAGATACT	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4545A>T	chr22.hg19:g.40708618A>T		68.0	0.0		82.0	18.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Silent	SNP	ENST00000454349.2	hg19	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	A	10.49	1.365661	0.24684	.	.	ENSG00000100354	ENST00000446273	.	.	.	5.01	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.9606	11.8066	0.52158	0.8406:0.1594:0.0:0.0	.	.	.	.	L	1201	.	.	X	+	2	0	TNRC6B	39038564	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.314000	0.43743	0.758000	0.33059	-0.331000	0.08364	TAG	.	.		0.483	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
CLCN4	1183	hgsc.bcm.edu	37	X	10166045	10166045	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:10166045G>C	ENST00000380833.4	+	6	890	c.499G>C	c.(499-501)Gct>Cct	p.A167P	CLCN4_ENST00000421085.2_Missense_Mutation_p.A73P|CLCN4_ENST00000380829.1_Missense_Mutation_p.A167P	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	167					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TGCATTTTTGGCTGTCTCCCT	0.433																																					p.A167P	Melanoma(74;1050 1296 1576 30544 38374)	Atlas-SNP	.											.	CLCN4	84	.	0			c.G499C						.						289.0	238.0	255.0					X																	10166045		2203	4300	6503	SO:0001583	missense	1183	exon6			TTTTTGGCTGTCT	X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.499G>C	chrX.hg19:g.10166045G>C	ENSP00000370213:p.Ala167Pro	99.0	0.0		141.0	34.0	NM_001830	A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation	SNP	ENST00000380833.4	hg19	CCDS14137.1	.	.	.	.	.	.	.	.	.	.	G	32	5.143757	0.94603	.	.	ENSG00000073464	ENST00000380833;ENST00000380829;ENST00000421085	D;D;D	0.95412	-3.7;-3.7;-3.7	5.4	5.4	0.78164	Chloride channel, core (2);	0.101975	0.64402	D	0.000003	D	0.98353	0.9453	M	0.93808	3.46	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.99643	1.0989	10	0.87932	D	0	-20.2161	17.8837	0.88848	0.0:0.0:1.0:0.0	.	167	P51793	CLCN4_HUMAN	P	167;167;73	ENSP00000370213:A167P;ENSP00000370209:A167P;ENSP00000405754:A73P	ENSP00000370209:A167P	A	+	1	0	CLCN4	10126045	1.000000	0.71417	0.528000	0.27938	0.981000	0.71138	9.667000	0.98616	2.264000	0.75181	0.544000	0.68410	GCT	.	.		0.433	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055730.1		
FRMPD4	9758	hgsc.bcm.edu	37	X	12735864	12735864	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:12735864T>A	ENST00000380682.1	+	16	3425	c.2919T>A	c.(2917-2919)gcT>gcA	p.A973A		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	973					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CCCTGGCTGCTAGGCCAGCAA	0.602																																					p.A973A		Atlas-SNP	.											.	FRMPD4	214	.	0			c.T2919A						.						57.0	58.0	58.0					X																	12735864		2203	4300	6503	SO:0001819	synonymous_variant	9758	exon16			GGCTGCTAGGCCA	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2919T>A	chrX.hg19:g.12735864T>A		204.0	0.0		234.0	65.0	NM_014728	A8K0X9|O15032	Silent	SNP	ENST00000380682.1	hg19	CCDS35201.1																																																																																			.	.		0.602	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
CDKL5	6792	hgsc.bcm.edu	37	X	18606148	18606148	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:18606148T>C	ENST00000379989.3	+	10	914	c.629T>C	c.(628-630)tTa>tCa	p.L210S	CDKL5_ENST00000379996.3_Missense_Mutation_p.L210S	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	210	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GGACAGCCTTTATTTCCTGGA	0.443																																					p.L210S		Atlas-SNP	.											.	CDKL5	124	.	0			c.T629C						.						222.0	217.0	219.0					X																	18606148		2203	4300	6503	SO:0001583	missense	6792	exon9			AGCCTTTATTTCC	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.629T>C	chrX.hg19:g.18606148T>C	ENSP00000369325:p.Leu210Ser	187.0	0.0		225.0	53.0	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	hg19	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620277	0.87460	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.67171	-0.25;-0.25	6.1	6.1	0.99115	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86347	0.5911	M	0.93939	3.475	0.53005	D	0.999963	D	0.76494	0.999	D	0.77557	0.99	D	0.89845	0.4005	10	0.87932	D	0	-12.2514	15.5648	0.76281	0.0:0.0:0.0:1.0	.	210	O76039	CDKL5_HUMAN	S	210	ENSP00000369332:L210S;ENSP00000369325:L210S	ENSP00000369325:L210S	L	+	2	0	CDKL5	18516069	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.695000	0.84257	2.060000	0.61445	0.481000	0.45027	TTA	.	.		0.443	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
MAGEB3	4114	hgsc.bcm.edu	37	X	30254845	30254845	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:30254845T>A	ENST00000361644.2	+	5	1541	c.804T>A	c.(802-804)ccT>ccA	p.P268P		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	268	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						ACAGTAATCCTGCACGCTATG	0.488																																					p.P268P		Atlas-SNP	.											.	MAGEB3	54	.	0			c.T804A						.						86.0	74.0	78.0					X																	30254845		2202	4300	6502	SO:0001819	synonymous_variant	4114	exon5			TAATCCTGCACGC	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.804T>A	chrX.hg19:g.30254845T>A		252.0	0.0		346.0	84.0	NM_002365	A0AVE4|B3KQ52|O75861	Silent	SNP	ENST00000361644.2	hg19	CCDS14220.1																																																																																			.	.		0.488	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365	
CXorf30	645090	hgsc.bcm.edu	37	X	36379611	36379611	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:36379611A>T	ENST00000378657.4	+	15	2004	c.1356A>T	c.(1354-1356)ccA>ccT	p.P452P		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	452										breast(1)|lung(2)|stomach(1)	4						CAAAGAAACCATTAAGGTAAA	0.249																																					p.P452P		Atlas-SNP	.											.	CXorf30	76	.	0			c.A1356T						.						35.0	27.0	29.0					X																	36379611		691	1565	2256	SO:0001819	synonymous_variant	645090	exon16			GAAACCATTAAGG		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.1356A>T	chrX.hg19:g.36379611A>T		531.0	0.0		624.0	132.0	NM_001098843		Silent	SNP	ENST00000378657.4	hg19	CCDS55396.1																																																																																			.	.		0.249	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NP_001092313	
PRRG1	5638	hgsc.bcm.edu	37	X	37285109	37285109	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:37285109A>G	ENST00000542554.1	+	4	299	c.27A>G	c.(25-27)gaA>gaG	p.E9E	PRRG1_ENST00000463135.1_Silent_p.E9E|PRRG1_ENST00000378628.4_Silent_p.E9E|TM4SF2_ENST00000465127.1_Silent_p.E9E|PRRG1_ENST00000449135.2_Silent_p.E9E|PRRG1_ENST00000543642.1_Silent_p.E9E|PRRG1_ENST00000491253.1_Intron	NM_001173489.1	NP_001166960.1	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	9						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	15						TCACGGGAGAAAAAGCCAATT	0.348																																					p.E9E		Atlas-SNP	.											.	PRRG1	42	.	0			c.A27G						.						45.0	44.0	44.0					X																	37285109		2202	4300	6502	SO:0001819	synonymous_variant	5638	exon3			GGGAGAAAAAGCC	AF009242	CCDS14239.1, CCDS55397.1	Xp21.1	2010-08-13	2004-05-27		ENSG00000130962	ENSG00000130962			9469	protein-coding gene	gene with protein product		604428	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 1"""			9256434	Standard	NM_000950		Approved	PRGP1	uc004ddo.3	O14668	OTTHUMG00000021360	ENST00000542554.1:c.27A>G	chrX.hg19:g.37285109A>G		549.0	0.0		677.0	151.0	NM_001173490	B2R7A3|C9JXL7|D3DWA9|Q5JT66	Silent	SNP	ENST00000542554.1	hg19	CCDS14239.1																																																																																			.	.		0.348	PRRG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056228.2	NM_000950	
RPGR	6103	hgsc.bcm.edu	37	X	38145017	38145017	+	Intron	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:38145017T>A	ENST00000339363.3	-	14	2688				TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.R1079W|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CCATCCTGCCTTTCATTCTCT	0.413																																					p.R1079W		Atlas-SNP	.											.	RPGR	175	.	0			c.A3235T						.						409.0	328.0	355.0					X																	38145017		2202	4300	6502	SO:0001627	intron_variant	6103	exon15			CCTGCCTTTCATT	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1329A>T	chrX.hg19:g.38145017T>A		86.0	0.0		115.0	20.0	NM_001034853	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	hg19		.	.	.	.	.	.	.	.	.	.	t	10.73	1.432423	0.25813	.	.	ENSG00000156313	ENST00000378505	T	0.02579	4.24	2.84	0.237	0.15475	.	1.292120	0.05640	U	0.583284	T	0.04815	0.0130	L	0.48642	1.525	0.34659	D	0.722529	D	0.62365	0.991	P	0.46389	0.515	T	0.46679	-0.9174	10	0.87932	D	0	.	5.9165	0.19057	0.0:0.3952:0.0:0.6048	.	1079	E9PE28	.	W	1079	ENSP00000367766:R1079W	ENSP00000367766:R1079W	R	-	1	2	RPGR	38029961	0.005000	0.15991	0.023000	0.16930	0.544000	0.35116	0.950000	0.29122	0.147000	0.19030	0.278000	0.19347	AGG	.	.		0.413	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
MAOB	4129	hgsc.bcm.edu	37	X	43656381	43656381	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:43656381A>T	ENST00000378069.4	-	6	756	c.609T>A	c.(607-609)aaT>aaA	p.N203K	MAOB_ENST00000538942.1_Missense_Mutation_p.N187K|MAOB_ENST00000536181.1_Missense_Mutation_p.N187K|MAOB_ENST00000487544.1_5'Flank	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	203					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	CCTGTCCTCCATTTGTTGTCG	0.473																																					p.N203K		Atlas-SNP	.											.	MAOB	52	.	0			c.T609A						.						127.0	112.0	117.0					X																	43656381		2203	4300	6503	SO:0001583	missense	4129	exon6			TCCTCCATTTGTT		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.609T>A	chrX.hg19:g.43656381A>T	ENSP00000367309:p.Asn203Lys	68.0	0.0		88.0	22.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.570033	0.45798	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	D;D;D	0.92397	-3.03;-3.03;-3.03	5.45	4.3	0.51218	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.95294	0.8473	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.85130	0.778;0.997	D	0.93049	0.6464	10	0.23891	T	0.37	-19.6609	9.2353	0.37461	0.8459:0.0:0.1541:0.0	.	187;203	B7Z5H3;P27338	.;AOFB_HUMAN	K	203;187;187	ENSP00000367309:N203K;ENSP00000441613:N187K;ENSP00000442240:N187K	ENSP00000367309:N203K	N	-	3	2	MAOB	43541325	1.000000	0.71417	1.000000	0.80357	0.271000	0.26615	1.002000	0.29796	0.726000	0.32339	0.441000	0.28932	AAT	.	.		0.473	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
SSX1	6756	hgsc.bcm.edu	37	X	48123234	48123234	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:48123234A>T	ENST00000376919.3	+	6	484	c.348A>T	c.(346-348)ccA>ccT	p.P116P		NM_001278691.1|NM_005635.2	NP_001265620.1|NP_005626.1	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		SS18/SSX1(1169)|SS18L1/SSX1(2)	endometrium(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9						CCAAGAAGCCAGCAGAGGACG	0.428			T	SS18	synovial sarcoma																																p.P116P	Esophageal Squamous(175;994 1982 2214 6527 18857)	Atlas-SNP	.		Dom	yes		X	Xp11.23-p11.22	6756	"""synovial sarcoma, X breakpoint 1"""		M	.	SSX1	27	.	0			c.A348T						.						182.0	173.0	176.0					X																	48123234		2203	4299	6502	SO:0001819	synonymous_variant	6756	exon6			GAAGCCAGCAGAG	BC001003	CCDS14290.1	Xp11.23	2009-03-12			ENSG00000126752	ENSG00000126752			11335	protein-coding gene	gene with protein product	"""cancer/testis antigen family 5, member 1"""	312820				7655467	Standard	NM_005635		Approved	CT5.1	uc004djb.1	Q16384	OTTHUMG00000021488	ENST00000376919.3:c.348A>T	chrX.hg19:g.48123234A>T		444.0	0.0		518.0	110.0	NM_005635	A3KN76|Q08AJ2|Q5JQ64	Silent	SNP	ENST00000376919.3	hg19	CCDS14290.1																																																																																			.	.		0.428	SSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056485.1	NM_005635	
HUWE1	10075	hgsc.bcm.edu	37	X	53619443	53619443	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:53619443T>A	ENST00000342160.3	-	32	4344	c.3887A>T	c.(3886-3888)gAg>gTg	p.E1296V	HUWE1_ENST00000262854.6_Missense_Mutation_p.E1296V|HUWE1_ENST00000218328.8_Missense_Mutation_p.E1296V			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1296					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCGAGACCCCTCCTTCTCCTT	0.542																																					p.E1296V		Atlas-SNP	.											.	HUWE1	724	.	0			c.A3887T						.						236.0	186.0	203.0					X																	53619443		2203	4300	6503	SO:0001583	missense	10075	exon33			GACCCCTCCTTCT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3887A>T	chrX.hg19:g.53619443T>A	ENSP00000340648:p.Glu1296Val	66.0	0.0		62.0	12.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.171325	0.57584	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.49720	1.11;1.11;0.77	5.88	5.88	0.94601	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.37376	0.1001	L	0.28115	0.83	0.80722	D	1	B;B	0.29432	0.192;0.244	B;B	0.28991	0.061;0.097	T	0.21042	-1.0257	10	0.45353	T	0.12	.	14.1505	0.65381	0.0:0.0:0.0:1.0	.	1296;1296	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	V	1296	ENSP00000340648:E1296V;ENSP00000262854:E1296V;ENSP00000218328:E1296V	ENSP00000218328:E1296V	E	-	2	0	HUWE1	53636168	1.000000	0.71417	0.996000	0.52242	0.811000	0.45836	7.286000	0.78671	1.987000	0.57996	0.486000	0.48141	GAG	.	.		0.542	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
TRO	7216	hgsc.bcm.edu	37	X	54956640	54956640	+	Silent	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:54956640T>C	ENST00000173898.7	+	12	3595	c.3483T>C	c.(3481-3483)agT>agC	p.S1161S	TRO_ENST00000399736.1_Intron|TRO_ENST00000319167.8_Intron|TRO_ENST00000375022.4_Intron|TRO_ENST00000375041.2_Silent_p.S764S|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000420798.2_Silent_p.S692S	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1161	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GCTTTGGCAGTGCATCTAATA	0.552																																					p.S1161S		Atlas-SNP	.											.	TRO	246	.	0			c.T3483C						.						78.0	76.0	76.0					X																	54956640		2012	4166	6178	SO:0001819	synonymous_variant	7216	exon12			TGGCAGTGCATCT	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3483T>C	chrX.hg19:g.54956640T>C		101.0	0.0		93.0	28.0	NM_001039705	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	hg19	CCDS43959.1																																																																																			.	.		0.552	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
TEX11	56159	hgsc.bcm.edu	37	X	69749740	69749740	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:69749740A>C	ENST00000395889.2	-	30	2830	c.2675T>G	c.(2674-2676)cTg>cGg	p.L892R	TEX11_ENST00000374320.2_Missense_Mutation_p.L567R|TEX11_ENST00000374333.2_Missense_Mutation_p.L877R|TEX11_ENST00000344304.3_Missense_Mutation_p.L892R	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	892					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					ACGCAAGGCCAGGCCACACCA	0.502																																					p.L892R		Atlas-SNP	.											.	TEX11	132	.	0			c.T2675G						.						125.0	90.0	102.0					X																	69749740		2203	4300	6503	SO:0001583	missense	56159	exon30			AAGGCCAGGCCAC	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2675T>G	chrX.hg19:g.69749740A>C	ENSP00000379226:p.Leu892Arg	76.0	0.0		89.0	18.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	A	11.92	1.782625	0.31502	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.52057	1.28;1.29;0.68;1.29	4.33	4.33	0.51752	.	0.103897	0.38959	U	0.001513	T	0.58963	0.2159	L	0.52573	1.65	0.09310	N	1	D;D	0.71674	0.998;0.997	D;D	0.73708	0.981;0.957	T	0.49872	-0.8893	9	.	.	.	-1.0835	10.4751	0.44659	1.0:0.0:0.0:0.0	.	877;892	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	R	877;892;567;892	ENSP00000363453:L877R;ENSP00000379226:L892R;ENSP00000363440:L567R;ENSP00000340995:L892R	.	L	-	2	0	TEX11	69666465	0.994000	0.37717	0.001000	0.08648	0.156000	0.22039	7.469000	0.80959	1.592000	0.50018	0.407000	0.27541	CTG	.	.		0.502	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
TEX11	56159	hgsc.bcm.edu	37	X	69964041	69964041	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:69964041T>C	ENST00000395889.2	-	11	921	c.766A>G	c.(766-768)Aag>Gag	p.K256E	TEX11_ENST00000374333.2_Missense_Mutation_p.K241E|TEX11_ENST00000344304.3_Missense_Mutation_p.K256E	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	256					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GTAGATTTCTTATCCATCTTC	0.234																																					p.K256E		Atlas-SNP	.											.	TEX11	132	.	0			c.A766G						.						45.0	39.0	41.0					X																	69964041		2203	4289	6492	SO:0001583	missense	56159	exon11			ATTTCTTATCCAT	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.766A>G	chrX.hg19:g.69964041T>C	ENSP00000379226:p.Lys256Glu	454.0	0.0		627.0	121.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	T	14.30	2.495590	0.44352	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.62498	0.02;0.02;0.02	3.66	-0.173	0.13322	Tetratricopeptide-like helical (1);	0.486384	0.20341	N	0.094226	T	0.51975	0.1706	L	0.40543	1.245	0.09310	N	1	P;P	0.48089	0.884;0.905	B;P	0.47941	0.426;0.562	T	0.45848	-0.9233	9	.	.	.	0.1503	5.9338	0.19154	0.0:0.3521:0.0:0.6479	.	241;256	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	E	241;256;256	ENSP00000363453:K241E;ENSP00000379226:K256E;ENSP00000340995:K256E	.	K	-	1	0	TEX11	69880766	0.790000	0.28787	0.006000	0.13384	0.395000	0.30598	1.087000	0.30865	-0.331000	0.08501	-0.456000	0.05471	AAG	.	.		0.234	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
IL2RG	3561	hgsc.bcm.edu	37	X	70330769	70330769	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:70330769T>A	ENST00000374202.2	-	2	338	c.247A>T	c.(247-249)Acc>Tcc	p.T83S	IL2RG_ENST00000456850.2_Intron|IL2RG_ENST00000374188.3_5'Flank	NM_000206.2	NP_000197.1	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma	83					immune response (GO:0006955)|interleukin-2-mediated signaling pathway (GO:0038110)|interleukin-4-mediated signaling pathway (GO:0035771)|interleukin-7-mediated signaling pathway (GO:0038111)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|interleukin-2 binding (GO:0019976)			breast(1)|endometrium(3)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	15	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	GTGAGGTTGGTAGGCTGGGGC	0.522									Severe Combined Immunodeficiency, X-linked																												p.T83S		Atlas-SNP	.											.	IL2RG	96	.	0			c.A247T						.						75.0	55.0	62.0					X																	70330769		2203	4300	6503	SO:0001583	missense	3561	exon2	Familial Cancer Database	Agammaglobulinemia, Swiss Type	GGTTGGTAGGCTG	D11086	CCDS14406.1	Xq13	2014-09-17	2010-06-24		ENSG00000147168	ENSG00000147168		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6010	protein-coding gene	gene with protein product		308380	"""severe combined immunodeficiency"", ""combined immunodeficiency, X-linked"""	SCIDX1, IMD4, CIDX		1631559, 7883965	Standard	NM_000206		Approved	CD132	uc004dyw.2	P31785	OTTHUMG00000021787	ENST00000374202.2:c.247A>T	chrX.hg19:g.70330769T>A	ENSP00000363318:p.Thr83Ser	149.0	0.0		171.0	42.0	NM_000206	Q5FC12	Missense_Mutation	SNP	ENST00000374202.2	hg19	CCDS14406.1	.	.	.	.	.	.	.	.	.	.	T	13.47	2.247801	0.39697	.	.	ENSG00000147168	ENST00000374202;ENST00000374191;ENST00000464642;ENST00000487883;ENST00000473378	D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.6	5.43	5.43	0.79202	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.597865	0.18482	N	0.139913	D	0.95815	0.8638	M	0.69823	2.125	0.80722	D	1	B	0.22080	0.064	B	0.21917	0.037	D	0.92475	0.5988	10	0.30078	T	0.28	-2.9811	6.3582	0.21412	0.0:0.1111:0.0:0.8889	.	83	P31785	IL2RG_HUMAN	S	83;83;39;71;62	ENSP00000363318:T83S;ENSP00000425233:T39S;ENSP00000423966:T71S;ENSP00000423601:T62S	ENSP00000363306:T83S	T	-	1	0	IL2RG	70247494	0.975000	0.34042	0.998000	0.56505	0.866000	0.49608	1.836000	0.39191	2.006000	0.58801	0.486000	0.48141	ACC	.	.		0.522	IL2RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057102.2		
CXCR3	2833	hgsc.bcm.edu	37	X	70836820	70836820	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:70836820C>T	ENST00000373693.3	-	2	569	c.502G>A	c.(502-504)Gtg>Atg	p.V168M	CXCR3_ENST00000373691.4_Missense_Mutation_p.V215M	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	168					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					GTGAGGGTCAcgcgggccggg	0.657																																					p.V215M		Atlas-SNP	.											.	CXCR3	57	.	0			c.G643A						.						25.0	27.0	27.0					X																	70836820		2192	4287	6479	SO:0001583	missense	2833	exon2			GGGTCACGCGGGC	U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.502G>A	chrX.hg19:g.70836820C>T	ENSP00000362797:p.Val168Met	248.0	0.0		254.0	61.0	NM_001142797	B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	ENST00000373693.3	hg19	CCDS14416.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926058	0.34002	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.39056	1.1;1.1	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.071575	0.53938	D	0.000045	T	0.54481	0.1861	L	0.46947	1.48	0.37781	D	0.927028	D;D	0.89917	1.0;1.0	D;D	0.83275	0.962;0.996	T	0.57940	-0.7724	10	0.46703	T	0.11	.	10.2579	0.43408	0.1966:0.8034:0.0:0.0	.	215;168	P49682-2;P49682	.;CXCR3_HUMAN	M	215;168;168	ENSP00000362795:V215M;ENSP00000362797:V168M	ENSP00000362791:V168M	V	-	1	0	CXCR3	70753545	0.000000	0.05858	0.653000	0.29593	0.010000	0.07245	0.235000	0.17948	2.472000	0.83506	0.538000	0.68166	GTG	.	.		0.657	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144141.1		
PCDH11X	27328	hgsc.bcm.edu	37	X	91132904	91132904	+	Silent	SNP	A	A	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:91132904A>T	ENST00000373094.1	+	2	2510	c.1665A>T	c.(1663-1665)acA>acT	p.T555T	PCDH11X_ENST00000504220.2_Silent_p.T555T|PCDH11X_ENST00000406881.1_Silent_p.T555T|PCDH11X_ENST00000395337.2_Silent_p.T555T|PCDH11X_ENST00000373097.1_Silent_p.T555T|PCDH11X_ENST00000361655.2_Silent_p.T555T|PCDH11X_ENST00000298274.8_Silent_p.T555T|PCDH11X_ENST00000361724.1_Silent_p.T555T|PCDH11X_ENST00000373088.1_Silent_p.T555T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	555	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GCAATGTCACAGTCTTTGTAA	0.378																																					p.T555T	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.A1665T						.						81.0	78.0	79.0					X																	91132904		2202	4298	6500	SO:0001819	synonymous_variant	27328	exon2			TGTCACAGTCTTT	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1665A>T	chrX.hg19:g.91132904A>T		268.0	0.0		324.0	86.0	NM_001168363	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	hg19	CCDS14461.1																																																																																			.	.		0.378	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
DCX	1641	hgsc.bcm.edu	37	X	110644314	110644314	+	Silent	SNP	T	T	A			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:110644314T>A	ENST00000338081.3	-	3	1023	c.852A>T	c.(850-852)acA>acT	p.T284T	DCX_ENST00000356915.2_Silent_p.T203T|DCX_ENST00000488120.1_Silent_p.T203T|DCX_ENST00000356220.3_Silent_p.T203T|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Silent_p.T203T	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	284	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.		T -> A (in SBHX). {ECO:0000269|PubMed:11175293}.|T -> R (in LISX1 and SBHX). {ECO:0000269|PubMed:11175293, ECO:0000269|PubMed:9489700}.		axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						AAGAGTGGGCTGTCTTCTTGT	0.517																																					p.T284T		Atlas-SNP	.											.	DCX	158	.	0			c.A852T						.						124.0	112.0	116.0					X																	110644314		2203	4300	6503	SO:0001819	synonymous_variant	1641	exon3			GTGGGCTGTCTTC	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.852A>T	chrX.hg19:g.110644314T>A		114.0	0.0		137.0	28.0	NM_000555	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Silent	SNP	ENST00000338081.3	hg19	CCDS14556.1	.	.	.	.	.	.	.	.	.	.	T	10.30	1.311170	0.23821	.	.	ENSG00000077279	ENST00000358070	.	.	.	4.74	-2.91	0.05631	.	.	.	.	.	T	0.36082	0.0954	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33727	-0.9857	4	.	.	.	.	0.0629	0.00016	0.3002:0.2271:0.1777:0.295	.	.	.	.	L	276	.	.	Q	-	2	0	DCX	110530970	0.000000	0.05858	0.989000	0.46669	0.991000	0.79684	-2.222000	0.01215	-0.372000	0.07992	0.486000	0.48141	CAG	.	.		0.517	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153	
ZNF75D	7626	hgsc.bcm.edu	37	X	134425482	134425482	+	Silent	SNP	A	A	G			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:134425482A>G	ENST00000370766.3	-	5	3321	c.612T>C	c.(610-612)caT>caC	p.H204H	ZNF75D_ENST00000370764.1_Intron|ZNF75D_ENST00000494295.1_Intron	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	204					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TCTGTTGATCATGCACAGCTG	0.408																																					p.H204H		Atlas-SNP	.											.	ZNF75D	65	.	0			c.T612C						.						110.0	86.0	94.0					X																	134425482		2203	4300	6503	SO:0001819	synonymous_variant	7626	exon4			TTGATCATGCACA	S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.612T>C	chrX.hg19:g.134425482A>G		133.0	0.0		180.0	45.0	NM_007131	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Silent	SNP	ENST00000370766.3	hg19	CCDS14648.1																																																																																			.	.		0.408	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058415.1	NM_007131	
PLXNB3	5365	hgsc.bcm.edu	37	X	153042749	153042749	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrX:153042749G>T	ENST00000361971.5	+	30	5128	c.5014G>T	c.(5014-5016)Gtg>Ttg	p.V1672L	SRPK3_ENST00000489426.1_5'UTR|PLXNB3_ENST00000538776.1_Missense_Mutation_p.V1325L|PLXNB3_ENST00000538966.1_Missense_Mutation_p.V1695L|PLXNB3_ENST00000485980.1_3'UTR	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1672					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGCCAAGGTGCGGTGCAG	0.657																																					p.V1695L		Atlas-SNP	.											.	PLXNB3	208	.	0			c.G5083T						.						38.0	26.0	30.0					X																	153042749		2191	4292	6483	SO:0001583	missense	5365	exon31			GCCAAGGTGCGGT	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.5014G>T	chrX.hg19:g.153042749G>T	ENSP00000355378:p.Val1672Leu	110.0	0.0		156.0	29.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	hg19	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	7.481	0.648744	0.14516	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776	T;T;T	0.11277	2.79;2.79;2.79	4.99	4.12	0.48240	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.552403	0.20624	N	0.088718	T	0.05823	0.0152	N	0.08118	0	0.80722	D	1	B;B;B	0.20368	0.044;0.035;0.044	B;B;B	0.29524	0.065;0.062;0.103	T	0.37911	-0.9685	10	0.28530	T	0.3	.	6.7321	0.23388	0.1189:0.4766:0.4045:0.0	.	1325;1695;1672	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	L	1695;1672;1325	ENSP00000442736:V1695L;ENSP00000355378:V1672L;ENSP00000445569:V1325L	ENSP00000355378:V1672L	V	+	1	0	PLXNB3	152695943	1.000000	0.71417	0.043000	0.18650	0.064000	0.16182	3.604000	0.54081	0.995000	0.38917	0.529000	0.55759	GTG	.	.		0.657	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
MT-ND6	4541	hgsc.bcm.edu	37	M	14459	14459	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chrM:14459G>C	ENST00000361681.2	-	1	214	c.215C>G	c.(214-216)gCg>gGg	p.A72G	MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	72			A -> V (in MT-C1D and LDYT; most severe mutation with no vision recovery). {ECO:0000269|PubMed:20818383, ECO:0000269|PubMed:8016139}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CAATAGCCATCGCTGTAGTAT	0.438																																					p.A72G		Atlas-SNP	.											.	.	.	.	0			c.C215G						.																																			SO:0001583	missense	0	exon1			GCCATCGCTGTAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.215C>G	chrM.hg19:g.14459G>C	ENSP00000354665:p.Ala72Gly	26.0	0.0		67.0	7.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.438	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
GRM3	2913	hgsc.bcm.edu	37	7	86394697	86394698	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:86394697_86394698insC	ENST00000361669.2	+	2	1335_1336	c.236_237insC	c.(235-240)atcaacfs	p.N80fs	GRM3_ENST00000536043.1_Intron|GRM3_ENST00000439827.1_Frame_Shift_Ins_p.N80fs|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000394720.2_Frame_Shift_Ins_p.N78fs	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	80					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					ATTGATGAAATCAACAAAGATG	0.426																																					p.I79fs	GBM(52;969 1098 3139 52280)	Atlas-INDEL	.											.	GRM3	237	.	0			c.236_237insC						.																																			SO:0001589	frameshift_variant	2913	exon2			.		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.237dupC	chr7.hg19:g.86394698_86394698dupC	ENSP00000355316:p.Asn80fs	85.0	0.0		118.0	31.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Frame_Shift_Ins	INS	ENST00000361669.2	hg19	CCDS5600.1																																																																																			.	.		0.426	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
NEK11	79858	hgsc.bcm.edu	37	3	130871532	130871543	+	In_Frame_Del	DEL	TTACCTTGATGA	TTACCTTGATGA	-			TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	TTACCTTGATGA	TTACCTTGATGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr3:130871532_130871543delTTACCTTGATGA	ENST00000383366.4	+	9	1148_1159	c.855_866delTTACCTTGATGA	c.(853-867)ccttaccttgatgag>ccg	p.YLDE286del	NEK11_ENST00000429253.2_In_Frame_Del_p.YLDE286del|NEK11_ENST00000356918.4_In_Frame_Del_p.YLDE286del|NEK11_ENST00000510769.1_Intron|NEK11_ENST00000508196.1_In_Frame_Del_p.YLDE286del|NEK11_ENST00000426022.2_3'UTR|NEK11_ENST00000507910.1_In_Frame_Del_p.YLDE286del|NEK11_ENST00000510688.1_In_Frame_Del_p.YLDE286del|NEK11_ENST00000511262.1_In_Frame_Del_p.YLDE286del|NEK11_ENST00000412440.2_In_Frame_Del_p.YLDE138del	NM_024800.4	NP_079076.3			NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						TAAAAATCCCTTACCTTGATGAGCAGCTACAG	0.335																																					p.285_289del		Atlas-INDEL	.											.	NEK11	76	.	0			c.854_865del						.																																			SO:0001651	inframe_deletion	79858	exon9			.	AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000383366.4:c.855_866delTTACCTTGATGA	chr3.hg19:g.130871532_130871543delTTACCTTGATGA	ENSP00000372857:p.Tyr286_Glu289del	173.0	0.0		207.0	28.0	NM_024800		In_Frame_Del	DEL	ENST00000383366.4	hg19	CCDS3069.1																																																																																			.	.		0.335	NEK11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356755.1	NM_024800	
COBL	23242	hgsc.bcm.edu	37	7	51287561	51287562	+	Frame_Shift_Ins	INS	-	-	G	rs368613191		TCGA-DD-AACL-01A-11D-A40R-10	TCGA-DD-AACL-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2b9cdb07-82ec-42bb-9de0-6329a096b64a	799314ef-97a0-4db6-ac6c-f820a0294be9	g.chr7:51287561_51287562insG	ENST00000265136.7	-	2	286_287	c.121_122insC	c.(121-123)cacfs	p.H41fs	COBL_ENST00000395540.2_Frame_Shift_Ins_p.H41fs|COBL_ENST00000441453.1_Frame_Shift_Ins_p.H41fs|COBL_ENST00000395542.2_Frame_Shift_Ins_p.H41fs	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	41					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GGCCCCATCGTGGGGGGGCTTC	0.604																																					p.H41fs	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-INDEL	.											.,1	COBL	167	.	0			c.122_123insC						.																																			SO:0001589	frameshift_variant	23242	exon2			.	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.122dupC	chr7.hg19:g.51287568_51287568dupG	ENSP00000265136:p.His41fs	136.0	0.0		169.0	30.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Frame_Shift_Ins	INS	ENST00000265136.7	hg19	CCDS34637.1																																																																																			.	.		0.604	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
