#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PADI3	51702	hgsc.bcm.edu	37	1	17586148	17586148	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr1:17586148G>A	ENST00000375460.3	+	2	208	c.168G>A	c.(166-168)atG>atA	p.M56I		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	56					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CTCCCAACATGGAGAGGGGCC	0.592																																					p.M56I		Atlas-SNP	.											.	PADI3	81	.	0			c.G168A						.						79.0	77.0	78.0					1																	17586148		2203	4300	6503	SO:0001583	missense	51702	exon2			CAACATGGAGAGG	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.168G>A	chr1.hg19:g.17586148G>A	ENSP00000364609:p.Met56Ile	178.0	0.0		177.0	66.0	NM_016233	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	hg19	CCDS179.1	.	.	.	.	.	.	.	.	.	.	G	1.357	-0.589924	0.03799	.	.	ENSG00000142619	ENST00000375460	T	0.07216	3.21	5.2	3.26	0.37387	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.863636	0.10280	N	0.693602	T	0.06142	0.0159	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.15870	0.014	T	0.45116	-0.9283	10	0.22109	T	0.4	-9.4176	7.5265	0.27658	0.0869:0.3131:0.6:0.0	.	56	Q9ULW8	PADI3_HUMAN	I	56	ENSP00000364609:M56I	ENSP00000364609:M56I	M	+	3	0	PADI3	17458735	0.002000	0.14202	0.224000	0.23877	0.052000	0.14988	1.142000	0.31540	0.536000	0.28733	0.563000	0.77884	ATG	.	.		0.592	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
SF3B4	10262	hgsc.bcm.edu	37	1	149895819	149895819	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr1:149895819G>C	ENST00000271628.8	-	5	1585	c.1001C>G	c.(1000-1002)cCg>cGg	p.P334R		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	334					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TGGTCGGGGCGGTGGCTGGCC	0.612																																					p.P334R		Atlas-SNP	.											.	SF3B4	37	.	0			c.C1001G						.						11.0	13.0	13.0					1																	149895819		2193	4291	6484	SO:0001583	missense	10262	exon5			CGGGGCGGTGGCT	L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1001C>G	chr1.hg19:g.149895819G>C	ENSP00000271628:p.Pro334Arg	206.0	0.0		245.0	67.0	NM_005850	Q5SZ63	Missense_Mutation	SNP	ENST00000271628.8	hg19	CCDS941.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181125	0.38511	.	.	ENSG00000143368	ENST00000271628	T	0.26067	1.76	5.1	5.1	0.69264	.	0.327890	0.35585	N	0.003112	T	0.18882	0.0453	M	0.64997	1.995	0.51482	D	0.999927	P	0.35033	0.481	B	0.32090	0.14	T	0.05162	-1.0902	10	0.66056	D	0.02	.	17.2581	0.87063	0.0:0.0:1.0:0.0	.	334	Q15427	SF3B4_HUMAN	R	334	ENSP00000271628:P334R	ENSP00000271628:P334R	P	-	2	0	SF3B4	148162443	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	8.396000	0.90190	2.653000	0.90120	0.650000	0.86243	CCG	.	.		0.612	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850	
CD247	919	hgsc.bcm.edu	37	1	167407853	167407853	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr1:167407853A>G	ENST00000362089.5	-	4	326	c.254T>C	c.(253-255)gTt>gCt	p.V85A	CD247_ENST00000483825.1_5'UTR|CD247_ENST00000392122.3_Missense_Mutation_p.V85A			P20963	CD3Z_HUMAN	CD247 molecule	85	ITAM 1. {ECO:0000255|PROSITE- ProRule:PRU00379}.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(543;0.236)		Muromonab(DB00075)	CTTGTCCAAAACATCGTACTC	0.552																																					p.V85A	Ovarian(192;1815 2869 36877 43334)	Atlas-SNP	.											.	CD247	25	.	0			c.T254C						.						149.0	141.0	144.0					1																	167407853		2203	4300	6503	SO:0001583	missense	919	exon4			TCCAAAACATCGT	BC025703	CCDS1260.1, CCDS1261.1	1q24.2	2014-09-17	2006-03-28	2006-03-09	ENSG00000198821	ENSG00000198821		"""CD molecules"""	1677	protein-coding gene	gene with protein product		186780	"""CD3z antigen, zeta polypeptide (TiT3 complex)"", ""CD247 antigen"""	CD3Z		2974162	Standard	NM_198053		Approved	CD3H, CD3Q	uc001gei.4	P20963	OTTHUMG00000034593	ENST00000362089.5:c.254T>C	chr1.hg19:g.167407853A>G	ENSP00000354782:p.Val85Ala	119.0	0.0		145.0	38.0	NM_198053	B1AK49|Q5VX13|Q8TAX4	Missense_Mutation	SNP	ENST00000362089.5	hg19	CCDS1261.1	.	.	.	.	.	.	.	.	.	.	A	10.06	1.245866	0.22796	.	.	ENSG00000198821	ENST00000392122;ENST00000362089	T;T	0.42513	0.97;0.97	4.52	4.52	0.55395	.	0.595996	0.12974	U	0.423873	T	0.25344	0.0616	L	0.50333	1.59	0.33143	D	0.544638	P;B;B	0.40000	0.698;0.079;0.097	P;B;B	0.46659	0.523;0.046;0.076	T	0.05338	-1.0891	9	0.07813	T	0.8	.	11.3298	0.49468	1.0:0.0:0.0:0.0	.	85;85;85	Q6KAV0;P20963-3;P20963	.;.;CD3Z_HUMAN	A	85	ENSP00000375969:V85A;ENSP00000354782:V85A	ENSP00000354782:V85A	V	-	2	0	CD247	165674477	0.056000	0.20664	0.012000	0.15200	0.971000	0.66376	2.808000	0.47963	1.885000	0.54596	0.460000	0.39030	GTT	.	.		0.552	CD247-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083707.1	NM_198053	
SPTBN1	6711	hgsc.bcm.edu	37	2	54786000	54786000	+	Intron	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr2:54786000G>A	ENST00000356805.4	+	2	429				SPTBN1_ENST00000333896.5_Missense_Mutation_p.E29K	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1						actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CAACCAGCTGGAAGGCAGATT	0.587																																					p.E29K		Atlas-SNP	.											.	SPTBN1	378	.	0			c.G85A						.						67.0	70.0	69.0					2																	54786000		2203	4300	6503	SO:0001627	intron_variant	6711	exon1			CAGCTGGAAGGCA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.148+32297G>A	chr2.hg19:g.54786000G>A		574.0	0.0		525.0	150.0	NM_178313	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079815	0.76528	.	.	ENSG00000115306	ENST00000333896	D	0.95447	-3.71	5.42	5.42	0.78866	.	.	.	.	.	D	0.93973	0.8070	.	.	.	0.33083	D	0.536881	B	0.21606	0.058	B	0.22601	0.04	D	0.93773	0.7077	8	0.87932	D	0	.	19.2114	0.93757	0.0:0.0:1.0:0.0	.	29	Q01082-3	.	K	29	ENSP00000334156:E29K	ENSP00000334156:E29K	E	+	1	0	SPTBN1	54639504	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.843000	0.75384	2.537000	0.85549	0.561000	0.74099	GAA	.	.		0.587	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
FER1L5	90342	hgsc.bcm.edu	37	2	97354959	97354959	+	RNA	SNP	C	C	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr2:97354959C>A	ENST00000457909.1	+	0	830							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GTATGAGAATCAGGCCAAGTA	0.607																																					p.Q786K		Atlas-SNP	.											.	FER1L5	113	.	0			c.C2356A						.						49.0	53.0	51.0					2																	97354959		692	1591	2283			90342	exon24			GAGAATCAGGCCA	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		chr2.hg19:g.97354959C>A		285.0	0.0		237.0	75.0	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.69	2.312189	0.40895	.	.	ENSG00000214272	ENST00000414152;ENST00000436930	.	.	.	4.83	0.546	0.17196	.	.	.	.	.	T	0.62011	0.2393	M	0.82823	2.61	.	.	.	D	0.54397	0.966	B	0.41860	0.368	T	0.78360	-0.2234	7	0.87932	D	0	-14.2635	16.9881	0.86346	0.0:0.4294:0.5706:0.0	.	786	A0AVI2	FR1L5_HUMAN	K	786;776	.	ENSP00000444148:Q786K	Q	+	1	0	FER1L5	96718686	1.000000	0.71417	0.996000	0.52242	0.917000	0.54804	2.464000	0.45067	-0.017000	0.14103	0.551000	0.68910	CAG	.	.		0.607	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
PDCL3	79031	hgsc.bcm.edu	37	2	101192856	101192856	+	Silent	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr2:101192856A>G	ENST00000264254.6	+	6	996	c.618A>G	c.(616-618)acA>acG	p.T206T	snoU13_ENST00000458824.1_RNA	NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	206	Thioredoxin fold. {ECO:0000250}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						CAATTATGACAGACCTGGAGG	0.498																																					p.T206T		Atlas-SNP	.											.	PDCL3	27	.	0			c.A618G						.						100.0	90.0	93.0					2																	101192856		2203	4300	6503	SO:0001819	synonymous_variant	79031	exon6			TATGACAGACCTG	AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.618A>G	chr2.hg19:g.101192856A>G		77.0	0.0		83.0	12.0	NM_024065	B2RA00|Q53S68	Silent	SNP	ENST00000264254.6	hg19	CCDS33261.1																																																																																			.	.		0.498	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329734.1	NM_024065	
TMEM43	79188	hgsc.bcm.edu	37	3	14174384	14174384	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr3:14174384A>G	ENST00000306077.4	+	6	715	c.461A>G	c.(460-462)gAa>gGa	p.E154G	RP11-434D12.1_ENST00000608606.1_5'Flank	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	154					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						TGGAGGTCAGAAATCATCAAC	0.567																																					p.E154G		Atlas-SNP	.											.	TMEM43	33	.	0			c.A461G						.						88.0	90.0	90.0					3																	14174384		2203	4300	6503	SO:0001583	missense	79188	exon6			GGTCAGAAATCAT	BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.461A>G	chr3.hg19:g.14174384A>G	ENSP00000303992:p.Glu154Gly	183.0	0.0		185.0	54.0	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	hg19	CCDS2618.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.628012	0.87560	.	.	ENSG00000170876	ENST00000306077	T	0.37752	1.18	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.20861	0.0502	N	0.04018	-0.295	0.80722	D	1	P;P	0.51147	0.942;0.557	B;B	0.43728	0.419;0.429	T	0.08391	-1.0724	10	0.23891	T	0.37	-12.4724	14.8499	0.70289	1.0:0.0:0.0:0.0	.	84;154	Q8TEP9;Q9BTV4	.;TMM43_HUMAN	G	154	ENSP00000303992:E154G	ENSP00000303992:E154G	E	+	2	0	TMEM43	14149385	1.000000	0.71417	0.949000	0.38748	0.942000	0.58702	8.962000	0.93254	1.900000	0.55004	0.482000	0.46254	GAA	.	.		0.567	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
ITIH4	3700	hgsc.bcm.edu	37	3	52847499	52847499	+	Silent	SNP	T	T	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr3:52847499T>G	ENST00000266041.4	-	24	2827	c.2731A>C	c.(2731-2733)Agg>Cgg	p.R911R	ITIH4_ENST00000406595.1_Silent_p.R881R|ITIH4_ENST00000485816.1_Silent_p.R916R|ITIH4_ENST00000346281.5_Silent_p.R895R|RP5-966M1.6_ENST00000468472.1_3'UTR	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	911					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TAATCCAGCCTGCGCTCTCTG	0.567																																					p.R911R		Atlas-SNP	.											.	ITIH4	74	.	0			c.A2731C						.						61.0	68.0	66.0					3																	52847499		2203	4300	6503	SO:0001819	synonymous_variant	3700	exon24			CCAGCCTGCGCTC	D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2731A>C	chr3.hg19:g.52847499T>G		207.0	0.0		172.0	56.0	NM_002218	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Silent	SNP	ENST00000266041.4	hg19	CCDS2865.1	.	.	.	.	.	.	.	.	.	.	T	1.323	-0.598868	0.03744	.	.	ENSG00000055955	ENST00000441637	.	.	.	4.3	3.12	0.35913	.	.	.	.	.	T	0.56746	0.2006	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51725	-0.8669	4	.	.	.	-9.7437	7.9988	0.30284	0.0:0.0:0.2074:0.7926	.	.	.	.	P	699	.	.	Q	-	2	0	ITIH4	52822539	0.982000	0.34865	0.985000	0.45067	0.154000	0.21943	1.289000	0.33307	0.957000	0.37930	0.459000	0.35465	CAG	.	.		0.567	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	
ABHD10	55347	hgsc.bcm.edu	37	3	111705759	111705759	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr3:111705759A>G	ENST00000273359.3	+	4	465		c.e4-1		ABHD10_ENST00000534857.1_Splice_Site|ABHD10_ENST00000494817.1_Splice_Site	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10						glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						ttttattttTAGATTCTTGTT	0.328																																					.		Atlas-SNP	.											.	ABHD10	20	.	0			c.439-2A>G						.						55.0	56.0	56.0					3																	111705759		2203	4300	6503	SO:0001630	splice_region_variant	55347	exon4			ATTTTTAGATTCT	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.439-1A>G	chr3.hg19:g.111705759A>G		35.0	0.0		25.0	7.0	NM_001272069	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Splice_Site	SNP	ENST00000273359.3	hg19	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.335067	0.41398	.	.	ENSG00000144827	ENST00000273359;ENST00000494817	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2058	0.73177	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABHD10	113188449	1.000000	0.71417	0.995000	0.50966	0.235000	0.25334	8.613000	0.90913	2.243000	0.73865	0.482000	0.46254	.	.	.		0.328	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	Intron
CPNE4	131034	hgsc.bcm.edu	37	3	131388547	131388547	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr3:131388547C>T	ENST00000512055.1	-	11	2779	c.653G>A	c.(652-654)tGc>tAc	p.C218Y	CPNE4_ENST00000511604.1_Missense_Mutation_p.C218Y|CPNE4_ENST00000429747.1_Missense_Mutation_p.C218Y|CPNE4_ENST00000512332.1_Missense_Mutation_p.C236Y|CPNE4_ENST00000502818.1_Missense_Mutation_p.C236Y			Q96A23	CPNE4_HUMAN	copine IV	218	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						GTCTCCGCTGCATAGAGAATT	0.388																																					p.C218Y		Atlas-SNP	.											.	CPNE4	112	.	0			c.G653A						.						93.0	104.0	100.0					3																	131388547		2203	4300	6503	SO:0001583	missense	131034	exon7			CCGCTGCATAGAG	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.653G>A	chr3.hg19:g.131388547C>T	ENSP00000421705:p.Cys218Tyr	69.0	0.0		51.0	13.0	NM_130808	D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	hg19	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807756	0.70797	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	5.66	5.66	0.87406	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.82655	-0.0350	10	0.72032	D	0.01	-20.9926	16.6772	0.85282	0.0:1.0:0.0:0.0	.	236;218	Q96A23-2;Q96A23	.;CPNE4_HUMAN	Y	218;218;236;218;236	ENSP00000421705:C218Y;ENSP00000411904:C218Y;ENSP00000424853:C236Y;ENSP00000423811:C218Y;ENSP00000421646:C236Y	ENSP00000411904:C218Y	C	-	2	0	CPNE4	132871237	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.719000	0.68462	2.675000	0.91044	0.655000	0.94253	TGC	.	.		0.388	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	
PIK3CA	5290	hgsc.bcm.edu	37	3	178916726	178916726	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr3:178916726G>A	ENST00000263967.3	+	2	270	c.113G>A	c.(112-114)cGt>cAt	p.R38H		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	38	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		R -> H (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R38H(10)|p.R38L(2)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAATGCCTCCGTGAGGCTACA	0.393		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R38H	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,caecum,carcinoma,+1,16	PIK3CA	8460	.	12	Substitution - Missense(12)	endometrium(7)|large_intestine(3)|lung(2)	c.G113A						.						76.0	74.0	75.0					3																	178916726		1838	4082	5920	SO:0001583	missense	5290	exon2			GCCTCCGTGAGGC		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.113G>A	chr3.hg19:g.178916726G>A	ENSP00000263967:p.Arg38His	217.0	0.0		170.0	51.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755529	0.89843	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.73681	-0.77;-0.77	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.84875	0.5569	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.83898	0.0288	9	.	.	.	-9.214	19.2635	0.93977	0.0:0.0:1.0:0.0	.	38	P42336	PK3CA_HUMAN	H	38	ENSP00000263967:R38H;ENSP00000417479:R38H	.	R	+	2	0	PIK3CA	180399420	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.409000	0.97331	2.547000	0.85894	0.555000	0.69702	CGT	.	.		0.393	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
YIPF7	285525	hgsc.bcm.edu	37	4	44631421	44631421	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr4:44631421A>G	ENST00000332990.5	-	4	513	c.497T>C	c.(496-498)cTg>cCg	p.L166P	YIPF7_ENST00000415895.4_Splice_Site_p.L142P	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	166						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						ACACATTACCAGAAGCAAGGT	0.443																																					p.L166P		Atlas-SNP	.											.	YIPF7	33	.	0			c.T497C						.						64.0	71.0	69.0					4																	44631421		1906	4114	6020	SO:0001630	splice_region_variant	285525	exon4			ATTACCAGAAGCA	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.498+1T>C	chr4.hg19:g.44631421A>G		87.0	0.0		346.0	18.0	NM_182592	Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	hg19	CCDS54766.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914571	0.72983	.	.	ENSG00000177752	ENST00000332990	T	0.47177	0.85	5.31	5.31	0.75309	Yip1 domain (1);	0.134012	0.49305	D	0.000152	T	0.72922	0.3521	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.78846	-0.2043	10	0.72032	D	0.01	-5.5962	14.5846	0.68315	1.0:0.0:0.0:0.0	.	166	Q8N8F6	YIPF7_HUMAN	P	166	ENSP00000332772:L166P	ENSP00000332772:L166P	L	-	2	0	YIPF7	44326178	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	9.077000	0.94016	2.217000	0.71921	0.477000	0.44152	CTG	.	.		0.443	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592	Missense_Mutation
KIAA1109	84162	hgsc.bcm.edu	37	4	123275094	123275094	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr4:123275094C>T	ENST00000264501.4	+	82	14600	c.14227C>T	c.(14227-14229)Cgt>Tgt	p.R4743C	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R4743C			Q2LD37	K1109_HUMAN	KIAA1109	4743					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R4743C(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GATAACAAGGCGTCGCCATGA	0.393																																					p.R4743C		Atlas-SNP	.											KIAA1109,colon,carcinoma,0,3	KIAA1109	424	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14227T						.						94.0	90.0	92.0					4																	123275094		1868	4116	5984	SO:0001583	missense	84162	exon80			ACAAGGCGTCGCC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14227C>T	chr4.hg19:g.123275094C>T	ENSP00000264501:p.Arg4743Cys	281.0	0.0		160.0	65.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283300	0.80803	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.57436	0.4;0.4;0.4	6.04	6.04	0.98038	Fragile site-associated protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65249	0.2673	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.64918	-0.6294	10	0.62326	D	0.03	.	13.9184	0.63916	0.2654:0.7345:0.0:0.0	.	4742;4743	Q2LD37-4;Q2LD37	.;K1109_HUMAN	C	4743;4743;1412;344	ENSP00000264501:R4743C;ENSP00000373390:R4743C;ENSP00000410874:R1412C	ENSP00000264501:R4743C	R	+	1	0	KIAA1109	123494544	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.834000	0.55798	2.876000	0.98609	0.650000	0.86243	CGT	.	.		0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
ELMOD2	255520	hgsc.bcm.edu	37	4	141464674	141464674	+	Silent	SNP	T	T	C			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr4:141464674T>C	ENST00000323570.3	+	8	802	c.670T>C	c.(670-672)Ttg>Ctg	p.L224L		NM_153702.3	NP_714913.1	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	224	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				defense response to virus (GO:0051607)|phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)|regulation of defense response to virus (GO:0050688)	cytoskeleton (GO:0005856)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7	all_hematologic(180;0.162)					GAGTGAAGCTTTGAAGTTTCA	0.338																																					p.L224L		Atlas-SNP	.											.	ELMOD2	16	.	0			c.T670C						.						108.0	108.0	108.0					4																	141464674		2203	4293	6496	SO:0001819	synonymous_variant	255520	exon8			GAAGCTTTGAAGT	BX648349	CCDS3752.1	4q31.1	2006-10-24	2006-01-20		ENSG00000179387	ENSG00000179387			28111	protein-coding gene	gene with protein product		610196	"""ELMO domain containing 2"""			16773575	Standard	NM_153702		Approved	MGC10084	uc003iik.3	Q8IZ81	OTTHUMG00000133417	ENST00000323570.3:c.670T>C	chr4.hg19:g.141464674T>C		48.0	0.0		37.0	16.0	NM_153702	B2R712|D3DNZ0	Silent	SNP	ENST00000323570.3	hg19	CCDS3752.1																																																																																			.	.		0.338	ELMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257277.2	NM_153702	
TENM3	55714	hgsc.bcm.edu	37	4	183721165	183721165	+	Silent	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr4:183721165C>T	ENST00000511685.1	+	28	7884	c.7761C>T	c.(7759-7761)aaC>aaT	p.N2587N	TENM3_ENST00000406950.2_Silent_p.N2587N			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2587					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CGGTGGTGAACGGCAGGACGC	0.692																																					p.N2587N		Atlas-SNP	.											.	.	.	.	0			c.C7761T						.						20.0	25.0	24.0					4																	183721165		2180	4264	6444	SO:0001819	synonymous_variant	55714	exon27			GGTGAACGGCAGG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.7761C>T	chr4.hg19:g.183721165C>T		184.0	0.0		90.0	33.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	hg19	CCDS47165.1																																																																																			.	.		0.692	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
ATG12	9140	hgsc.bcm.edu	37	5	115177201	115177201	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr5:115177201C>A	ENST00000509910.1	-	1	354	c.49G>T	c.(49-51)Gct>Tct	p.A17S	ATG12_ENST00000509598.1_5'Flank|AP3S1_ENST00000316788.7_5'UTR|ATG12_ENST00000500945.2_Missense_Mutation_p.A17S|ATG12_ENST00000274459.4_Missense_Mutation_p.A64S			O94817	ATG12_HUMAN	autophagy related 12	17					autophagic vacuole assembly (GO:0000045)|C-terminal protein lipidation (GO:0006501)|cellular response to nitrogen starvation (GO:0006995)|innate immune response (GO:0045087)|mitochondrion degradation (GO:0000422)|negative regulation of type I interferon production (GO:0032480)|nucleophagy (GO:0044804)	Atg12-Atg5-Atg16 complex (GO:0034274)|pre-autophagosomal structure membrane (GO:0034045)	Atg8 ligase activity (GO:0019776)			endometrium(2)|kidney(1)|lung(1)|prostate(1)	5		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		TCCCCTCCAGCAGCAATTGAA	0.607																																					p.A17S		Atlas-SNP	.											.	ATG12	14	.	0			c.G49T						.						76.0	83.0	81.0					5																	115177201		2202	4300	6502	SO:0001583	missense	9140	exon1			CTCCAGCAGCAAT	AB017507	CCDS4122.1, CCDS4122.2, CCDS64222.1	5q21-q22	2014-02-12	2012-06-06	2005-09-11	ENSG00000145782	ENSG00000145782			588	protein-coding gene	gene with protein product	"""APG12 autophagy 12-like"""	609608	"""Apg12 (autophagy 12, S. cerevisiae)-like"", ""APG12 autophagy 12-like (S. cerevisiae)"", ""ATG12 autophagy related 12 homolog (S. cerevisiae)"""	APG12L		9852036	Standard	NM_004707		Approved	APG12	uc003krh.3	O94817	OTTHUMG00000128889	ENST00000509910.1:c.49G>T	chr5.hg19:g.115177201C>A	ENSP00000425107:p.Ala17Ser	143.0	0.0		129.0	33.0	NM_004707	Q6PJV2	Missense_Mutation	SNP	ENST00000509910.1	hg19	CCDS4122.2	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420345	0.42918	.	.	ENSG00000145782	ENST00000274459;ENST00000509910;ENST00000500945	.	.	.	4.88	2.06	0.26882	.	0.938134	0.08865	N	0.882410	T	0.35158	0.0922	L	0.57536	1.79	0.21220	N	0.999759	P;B	0.37061	0.58;0.18	B;B	0.34722	0.188;0.037	T	0.18023	-1.0350	9	0.13853	T	0.58	-22.4913	8.0103	0.30349	0.0:0.6119:0.3035:0.0845	.	17;64	O94817;C1IDX9	ATG12_HUMAN;.	S	64;17;17	.	ENSP00000274459:A64S	A	-	1	0	ATG12	115205100	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.365000	0.20348	0.114000	0.18032	-0.176000	0.13171	GCT	.	.		0.607	ATG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250851.3	NM_004707	
HAND1	9421	hgsc.bcm.edu	37	5	153857205	153857205	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr5:153857205G>C	ENST00000231121.2	-	1	619	c.364C>G	c.(364-366)Ccc>Gcc	p.P122A		NM_004821.2	NP_004812.1	O96004	HAND1_HUMAN	heart and neural crest derivatives expressed 1	122	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|blastocyst development (GO:0001824)|cardiac left ventricle formation (GO:0003218)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cartilage morphogenesis (GO:0060536)|embryonic heart tube development (GO:0035050)|embryonic heart tube formation (GO:0003144)|heart development (GO:0007507)|heart looping (GO:0001947)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)|trophoblast giant cell differentiation (GO:0060707)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GGCACGTTGGGGATGCACTCG	0.617																																					p.P122A		Atlas-SNP	.											.	HAND1	21	.	0			c.C364G						.						149.0	122.0	131.0					5																	153857205		2203	4300	6503	SO:0001583	missense	9421	exon1			CGTTGGGGATGCA	AF061756	CCDS4327.1	5q33	2013-05-21			ENSG00000113196	ENSG00000113196		"""Basic helix-loop-helix proteins"""	4807	protein-coding gene	gene with protein product		602406				9337404, 9931445	Standard	NM_004821		Approved	eHand, Thing1, Hxt, bHLHa27	uc003lvn.3	O96004	OTTHUMG00000130193	ENST00000231121.2:c.364C>G	chr5.hg19:g.153857205G>C	ENSP00000231121:p.Pro122Ala	92.0	0.0		84.0	25.0	NM_004821		Missense_Mutation	SNP	ENST00000231121.2	hg19	CCDS4327.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721626	0.89298	.	.	ENSG00000113196	ENST00000231121	D	0.97328	-4.34	5.11	5.11	0.69529	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98960	0.9646	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99517	1.0957	10	0.87932	D	0	-24.9243	16.0319	0.80585	0.0:0.0:1.0:0.0	.	122	O96004	HAND1_HUMAN	A	122	ENSP00000231121:P122A	ENSP00000231121:P122A	P	-	1	0	HAND1	153837398	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.612000	0.98347	2.367000	0.80283	0.462000	0.41574	CCC	.	.		0.617	HAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252511.1	NM_004821	
SLIT3	6586	hgsc.bcm.edu	37	5	168180048	168180048	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr5:168180048T>A	ENST00000519560.1	-	18	2304	c.1885A>T	c.(1885-1887)Agt>Tgt	p.S629C	SLIT3_ENST00000332966.8_Missense_Mutation_p.S629C|SLIT3_ENST00000404867.3_Missense_Mutation_p.S629C	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	629					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCACCGAACTCAGGCCGGCA	0.547																																					p.S629C	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.A1885T						.						141.0	99.0	113.0					5																	168180048		2203	4300	6503	SO:0001583	missense	6586	exon18			CCGAACTCAGGCC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1885A>T	chr5.hg19:g.168180048T>A	ENSP00000430333:p.Ser629Cys	157.0	0.0		121.0	43.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	hg19	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.629850	0.67015	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.60040	0.22;0.22;0.22	5.34	5.34	0.76211	.	0.153798	0.64402	D	0.000001	T	0.69931	0.3166	M	0.88979	2.995	0.80722	D	1	P	0.40578	0.722	P	0.44359	0.447	T	0.76462	-0.2950	10	0.62326	D	0.03	.	15.3207	0.74120	0.0:0.0:0.0:1.0	.	629	O75094	SLIT3_HUMAN	C	629	ENSP00000430333:S629C;ENSP00000332164:S629C;ENSP00000384890:S629C	ENSP00000332164:S629C	S	-	1	0	SLIT3	168112626	1.000000	0.71417	0.986000	0.45419	0.973000	0.67179	5.159000	0.64923	2.031000	0.59945	0.533000	0.62120	AGT	.	.		0.547	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
FGFR4	2264	hgsc.bcm.edu	37	5	176520342	176520342	+	Intron	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr5:176520342G>A	ENST00000292408.4	+	9	1496				FGFR4_ENST00000292410.3_Missense_Mutation_p.R356H|FGFR4_ENST00000393637.1_Missense_Mutation_p.R356H|FGFR4_ENST00000502906.1_Intron|FGFR4_ENST00000393648.2_Intron	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4						alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	GGTACTGGGCGCATCCCCCAC	0.662										TSP Lung(9;0.080)																											p.R356H		Atlas-SNP	.											FGFR4_ENST00000292408,caecum,carcinoma,0,2	FGFR4	174	.	0			c.G1067A						.						72.0	76.0	74.0					5																	176520342		2203	4300	6503	SO:0001627	intron_variant	2264	exon8			CTGGGCGCATCCC	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1251+10G>A	chr5.hg19:g.176520342G>A		115.0	0.0		94.0	4.0	NM_022963	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	hg19	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	G	3.996	-0.003484	0.07773	.	.	ENSG00000160867	ENST00000292410;ENST00000393637	T;T	0.78816	-1.21;-1.21	4.01	-1.99	0.07457	.	.	.	.	.	T	0.58949	0.2158	.	.	.	0.09310	N	1	B	0.30914	0.3	B	0.25140	0.058	T	0.42882	-0.9425	8	0.33940	T	0.23	.	5.2551	0.15542	0.0:0.46:0.1558:0.3842	.	356	P22455-2	.	H	356	ENSP00000292410:R356H;ENSP00000377254:R356H	ENSP00000292410:R356H	R	+	2	0	FGFR4	176452948	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.917000	0.04025	-0.329000	0.08527	-0.311000	0.09066	CGC	.	.		0.662	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
GABBR1	2550	hgsc.bcm.edu	37	6	29599329	29599329	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr6:29599329C>T	ENST00000377034.4	-	3	468	c.133G>A	c.(133-135)Ggc>Agc	p.G45S	GABBR1_ENST00000377016.4_Missense_Mutation_p.G45S|GABBR1_ENST00000376977.3_Missense_Mutation_p.G45S	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	45	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CGAGTCAGGCCCCGGTACCTG	0.597																																					p.G45S		Atlas-SNP	.											.	GABBR1	95	.	0			c.G133A						.						80.0	86.0	84.0					6																	29599329		2203	4300	6503	SO:0001583	missense	2550	exon3			TCAGGCCCCGGTA	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.133G>A	chr6.hg19:g.29599329C>T	ENSP00000366233:p.Gly45Ser	134.0	0.0		149.0	6.0	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367941	0.82463	.	.	ENSG00000204681	ENST00000376977;ENST00000377016;ENST00000377034;ENST00000462632;ENST00000476670	T;D;T;T;T	0.94497	-0.93;-3.44;-0.4;1.48;0.86	4.48	4.48	0.54585	Complement control module (1);Sushi/SCR/CCP (1);	0.133753	0.49305	D	0.000144	D	0.93265	0.7854	N	0.19112	0.55	0.41362	D	0.987431	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.998	D	0.95178	0.8296	10	0.87932	D	0	-2.4707	14.7347	0.69406	0.0:1.0:0.0:0.0	.	45;45;45	Q9UBS5-5;Q9UBS5-3;Q9UBS5	.;.;GABR1_HUMAN	S	45;45;45;45;50	ENSP00000366176:G45S;ENSP00000366215:G45S;ENSP00000366233:G45S;ENSP00000419755:G45S;ENSP00000417332:G50S	ENSP00000366176:G45S	G	-	1	0	GABBR1	29707308	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.024000	0.49674	2.062000	0.61559	0.449000	0.29647	GGC	.	.		0.597	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
COL19A1	1310	hgsc.bcm.edu	37	6	70890211	70890211	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr6:70890211C>T	ENST00000322773.4	+	43	2777	c.2675C>T	c.(2674-2676)cCt>cTt	p.P892L	COL19A1_ENST00000393344.1_Missense_Mutation_p.P514L	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	892	Collagen-like 9.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CAGGGAAAACCTGGTGCCCCA	0.473																																					p.P892L		Atlas-SNP	.											.	COL19A1	232	.	0			c.C2675T						.						116.0	132.0	127.0					6																	70890211		2203	4300	6503	SO:0001583	missense	1310	exon43			GAAAACCTGGTGC		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2675C>T	chr6.hg19:g.70890211C>T	ENSP00000316030:p.Pro892Leu	121.0	0.0		111.0	38.0	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	hg19	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.694043	0.30052	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.95554	-3.74;-3.74	5.54	5.54	0.83059	.	0.068176	0.56097	D	0.000026	D	0.96562	0.8878	M	0.83118	2.625	0.58432	D	0.999995	D	0.58268	0.982	P	0.57620	0.824	D	0.96278	0.9204	10	0.52906	T	0.07	.	13.4928	0.61407	0.1559:0.8441:0.0:0.0	.	892	Q14993	COJA1_HUMAN	L	892;514	ENSP00000316030:P892L;ENSP00000377013:P514L	ENSP00000316030:P892L	P	+	2	0	COL19A1	70946932	0.995000	0.38212	0.861000	0.33841	0.008000	0.06430	3.308000	0.51896	2.601000	0.87937	0.585000	0.79938	CCT	.	.		0.473	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
TRDN	10345	hgsc.bcm.edu	37	6	123868487	123868487	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr6:123868487T>G	ENST00000398178.3	-	4	443	c.422A>C	c.(421-423)aAa>aCa	p.K141T	TRDN_ENST00000542443.1_Missense_Mutation_p.K141T|TRDN_ENST00000334268.4_Missense_Mutation_p.K141T|TRDN_ENST00000546248.1_Missense_Mutation_p.K141T	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	141					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CAACTAACCTTTTTTTCTCAA	0.249																																					p.K141T		Atlas-SNP	.											.	TRDN	88	.	0			c.A422C						.						13.0	12.0	12.0					6																	123868487		1701	3839	5540	SO:0001583	missense	10345	exon4			TAACCTTTTTTTC	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.422A>C	chr6.hg19:g.123868487T>G	ENSP00000381240:p.Lys141Thr	626.0	0.0		464.0	138.0	NM_001256022	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	hg19	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.385488	0.42308	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613;ENST00000542443;ENST00000265491	T;T;T;T	0.65732	0.21;0.21;0.21;-0.17	5.73	4.52	0.55395	Aspartyl beta-hydroxylase/Triadin domain (1);	0.370469	0.27031	N	0.021264	T	0.66954	0.2842	M	0.75447	2.3	0.80722	D	1	B;P;P;P;D	0.67145	0.073;0.885;0.951;0.951;0.996	B;B;P;P;D	0.67900	0.053;0.389;0.807;0.807;0.954	T	0.72523	-0.4267	10	0.87932	D	0	-8.7326	6.1972	0.20555	0.0:0.0826:0.1627:0.7547	.	141;141;141;141;141	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	T	141;141;141;141;141;141;46;141;46	ENSP00000381240:K141T;ENSP00000333984:K141T;ENSP00000439281:K141T;ENSP00000437684:K141T	ENSP00000265491:K46T	K	-	2	0	TRDN	123910186	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	1.572000	0.36461	2.196000	0.70406	0.524000	0.50904	AAA	.	.		0.249	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ECT2L	345930	hgsc.bcm.edu	37	6	139164328	139164328	+	Silent	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr6:139164328C>T	ENST00000423192.1	+	5	716	c.555C>T	c.(553-555)tgC>tgT	p.C185C	ECT2L_ENST00000541398.1_Silent_p.C116C|ECT2L_ENST00000367682.2_Silent_p.C185C			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	185							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						GAGAAAAGTGCCTGAGGAAAA	0.403			"""N, Splice, Mis"""		ETP ALL																																p.C185C		Atlas-SNP	.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L	75	.	0			c.C555T						.						116.0	117.0	116.0					6																	139164328		1863	4095	5958	SO:0001819	synonymous_variant	345930	exon5			AAAGTGCCTGAGG		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.555C>T	chr6.hg19:g.139164328C>T		143.0	0.0		123.0	40.0	NM_001195037	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	ENST00000423192.1	hg19	CCDS43508.1																																																																																			.	.		0.403	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
TAGAP	117289	hgsc.bcm.edu	37	6	159456896	159456896	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr6:159456896G>A	ENST00000367066.3	-	10	2490	c.2159C>T	c.(2158-2160)gCt>gTt	p.A720V	RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|TAGAP_ENST00000326965.6_Missense_Mutation_p.A542V|RP1-111C20.4_ENST00000606466.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	720					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GAATTGGTCAGCCTCAAAGAC	0.517																																					p.A720V		Atlas-SNP	.											.	TAGAP	75	.	0			c.C2159T						.						69.0	63.0	65.0					6																	159456896		2203	4300	6503	SO:0001583	missense	117289	exon10			TGGTCAGCCTCAA	AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.2159C>T	chr6.hg19:g.159456896G>A	ENSP00000356033:p.Ala720Val	88.0	0.0		62.0	16.0	NM_054114	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	hg19	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	G	1.822	-0.471899	0.04445	.	.	ENSG00000164691	ENST00000367066;ENST00000326965	T;T	0.15718	2.4;2.66	5.95	0.439	0.16567	.	0.530211	0.19672	N	0.108739	T	0.03053	0.0090	N	0.26130	0.795	0.80722	D	1	B	0.09022	0.002	B	0.12156	0.007	T	0.34428	-0.9829	10	0.11794	T	0.64	-4.1843	8.0603	0.30629	0.6241:0.0:0.3759:0.0	.	720	Q8N103	TAGAP_HUMAN	V	720;542	ENSP00000356033:A720V;ENSP00000322650:A542V	ENSP00000322650:A542V	A	-	2	0	TAGAP	159376884	0.736000	0.28164	0.339000	0.25562	0.076000	0.17211	1.171000	0.31896	0.125000	0.18397	-0.136000	0.14681	GCT	.	.		0.517	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114	
ELFN1	392617	hgsc.bcm.edu	37	7	1785451	1785451	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr7:1785451G>A	ENST00000424383.2	+	3	1706	c.1219G>A	c.(1219-1221)Ggt>Agt	p.G407S	ELFN1_ENST00000541472.1_Missense_Mutation_p.G407S|ELFN1_ENST00000561626.1_Missense_Mutation_p.G407S			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	407					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CAGCCCGCCTGGTCCGGTGCC	0.672																																					p.G407S		Atlas-SNP	.											.	ELFN1	22	.	0			c.G1219A						.						28.0	31.0	30.0					7																	1785451		691	1590	2281	SO:0001583	missense	392617	exon2			CCGCCTGGTCCGG		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.1219G>A	chr7.hg19:g.1785451G>A	ENSP00000456548:p.Gly407Ser	73.0	0.0		85.0	23.0	NM_001128636	H3BS57	Missense_Mutation	SNP	ENST00000424383.2	hg19	CCDS59046.1																																																																																			.	.		0.672	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2	NM_001128636	
CSGALNACT1	55790	hgsc.bcm.edu	37	8	19315958	19315958	+	Missense_Mutation	SNP	C	C	T	rs35454485		TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr8:19315958C>T	ENST00000454498.2	-	5	1843	c.830G>A	c.(829-831)cGg>cAg	p.R277Q	CSGALNACT1_ENST00000518542.1_5'UTR|CSGALNACT1_ENST00000311540.4_Missense_Mutation_p.R277Q|CSGALNACT1_ENST00000332246.6_Missense_Mutation_p.R277Q|CSGALNACT1_ENST00000544602.1_Missense_Mutation_p.R277Q|CSGALNACT1_ENST00000522854.1_Missense_Mutation_p.R277Q	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1	277					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		CATGAACTGCCGGAACTTGTC	0.448																																					p.R277Q		Atlas-SNP	.											.	CSGALNACT1	72	.	0			c.G830A						.						312.0	295.0	301.0					8																	19315958		2203	4300	6503	SO:0001583	missense	55790	exon5			AACTGCCGGAACT	AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.830G>A	chr8.hg19:g.19315958C>T	ENSP00000411816:p.Arg277Gln	207.0	0.0		140.0	58.0	NM_018371	B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Missense_Mutation	SNP	ENST00000454498.2	hg19	CCDS6010.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079119	0.36662	.	.	ENSG00000147408	ENST00000454498;ENST00000332246;ENST00000311540;ENST00000522854;ENST00000544602	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	5.61	3.83	0.44106	.	0.317587	0.35772	N	0.003000	T	0.19685	0.0473	N	0.25485	0.75	0.38096	D	0.937101	B	0.31655	0.334	B	0.25291	0.059	T	0.08027	-1.0742	10	0.10111	T	0.7	-32.1472	8.8171	0.35002	0.0:0.7685:0.0:0.2315	rs35454485	277	Q8TDX6	CGAT1_HUMAN	Q	277	ENSP00000411816:R277Q;ENSP00000330805:R277Q;ENSP00000310891:R277Q;ENSP00000429809:R277Q;ENSP00000442155:R277Q	ENSP00000310891:R277Q	R	-	2	0	CSGALNACT1	19360238	0.996000	0.38824	1.000000	0.80357	0.986000	0.74619	1.875000	0.39578	0.862000	0.35528	-0.140000	0.14226	CGG	.	C|0.987;T|0.013		0.448	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375204.1	NM_018371	
SNX30	401548	hgsc.bcm.edu	37	9	115567201	115567201	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr9:115567201A>T	ENST00000374232.3	+	2	466	c.302A>T	c.(301-303)cAt>cTt	p.H101L		NM_001012994.1	NP_001013012.1	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30	101	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CCCAAGAAGCATGTGTGTACA	0.448																																					p.H101L		Atlas-SNP	.											.	SNX30	32	.	0			c.A302T						.						211.0	190.0	197.0					9																	115567201		1965	4165	6130	SO:0001583	missense	401548	exon2			AGAAGCATGTGTG	AK126644	CCDS43865.1	9q33.1	2014-02-12			ENSG00000148158	ENSG00000148158		"""Sorting nexins"""	23685	protein-coding gene	gene with protein product							Standard	NM_001012994		Approved	ATG24A	uc004bgj.4	Q5VWJ9	OTTHUMG00000020512	ENST00000374232.3:c.302A>T	chr9.hg19:g.115567201A>T	ENSP00000363349:p.His101Leu	91.0	0.0		79.0	30.0	NM_001012994		Missense_Mutation	SNP	ENST00000374232.3	hg19	CCDS43865.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.458659	0.84317	.	.	ENSG00000148158	ENST00000374232	T	0.39592	1.07	5.33	5.33	0.75918	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.60392	0.2265	M	0.73753	2.245	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.59920	-0.7363	10	0.07813	T	0.8	.	15.308	0.74008	1.0:0.0:0.0:0.0	.	101	Q5VWJ9	SNX30_HUMAN	L	101	ENSP00000363349:H101L	ENSP00000363349:H101L	H	+	2	0	SNX30	114607022	1.000000	0.71417	0.998000	0.56505	0.804000	0.45430	8.885000	0.92439	2.017000	0.59298	0.460000	0.39030	CAT	.	.		0.448	SNX30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053700.1		
USP54	159195	hgsc.bcm.edu	37	10	75276875	75276875	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr10:75276875T>G	ENST00000339859.4	-	19	3409	c.3309A>C	c.(3307-3309)aaA>aaC	p.K1103N	RP11-137L10.6_ENST00000595069.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|USP54_ENST00000408019.1_Missense_Mutation_p.K1103N|USP54_ENST00000394811.2_Missense_Mutation_p.K191N|RP11-137L10.6_ENST00000597958.1_RNA|RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000422491.2_Missense_Mutation_p.K285N|USP54_ENST00000428547.1_Missense_Mutation_p.K953N			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1103					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					TCAATGAAGTTTTGAGGCTTT	0.498																																					p.K1103N	Colon(195;880 2046 8854 25025 38456)	Atlas-SNP	.											.	USP54	178	.	0			c.A3309C						.						95.0	96.0	96.0					10																	75276875		2203	4300	6503	SO:0001583	missense	159195	exon18			TGAAGTTTTGAGG	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.3309A>C	chr10.hg19:g.75276875T>G	ENSP00000345216:p.Lys1103Asn	76.0	0.0		112.0	26.0	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	hg19	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	T	14.18	2.459443	0.43736	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000394811;ENST00000422491	T;T;T;T;T	0.24908	1.87;1.87;1.86;1.83;1.84	5.83	2.18	0.27775	.	.	.	.	.	T	0.16214	0.0390	N	0.24115	0.695	0.80722	D	1	P;B	0.49090	0.919;0.361	B;B	0.42422	0.387;0.036	T	0.02925	-1.1093	9	0.49607	T	0.09	-2.894	6.9605	0.24595	0.0:0.4399:0.0:0.5601	.	285;1103	E7EW90;Q70EL1	.;UBP54_HUMAN	N	1103;1103;953;191;285	ENSP00000345216:K1103N;ENSP00000386080:K1103N;ENSP00000408714:K953N;ENSP00000378290:K191N;ENSP00000407368:K285N	ENSP00000345216:K1103N	K	-	3	2	USP54	74946881	1.000000	0.71417	0.814000	0.32528	0.992000	0.81027	0.799000	0.27028	0.436000	0.26393	0.533000	0.62120	AAA	.	.		0.498	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
SEC24C	9632	hgsc.bcm.edu	37	10	75519919	75519919	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr10:75519919C>T	ENST00000339365.2	+	6	787	c.625C>T	c.(625-627)Cag>Tag	p.Q209*	SEC24C_ENST00000345254.4_Nonsense_Mutation_p.Q209*|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Nonsense_Mutation_p.Q67*|SEC24C_ENST00000546025.1_Nonsense_Mutation_p.Q67*|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	209					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					TGCCCCATCACAGGCCTCCAG	0.627																																					p.Q209X		Atlas-SNP	.											.	SEC24C	86	.	0			c.C625T						.						91.0	92.0	92.0					10																	75519919		2203	4299	6502	SO:0001587	stop_gained	9632	exon5			CCATCACAGGCCT	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.625C>T	chr10.hg19:g.75519919C>T	ENSP00000343405:p.Gln209*	78.0	0.0		102.0	25.0	NM_198597	B4DZT4|Q8WV25	Nonsense_Mutation	SNP	ENST00000339365.2	hg19	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578913	0.86645	.	.	ENSG00000176986	ENST00000546025;ENST00000345254;ENST00000339365;ENST00000411652	.	.	.	5.63	4.73	0.59995	.	0.322570	0.36740	N	0.002423	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-1.0912	14.329	0.66541	0.0:0.9281:0.0:0.0719	.	.	.	.	X	67;209;209;67	.	ENSP00000343405:Q209X	Q	+	1	0	SEC24C	75189925	0.974000	0.33945	0.965000	0.40720	0.850000	0.48378	2.441000	0.44864	1.523000	0.49018	0.561000	0.74099	CAG	.	.		0.627	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
MKI67	4288	hgsc.bcm.edu	37	10	129901847	129901847	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr10:129901847C>G	ENST00000368654.3	-	13	8632	c.8257G>C	c.(8257-8259)Gac>Cac	p.D2753H	MKI67_ENST00000368653.3_Missense_Mutation_p.D2393H	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2753	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGTTCTTTGTCTGCATCCGTG	0.488																																					p.D2753H		Atlas-SNP	.											.	MKI67	363	.	0			c.G8257C						.						160.0	141.0	147.0					10																	129901847		2203	4300	6503	SO:0001583	missense	4288	exon13			CTTTGTCTGCATC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8257G>C	chr10.hg19:g.129901847C>G	ENSP00000357643:p.Asp2753His	105.0	0.0		55.0	26.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	1.348	-0.592300	0.03799	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02103	4.45;4.45	3.24	-1.69	0.08186	.	.	.	.	.	T	0.01940	0.0061	L	0.28274	0.84	0.09310	N	1	B;B;B	0.25272	0.004;0.043;0.122	B;B;B	0.26416	0.003;0.019;0.069	T	0.44757	-0.9307	9	0.45353	T	0.12	.	7.5951	0.28044	0.1157:0.5875:0.2968:0.0	.	2752;2393;2753	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	H	2753;2393;2752	ENSP00000357643:D2753H;ENSP00000357642:D2393H	ENSP00000357642:D2393H	D	-	1	0	MKI67	129791837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.112000	0.10791	-0.492000	0.06687	-0.211000	0.12701	GAC	.	.		0.488	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
OR9G4	283189	hgsc.bcm.edu	37	11	56510313	56510313	+	Silent	SNP	T	T	C			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr11:56510313T>C	ENST00000302957.3	-	1	974	c.975A>G	c.(973-975)ccA>ccG	p.P325P		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	325						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						TTCATGTTTGTGGTTGTATAG	0.368																																					p.P325P		Atlas-SNP	.											.	OR9G4	73	.	0			c.A975G						.						184.0	162.0	170.0					11																	56510313		2201	4296	6497	SO:0001819	synonymous_variant	283189	exon1			TGTTTGTGGTTGT	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.975A>G	chr11.hg19:g.56510313T>C		86.0	0.0		75.0	18.0	NM_001005284	Q6IF62|Q96RA9	Silent	SNP	ENST00000302957.3	hg19	CCDS31537.1																																																																																			.	.		0.368	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284	
ZFP91	80829	hgsc.bcm.edu	37	11	58345512	58345512	+	5'Flank	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr11:58345512G>A	ENST00000316059.6	+	0	0				LPXN_ENST00000528954.1_Missense_Mutation_p.T3I|LPXN_ENST00000528489.1_5'UTR|ZFP91-CNTF_ENST00000389919.4_5'Flank|LPXN_ENST00000395074.2_5'Flank	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein						activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				gatcaataatgtagacatgaa	0.557																																					p.T3I		Atlas-SNP	.											.	LPXN	55	.	0			c.C8T						.						48.0	46.0	46.0					11																	58345512		692	1591	2283	SO:0001631	upstream_gene_variant	9404	exon1			AATAATGTAGACA	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391		chr11.hg19:g.58345512G>A	Exception_encountered	194.0	0.0		178.0	46.0	NM_001143995	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	ENST00000316059.6	hg19	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521171	0.27211	.	.	ENSG00000110031	ENST00000528954	T	0.29655	1.56	3.89	2.96	0.34315	.	.	.	.	.	T	0.16642	0.0400	N	0.08118	0	0.24849	N	0.99241	B	0.19583	0.037	B	0.17098	0.017	T	0.18023	-1.0350	9	0.72032	D	0.01	.	8.9831	0.35977	0.0:0.0:0.7799:0.2201	.	3	B4DV71	.	I	3	ENSP00000431284:T3I	ENSP00000431284:T3I	T	-	2	0	LPXN	58102088	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.998000	0.29744	1.211000	0.43351	0.561000	0.74099	ACA	.	.		0.557	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
GDPD5	81544	hgsc.bcm.edu	37	11	75146556	75146556	+	Missense_Mutation	SNP	C	C	T	rs551593132	byFrequency	TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr11:75146556C>T	ENST00000336898.3	-	17	2651	c.1814G>A	c.(1813-1815)cGt>cAt	p.R605H	GDPD5_ENST00000533784.1_Missense_Mutation_p.R486H|GDPD5_ENST00000376282.3_Missense_Mutation_p.R486H|GDPD5_ENST00000529721.1_Missense_Mutation_p.R605H|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000533805.1_Missense_Mutation_p.R360H|GDPD5_ENST00000526177.1_Missense_Mutation_p.R467H	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	605					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						CTTCAGCTAACGCCCACTCCG	0.592													C|||	4	0.000798722	0.0	0.0	5008	,	,		19386	0.0		0.0	False		,,,				2504	0.0041				p.R605H		Atlas-SNP	.											.	GDPD5	49	.	0			c.G1814A						.						66.0	59.0	61.0					11																	75146556		2200	4293	6493	SO:0001583	missense	81544	exon17			AGCTAACGCCCAC	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1814G>A	chr11.hg19:g.75146556C>T	ENSP00000337972:p.Arg605His	45.0	0.0		32.0	5.0	NM_030792	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	ENST00000336898.3	hg19	CCDS8238.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008051	0.75046	.	.	ENSG00000158555	ENST00000526177;ENST00000533784;ENST00000529721;ENST00000336898;ENST00000533805;ENST00000376282	T;T;T;T;T;T	0.16597	2.33;2.34;2.36;2.36;2.35;2.34	4.74	-1.98	0.07480	.	0.602094	0.15213	N	0.274342	T	0.06962	0.0177	N	0.08118	0	0.22266	N	0.999243	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.24941	-1.0146	10	0.87932	D	0	.	5.0714	0.14609	0.0:0.3104:0.1639:0.5257	.	486;605	Q8WTR4-2;Q8WTR4	.;GDPD5_HUMAN	H	467;486;605;605;360;486	ENSP00000434050:R467H;ENSP00000437049:R486H;ENSP00000433214:R605H;ENSP00000337972:R605H;ENSP00000435196:R360H;ENSP00000365459:R486H	ENSP00000337972:R605H	R	-	2	0	GDPD5	74824204	0.012000	0.17670	0.748000	0.31131	0.982000	0.71751	-0.589000	0.05767	-0.220000	0.09988	0.655000	0.94253	CGT	.	.		0.592	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792	
CADM1	23705	hgsc.bcm.edu	37	11	115047195	115047195	+	Nonstop_Mutation	SNP	T	T	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr11:115047195T>A	ENST00000452722.3	-	10	1348	c.1328A>T	c.(1327-1329)tAg>tTg	p.*443L	CADM1_ENST00000537058.1_Nonstop_Mutation_p.*454L|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000542447.2_Nonstop_Mutation_p.*415L|CADM1_ENST00000536727.1_Nonstop_Mutation_p.*444L|CADM1_ENST00000331581.6_Nonstop_Mutation_p.*472L	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		AAGGCTGATCTAGATGAAGTA	0.418																																					p.X443L		Atlas-SNP	.											.	CADM1	74	.	0			c.A1328T						.						260.0	240.0	247.0					11																	115047195		2201	4296	6497	SO:0001578	stop_lost	23705	exon10			CTGATCTAGATGA	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1328A>T	chr11.hg19:g.115047195T>A		115.0	0.0		109.0	30.0	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	hg19	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.609213	0.46527	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5185	0.75846	0.0:0.0:0.0:1.0	.	.	.	.	L	415;443;454;444;374;472;128	.	.	X	-	2	0	CADM1	114552405	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.526000	0.60566	2.246000	0.74042	0.533000	0.62120	TAG	.	.		0.418	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
DSCAML1	57453	hgsc.bcm.edu	37	11	117375644	117375644	+	Missense_Mutation	SNP	G	G	A	rs147991561		TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr11:117375644G>A	ENST00000321322.6	-	10	2358	c.2357C>T	c.(2356-2358)gCc>gTc	p.A786V	DSCAML1_ENST00000527706.1_Missense_Mutation_p.A516V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	726					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.A786V(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTTACCCTTGGCATGCTTCCA	0.592																																					p.A786V		Atlas-SNP	.											DSCAML1,arm,malignant_melanoma,+1,1	DSCAML1	286	.	1	Substitution - Missense(1)	skin(1)	c.C2357T						.						63.0	59.0	60.0					11																	117375644		2201	4296	6497	SO:0001583	missense	57453	exon10			CCCTTGGCATGCT		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2357C>T	chr11.hg19:g.117375644G>A	ENSP00000315465:p.Ala786Val	70.0	0.0		61.0	15.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990913	0.93106	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.67865	-0.29;-0.29	4.42	4.42	0.53409	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72070	0.3415	L	0.39085	1.19	0.80722	D	1	D	0.54207	0.965	P	0.59221	0.854	T	0.76334	-0.2997	9	0.87932	D	0	.	16.8247	0.85927	0.0:0.0:1.0:0.0	.	726	Q8TD84	DSCL1_HUMAN	V	516;786;493	ENSP00000434335:A516V;ENSP00000315465:A786V	ENSP00000315465:A786V	A	-	2	0	DSCAML1	116880854	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.540000	0.98080	2.289000	0.77006	0.305000	0.20034	GCC	.	.		0.592	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
LRP1	4035	hgsc.bcm.edu	37	12	57586981	57586981	+	Silent	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr12:57586981A>G	ENST00000243077.3	+	46	8044	c.7578A>G	c.(7576-7578)gcA>gcG	p.A2526A	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2526	LDL-receptor class A 11. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTTGCCGAGCACAAGATGAGT	0.627																																					p.A2526A		Atlas-SNP	.											.	LRP1	428	.	0			c.A7578G						.						77.0	62.0	67.0					12																	57586981		2203	4300	6503	SO:0001819	synonymous_variant	4035	exon46			CCGAGCACAAGAT	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7578A>G	chr12.hg19:g.57586981A>G		62.0	0.0		66.0	13.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	hg19	CCDS8932.1																																																																																			.	.		0.627	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
FAM71C	196472	hgsc.bcm.edu	37	12	100041989	100041989	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr12:100041989C>T	ENST00000324341.1	+	1	459	c.37C>T	c.(37-39)Caa>Taa	p.Q13*	ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	13										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		TTACACGGCCCAAAGCAGCCC	0.498																																					p.Q13X		Atlas-SNP	.											.	FAM71C	48	.	0			c.C37T						.						66.0	65.0	65.0					12																	100041989		2203	4300	6503	SO:0001587	stop_gained	196472	exon1			ACGGCCCAAAGCA		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.37C>T	chr12.hg19:g.100041989C>T	ENSP00000315247:p.Gln13*	102.0	0.0		97.0	30.0	NM_153364	B2R6Y6	Nonsense_Mutation	SNP	ENST00000324341.1	hg19	CCDS9072.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.603009	0.87157	.	.	ENSG00000180219	ENST00000324341	.	.	.	3.94	-6.34	0.01982	.	1.291070	0.05656	N	0.586079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.3648	4.4746	0.11729	0.3071:0.1549:0.4565:0.0815	.	.	.	.	X	13	.	.	Q	+	1	0	FAM71C	98566120	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.263000	0.01174	-1.468000	0.01892	-1.497000	0.00963	CAA	.	.		0.498	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
DHX37	57647	hgsc.bcm.edu	37	12	125451681	125451681	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr12:125451681C>A	ENST00000308736.2	-	11	1590	c.1492G>T	c.(1492-1494)Gcc>Tcc	p.A498S	DHX37_ENST00000544745.1_Missense_Mutation_p.A285S	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	498	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TGTGGCCGGGCTCTGGAGGGT	0.662																																					p.A498S		Atlas-SNP	.											.	DHX37	114	.	0			c.G1492T						.						48.0	38.0	41.0					12																	125451681		2203	4300	6503	SO:0001583	missense	57647	exon11			GCCGGGCTCTGGA	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1492G>T	chr12.hg19:g.125451681C>A	ENSP00000311135:p.Ala498Ser	53.0	0.0		63.0	17.0	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	hg19	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	2.698	-0.271599	0.05716	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.13538	2.58;2.58	4.43	-1.92	0.07618	Helicase, C-terminal (1);	1.034950	0.07576	N	0.919411	T	0.05227	0.0139	N	0.12182	0.205	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.43097	-0.9412	10	0.11794	T	0.64	-22.1249	1.0184	0.01513	0.3778:0.292:0.1726:0.1577	.	498	Q8IY37	DHX37_HUMAN	S	498;285	ENSP00000311135:A498S;ENSP00000439009:A285S	ENSP00000311135:A498S	A	-	1	0	DHX37	124017634	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.043000	0.13971	-0.174000	0.10743	-0.152000	0.13540	GCC	.	.		0.662	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
FSCB	84075	hgsc.bcm.edu	37	14	44975143	44975143	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr14:44975143T>C	ENST00000340446.4	-	1	1339	c.1048A>G	c.(1048-1050)Att>Gtt	p.I350V	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	350	Pro-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GGAGGCAGAATTTCAGCCAGA	0.512																																					p.I350V		Atlas-SNP	.											.	FSCB	173	.	0			c.A1048G						.						73.0	85.0	81.0					14																	44975143		2203	4300	6503	SO:0001583	missense	84075	exon1			GCAGAATTTCAGC	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1048A>G	chr14.hg19:g.44975143T>C	ENSP00000344579:p.Ile350Val	135.0	0.0		123.0	35.0	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	hg19	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.700276	0.00725	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.12039	2.72	4.13	-8.26	0.01021	.	.	.	.	.	T	0.07052	0.0179	N	0.19112	0.55	0.09310	N	1	B	0.18741	0.03	B	0.17433	0.018	T	0.32666	-0.9898	9	0.25106	T	0.35	.	9.8942	0.41309	0.0:0.4712:0.3222:0.2066	.	350	Q5H9T9	FSCB_HUMAN	V	350	ENSP00000344579:I350V	ENSP00000344579:I350V	I	-	1	0	FSCB	44044893	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-5.784000	0.00098	-3.134000	0.00235	-0.548000	0.04221	ATT	.	.		0.512	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
HERC2	8924	hgsc.bcm.edu	37	15	28501325	28501325	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr15:28501325C>A	ENST00000261609.7	-	18	2764	c.2656G>T	c.(2656-2658)Gcc>Tcc	p.A886S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACGGCCTGGGCGGCCGACTGC	0.701																																					p.A886S		Atlas-SNP	.											HERC2,NS,carcinoma,0,1	HERC2	501	.	0			c.G2656T						.						14.0	16.0	15.0					15																	28501325		2168	4223	6391	SO:0001583	missense	8924	exon18			CCTGGGCGGCCGA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2656G>T	chr15.hg19:g.28501325C>A	ENSP00000261609:p.Ala886Ser	27.0	0.0		30.0	6.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537435	0.85917	.	.	ENSG00000128731	ENST00000261609	T	0.52754	0.65	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.70298	0.3208	M	0.79475	2.455	0.80722	D	1	D	0.63880	0.993	D	0.69479	0.964	T	0.73212	-0.4054	10	0.59425	D	0.04	.	19.0185	0.92903	0.0:1.0:0.0:0.0	.	886	O95714	HERC2_HUMAN	S	886	ENSP00000261609:A886S	ENSP00000261609:A886S	A	-	1	0	HERC2	26174920	1.000000	0.71417	0.803000	0.32268	0.439000	0.31926	6.048000	0.71046	2.500000	0.84329	0.539000	0.68188	GCC	.	.		0.701	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
FBXW10	10517	hgsc.bcm.edu	37	17	18654340	18654340	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:18654340C>A	ENST00000395665.4	+	5	1317	c.1096C>A	c.(1096-1098)Cat>Aat	p.H366N	FBXW10_ENST00000395667.1_Missense_Mutation_p.H366N|FBXW10_ENST00000301938.4_Missense_Mutation_p.H366N|FBXW10_ENST00000308799.4_Missense_Mutation_p.H395N			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	366										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GCGTGTGAAACATCCGAAGTG	0.478																																					p.H366N		Atlas-SNP	.											.	FBXW10	82	.	0			c.C1096A						.						193.0	186.0	189.0					17																	18654340		2203	4300	6503	SO:0001583	missense	10517	exon5			GTGAAACATCCGA	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1096C>A	chr17.hg19:g.18654340C>A	ENSP00000379025:p.His366Asn	102.0	0.0		60.0	23.0	NM_001267585	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	hg19	CCDS11199.3	.	.	.	.	.	.	.	.	.	.	C	0	-2.809061	0.00074	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	2.73	0.408	0.16377	F-box domain, Skp2-like (1);	0.597736	0.13615	N	0.374861	T	0.04003	0.0112	N	0.00707	-1.245	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.40327	-0.9569	10	0.07644	T	0.81	.	2.5763	0.04807	0.4417:0.2823:0.276:0.0	.	366;395;366;366	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	N	366;395;366;366	ENSP00000379026:H366N;ENSP00000310382:H395N;ENSP00000306937:H366N;ENSP00000379025:H366N	ENSP00000306937:H366N	H	+	1	0	FBXW10	18595065	0.130000	0.22417	0.406000	0.26421	0.367000	0.29736	0.394000	0.20834	0.264000	0.21851	-0.750000	0.03501	CAT	.	.		0.478	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
USP22	23326	hgsc.bcm.edu	37	17	20919117	20919117	+	Silent	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:20919117G>A	ENST00000261497.4	-	6	989	c.786C>T	c.(784-786)gaC>gaT	p.D262D	USP22_ENST00000537526.2_Silent_p.D250D|USP22_ENST00000455117.2_Intron	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	262	USP.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						ACTCGTGGGCGTCCTGCTGCT	0.627																																					p.D262D		Atlas-SNP	.											.	USP22	45	.	0			c.C786T						.						51.0	61.0	57.0					17																	20919117		2052	4184	6236	SO:0001819	synonymous_variant	23326	exon6			GTGGGCGTCCTGC	AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.786C>T	chr17.hg19:g.20919117G>A		107.0	0.0		59.0	26.0	NM_015276	A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Silent	SNP	ENST00000261497.4	hg19	CCDS42285.1																																																																																			.	.		0.627	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1		
DHRS7B	25979	hgsc.bcm.edu	37	17	21075458	21075458	+	Missense_Mutation	SNP	C	C	G	rs115639276		TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:21075458C>G	ENST00000395511.3	+	2	468	c.148C>G	c.(148-150)Ctg>Gtg	p.L50V	DHRS7B_ENST00000579303.1_Missense_Mutation_p.L35V	NM_015510.4	NP_056325.2	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B	50						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|pancreas(2)	7						GAAGGCCTACCTGCGGAATGC	0.672																																					p.L50V		Atlas-SNP	.											.	DHRS7B	27	.	0			c.C148G						.						34.0	32.0	32.0					17																	21075458		2203	4300	6503	SO:0001583	missense	25979	exon2			GCCTACCTGCGGA	BC004126	CCDS11215.1	17p12	2011-09-20				ENSG00000109016		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	24547	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 1"""					10810093, 11230166, 19027726	Standard	NM_015510		Approved	DKFZp566O084, MGC8916, CGI-93, SDR32C1	uc002gyo.3	Q6IAN0		ENST00000395511.3:c.148C>G	chr17.hg19:g.21075458C>G	ENSP00000378887:p.Leu50Val	148.0	0.0		99.0	43.0	NM_015510	B5MEF4|Q6UX59|Q9BTF9|Q9UFM6|Q9Y3A1	Missense_Mutation	SNP	ENST00000395511.3	hg19	CCDS11215.1	.	.	.	.	.	.	.	.	.	.	C	9.087	1.000787	0.19121	.	.	ENSG00000109016	ENST00000395511;ENST00000346603	T	0.58797	0.31	5.41	-3.28	0.05033	.	0.416255	0.26275	N	0.025309	T	0.36580	0.0972	L	0.34521	1.04	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.02676	-1.1125	10	0.48119	T	0.1	.	5.5244	0.16951	0.3673:0.3821:0.1893:0.0613	.	50	Q6IAN0	DRS7B_HUMAN	V	50	ENSP00000378887:L50V	ENSP00000320352:L50V	L	+	1	2	DHRS7B	21016050	0.046000	0.20272	0.104000	0.21259	0.451000	0.32288	-0.484000	0.06528	-0.171000	0.10797	-0.137000	0.14449	CTG	.	C|0.995;T|0.005		0.672	DHRS7B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444066.3	NM_015510	
CA10	56934	hgsc.bcm.edu	37	17	49710849	49710849	+	Missense_Mutation	SNP	G	G	A	rs375126312		TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:49710849G>A	ENST00000285273.4	-	9	2063	c.952C>T	c.(952-954)Ctt>Ttt	p.L318F	CA10_ENST00000571918.1_5'Flank|CA10_ENST00000340813.6_Missense_Mutation_p.L324F|CA10_ENST00000442502.2_Missense_Mutation_p.L318F|CA10_ENST00000451037.2_Missense_Mutation_p.L318F|CA10_ENST00000570565.1_Missense_Mutation_p.L243F	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	318					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CTATACTGAAGCTTCTGGGCT	0.502																																					p.L318F		Atlas-SNP	.											.	CA10	84	.	0			c.C952T						.	G	PHE/LEU,PHE/LEU,PHE/LEU	0,4406		0,0,2203	124.0	113.0	117.0		952,952,952	5.4	1.0	17		117	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	CA10	NM_001082533.1,NM_001082534.1,NM_020178.4	22,22,22	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	318/329,318/329,318/329	49710849	1,13005	2203	4300	6503	SO:0001583	missense	56934	exon9			ACTGAAGCTTCTG	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.952C>T	chr17.hg19:g.49710849G>A	ENSP00000285273:p.Leu318Phe	153.0	0.0		125.0	41.0	NM_001082534	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	hg19	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672754	0.88445	0.0	1.16E-4	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.71103	-0.5;-0.5;-0.5;-0.54	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	T	0.62756	0.2454	L	0.29908	0.895	0.80722	D	1	B;B;P	0.36483	0.267;0.267;0.555	B;B;B	0.36719	0.058;0.058;0.231	T	0.63919	-0.6528	10	0.42905	T	0.14	.	18.2623	0.90039	0.0:0.0:1.0:0.0	.	318;324;243	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	F	318;318;318;324	ENSP00000390666:L318F;ENSP00000285273:L318F;ENSP00000405388:L318F;ENSP00000340363:L324F	ENSP00000285273:L318F	L	-	1	0	CA10	47065848	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.583000	0.74053	2.558000	0.86282	0.655000	0.94253	CTT	.	.		0.502	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
BPTF	2186	hgsc.bcm.edu	37	17	65905802	65905802	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:65905802A>G	ENST00000321892.4	+	12	3356	c.3295A>G	c.(3295-3297)Aaa>Gaa	p.K1099E	BPTF_ENST00000424123.3_Missense_Mutation_p.K960E|BPTF_ENST00000306378.6_Missense_Mutation_p.K973E|BPTF_ENST00000335221.5_Missense_Mutation_p.K1099E			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1099					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGATGAGGTAAAAGGTTCAGA	0.363																																					p.K1099E		Atlas-SNP	.											.	BPTF	415	.	0			c.A3295G						.						58.0	57.0	57.0					17																	65905802		2203	4300	6503	SO:0001583	missense	2186	exon12			GAGGTAAAAGGTT	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3295A>G	chr17.hg19:g.65905802A>G	ENSP00000315454:p.Lys1099Glu	227.0	0.0		201.0	51.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	hg19		.	.	.	.	.	.	.	.	.	.	A	12.48	1.950761	0.34471	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.61859	0.07;0.07;0.11	6.07	5.0	0.66597	.	.	.	.	.	T	0.41789	0.1174	N	0.19112	0.55	0.20307	N	0.999911	B;B	0.24920	0.01;0.114	B;B	0.24394	0.009;0.053	T	0.28170	-1.0052	9	0.56958	D	0.05	-3.8014	8.167	0.31233	0.9133:0.0:0.0867:0.0	.	973;1099	Q12830-2;Q12830-4	.;.	E	973;1099;1099	ENSP00000307208:K973E;ENSP00000334351:K1099E;ENSP00000315454:K1099E	ENSP00000307208:K973E	K	+	1	0	BPTF	63336264	1.000000	0.71417	0.589000	0.28718	0.968000	0.65278	2.991000	0.49409	2.326000	0.78906	0.533000	0.62120	AAA	.	.		0.363	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
SDK2	54549	hgsc.bcm.edu	37	17	71361407	71361407	+	Silent	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:71361407G>A	ENST00000392650.3	-	38	5295	c.5295C>T	c.(5293-5295)agC>agT	p.S1765S	SDK2_ENST00000388726.3_Silent_p.S1746S|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1765	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CATCCACGGGGCTGCAGGGCT	0.612																																					p.S1765S		Atlas-SNP	.											.	SDK2	219	.	0			c.C5295T						.						27.0	26.0	26.0					17																	71361407		2203	4300	6503	SO:0001819	synonymous_variant	54549	exon38			CACGGGGCTGCAG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5295C>T	chr17.hg19:g.71361407G>A		64.0	0.0		41.0	21.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	hg19	CCDS45769.1																																																																																			.	.		0.612	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
PPP5C	5536	hgsc.bcm.edu	37	19	46891672	46891672	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr19:46891672G>A	ENST00000012443.4	+	10	1246	c.1143G>A	c.(1141-1143)atG>atA	p.M381I	PPP5C_ENST00000391919.1_Missense_Mutation_p.M253I|AC007193.8_ENST00000598616.1_RNA	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	381	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CAGGGCCCATGTGTGACCTGC	0.672																																					p.M381I		Atlas-SNP	.											.	PPP5C	44	.	0			c.G1143A						.						56.0	52.0	53.0					19																	46891672		2203	4300	6503	SO:0001583	missense	5536	exon10			GCCCATGTGTGAC		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.1143G>A	chr19.hg19:g.46891672G>A	ENSP00000012443:p.Met381Ile	90.0	0.0		99.0	35.0	NM_006247	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	hg19	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.278012	0.59758	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	T;T	0.05199	3.48;3.48	4.8	3.68	0.42216	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.041386	0.85682	D	0.000000	T	0.17916	0.0430	M	0.78285	2.405	0.80722	D	1	P;B	0.48640	0.913;0.18	P;B	0.54499	0.754;0.128	T	0.00557	-1.1672	10	0.49607	T	0.09	-25.508	12.1384	0.53984	0.0:0.1745:0.8255:0.0	.	381;381	B2R6R6;P53041	.;PPP5_HUMAN	I	381;368;253	ENSP00000012443:M381I;ENSP00000375786:M253I	ENSP00000012443:M381I	M	+	3	0	PPP5C	51583512	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.143000	0.77348	2.211000	0.71520	0.491000	0.48974	ATG	.	.		0.672	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
SIGLEC14	100049587	hgsc.bcm.edu	37	19	52147072	52147072	+	Silent	SNP	C	C	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr19:52147072C>T	ENST00000360844.6	-	5	1013	c.972G>A	c.(970-972)ccG>ccA	p.P324P	SIGLEC5_ENST00000534261.2_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000222107.4_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	324	Ig-like C2-type 2.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GGGAGCCCAGCGGATGCTGAA	0.577																																					p.P324P		Atlas-SNP	.											.	SIGLEC14	46	.	0			c.G972A						.						47.0	53.0	51.0					19																	52147072		1803	4039	5842	SO:0001819	synonymous_variant	100049587	exon5			GCCCAGCGGATGC	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.972G>A	chr19.hg19:g.52147072C>T		115.0	0.0		125.0	34.0	NM_001098612	Q6UXG0	Silent	SNP	ENST00000360844.6	hg19	CCDS42604.1																																																																																			.	.		0.577	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612	
ZFP28	140612	hgsc.bcm.edu	37	19	57065248	57065248	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr19:57065248A>T	ENST00000301318.3	+	8	1165	c.1094A>T	c.(1093-1095)aAc>aTc	p.N365I	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		ATTACTCATAACAAAACCCTC	0.378																																					p.N365I	Ovarian(124;554 1662 19430 21141 52494)	Atlas-SNP	.											.	ZFP28	99	.	0			c.A1094T						.						82.0	76.0	78.0					19																	57065248		2203	4300	6503	SO:0001583	missense	140612	exon8			CTCATAACAAAAC		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1094A>T	chr19.hg19:g.57065248A>T	ENSP00000301318:p.Asn365Ile	165.0	0.0		179.0	91.0	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	hg19	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	A	3.378	-0.126951	0.06795	.	.	ENSG00000196867	ENST00000301318	T	0.05139	3.49	4.96	2.86	0.33363	.	0.554792	0.16498	N	0.211799	T	0.04770	0.0129	N	0.26130	0.795	0.19775	N	0.999959	P	0.45283	0.855	B	0.38327	0.271	T	0.34800	-0.9814	10	0.62326	D	0.03	.	7.8401	0.29393	0.8255:0.0:0.1745:0.0	.	365	Q8NHY6	ZFP28_HUMAN	I	365	ENSP00000301318:N365I	ENSP00000301318:N365I	N	+	2	0	ZFP28	61757060	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	0.571000	0.23669	0.372000	0.24591	0.533000	0.62120	AAC	.	.		0.378	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
SLC5A4	6527	hgsc.bcm.edu	37	22	32620469	32620469	+	Splice_Site	SNP	C	C	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr22:32620469C>A	ENST00000266086.4	-	13	1461	c.1450G>T	c.(1450-1452)Gga>Tga	p.G484*	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	484					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAGAATGCTCCCTGCAAAAGA	0.408																																					p.G484X		Atlas-SNP	.											.	SLC5A4	82	.	0			c.G1450T						.						45.0	40.0	41.0					22																	32620469		2203	4300	6503	SO:0001630	splice_region_variant	6527	exon13			ATGCTCCCTGCAA	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1450-1G>T	chr22.hg19:g.32620469C>A		125.0	0.0		114.0	35.0	NM_014227	O15279	Nonsense_Mutation	SNP	ENST00000266086.4	hg19	CCDS13903.1	.	.	.	.	.	.	.	.	.	.	C	32	5.118820	0.94385	.	.	ENSG00000100191	ENST00000266086	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.4815	0.75530	0.0:1.0:0.0:0.0	.	.	.	.	X	484	.	ENSP00000266086:G484X	G	-	1	0	SLC5A4	30950469	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	7.463000	0.80869	2.507000	0.84556	0.643000	0.83706	GGA	.	.		0.408	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227	Nonsense_Mutation
APOBEC3B	9582	hgsc.bcm.edu	37	22	39387543	39387543	+	Silent	SNP	C	C	G			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr22:39387543C>G	ENST00000333467.3	+	6	975	c.930C>G	c.(928-930)gcC>gcG	p.A310A	APOBEC3B_ENST00000407298.3_Silent_p.A285A|APOBEC3B_ENST00000402182.3_Silent_p.A310A|APOBEC3B-AS1_ENST00000513758.2_RNA	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	310					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					TCTTCGCTGCCCGCATCTATG	0.572																																					p.A310A		Atlas-SNP	.											.	APOBEC3B	32	.	0			c.C930G						.						126.0	123.0	124.0					22																	39387543		2199	4282	6481	SO:0001819	synonymous_variant	9582	exon6			CGCTGCCCGCATC	AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.930C>G	chr22.hg19:g.39387543C>G		205.0	0.0		183.0	37.0	NM_004900	B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Silent	SNP	ENST00000333467.3	hg19	CCDS13982.1																																																																																			.	.		0.572	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321233.1	NM_004900	
MAOB	4129	hgsc.bcm.edu	37	X	43634423	43634423	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chrX:43634423T>A	ENST00000378069.4	-	12	1381	c.1234A>T	c.(1234-1236)Agg>Tgg	p.R412W	MAOB_ENST00000538942.1_Intron|MAOB_ENST00000536181.1_Splice_Site_p.R396W	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	412					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	TTACTCTACCTTCCATATTGA	0.448																																					p.R412W		Atlas-SNP	.											.	MAOB	52	.	0			c.A1234T						.						42.0	39.0	40.0					X																	43634423		2203	4300	6503	SO:0001630	splice_region_variant	4129	exon12			TCTACCTTCCATA		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.1235+1A>T	chrX.hg19:g.43634423T>A		45.0	0.0		45.0	27.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.905092	0.92035	.	.	ENSG00000069535	ENST00000378069;ENST00000536181	D;D	0.92348	-3.02;-3.02	5.96	5.96	0.96718	Amine oxidase (1);	0.044283	0.85682	D	0.000000	D	0.96071	0.8720	M	0.84683	2.71	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	D	0.96501	0.9371	10	0.72032	D	0.01	-6.3778	14.2661	0.66118	0.0:0.0:0.0:1.0	.	412	P27338	AOFB_HUMAN	W	412;396	ENSP00000367309:R412W;ENSP00000441613:R396W	ENSP00000367309:R412W	R	-	1	2	MAOB	43519367	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.422000	0.66453	2.015000	0.59207	0.486000	0.48141	AGG	.	.		0.448	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7576854	7576860	+	Splice_Site	DEL	TGAAGGG	TGAAGGG	-			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	TGAAGGG	TGAAGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:7576854_7576860delTGAAGGG	ENST00000269305.4	-	9	1175_1181	c.986_992delCCCTTCA	c.(985-993)acccttcag>ag	p.TLQ329fs	TP53_ENST00000420246.2_Splice_Site_p.TLQ329fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site_p.TLQ329fs|TP53_ENST00000359597.4_Splice_Site_p.TLQ329fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Splice_Site_p.TLQ329fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	329	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		T -> I (in a sporadic cancer; somatic mutation).|T -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q331*(23)|p.0?(8)|p.Q331fs*6(3)|p.Q331P(3)|p.T329I(3)|p.L330H(3)|p.T329T(2)|p.Q331fs*14(1)|p.?(1)|p.L330P(1)|p.Q331R(1)|p.L330fs*15(1)|p.L330R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACTTAGTACCTGAAGGGTGAAATATTC	0.444		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.329_331del	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,0,3	TP53	33396	.	51	Substitution - Nonsense(23)|Substitution - Missense(12)|Whole gene deletion(8)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Substitution - coding silent(2)|Unknown(1)	skin(6)|lung(6)|large_intestine(5)|urinary_tract(5)|ovary(5)|upper_aerodigestive_tract(4)|oesophagus(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|breast(2)|liver(2)|stomach(1)|prostate(1)	c.987_993del						.																																			SO:0001630	splice_region_variant	7157	exon9	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1CCCTTCA>-	chr17.hg19:g.7576854_7576860delTGAAGGG		162.0	0.0		51.0	20.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.444	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Frame_Shift_Del
NF1	4763	hgsc.bcm.edu	37	17	29657472	29657483	+	In_Frame_Del	DEL	CGTTAGAATTTT	CGTTAGAATTTT	-	rs137854565		TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	CGTTAGAATTTT	CGTTAGAATTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr17:29657472_29657483delCGTTAGAATTTT	ENST00000358273.4	+	39	6151_6162	c.5768_5779delCGTTAGAATTTT	c.(5767-5781)acgttagaatttttg>atg	p.1923_1927TLEFL>M	NF1_ENST00000356175.3_In_Frame_Del_p.1902_1906TLEFL>M|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1923					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCACACCTCACGTTAGAATTTTTGGAAGAGTG	0.354			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.1923_1926del		Atlas-INDEL	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.5767_5778del	GRCh37	CD086562	NF1	D		.																																			SO:0001651	inframe_deletion	4763	exon39	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5768_5779delCGTTAGAATTTT	chr17.hg19:g.29657472_29657483delCGTTAGAATTTT	ENSP00000351015:p.Thr1923_Leu1927delinsMet	100.0	0.0		87.0	17.0	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	In_Frame_Del	DEL	ENST00000358273.4	hg19	CCDS42292.1																																																																																			.	.		0.354	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
MLH3	27030	hgsc.bcm.edu	37	14	75485660	75485678	+	Frame_Shift_Del	DEL	GGCCATCATTAAACTTAAT	GGCCATCATTAAACTTAAT	-	rs61752724|rs142590981		TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	GGCCATCATTAAACTTAAT	GGCCATCATTAAACTTAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr14:75485660_75485678delGGCCATCATTAAACTTAAT	ENST00000556740.1	-	11	4131_4149	c.4096_4114delATTAAGTTTAATGATGGCC	c.(4096-4116)attaagtttaatgatggcctgfs	p.IKFNDGL1366fs	MLH3_ENST00000355774.2_Frame_Shift_Del_p.IKFNDGL1366fs|MLH3_ENST00000238662.7_Frame_Shift_Del_p.IKFNDGL1342fs|MLH3_ENST00000380968.2_Frame_Shift_Del_p.IKFNDGL304fs|MLH3_ENST00000556257.1_Frame_Shift_Del_p.IKFNDGL1188fs|RNU6-689P_ENST00000384197.1_RNA			Q9UHC1	MLH3_HUMAN	mutL homolog 3	1366					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TGTAAGCTCAGGCCATCATTAAACTTAATGGCCCCTAAA	0.452								Mismatch excision repair (MMR)																													p.1366_1372del		Atlas-INDEL	.											.	MLH3	200	.	0			c.4097_4115del						.																																			SO:0001589	frameshift_variant	27030	exon12			.	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.4096_4114delATTAAGTTTAATGATGGCC	chr14.hg19:g.75485660_75485678delGGCCATCATTAAACTTAAT	ENSP00000452316:p.Ile1366fs	77.0	0.0		85.0	16.0	NM_001040108	P49751|Q56DK9|Q9P292|Q9UHC0	Frame_Shift_Del	DEL	ENST00000556740.1	hg19	CCDS32123.1																																																																																			.	.		0.452	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
C11orf48	79081	hgsc.bcm.edu	37	11	62437490	62437493	+	Frame_Shift_Del	DEL	GGCA	GGCA	-			TCGA-DD-AACM-01A-11D-A40R-10	TCGA-DD-AACM-10A-01D-A40U-10	GGCA	GGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f581ac9-bc00-4c25-8727-7069d737912e	c758de19-378a-4db8-b408-599509d3864c	g.chr11:62437490_62437493delGGCA	ENST00000431002.2	-	1	1744_1747	c.11_14delTGCC	c.(10-15)gtgccafs	p.VP4fs	C11orf48_ENST00000532208.1_Frame_Shift_Del_p.VP4fs|C11orf48_ENST00000354588.3_Frame_Shift_Del_p.VP4fs|C11orf83_ENST00000531323.1_5'Flank|C11orf83_ENST00000377953.3_5'Flank			Q9BQE6	CK048_HUMAN	chromosome 11 open reading frame 48	4										endometrium(1)|lung(5)|urinary_tract(1)	7						GCTTCTCCCTGGCACAAGGGCCAT	0.529																																					p.4_5del		Atlas-INDEL	.											.	C11orf48	18	.	0			c.12_15del						.																																			SO:0001589	frameshift_variant	79081	exon2			.	BC001434	CCDS8028.1	11q12.3	2014-02-12			ENSG00000162194	ENSG00000162194			28351	protein-coding gene	gene with protein product						12477932	Standard	NM_024099		Approved	MGC2477	uc001nuf.3	Q9BQE6	OTTHUMG00000167588	ENST00000431002.2:c.11_14delTGCC	chr11.hg19:g.62437490_62437493delGGCA	ENSP00000416856:p.Val4fs	76.0	0.0		62.0	18.0	NM_024099	Q96NA4	Frame_Shift_Del	DEL	ENST00000431002.2	hg19																																																																																				.	.		0.529	C11orf48-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000395233.1	NM_024099	
