#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R1	80835	hgsc.bcm.edu	37	1	6630983	6630983	+	Missense_Mutation	SNP	A	A	T	rs373171619		TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:6630983A>T	ENST00000333172.6	+	2	399	c.206A>T	c.(205-207)aAt>aTt	p.N69I	TAS1R1_ENST00000351136.3_Missense_Mutation_p.N69I|TAS1R1_ENST00000328191.4_Missense_Mutation_p.N69I	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	69					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGTAGCTTCAATGAGCATGGC	0.567																																					p.N69I		Atlas-SNP	.											.	TAS1R1	76	.	0			c.A206T						.						112.0	101.0	105.0					1																	6630983		2203	4300	6503	SO:0001583	missense	80835	exon2			GCTTCAATGAGCA		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.206A>T	chr1.hg19:g.6630983A>T	ENSP00000331867:p.Asn69Ile	62.0	0.0		60.0	5.0	NM_177540	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	ENST00000333172.6	hg19	CCDS81.1	.	.	.	.	.	.	.	.	.	.	A	6.915	0.538504	0.13250	.	.	ENSG00000173662	ENST00000333172;ENST00000328191;ENST00000351136	D;D;D	0.86497	-2.13;-2.13;-2.13	5.08	3.95	0.45737	.	0.105784	0.64402	D	0.000008	D	0.89529	0.6741	L	0.54323	1.7	0.44523	D	0.997475	D;D;D;D	0.89917	1.0;0.997;0.989;0.997	D;D;P;D	0.79784	0.993;0.964;0.885;0.94	D	0.87319	0.2317	10	0.54805	T	0.06	.	5.5356	0.17009	0.7371:0.172:0.0908:0.0	.	69;69;69;69	Q7RTX1-3;Q7RTX1-4;Q7RTX1-2;Q7RTX1	.;.;.;TS1R1_HUMAN	I	69	ENSP00000331867:N69I;ENSP00000327705:N69I;ENSP00000312558:N69I	ENSP00000327705:N69I	N	+	2	0	TAS1R1	6553570	0.846000	0.29590	0.862000	0.33874	0.221000	0.24807	1.677000	0.37576	0.745000	0.32763	0.528000	0.53228	AAT	.	.		0.567	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
GIPC2	54810	hgsc.bcm.edu	37	1	78601371	78601371	+	Nonsense_Mutation	SNP	G	G	T	rs138793126		TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:78601371G>T	ENST00000370759.3	+	6	1085	c.892G>T	c.(892-894)Gaa>Taa	p.E298*		NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	298						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						GTTCCCAGACGAATTTGTCTT	0.423																																					p.E298X		Atlas-SNP	.											GIPC2,NS,carcinoma,0,1	GIPC2	37	.	0			c.G892T						.						111.0	98.0	103.0					1																	78601371		2203	4300	6503	SO:0001587	stop_gained	54810	exon6			CCAGACGAATTTG	AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.892G>T	chr1.hg19:g.78601371G>T	ENSP00000359795:p.Glu298*	101.0	0.0		71.0	3.0	NM_017655	Q8IYD3|Q9NXS7	Nonsense_Mutation	SNP	ENST00000370759.3	hg19	CCDS685.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303818	0.81136	.	.	ENSG00000137960	ENST00000370759	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-10.7864	19.85	0.96736	0.0:0.0:1.0:0.0	.	.	.	.	X	298	.	ENSP00000359795:E298X	E	+	1	0	GIPC2	78373959	1.000000	0.71417	1.000000	0.80357	0.065000	0.16274	9.447000	0.97595	2.771000	0.95319	0.650000	0.86243	GAA	.	G|1.000;A|0.000		0.423	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098629.1	NM_017655	
TCHH	7062	hgsc.bcm.edu	37	1	152084224	152084224	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:152084224T>C	ENST00000368804.1	-	2	1468	c.1469A>G	c.(1468-1470)aAg>aGg	p.K490R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	490	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCGAGCTTCAGCCAACG	0.672																																					p.K490R		Atlas-SNP	.											.	TCHH	275	.	0			c.A1469G						.						65.0	71.0	69.0					1																	152084224		2109	4224	6333	SO:0001583	missense	7062	exon3			TCGAGCTTCAGCC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1469A>G	chr1.hg19:g.152084224T>C	ENSP00000357794:p.Lys490Arg	28.0	0.0		64.0	5.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	t	8.419	0.845945	0.16963	.	.	ENSG00000159450	ENST00000368804	T	0.04654	3.58	2.98	-5.97	0.02227	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48547	-0.9026	9	0.09590	T	0.72	.	5.0277	0.14393	0.1398:0.4054:0.0:0.4548	.	490	Q07283	TRHY_HUMAN	R	490	ENSP00000357794:K490R	ENSP00000357794:K490R	K	-	2	0	TCHH	150350848	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.247000	0.00266	-1.053000	0.03218	-1.396000	0.01147	AAG	.	.		0.672	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TDRD10	126668	hgsc.bcm.edu	37	1	154516919	154516919	+	Silent	SNP	G	G	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:154516919G>A	ENST00000368480.3	+	10	808	c.723G>A	c.(721-723)gaG>gaA	p.E241E	TDRD10_ENST00000368482.4_Silent_p.E241E|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	241	Tudor.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCTACCTGGAGGGCTCCACCG	0.632																																					p.E241E		Atlas-SNP	.											.	TDRD10	48	.	0			c.G723A						.						35.0	31.0	32.0					1																	154516919		2203	4300	6503	SO:0001819	synonymous_variant	126668	exon10			CCTGGAGGGCTCC	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.723G>A	chr1.hg19:g.154516919G>A		252.0	0.0		339.0	44.0	NM_182499	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Silent	SNP	ENST00000368480.3	hg19	CCDS41406.1																																																																																			.	.		0.632	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
KCNT2	343450	hgsc.bcm.edu	37	1	196394993	196394993	+	Silent	SNP	T	T	C			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:196394993T>C	ENST00000294725.9	-	11	2025	c.1110A>G	c.(1108-1110)ctA>ctG	p.L370L	KCNT2_ENST00000609185.1_Silent_p.L370L|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000367431.4_Silent_p.L370L|KCNT2_ENST00000367433.5_Silent_p.L370L			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	370					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTGCTCTCAATAGGTCTTGAT	0.403																																					p.L370L		Atlas-SNP	.											KCNT2,colon,carcinoma,0,1	KCNT2	243	.	0			c.A1110G						.						175.0	160.0	165.0					1																	196394993		2203	4300	6503	SO:0001819	synonymous_variant	343450	exon11			TCTCAATAGGTCT	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1110A>G	chr1.hg19:g.196394993T>C		133.0	0.0		214.0	59.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	hg19	CCDS1384.1																																																																																			.	.		0.403	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
CRB1	23418	hgsc.bcm.edu	37	1	197390426	197390426	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:197390426G>T	ENST00000367400.3	+	6	1603	c.1468G>T	c.(1468-1470)Ggc>Tgc	p.G490C	CRB1_ENST00000543483.1_Missense_Mutation_p.G189C|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000538660.1_Missense_Mutation_p.G490C|CRB1_ENST00000544212.1_5'UTR|CRB1_ENST00000476483.1_3'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.G421C|CRB1_ENST00000367399.2_Missense_Mutation_p.G378C	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	490	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTCATTTGAGGGCGATGGCTT	0.517																																					p.G490C		Atlas-SNP	.											.	CRB1	284	.	0			c.G1468T						.						106.0	95.0	99.0					1																	197390426		2203	4300	6503	SO:0001583	missense	23418	exon6			TTTGAGGGCGATG		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1468G>T	chr1.hg19:g.197390426G>T	ENSP00000356370:p.Gly490Cys	84.0	0.0		144.0	22.0	NM_001257966	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	hg19	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810482	0.32053	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000367401	D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81	5.82	3.94	0.45596	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	D	0.91168	0.7218	M	0.78916	2.43	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.74348	0.942;0.981;0.974;0.983;0.953	D	0.90763	0.4666	9	0.56958	D	0.05	.	12.1515	0.54051	0.1271:0.0:0.8729:0.0	.	490;421;378;139;490	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	C	421;490;490;378;189;139	ENSP00000438786:G421C;ENSP00000438091:G490C;ENSP00000356370:G490C;ENSP00000356369:G378C;ENSP00000439579:G189C	ENSP00000356369:G378C	G	+	1	0	CRB1	195657049	1.000000	0.71417	0.015000	0.15790	0.003000	0.03518	3.934000	0.56553	0.782000	0.33613	0.650000	0.86243	GGC	.	.		0.517	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
LAMB3	3914	hgsc.bcm.edu	37	1	209807908	209807908	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr1:209807908C>T	ENST00000356082.4	-	6	582	c.448G>A	c.(448-450)Gct>Act	p.A150T	LAMB3_ENST00000391911.1_Missense_Mutation_p.A150T|LAMB3_ENST00000367030.3_Missense_Mutation_p.A150T	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	150	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CAGTCGGCAGCCAGGTACTGG	0.652																																					p.A150T		Atlas-SNP	.											.	LAMB3	136	.	0			c.G448A						.						64.0	56.0	59.0					1																	209807908		2203	4300	6503	SO:0001583	missense	3914	exon6			CGGCAGCCAGGTA	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.448G>A	chr1.hg19:g.209807908C>T	ENSP00000348384:p.Ala150Thr	104.0	0.0		196.0	123.0	NM_000228	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	hg19	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307411	0.81247	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000415782	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	4.57	4.57	0.56435	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90652	0.7068	M	0.91406	3.205	0.58432	D	0.999995	D	0.76494	0.999	D	0.68765	0.96	D	0.92418	0.5943	10	0.87932	D	0	.	13.1427	0.59444	0.1604:0.8396:0.0:0.0	.	150	Q13751	LAMB3_HUMAN	T	150	ENSP00000375778:A150T;ENSP00000348384:A150T;ENSP00000355997:A150T;ENSP00000388960:A150T	ENSP00000348384:A150T	A	-	1	0	LAMB3	207874531	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	2.423000	0.44705	2.381000	0.81170	0.558000	0.71614	GCT	.	.		0.652	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
AMER3	205147	hgsc.bcm.edu	37	2	131520231	131520231	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr2:131520231C>T	ENST00000423981.1	+	2	696	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W	AMER3_ENST00000321420.4_Missense_Mutation_p.R196W	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	196					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										CCCTGGGGGGCGGCGAAGCAA	0.672																																					p.R196W		Atlas-SNP	.											.	.	.	.	0			c.C586T						.						25.0	32.0	29.0					2																	131520231		2200	4284	6484	SO:0001583	missense	205147	exon2			GGGGGGCGGCGAA	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.586C>T	chr2.hg19:g.131520231C>T	ENSP00000392700:p.Arg196Trp	61.0	0.0		58.0	13.0	NM_152698	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	hg19	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.415480	0.25552	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.54279	0.58;0.58	5.21	0.769	0.18492	.	1.448950	0.03947	N	0.287921	T	0.52517	0.1739	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	P	0.54815	0.761	T	0.47560	-0.9108	10	0.72032	D	0.01	.	8.3373	0.32221	0.4865:0.3968:0.1168:0.0	.	196	Q8N944	F123C_HUMAN	W	196	ENSP00000314914:R196W;ENSP00000392700:R196W	ENSP00000314914:R196W	R	+	1	2	FAM123C	131236701	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.044000	0.13992	0.009000	0.14813	-0.314000	0.08810	CGG	.	.		0.672	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
P2RY12	64805	hgsc.bcm.edu	37	3	151056067	151056067	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr3:151056067T>C	ENST00000302632.3	-	3	866	c.567A>G	c.(565-567)atA>atG	p.I189M	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000491549.1_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	189					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TGTAATTTACTATTTCATGCC	0.358																																					p.I189M		Atlas-SNP	.											.	P2RY12	36	.	0			c.A567G						.						88.0	87.0	87.0					3																	151056067		2203	4300	6503	SO:0001583	missense	64805	exon3			ATTTACTATTTCA	AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.567A>G	chr3.hg19:g.151056067T>C	ENSP00000307259:p.Ile189Met	103.0	0.0		95.0	18.0	NM_022788	D3DNJ5|Q546J7	Missense_Mutation	SNP	ENST00000302632.3	hg19	CCDS3159.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.076140	0.36662	.	.	ENSG00000169313	ENST00000302632	T	0.73469	-0.75	5.42	-3.77	0.04346	GPCR, rhodopsin-like superfamily (1);	0.266926	0.42172	D	0.000758	T	0.59542	0.2201	L	0.57536	1.79	0.33964	D	0.645931	B	0.14438	0.01	B	0.22386	0.039	T	0.40117	-0.9580	10	0.33141	T	0.24	-18.7762	2.695	0.05132	0.2655:0.0802:0.3979:0.2564	.	189	Q9H244	P2Y12_HUMAN	M	189	ENSP00000307259:I189M	ENSP00000307259:I189M	I	-	3	3	P2RY12	152538757	0.688000	0.27680	0.996000	0.52242	0.993000	0.82548	-0.138000	0.10374	-0.171000	0.10797	0.533000	0.62120	ATA	.	.		0.358	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357796.1		
JAKMIP1	152789	hgsc.bcm.edu	37	4	6037770	6037770	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr4:6037770C>T	ENST00000409021.3	-	19	2689	c.2240G>A	c.(2239-2241)gGt>gAt	p.G747D	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.G562D	NM_001099433.1	NP_001092903.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	103					cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CAGCGCCTCACCGGCCCTCCG	0.642																																					p.G747D		Atlas-SNP	.											.	JAKMIP1	250	.	0			c.G2240A						.						10.0	13.0	12.0					4																	6037770		2067	4128	6195	SO:0001583	missense	152789	exon19			GCCTCACCGGCCC	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000409021.3:c.2240G>A	chr4.hg19:g.6037770C>T	ENSP00000386711:p.Gly747Asp	143.0	0.0		116.0	30.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000409021.3	hg19	CCDS47005.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048128	0.36181	.	.	ENSG00000152969	ENST00000409021;ENST00000409371	T;T	0.30714	1.94;1.52	4.79	4.79	0.61399	.	0.116804	0.31071	U	0.008301	T	0.22859	0.0552	.	.	.	0.80722	D	1	B;B	0.25609	0.02;0.13	B;B	0.32533	0.05;0.147	T	0.05666	-1.0871	9	0.13470	T	0.59	.	12.6993	0.57022	0.0:0.8344:0.1656:0.0	.	562;747	Q96N16-5;Q96N16-2	.;.	D	747;562	ENSP00000386711:G747D;ENSP00000387042:G562D	ENSP00000386711:G747D	G	-	2	0	JAKMIP1	6088671	0.999000	0.42202	0.927000	0.36925	0.457000	0.32468	3.058000	0.49939	2.219000	0.72066	0.436000	0.28706	GGT	.	.		0.642	JAKMIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329747.1	NM_144720	
ATP8A1	10396	hgsc.bcm.edu	37	4	42524292	42524292	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr4:42524292A>G	ENST00000381668.5	-	22	2063	c.1832T>C	c.(1831-1833)gTg>gCg	p.V611A	ATP8A1_ENST00000264449.10_Missense_Mutation_p.V596A	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	611					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	AATCTCAGCCACAGCAAAACA	0.418																																					p.V611A		Atlas-SNP	.											.	ATP8A1	206	.	0			c.T1832C						.						70.0	66.0	67.0					4																	42524292		2203	4300	6503	SO:0001583	missense	10396	exon22			TCAGCCACAGCAA	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1832T>C	chr4.hg19:g.42524292A>G	ENSP00000371084:p.Val611Ala	83.0	0.0		90.0	13.0	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	hg19	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.848875	0.32699	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.67345	-0.26;-0.26	5.54	5.54	0.83059	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.69584	0.3127	L	0.33137	0.985	0.80722	D	1	B;B	0.32862	0.387;0.037	P;B	0.48089	0.566;0.055	T	0.70597	-0.4828	10	0.51188	T	0.08	.	15.9755	0.80060	1.0:0.0:0.0:0.0	.	596;611	Q32M35;Q9Y2Q0	.;AT8A1_HUMAN	A	611;596	ENSP00000371084:V611A;ENSP00000264449:V596A	ENSP00000264449:V596A	V	-	2	0	ATP8A1	42219049	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	8.196000	0.89725	2.219000	0.72066	0.528000	0.53228	GTG	.	.		0.418	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
KIT	3815	hgsc.bcm.edu	37	4	55569979	55569979	+	Silent	SNP	T	T	C			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr4:55569979T>C	ENST00000288135.5	+	5	943	c.846T>C	c.(844-846)gtT>gtC	p.V282V		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	282	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCGAGAGTTAATGATTCTG	0.398		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.V282V		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.T846C						.						152.0	150.0	150.0					4																	55569979		2203	4300	6503	SO:0001819	synonymous_variant	3815	exon5	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GAGAGTTAATGAT	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.846T>C	chr4.hg19:g.55569979T>C		222.0	0.0		139.0	87.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	ENST00000288135.5	hg19	CCDS3496.1																																																																																			.	.		0.398	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
ALB	213	hgsc.bcm.edu	37	4	74272458	74272458	+	Missense_Mutation	SNP	G	G	C	rs77050410		TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr4:74272458G>C	ENST00000295897.4	+	3	339	c.250G>C	c.(250-252)Gaa>Caa	p.E84Q	ALB_ENST00000503124.1_Silent_p.L4L|ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000509063.1_Missense_Mutation_p.E84Q	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGAGTCAGCTGAAAATTGTGA	0.323																																					p.E84Q		Atlas-SNP	.											.,1	ALB	132	.	0			c.G250C	GRCh37	CM900420	ALB	M	rs77050410	.						98.0	92.0	94.0					4																	74272458		2203	4300	6503	SO:0001583	missense	213	exon3			TCAGCTGAAAATT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.250G>C	chr4.hg19:g.74272458G>C	ENSP00000295897:p.Glu84Gln	65.0	0.0		18.0	0.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000295897.4	hg19	CCDS3555.1	.	.	.	.	.	.	.	.	.	.	G	9.932	1.215120	0.22373	.	.	ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000329326;ENST00000509063;ENST00000430202	T;T;T	0.73789	-0.78;-0.78;-0.78	5.44	2.6	0.31112	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.861933	0.09632	N	0.776156	T	0.71005	0.3289	L	0.47716	1.5	0.09310	N	0.999999	B;B	0.14438	0.01;0.005	B;B	0.18561	0.01;0.022	T	0.57734	-0.7760	10	0.36615	T	0.2	-1.6974	16.7573	0.85503	0.0:0.6476:0.3524:0.0	.	84;84	A6NBZ8;P02768	.;ALBU_HUMAN	Q	86;84;84;84;93	ENSP00000392541:E86Q;ENSP00000295897:E84Q;ENSP00000422784:E84Q	ENSP00000295897:E84Q	E	+	1	0	ALB	74491322	0.001000	0.12720	0.002000	0.10522	0.995000	0.86356	1.001000	0.29783	0.340000	0.23745	0.650000	0.86243	GAA	.	.		0.323	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	
UNC5C	8633	hgsc.bcm.edu	37	4	96141175	96141175	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr4:96141175C>T	ENST00000453304.1	-	8	1609	c.1261G>A	c.(1261-1263)Ggg>Agg	p.G421R	UNC5C_ENST00000506749.1_Missense_Mutation_p.G440R	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	421					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TGAAAGCCCCCATTGAGTGCC	0.443																																					p.G421R		Atlas-SNP	.											.	UNC5C	141	.	0			c.G1261A						.						140.0	128.0	132.0					4																	96141175		2203	4300	6503	SO:0001583	missense	8633	exon8			AGCCCCCATTGAG	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1261G>A	chr4.hg19:g.96141175C>T	ENSP00000406022:p.Gly421Arg	318.0	0.0		190.0	95.0	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	hg19	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022802	0.93462	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.61627	0.48;0.17;0.09	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.80369	0.4610	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.91635	0.918;0.999;0.999	T	0.82532	-0.0410	10	0.87932	D	0	.	19.9179	0.97070	0.0:1.0:0.0:0.0	.	421;440;421	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	R	421;380;440;440	ENSP00000406022:G421R;ENSP00000426924:G440R;ENSP00000426153:G440R	ENSP00000328673:G380R	G	-	1	0	UNC5C	96360198	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.818000	0.86416	2.723000	0.93209	0.655000	0.94253	GGG	.	.		0.443	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
CCT5	22948	hgsc.bcm.edu	37	5	10250466	10250466	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr5:10250466G>T	ENST00000280326.4	+	1	434	c.14G>T	c.(13-15)gGg>gTg	p.G5V	CCT5_ENST00000506600.1_5'Flank|FAM173B_ENST00000280330.8_5'Flank|FAM173B_ENST00000511437.1_5'Flank|CTD-2256P15.1_ENST00000509915.1_RNA|CCT5_ENST00000515390.1_Missense_Mutation_p.G5V|FAM173B_ENST00000510052.1_5'Flank|CCT5_ENST00000515676.1_5'Flank|CCT5_ENST00000503026.1_Intron|FAM173B_ENST00000510047.1_5'Flank	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	5					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						GCGTCCATGGGGACCCTCGCC	0.577																																					p.G5V		Atlas-SNP	.											.	CCT5	49	.	0			c.G14T						.						80.0	59.0	66.0					5																	10250466		2203	4300	6503	SO:0001583	missense	22948	exon1			CCATGGGGACCCT	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.14G>T	chr5.hg19:g.10250466G>T	ENSP00000280326:p.Gly5Val	172.0	0.0		142.0	49.0	NM_012073	A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	ENST00000280326.4	hg19	CCDS3877.1	.	.	.	.	.	.	.	.	.	.	G	38	7.023384	0.98010	.	.	ENSG00000150753	ENST00000280326;ENST00000515390;ENST00000440011	T;T	0.56941	0.43;2.52	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.71195	0.3311	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.982;0.982	D;D;P;P	0.80764	0.994;0.911;0.743;0.743	T	0.73269	-0.4036	10	0.72032	D	0.01	-25.754	18.3542	0.90351	0.0:0.0:1.0:0.0	.	5;3;5;5	E7ENZ3;Q9BU08;A8K2X8;P48643	.;.;.;TCPE_HUMAN	V	5	ENSP00000280326:G5V;ENSP00000426923:G5V	ENSP00000280326:G5V	G	+	2	0	CCT5	10303466	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.737000	0.91562	2.565000	0.86533	0.650000	0.86243	GGG	.	.		0.577	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2		
FAM134B	54463	hgsc.bcm.edu	37	5	16477816	16477816	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr5:16477816A>T	ENST00000306320.9	-	8	1041	c.955T>A	c.(955-957)Ttc>Atc	p.F319I	FAM134B_ENST00000399793.2_Missense_Mutation_p.F178I	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	319					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						GAAAGGTTGAAGGTCCCATTA	0.388																																					p.F319I		Atlas-SNP	.											.	FAM134B	72	.	0			c.T955A						.						89.0	83.0	85.0					5																	16477816		1841	4090	5931	SO:0001583	missense	54463	exon8			GGTTGAAGGTCCC	BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.955T>A	chr5.hg19:g.16477816A>T	ENSP00000304642:p.Phe319Ile	171.0	0.0		146.0	31.0	NM_001034850	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	hg19	CCDS43304.1	.	.	.	.	.	.	.	.	.	.	A	34	5.320351	0.95682	.	.	ENSG00000154153	ENST00000399793;ENST00000306320	T;T	0.69806	-0.11;-0.43	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.82513	0.5053	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.991;0.996	D	0.84628	0.0688	10	0.87932	D	0	-17.8941	16.5494	0.84464	1.0:0.0:0.0:0.0	.	319;178	Q9H6L5;Q9H6L5-2	F134B_HUMAN;.	I	178;319	ENSP00000382691:F178I;ENSP00000304642:F319I	ENSP00000304642:F319I	F	-	1	0	FAM134B	16530816	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.637000	0.91014	2.299000	0.77371	0.528000	0.53228	TTC	.	.		0.388	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1	NM_001034850	
ITGA2	3673	hgsc.bcm.edu	37	5	52367816	52367816	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr5:52367816C>A	ENST00000296585.5	+	18	2427	c.2284C>A	c.(2284-2286)Ctg>Atg	p.L762M		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	762					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				GGACATCAGTCTGGAAAACCC	0.473																																					p.L762M		Atlas-SNP	.											.	ITGA2	211	.	0			c.C2284A						.						166.0	147.0	153.0					5																	52367816		2203	4300	6503	SO:0001583	missense	3673	exon18			ATCAGTCTGGAAA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2284C>A	chr5.hg19:g.52367816C>A	ENSP00000296585:p.Leu762Met	115.0	0.0		103.0	23.0	NM_002203	Q14595	Missense_Mutation	SNP	ENST00000296585.5	hg19	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868437	0.51588	.	.	ENSG00000164171	ENST00000296585	T	0.58506	0.33	5.03	2.31	0.28768	Integrin alpha-2 (1);	0.272680	0.30890	N	0.008669	T	0.64962	0.2646	L	0.55481	1.735	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.989	T	0.52555	-0.8560	10	0.66056	D	0.02	.	5.2632	0.15586	0.0:0.5272:0.1571:0.3158	.	762;762	E7ESP4;P17301	.;ITA2_HUMAN	M	762	ENSP00000296585:L762M	ENSP00000296585:L762M	L	+	1	2	ITGA2	52403573	0.959000	0.32827	0.991000	0.47740	0.893000	0.52053	1.922000	0.40045	0.759000	0.33084	0.467000	0.42956	CTG	.	.		0.473	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
REEP5	7905	hgsc.bcm.edu	37	5	112238198	112238198	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr5:112238198C>T	ENST00000379638.4	-	3	578	c.230G>A	c.(229-231)aGt>aAt	p.S77N	REEP5_ENST00000474542.2_5'UTR|REEP5_ENST00000513339.1_Missense_Mutation_p.S77N|REEP5_ENST00000504247.1_Intron|REEP5_ENST00000545426.1_Missense_Mutation_p.S77N	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	77						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		TTTGTTGGGACTCTCTATAGC	0.378																																					p.S77N		Atlas-SNP	.											.	REEP5	12	.	0			c.G230A						.						141.0	141.0	141.0					5																	112238198		2202	4300	6502	SO:0001583	missense	7905	exon3			TTGGGACTCTCTA	BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.230G>A	chr5.hg19:g.112238198C>T	ENSP00000368959:p.Ser77Asn	114.0	0.0		133.0	22.0	NM_005669	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	ENST00000379638.4	hg19	CCDS4109.2	.	.	.	.	.	.	.	.	.	.	C	32	5.112205	0.94339	.	.	ENSG00000129625	ENST00000379638;ENST00000513339;ENST00000545426;ENST00000261482	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.96592	0.8888	M	0.72576	2.205	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.887	D;D;P	0.87578	0.995;0.998;0.775	D	0.96636	0.9470	10	0.87932	D	0	-26.8718	19.9036	0.96999	0.0:1.0:0.0:0.0	.	77;50;77	B7Z510;B7Z2A3;Q00765	.;.;REEP5_HUMAN	N	77;77;77;68	ENSP00000368959:S77N;ENSP00000425901:S77N;ENSP00000442940:S77N;ENSP00000261482:S68N	ENSP00000261482:S68N	S	-	2	0	REEP5	112266097	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.794000	0.85869	2.706000	0.92434	0.655000	0.94253	AGT	.	.		0.378	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250739.2	NM_005669	
PRSS16	10279	hgsc.bcm.edu	37	6	27223091	27223091	+	Silent	SNP	C	C	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr6:27223091C>A	ENST00000230582.3	+	12	1557	c.1542C>A	c.(1540-1542)gtC>gtA	p.V514V	PRSS16_ENST00000377456.2_3'UTR|PRSS16_ENST00000421826.2_Silent_p.V257V	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	514					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						AGGGTGAAGTCTGAATCTCAT	0.463																																					p.V514V	NSCLC(178;1118 2105 17078 23587 44429)	Atlas-SNP	.											.	PRSS16	66	.	0			c.C1542A						.						83.0	68.0	73.0					6																	27223091		2203	4300	6503	SO:0001819	synonymous_variant	10279	exon12			TGAAGTCTGAATC	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1542C>A	chr6.hg19:g.27223091C>A		119.0	0.0		178.0	52.0	NM_005865	O75416	Silent	SNP	ENST00000230582.3	hg19	CCDS4623.1																																																																																			.	.		0.463	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
TMEM30A	55754	hgsc.bcm.edu	37	6	75974997	75974997	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr6:75974997C>T	ENST00000230461.6	-	3	732	c.403G>A	c.(403-405)Gtg>Atg	p.V135M	TMEM30A_ENST00000475111.2_Missense_Mutation_p.V99M|TMEM30A_ENST00000370050.5_Missense_Mutation_p.V16M	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	135					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CGAGATTTCACGTAACGACGA	0.294																																					p.V135M		Atlas-SNP	.											.	TMEM30A	40	.	0			c.G403A						.						77.0	75.0	76.0					6																	75974997		2203	4298	6501	SO:0001583	missense	55754	exon3			ATTTCACGTAACG	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.403G>A	chr6.hg19:g.75974997C>T	ENSP00000230461:p.Val135Met	67.0	0.0		84.0	57.0	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	ENST00000230461.6	hg19	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522822	0.85600	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111;ENST00000518161	.	.	.	6.02	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	M	0.84326	2.69	0.80722	D	1	P;P	0.48407	0.89;0.91	P;P	0.48795	0.454;0.59	T	0.70554	-0.4840	9	0.49607	T	0.09	.	15.4073	0.74890	0.0:0.9335:0.0:0.0665	.	99;135	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	M	135;119;16;99;16	.	ENSP00000230461:V135M	V	-	1	0	TMEM30A	76031717	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	7.719000	0.84751	1.551000	0.49450	0.650000	0.86243	GTG	.	.		0.294	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
ADAM18	8749	hgsc.bcm.edu	37	8	39467002	39467002	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr8:39467002A>T	ENST00000265707.5	+	5	312		c.e5-1		ADAM18_ENST00000379866.1_Splice_Site|ADAM18_ENST00000541111.1_Splice_Site|ADAM18_ENST00000520772.1_Splice_Site	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			ACTGTTTTTCAGATGCATTGC	0.299																																					.		Atlas-SNP	.											.	ADAM18	169	.	0			c.268-2A>T						.						85.0	81.0	82.0					8																	39467002		2203	4298	6501	SO:0001630	splice_region_variant	8749	exon5			TTTTTCAGATGCA	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.268-1A>T	chr8.hg19:g.39467002A>T		48.0	0.0		70.0	42.0	NM_001190956	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Splice_Site	SNP	ENST00000265707.5	hg19	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	A	8.779	0.927871	0.18056	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000520772;ENST00000522198	.	.	.	4.89	3.75	0.43078	.	.	.	.	.	.	.	.	.	.	.	0.44728	D	0.997722	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6969	0.23203	0.897:0.0:0.103:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM18	39586159	0.973000	0.33851	0.896000	0.35187	0.253000	0.25986	4.186000	0.58337	2.168000	0.68352	0.528000	0.53228	.	.	.		0.299	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	Intron
PRKDC	5591	hgsc.bcm.edu	37	8	48846651	48846651	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr8:48846651C>T	ENST00000523565.1	-	15	1554		c.e15-1		PRKDC_ENST00000338368.3_Splice_Site|PRKDC_ENST00000314191.2_Splice_Site			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ACTCAGGGCCCTGGCCAGAAA	0.473								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	Atlas-SNP	.											PRKDC,bladder,carcinoma,0,2	PRKDC	394	.	0			c.1498-1G>A						.						117.0	111.0	113.0					8																	48846651		1894	4106	6000	SO:0001630	splice_region_variant	5591	exon16			AGGGCCCTGGCCA		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.11955-1G>A	chr8.hg19:g.48846651C>T		48.0	0.0		86.0	62.0	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Splice_Site	SNP	ENST00000523565.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.34	1.908506	0.33721	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	4.14	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3222	0.21225	0.0:0.808:0.0:0.192	.	.	.	.	.	-1	.	.	.	-	.	.	PRKDC	49009204	0.982000	0.34865	0.662000	0.29724	0.036000	0.12997	1.609000	0.36858	2.583000	0.87209	0.557000	0.71058	.	.	.		0.473	PRKDC-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000377896.1	NM_001081640	Intron
EFR3A	23167	hgsc.bcm.edu	37	8	133008691	133008691	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr8:133008691A>G	ENST00000254624.5	+	19	2329	c.2104A>G	c.(2104-2106)Acc>Gcc	p.T702A	EFR3A_ENST00000519656.1_Missense_Mutation_p.T666A|EFR3A_ENST00000334503.4_Missense_Mutation_p.T702A	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	702						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CATTGTGGACACCGTATCCAT	0.328																																					p.T702A		Atlas-SNP	.											.	EFR3A	96	.	0			c.A2104G						.						94.0	92.0	93.0					8																	133008691		2203	4299	6502	SO:0001583	missense	23167	exon19			GTGGACACCGTAT	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.2104A>G	chr8.hg19:g.133008691A>G	ENSP00000254624:p.Thr702Ala	70.0	0.0		78.0	47.0	NM_015137	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	ENST00000254624.5	hg19	CCDS34942.2	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391569	0.83011	.	.	ENSG00000132294	ENST00000254624;ENST00000407309;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.32272	1.46;1.46;1.46	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.32912	0.0845	L	0.47716	1.5	0.80722	D	1	B	0.32338	0.365	B	0.35470	0.203	T	0.07520	-1.0768	10	0.52906	T	0.07	-14.8991	15.7938	0.78394	1.0:0.0:0.0:0.0	.	702	Q14156	EFR3A_HUMAN	A	702;81;658;702;666	ENSP00000254624:T702A;ENSP00000334769:T702A;ENSP00000428086:T666A	ENSP00000254624:T702A	T	+	1	0	EFR3A	133077873	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	8.622000	0.90953	2.322000	0.78497	0.528000	0.53228	ACC	.	.		0.328	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	
RPL8	6132	hgsc.bcm.edu	37	8	146016689	146016689	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr8:146016689T>A	ENST00000262584.3	-	4	704	c.472A>T	c.(472-474)Atc>Ttc	p.I158F	RPL8_ENST00000528957.1_Missense_Mutation_p.I158F|RPL8_ENST00000394920.2_Missense_Mutation_p.I158F|RPL8_ENST00000527914.1_Missense_Mutation_p.I49F|RPL8_ENST00000529163.1_5'UTR	NM_000973.3	NP_000964.1	P62917	RL8_HUMAN	ribosomal protein L8	158					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(12)|lung(7)|prostate(1)	20	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		GCTGAGGAGATAACCTTCTTG	0.577																																					p.I158F		Atlas-SNP	.											.	RPL8	29	.	0			c.A472T						.						76.0	69.0	71.0					8																	146016689		2203	4300	6503	SO:0001583	missense	6132	exon4			AGGAGATAACCTT	Z28407	CCDS6433.1	8q24.3	2011-04-06			ENSG00000161016	ENSG00000161016		"""L ribosomal proteins"""	10368	protein-coding gene	gene with protein product		604177				7506540, 9582194	Standard	NM_033301		Approved	L8	uc003zec.3	P62917	OTTHUMG00000165249	ENST00000262584.3:c.472A>T	chr8.hg19:g.146016689T>A	ENSP00000262584:p.Ile158Phe	73.0	0.0		116.0	21.0	NM_033301	A8K094|D3DWN2|P25120|Q567Q7|Q969V7|Q9BWQ9	Missense_Mutation	SNP	ENST00000262584.3	hg19	CCDS6433.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.568049	0.86439	.	.	ENSG00000161016	ENST00000394920;ENST00000527914;ENST00000262584;ENST00000528957;ENST00000534813;ENST00000533397;ENST00000532702	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.21	5.21	0.72293	Translation protein SH3-like (1);Translation protein SH3-like, subgroup (1);Ribosomal protein L2, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	M	0.62088	1.915	0.80722	D	1	B;B	0.24092	0.009;0.097	B;B	0.35353	0.066;0.201	T	0.37267	-0.9713	10	0.28530	T	0.3	.	13.3852	0.60791	0.0:0.0:0.0:1.0	.	158;122	P62917;E9PIZ3	RL8_HUMAN;.	F	158;49;158;158;122;137;158	ENSP00000378378:I158F;ENSP00000436460:I49F;ENSP00000262584:I158F;ENSP00000433464:I158F;ENSP00000435313:I137F;ENSP00000434535:I158F	ENSP00000262584:I158F	I	-	1	0	RPL8	145987493	1.000000	0.71417	0.995000	0.50966	0.911000	0.54048	4.024000	0.57218	2.103000	0.63969	0.456000	0.33151	ATC	.	.		0.577	RPL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382948.1	NM_000973	
PTPRD	5789	hgsc.bcm.edu	37	9	8341939	8341939	+	Silent	SNP	A	A	G			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr9:8341939A>G	ENST00000381196.4	-	37	5244	c.4701T>C	c.(4699-4701)gaT>gaC	p.D1567D	PTPRD_ENST00000397606.3_Silent_p.D1160D|PTPRD_ENST00000540109.1_Silent_p.D1567D|PTPRD_ENST00000356435.5_Silent_p.D1567D|PTPRD_ENST00000397611.3_Silent_p.D1157D|PTPRD_ENST00000537002.1_Silent_p.D1157D|PTPRD_ENST00000360074.4_Silent_p.D1554D|PTPRD_ENST00000358503.5_Silent_p.D1545D|PTPRD_ENST00000397617.3_Silent_p.D1160D|PTPRD_ENST00000486161.1_Silent_p.D1160D|PTPRD_ENST00000355233.5_Silent_p.D1161D	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1567	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTAACATGGCATCTATGACGA	0.373										TSP Lung(15;0.13)																											p.D1567D		Atlas-SNP	.											.	PTPRD	1348	.	0			c.T4701C						.						79.0	79.0	79.0					9																	8341939		2203	4300	6503	SO:0001819	synonymous_variant	5789	exon40			CATGGCATCTATG	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4701T>C	chr9.hg19:g.8341939A>G		79.0	0.0		85.0	36.0	NM_002839	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	hg19	CCDS43786.1																																																																																			.	.		0.373	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
KCNT1	57582	hgsc.bcm.edu	37	9	138662763	138662763	+	Silent	SNP	G	G	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr9:138662763G>T	ENST00000263604.3	+	18	1773	c.1773G>T	c.(1771-1773)ccG>ccT	p.P591P	KCNT1_ENST00000371757.2_Silent_p.P610P|KCNT1_ENST00000488444.2_Silent_p.P591P|KCNT1_ENST00000486577.2_Silent_p.P571P|KCNT1_ENST00000490355.2_Silent_p.P591P|KCNT1_ENST00000491806.2_Silent_p.P577P|KCNT1_ENST00000487664.1_Silent_p.P565P|KCNT1_ENST00000298480.5_Silent_p.P610P			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	591	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TGCTGAACCCGGGGCCCCGGC	0.612																																					p.P610P		Atlas-SNP	.											.	KCNT1	139	.	0			c.G1830T						.						46.0	41.0	42.0					9																	138662763		2202	4300	6502	SO:0001819	synonymous_variant	57582	exon18			GAACCCGGGGCCC	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1773G>T	chr9.hg19:g.138662763G>T		209.0	0.0		203.0	41.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	ENST00000263604.3	hg19																																																																																				.	.		0.612	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
PROSER2	254427	hgsc.bcm.edu	37	10	11912001	11912001	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr10:11912001G>A	ENST00000277570.5	+	4	1058	c.904G>A	c.(904-906)Gcc>Acc	p.A302T	PROSER2_ENST00000379200.1_Missense_Mutation_p.A106T|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	302																	cgcgggggacgccggcgaggg	0.806																																					p.A302T		Atlas-SNP	.											.	.	.	.	0			c.G904A						.						1.0	1.0	1.0					10																	11912001		349	861	1210	SO:0001583	missense	254427	exon4			GGGGACGCCGGCG	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.904G>A	chr10.hg19:g.11912001G>A	ENSP00000277570:p.Ala302Thr	19.0	0.0		27.0	15.0	NM_153256	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Missense_Mutation	SNP	ENST00000277570.5	hg19	CCDS7085.1	.	.	.	.	.	.	.	.	.	.	G	6.708	0.499271	0.12762	.	.	ENSG00000148426	ENST00000277570;ENST00000379200	T;T	0.39592	1.07;1.08	4.49	-8.98	0.00754	.	2.037870	0.02223	N	0.064156	T	0.18718	0.0449	N	0.04880	-0.145	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.25363	-1.0134	10	0.87932	D	0	1.8777	4.961	0.14066	0.1296:0.353:0.4103:0.1071	.	302	Q86WR7	CJ047_HUMAN	T	302;106	ENSP00000277570:A302T;ENSP00000368498:A106T	ENSP00000277570:A302T	A	+	1	0	C10orf47	11952007	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.568000	0.05909	-2.283000	0.00672	0.305000	0.20034	GCC	.	.		0.806	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
CYP2E1	1571	hgsc.bcm.edu	37	10	135340900	135340900	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr10:135340900A>G	ENST00000463117.2	+	3	273	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_Start_Codon_SNP_p.M1V			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	1					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CAGCGGCACCATGTCTGCCCT	0.617									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.M1V		Atlas-SNP	.											.	CYP2E1	69	.	0			c.A1G						.						60.0	64.0	63.0					10																	135340900		2203	4300	6503	SO:0001582	initiator_codon_variant	1571	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	GGCACCATGTCTG	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.1A>G	chr10.hg19:g.135340900A>G	ENSP00000440689:p.Met1Val	69.0	0.0		94.0	20.0	NM_000773	Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	ENST00000463117.2	hg19	CCDS7686.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.359373	0.41801	.	.	ENSG00000130649	ENST00000463117;ENST00000541261;ENST00000252945	T;T;T	0.66460	-0.21;2.01;-0.21	4.86	2.43	0.29744	.	0.461775	0.25747	N	0.028566	T	0.74831	0.3768	.	.	.	0.25681	N	0.985792	D	0.58268	0.982	D	0.67548	0.952	T	0.64283	-0.6444	9	0.87932	D	0	.	5.1627	0.15070	0.7245:0.181:0.0945:0.0	.	1	P05181	CP2E1_HUMAN	V	1	ENSP00000440689:M1V;ENSP00000437799:M1V;ENSP00000252945:M1V	ENSP00000252945:M1V	M	+	1	0	CYP2E1	135190890	1.000000	0.71417	0.360000	0.25837	0.051000	0.14879	3.585000	0.53943	0.402000	0.25451	0.460000	0.39030	ATG	.	.		0.617	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051161.2	NM_000773	Missense_Mutation
ABTB2	25841	hgsc.bcm.edu	37	11	34180864	34180864	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr11:34180864G>T	ENST00000435224.2	-	14	3100	c.2676C>A	c.(2674-2676)gaC>gaA	p.D892E	ABTB2_ENST00000298992.2_Missense_Mutation_p.D706E	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	892	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				GGTACTTCATGTCGCTGATCT	0.527																																					p.D892E		Atlas-SNP	.											.	ABTB2	101	.	0			c.C2676A						.						306.0	205.0	239.0					11																	34180864		2202	4298	6500	SO:0001583	missense	25841	exon14			CTTCATGTCGCTG	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2676C>A	chr11.hg19:g.34180864G>T	ENSP00000410157:p.Asp892Glu	73.0	0.0		92.0	4.0	NM_145804	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	ENST00000435224.2	hg19	CCDS7890.2	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658268	0.67586	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.26957	1.7;1.7	5.32	4.39	0.52855	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.104848	0.64402	D	0.000006	T	0.25232	0.0613	M	0.64997	1.995	0.48571	D	0.999678	B	0.31256	0.316	B	0.32342	0.144	T	0.07102	-1.0790	10	0.52906	T	0.07	-8.5818	7.0064	0.24838	0.299:0.0:0.701:0.0	.	706	Q8N961	ABTB2_HUMAN	E	892;706	ENSP00000410157:D892E;ENSP00000298992:D706E	ENSP00000298992:D706E	D	-	3	2	ABTB2	34137440	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	0.942000	0.29017	1.340000	0.45581	0.655000	0.94253	GAC	.	.		0.527	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	NM_145804	
PACSIN3	29763	hgsc.bcm.edu	37	11	47201777	47201777	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr11:47201777A>T	ENST00000539589.1	-	6	905	c.563T>A	c.(562-564)cTg>cAg	p.L188Q	PACSIN3_ENST00000298838.6_Missense_Mutation_p.L188Q	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	188	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CCGTTCCTGCAGTTTGCGCAG	0.642											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L188Q		Atlas-SNP	.											.	PACSIN3	28	.	0			c.T563A						.						106.0	90.0	96.0					11																	47201777		2201	4298	6499	SO:0001583	missense	29763	exon6			TCCTGCAGTTTGC	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.563T>A	chr11.hg19:g.47201777A>T	ENSP00000440945:p.Leu188Gln	35.0	0.0	945	33.0	16.0	NM_016223	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	hg19	CCDS31481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.085343|5.085343	0.94100|0.94100	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000415232|ENST00000298838;ENST00000539589;ENST00000528462	.|T;T;T	.|0.44482	.|0.92;0.92;0.92	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.174164	.|0.52532	.|D	.|0.000078	T|T	0.43478|0.43478	0.1249|0.1249	M|M	0.76727|0.76727	2.345|2.345	0.50632|0.50632	D|D	0.99988|0.99988	.|P	.|0.51240	.|0.943	.|B	.|0.37267	.|0.245	T|T	0.55431|0.55431	-0.8142|-0.8142	6|10	0.52906|0.66056	T|D	0.07|0.02	-15.5803|-15.5803	15.6266|15.6266	0.76863|0.76863	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|188	.|Q9UKS6	.|PACN3_HUMAN	S|Q	187|188	.|ENSP00000298838:L188Q;ENSP00000440945:L188Q;ENSP00000437252:L188Q	ENSP00000405352:C187S|ENSP00000298838:L188Q	C|L	-|-	1|2	0|0	PACSIN3|PACSIN3	47158353|47158353	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	7.519000|7.519000	0.81809|0.81809	2.109000|2.109000	0.64355|0.64355	0.459000|0.459000	0.35465|0.35465	TGC|CTG	.	.		0.642	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391632.1	NM_016223	
TYR	7299	hgsc.bcm.edu	37	11	89028410	89028410	+	Missense_Mutation	SNP	C	C	T	rs543973275|rs61754399		TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr11:89028410C>T	ENST00000263321.5	+	5	1968	c.1466C>T	c.(1465-1467)aCt>aTt	p.T489I		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	489					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GCCGTCCTCACTGCCCTGCTG	0.537																																					p.T489I		Atlas-SNP	.											TYR,NS,carcinoma,0,1	TYR	130	.	0			c.C1466T						.						47.0	49.0	48.0					11																	89028410		2201	4299	6500	SO:0001583	missense	7299	exon5			TCCTCACTGCCCT	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1466C>T	chr11.hg19:g.89028410C>T	ENSP00000263321:p.Thr489Ile	192.0	0.0		194.0	32.0	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	hg19	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	C	7.314	0.615527	0.14129	.	.	ENSG00000077498	ENST00000263321	D	0.99143	-5.48	5.02	4.11	0.48088	.	0.352939	0.32671	N	0.005800	D	0.96393	0.8823	L	0.36672	1.1	0.09310	N	1	B	0.28713	0.22	B	0.26864	0.074	D	0.91333	0.5091	9	.	.	.	.	9.7404	0.40416	0.0:0.8295:0.0:0.1705	.	489	P14679	TYRO_HUMAN	I	489	ENSP00000263321:T489I	.	T	+	2	0	TYR	88668058	0.013000	0.17824	0.002000	0.10522	0.218000	0.24690	2.557000	0.45871	1.247000	0.43917	0.455000	0.32223	ACT	.	.		0.537	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
POU2F3	25833	hgsc.bcm.edu	37	11	120175898	120175898	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr11:120175898C>T	ENST00000543440.2	+	7	754	c.604C>T	c.(604-606)Cgc>Tgc	p.R202C	POU2F3_ENST00000260264.4_Missense_Mutation_p.R204C	NM_014352.3	NP_055167.2	Q9UKI9	PO2F3_HUMAN	POU class 2 homeobox 3	202	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)	17		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		CAAGCAGAGGCGCATTAAGCT	0.557																																					p.R204C		Atlas-SNP	.											.	POU2F3	44	.	0			c.C610T						.						78.0	83.0	81.0					11																	120175898		2203	4299	6502	SO:0001583	missense	25833	exon7			CAGAGGCGCATTA	AF133895	CCDS8431.1, CCDS58190.1	11q23.3	2011-06-20	2007-07-13		ENSG00000137709	ENSG00000137709		"""Homeoboxes / POU class"""	19864	protein-coding gene	gene with protein product		607394	"""POU domain class 2, transcription factor 3"""			10473598	Standard	NM_014352		Approved	OCT11, PLA-1, Skn-1a, Epoc-1	uc021qrk.1	Q9UKI9	OTTHUMG00000166140	ENST00000543440.2:c.604C>T	chr11.hg19:g.120175898C>T	ENSP00000441687:p.Arg202Cys	113.0	0.0		136.0	12.0	NM_001244682	A8K7H8|B4DY07|F5GWW6|Q3MIY3|Q9UKR7|Q9Y504	Missense_Mutation	SNP	ENST00000543440.2	hg19	CCDS8431.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672501	0.88348	.	.	ENSG00000137709	ENST00000543440;ENST00000260264;ENST00000533620	D;D;D	0.90197	-2.63;-2.63;-2.63	6.16	6.16	0.99307	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.95903	0.8666	M	0.88512	2.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95948	0.8952	10	0.87932	D	0	.	14.6998	0.69147	0.2551:0.7448:0.0:0.0	.	156;202	E9PIN6;Q9UKI9	.;PO2F3_HUMAN	C	204;202;156	ENSP00000441687:R204C;ENSP00000260264:R202C;ENSP00000435738:R156C	ENSP00000260264:R202C	R	+	1	0	POU2F3	119681108	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.833000	0.62766	2.937000	0.99478	0.650000	0.86243	CGC	.	.		0.557	POU2F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388039.2		
WSB2	55884	hgsc.bcm.edu	37	12	118480654	118480654	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr12:118480654T>C	ENST00000315436.3	-	4	692	c.551A>G	c.(550-552)aAt>aGt	p.N184S	WSB2_ENST00000536738.1_5'UTR|WSB2_ENST00000544233.1_Intron|WSB2_ENST00000441406.2_Missense_Mutation_p.N201S|WSB2_ENST00000542304.1_5'UTR|WSB2_ENST00000535496.1_Missense_Mutation_p.N186S	NM_001278557.1|NM_018639.3	NP_001265486.1|NP_061109.1	Q9NYS7	WSB2_HUMAN	WD repeat and SOCS box containing 2	184					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACCGTGTTTATTCAGGTCCCA	0.453																																					p.N184S		Atlas-SNP	.											.	WSB2	32	.	0			c.A551G						.						151.0	152.0	152.0					12																	118480654		2203	4300	6503	SO:0001583	missense	55884	exon4			TGTTTATTCAGGT	AF038187	CCDS9186.1, CCDS61251.1, CCDS61252.1	12q24.23	2013-01-09	2011-01-25		ENSG00000176871	ENSG00000176871		"""WD repeat domain containing"""	19222	protein-coding gene	gene with protein product			"""WD repeat and SOCS box-containing 2"""			12076535	Standard	NM_018639		Approved	SBA2, MGC10210	uc001twr.2	Q9NYS7	OTTHUMG00000168885	ENST00000315436.3:c.551A>G	chr12.hg19:g.118480654T>C	ENSP00000319474:p.Asn184Ser	76.0	0.0		56.0	14.0	NM_018639	B4DIE6|B4DPV6|Q9NRX9	Missense_Mutation	SNP	ENST00000315436.3	hg19	CCDS9186.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.741379	0.30865	.	.	ENSG00000176871	ENST00000315436;ENST00000441406;ENST00000535496;ENST00000537945	T;T;T;T	0.01287	5.05;5.05;5.05;5.05	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.219434	0.31809	N	0.007032	T	0.01092	0.0036	N	0.13327	0.33	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.61058	-0.7139	10	0.14252	T	0.57	-24.1683	10.0893	0.42436	0.0:0.0781:0.0:0.9219	.	184	Q9NYS7	WSB2_HUMAN	S	184;201;186;186	ENSP00000319474:N184S;ENSP00000409131:N201S;ENSP00000439450:N186S;ENSP00000440386:N186S	ENSP00000319474:N184S	N	-	2	0	WSB2	116965037	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.360000	0.52299	2.202000	0.70862	0.524000	0.50904	AAT	.	.		0.453	WSB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401515.1	NM_018639	
NCOR2	9612	hgsc.bcm.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q		Atlas-SNP	.											NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2	475	.	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A						.						9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	chr12.hg19:g.124887093C>T		29.0	0.0		38.0	3.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	hg19	CCDS41858.2																																																																																			.	.		0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
BORA	79866	hgsc.bcm.edu	37	13	73327942	73327942	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr13:73327942C>G	ENST00000390667.5	+	11	1694	c.1597C>G	c.(1597-1599)Caa>Gaa	p.Q533E	BORA_ENST00000377815.3_Missense_Mutation_p.Q463E	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	533					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)										GAGTAAATCTCAAGCATTTAA	0.294																																					p.Q533E		Atlas-SNP	.											.	.	.	.	0			c.C1597G						.						77.0	75.0	76.0					13																	73327942		1821	4082	5903	SO:0001583	missense	79866	exon11			AAATCTCAAGCAT	BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.1597C>G	chr13.hg19:g.73327942C>G	ENSP00000375082:p.Gln533Glu	326.0	0.0		204.0	118.0	NM_024808	B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	ENST00000390667.5	hg19	CCDS9446.1	.	.	.	.	.	.	.	.	.	.	C	7.494	0.651318	0.14516	.	.	ENSG00000136122	ENST00000377815;ENST00000390667	T;T	0.35789	1.29;1.32	5.51	3.72	0.42706	.	0.580975	0.19008	N	0.125162	T	0.34803	0.0910	L	0.58101	1.795	0.29893	N	0.825024	B;B;B;B	0.33549	0.417;0.287;0.287;0.287	B;B;B;B	0.31101	0.085;0.079;0.124;0.079	T	0.34229	-0.9837	10	0.72032	D	0.01	1.2477	12.5995	0.56489	0.1326:0.7402:0.1273:0.0	.	463;533;593;533	B4DQ30;A8K631;B5LMG6;Q6PGQ7	.;.;.;BORA_HUMAN	E	463;533	ENSP00000367046:Q463E;ENSP00000375082:Q533E	ENSP00000367046:Q463E	Q	+	1	0	BORA	72225943	0.996000	0.38824	0.308000	0.25141	0.042000	0.13812	0.944000	0.29043	0.745000	0.32763	0.655000	0.94253	CAA	.	.		0.294	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045245.3	NM_024808	
C16orf78	123970	hgsc.bcm.edu	37	16	49407994	49407994	+	Silent	SNP	T	T	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr16:49407994T>A	ENST00000299191.3	+	1	261	c.144T>A	c.(142-144)gcT>gcA	p.A48A		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	48						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						AGAAACAAGCTCCCGAGGTGG	0.502																																					p.A48A		Atlas-SNP	.											.	C16orf78	57	.	0			c.T144A						.						66.0	64.0	64.0					16																	49407994		2199	4300	6499	SO:0001819	synonymous_variant	123970	exon1			ACAAGCTCCCGAG	BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.144T>A	chr16.hg19:g.49407994T>A		82.0	0.0		60.0	37.0	NM_144602		Silent	SNP	ENST00000299191.3	hg19	CCDS10738.1																																																																																			.	.		0.502	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256846.1	NM_144602	
LCAT	3931	hgsc.bcm.edu	37	16	67974099	67974099	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr16:67974099G>A	ENST00000264005.5	-	6	1060	c.1031C>T	c.(1030-1032)cCc>cTc	p.P344L		NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	344					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		GCGGGGCGTGGGCAGGCCCAC	0.612																																					p.P344L		Atlas-SNP	.											.	LCAT	31	.	0			c.C1031T						.						75.0	85.0	81.0					16																	67974099		2198	4300	6498	SO:0001583	missense	3931	exon6			GGCGTGGGCAGGC		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.1031C>T	chr16.hg19:g.67974099G>A	ENSP00000264005:p.Pro344Leu	109.0	0.0		69.0	22.0	NM_000229	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	hg19	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459532	0.43736	.	.	ENSG00000213398	ENST00000264005	D	0.96856	-4.15	5.61	5.61	0.85477	.	0.000000	0.64402	U	0.000001	D	0.95847	0.8648	M	0.85299	2.745	0.49389	D	0.999784	B	0.12630	0.006	B	0.12837	0.008	D	0.93302	0.6677	10	0.62326	D	0.03	-19.4667	12.142	0.54002	0.0:0.0:0.829:0.171	.	344	P04180	LCAT_HUMAN	L	344	ENSP00000264005:P344L	ENSP00000264005:P344L	P	-	2	0	LCAT	66531600	1.000000	0.71417	0.999000	0.59377	0.671000	0.39405	5.571000	0.67404	2.639000	0.89480	0.555000	0.69702	CCC	.	.		0.612	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
SNTB2	6645	hgsc.bcm.edu	37	16	69318053	69318053	+	Silent	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr16:69318053C>T	ENST00000336278.4	+	5	1289	c.1251C>T	c.(1249-1251)ttC>ttT	p.F417F		NM_006750.3	NP_006741.1	Q13425	SNTB2_HUMAN	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	417	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|microtubule (GO:0005874)|protein complex (GO:0043234)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)		TGCATCTCTTCAGGGTGGAGA	0.532																																					p.F417F	NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	Atlas-SNP	.											.	SNTB2	22	.	0			c.C1251T						.						154.0	140.0	145.0					16																	69318053		2198	4300	6498	SO:0001819	synonymous_variant	6645	exon5			TCTCTTCAGGGTG	U40572	CCDS10873.1	16q22.1	2008-05-14	2002-08-29		ENSG00000168807	ENSG00000168807			11169	protein-coding gene	gene with protein product		600027	"""syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2)"""	SNT2B2, SNTL, D16S2531E		8576247, 8183929	Standard	NM_006750		Approved	EST25263, SNT3	uc002ewu.3	Q13425	OTTHUMG00000137567	ENST00000336278.4:c.1251C>T	chr16.hg19:g.69318053C>T		117.0	0.0		70.0	19.0	NM_006750	Q9BY09	Silent	SNP	ENST00000336278.4	hg19	CCDS10873.1																																																																																			.	.		0.532	SNTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268945.1		
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	20.0	0.0		58.0	11.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
ARMC7	79637	hgsc.bcm.edu	37	17	73106617	73106617	+	Missense_Mutation	SNP	G	G	A	rs141301558		TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr17:73106617G>A	ENST00000245543.1	+	2	453	c.151G>A	c.(151-153)Gag>Aag	p.E51K	ARMC7_ENST00000581078.1_Missense_Mutation_p.E51K|ARMC7_ENST00000584947.1_Missense_Mutation_p.E51K|ARMC7_ENST00000582136.1_Missense_Mutation_p.E51K	NM_024585.2	NP_078861.1	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	51						cytoplasm (GO:0005737)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|pancreas(3)	9	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			CAGCAACTACGAGTATCTGCG	0.597																																					p.E51K		Atlas-SNP	.											.	ARMC7	14	.	0			c.G151A						.						86.0	82.0	83.0					17																	73106617		2203	4300	6503	SO:0001583	missense	79637	exon2			AACTACGAGTATC	AK025813	CCDS11714.1	17q25	2013-02-14				ENSG00000125449		"""Armadillo repeat containing"""	26168	protein-coding gene	gene with protein product						12477932	Standard	NM_024585		Approved	FLJ22160	uc002jmw.1	Q9H6L4		ENST00000245543.1:c.151G>A	chr17.hg19:g.73106617G>A	ENSP00000245543:p.Glu51Lys	108.0	0.0		133.0	24.0	NM_024585	B4DVA4	Missense_Mutation	SNP	ENST00000245543.1	hg19	CCDS11714.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876175	0.51801	.	.	ENSG00000125449	ENST00000245543	T	0.53640	0.61	6.07	1.69	0.24217	Armadillo-like helical (1);Armadillo-type fold (1);	0.479354	0.23316	N	0.049502	T	0.30947	0.0781	L	0.34521	1.04	0.29223	N	0.873825	B;B	0.22346	0.068;0.025	B;B	0.13407	0.009;0.004	T	0.24083	-1.0170	10	0.11485	T	0.65	.	10.8369	0.46692	0.0996:0.2367:0.6018:0.062	.	51;51	B4DVA4;Q9H6L4	.;ARMC7_HUMAN	K	51	ENSP00000245543:E51K	ENSP00000245543:E51K	E	+	1	0	ARMC7	70618212	0.998000	0.40836	0.997000	0.53966	0.927000	0.56198	0.888000	0.28268	0.111000	0.17947	-0.165000	0.13383	GAG	.	G|1.000;C|0.000		0.597	ARMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445846.1	NM_024585	
MATK	4145	hgsc.bcm.edu	37	19	3783153	3783153	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr19:3783153G>C	ENST00000310132.6	-	7	1045	c.647C>G	c.(646-648)aCc>aGc	p.T216S	MATK_ENST00000395040.2_Missense_Mutation_p.T175S|MATK_ENST00000585778.1_Missense_Mutation_p.T216S|MATK_ENST00000395045.2_Missense_Mutation_p.T217S	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	216					cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGACTTGGTCCCGTGTTT	0.652																																					p.T217S		Atlas-SNP	.											.	MATK	108	.	0			c.C650G						.						131.0	97.0	109.0					19																	3783153		2203	4300	6503	SO:0001583	missense	4145	exon7			GACTTGGTCCCGT	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.647C>G	chr19.hg19:g.3783153G>C	ENSP00000308734:p.Thr216Ser	73.0	0.0		79.0	11.0	NM_002378	B3KNZ9|Q9NST8	Missense_Mutation	SNP	ENST00000310132.6	hg19	CCDS12114.1	.	.	.	.	.	.	.	.	.	.	G	8.738	0.918267	0.17982	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.73363	-0.74;-0.74;-0.72	4.71	4.71	0.59529	.	0.387226	0.25651	N	0.029220	T	0.63046	0.2478	L	0.48642	1.525	0.20403	N	0.999906	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.12837	0.007;0.008;0.007	T	0.45249	-0.9274	10	0.15952	T	0.53	-23.4139	8.3547	0.32323	0.1144:0.0:0.8856:0.0	.	216;217;216	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	S	217;216;175	ENSP00000378485:T217S;ENSP00000308734:T216S;ENSP00000378481:T175S	ENSP00000308734:T216S	T	-	2	0	MATK	3734153	1.000000	0.71417	0.312000	0.25196	0.045000	0.14185	4.694000	0.61760	2.159000	0.67721	0.561000	0.74099	ACC	.	.		0.652	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355	
ZSWIM4	65249	hgsc.bcm.edu	37	19	13915863	13915863	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr19:13915863C>T	ENST00000254323.2	+	3	802	c.613C>T	c.(613-615)Cag>Tag	p.Q205*	ZSWIM4_ENST00000440752.2_5'Flank	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	205							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GAAGTTCGTGCAGTACCTCAT	0.617											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q205X		Atlas-SNP	.											.	ZSWIM4	69	.	0			c.C613T						.						54.0	46.0	49.0					19																	13915863		2203	4300	6503	SO:0001587	stop_gained	65249	exon3			TTCGTGCAGTACC	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.613C>T	chr19.hg19:g.13915863C>T	ENSP00000254323:p.Gln205*	47.0	0.0	691	31.0	5.0	NM_023072		Nonsense_Mutation	SNP	ENST00000254323.2	hg19	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	C	39	7.524704	0.98339	.	.	ENSG00000132003	ENST00000254323	.	.	.	4.81	4.81	0.61882	.	0.109676	0.39083	N	0.001469	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-17.006	15.3756	0.74602	0.0:1.0:0.0:0.0	.	.	.	.	X	205	.	ENSP00000254323:Q205X	Q	+	1	0	ZSWIM4	13776863	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	7.565000	0.82337	2.226000	0.72624	0.561000	0.74099	CAG	.	.		0.617	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
ALB	213	hgsc.bcm.edu	37	4	74272457	74272457	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr4:74272457delT	ENST00000503124.1	+	2	218	c.11delT	c.(10-12)ctgfs	p.L4fs	ALB_ENST00000295897.4_Frame_Shift_Del_p.A83fs|ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000509063.1_Frame_Shift_Del_p.A83fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATGAGTCAGCTGAAAATTGTG	0.328																																					p.A83fs		Atlas-INDEL	.											.	ALB	132	.	0			c.248delC						.						100.0	93.0	95.0					4																	74272457		2203	4300	6503	SO:0001589	frameshift_variant	213	exon3			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.11delT	chr4.hg19:g.74272457delT	ENSP00000421027:p.Leu4fs	68.0	0.0		41.0	21.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.328	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
BRD7	29117	hgsc.bcm.edu	37	16	50368752	50368752	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr16:50368752delT	ENST00000394688.3	-	7	916	c.757delA	c.(757-759)actfs	p.T253fs	BRD7_ENST00000394689.2_Frame_Shift_Del_p.T253fs			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	253					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				TGCTTTCGAGTTTTCTGCAAG	0.453																																					p.T253fs		Atlas-INDEL	.											.	BRD7	61	.	0			c.758delC						.						98.0	96.0	97.0					16																	50368752		2198	4297	6495	SO:0001589	frameshift_variant	29117	exon7			.	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.757delA	chr16.hg19:g.50368752delT	ENSP00000378180:p.Thr253fs	117.0	0.0		56.0	30.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Frame_Shift_Del	DEL	ENST00000394688.3	hg19	CCDS10742.1																																																																																			.	.		0.453	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
KRT40	125115	hgsc.bcm.edu	37	17	39134528	39134528	+	Frame_Shift_Del	DEL	G	G	-	rs16968862	byFrequency	TCGA-DD-AACN-01A-11D-A40R-10	TCGA-DD-AACN-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4fcf6ef-eba4-47be-8457-574686f0add0	1d70749b-f7ee-4419-9978-ef6792e52e18	g.chr17:39134528delG	ENST00000398486.2	-	9	1377	c.1217delC	c.(1216-1218)tcgfs	p.S406fs	AC004231.2_ENST00000418393.1_RNA|KRT40_ENST00000377755.4_Frame_Shift_Del_p.S406fs	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	406	Tail.		S -> L (in dbSNP:rs16968862).			intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				GCATGTGGTCGAACATGGGCT	0.438																																					p.S406fs		Atlas-INDEL	.											.	KRT40	27	.	0			c.1218delG						.						100.0	110.0	107.0					17																	39134528		1933	4144	6077	SO:0001589	frameshift_variant	125115	exon9			.	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.1217delC	chr17.hg19:g.39134528delG	ENSP00000381500:p.Ser406fs	102.0	0.0		111.0	15.0	NM_182497	Q6IFU5	Frame_Shift_Del	DEL	ENST00000398486.2	hg19	CCDS42320.1																																																																																			.	.		0.438	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	
