#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZBTB17	7709	hgsc.bcm.edu	37	1	16271291	16271291	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:16271291T>G	ENST00000375743.4	-	8	1203	c.971A>C	c.(970-972)cAc>cCc	p.H324P	ZBTB17_ENST00000537142.1_Missense_Mutation_p.H242P|ZBTB17_ENST00000448462.2_Missense_Mutation_p.H261P|ZBTB17_ENST00000479282.1_5'Flank|ZBTB17_ENST00000375733.2_Missense_Mutation_p.H324P	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	324					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		GATGCGGATGTGCCGCTTGAA	0.672																																					p.H324P		Atlas-SNP	.											.	ZBTB17	45	.	0			c.A971C						.						42.0	41.0	42.0					1																	16271291		2202	4300	6502	SO:0001583	missense	7709	exon8			CGGATGTGCCGCT	U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.971A>C	chr1.hg19:g.16271291T>G	ENSP00000364895:p.His324Pro	72.0	0.0		53.0	6.0	NM_003443	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	ENST00000375743.4	hg19	CCDS165.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499630	0.85176	.	.	ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142;ENST00000448462	D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18	5.33	4.19	0.49359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94644	0.8273	H	0.94698	3.57	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.997;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.993;0.996;0.998;0.977	D	0.95333	0.8431	10	0.87932	D	0	.	11.2715	0.49142	0.0:0.0732:0.0:0.9268	.	248;261;324;242;324	B4DYU5;E7EPQ4;Q13105-2;F5H411;Q13105	.;.;.;.;ZBT17_HUMAN	P	324;324;243;242;261	ENSP00000364895:H324P;ENSP00000364885:H324P;ENSP00000438529:H242P;ENSP00000391002:H261P	ENSP00000364885:H324P	H	-	2	0	ZBTB17	16143878	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.170000	0.71920	2.009000	0.58944	0.459000	0.35465	CAC	.	.		0.672	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	NM_003443	
ZMYM6NB	100506144	hgsc.bcm.edu	37	1	35447692	35447692	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:35447692T>C	ENST00000373337.3	-	3	365	c.318A>G	c.(316-318)aaA>aaG	p.K106K	RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000487874.1_3'UTR	NM_001195156.1	NP_001182085.1	Q8NCS4	ZMYNB_HUMAN	ZMYM6 neighbor	106						integral component of membrane (GO:0016021)											TTAGTGACTCTTTCAGAGCTG	0.557																																					p.K106K		Atlas-SNP	.											.	.	.	.	0			c.A318G						.																																			SO:0001819	synonymous_variant	100506144	exon3			TGACTCTTTCAGA		CCDS53296.1	1p34.3	2011-05-23			ENSG00000243749	ENSG00000243749			40021	protein-coding gene	gene with protein product							Standard	NM_001195156		Approved		uc001bye.3	Q8NCS4	OTTHUMG00000004158	ENST00000373337.3:c.318A>G	chr1.hg19:g.35447692T>C		89.0	0.0		67.0	32.0	NM_001195156		Silent	SNP	ENST00000373337.3	hg19	CCDS53296.1																																																																																			.	.		0.557	ZMYM6NB-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000011985.1		
AGO3	192669	hgsc.bcm.edu	37	1	36479616	36479616	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:36479616C>A	ENST00000373191.4	+	11	1722	c.1373C>A	c.(1372-1374)gCc>gAc	p.A458D	RP4-665N4.8_ENST00000479395.2_RNA|RP4-665N4.8_ENST00000466576.2_RNA|AGO3_ENST00000246314.6_Missense_Mutation_p.A224D	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	458					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GCTTGTTTTGCCACACAGAGG	0.418																																					p.A458D		Atlas-SNP	.											.	.	.	.	0			c.C1373A						.						162.0	153.0	156.0					1																	36479616		2203	4300	6503	SO:0001583	missense	192669	exon11			GTTTTGCCACACA	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1373C>A	chr1.hg19:g.36479616C>A	ENSP00000362287:p.Ala458Asp	396.0	0.0		318.0	137.0	NM_024852	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	hg19	CCDS399.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324380	0.81580	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.06294	3.32;3.32	5.65	5.65	0.86999	.	0.048537	0.85682	D	0.000000	T	0.13500	0.0327	M	0.75150	2.29	0.80722	D	1	B	0.12630	0.006	B	0.18263	0.021	T	0.02411	-1.1163	10	0.48119	T	0.1	-7.2302	19.7916	0.96461	0.0:1.0:0.0:0.0	.	458	Q9H9G7	AGO3_HUMAN	D	458;224	ENSP00000362287:A458D;ENSP00000246314:A224D	ENSP00000246314:A224D	A	+	2	0	EIF2C3	36252203	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.810000	0.86072	2.685000	0.91497	0.650000	0.86243	GCC	.	.		0.418	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
PCSK9	255738	hgsc.bcm.edu	37	1	55527163	55527163	+	Silent	SNP	C	C	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:55527163C>G	ENST00000302118.5	+	11	2087	c.1797C>G	c.(1795-1797)tcC>tcG	p.S599S	PCSK9_ENST00000490692.1_3'UTR|PCSK9_ENST00000543384.1_3'UTR	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	599	C-terminal domain.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						TCCACGCTTCCTGCTGCCATG	0.667																																					p.S599S	Pancreas(137;1454 1827 5886 22361 42375)	Atlas-SNP	.											.	PCSK9	76	.	0			c.C1797G						.						29.0	26.0	27.0					1																	55527163		2198	4299	6497	SO:0001819	synonymous_variant	255738	exon11			CGCTTCCTGCTGC	AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.1797C>G	chr1.hg19:g.55527163C>G		387.0	0.0		304.0	113.0	NM_174936	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Silent	SNP	ENST00000302118.5	hg19	CCDS603.1																																																																																			.	.		0.667	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1	NM_174936	
HFM1	164045	hgsc.bcm.edu	37	1	91781372	91781372	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:91781372G>A	ENST00000370425.3	-	28	3238	c.3140C>T	c.(3139-3141)aCg>aTg	p.T1047M	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Splice_Site_p.T726M|HFM1_ENST00000294696.5_Splice_Site_p.T279M	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1047	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.T1047M(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TCACACTTACGTAATCTTGTG	0.313																																					p.T1047M		Atlas-SNP	.											HFM1,caecum,carcinoma,0,1	HFM1	188	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3140T						.						66.0	64.0	64.0					1																	91781372		2201	4299	6500	SO:0001630	splice_region_variant	164045	exon28			ACTTACGTAATCT	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3140+1C>T	chr1.hg19:g.91781372G>A		154.0	0.0		115.0	47.0	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	hg19	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	5.133|5.133	0.210150|0.210150	0.09757|0.09757	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	.|T;T;T	.|0.62232	.|0.04;0.04;0.04	5.25|5.25	4.12|4.12	0.48240|0.48240	.|Sec63 domain (2);	.|0.765588	.|0.12875	.|N	.|0.431977	T|T	0.11281|0.11281	0.0275|0.0275	N|N	0.00855|0.00855	-1.145|-1.145	0.25714|0.25714	N|N	0.985443|0.985443	.|B;B;B	.|0.14012	.|0.009;0.0;0.005	.|B;B;B	.|0.09377	.|0.001;0.002;0.004	T|T	0.31971|0.31971	-0.9924|-0.9924	5|9	.|.	.|.	.|.	.|.	11.1879|11.1879	0.48669|0.48669	0.9269:0.0:0.0731:0.0|0.9269:0.0:0.0731:0.0	.|.	.|726;258;1047	.|A6NGI5;B1B0B5;A2PYH4	.|.;.;HFM1_HUMAN	W|M	259|1047;279;726;731	.|ENSP00000359454:T1047M;ENSP00000294696:T279M;ENSP00000359453:T726M	.|.	R|T	-|-	1|2	2|0	HFM1|HFM1	91553960|91553960	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.100000|0.100000	0.18952|0.18952	3.507000|3.507000	0.53371|0.53371	0.832000|0.832000	0.34804|0.34804	-0.606000|-0.606000	0.04082|0.04082	CGG|ACG	.	.		0.313	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	Missense_Mutation
SLC44A3	126969	hgsc.bcm.edu	37	1	95310943	95310943	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:95310943A>T	ENST00000271227.6	+	9	1097	c.995A>T	c.(994-996)cAg>cTg	p.Q332L	SLC44A3_ENST00000527077.1_Missense_Mutation_p.Q264L|SLC44A3_ENST00000446120.2_Missense_Mutation_p.Q296L|SLC44A3_ENST00000467909.1_Missense_Mutation_p.Q284L|SLC44A3_ENST00000530397.1_3'UTR|RP11-465K1.2_ENST00000422162.1_RNA|SLC44A3_ENST00000529450.1_Missense_Mutation_p.Q300L|SLC44A3_ENST00000532427.1_Missense_Mutation_p.Q252L	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	332					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	CTGCTGTTCCAGCCACTGTGG	0.483																																					p.Q332L		Atlas-SNP	.											.	SLC44A3	109	.	0			c.A995T						.						121.0	125.0	124.0					1																	95310943		2203	4300	6503	SO:0001583	missense	126969	exon9			TGTTCCAGCCACT	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.995A>T	chr1.hg19:g.95310943A>T	ENSP00000271227:p.Gln332Leu	49.0	0.0		47.0	14.0	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	hg19	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.412535	0.42817	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427	T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18	5.86	3.49	0.39957	.	0.208139	0.33916	N	0.004433	T	0.30355	0.0762	M	0.73372	2.23	0.41018	D	0.985056	D;D;D;D;D	0.89917	0.997;0.982;0.997;0.998;1.0	D;D;D;D;D	0.85130	0.973;0.914;0.994;0.982;0.997	T	0.04467	-1.0949	10	0.46703	T	0.11	-5.0002	11.0309	0.47772	0.7527:0.0:0.0:0.2473	.	252;296;264;300;332	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	L	296;332;264;300;284;252	ENSP00000389143:Q296L;ENSP00000271227:Q332L;ENSP00000433641:Q264L;ENSP00000431836:Q300L;ENSP00000432789:Q284L;ENSP00000436661:Q252L	ENSP00000271227:Q332L	Q	+	2	0	SLC44A3	95083531	1.000000	0.71417	0.861000	0.33841	0.087000	0.18053	7.659000	0.83766	0.446000	0.26666	-1.412000	0.01120	CAG	.	.		0.483	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
STXBP3	6814	hgsc.bcm.edu	37	1	109321972	109321972	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:109321972A>G	ENST00000370008.3	+	9	799	c.749A>G	c.(748-750)cAt>cGt	p.H250R	STXBP3_ENST00000485167.1_3'UTR	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	250	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		ACTGTCCTGCATGAACTGACC	0.373																																					p.H250R		Atlas-SNP	.											.	STXBP3	44	.	0			c.A749G						.						207.0	196.0	199.0					1																	109321972		2203	4300	6503	SO:0001583	missense	6814	exon9			TCCTGCATGAACT	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.749A>G	chr1.hg19:g.109321972A>G	ENSP00000359025:p.His250Arg	123.0	0.0		69.0	24.0	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	hg19	CCDS790.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.787090	0.90367	.	.	ENSG00000116266	ENST00000370008	T	0.80566	-1.39	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.90229	0.6945	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92316	0.5862	10	0.87932	D	0	-19.3411	15.7572	0.78043	1.0:0.0:0.0:0.0	.	250	O00186	STXB3_HUMAN	R	250	ENSP00000359025:H250R	ENSP00000359025:H250R	H	+	2	0	STXBP3	109123495	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.283000	0.95860	2.199000	0.70637	0.533000	0.62120	CAT	.	.		0.373	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
HIPK1	204851	hgsc.bcm.edu	37	1	114514596	114514596	+	Intron	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:114514596G>A	ENST00000369558.1	+	15	3376				HIPK1_ENST00000340480.4_Intron|HIPK1_ENST00000369561.4_Intron|HIPK1_ENST00000369555.2_Intron|HIPK1_ENST00000369553.1_Intron|HIPK1_ENST00000369554.2_Intron|HIPK1_ENST00000426820.2_Intron|HIPK1_ENST00000406344.1_Intron|HIPK1_ENST00000369559.4_Missense_Mutation_p.C1055Y			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1						anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGGGCTACTGCCTTCTGTTT	0.517																																					p.C1055Y		Atlas-SNP	.											HIPK1,NS,carcinoma,0,1	HIPK1	195	.	0			c.G3164A						.						193.0	160.0	171.0					1																	114514596		2203	4300	6503	SO:0001627	intron_variant	204851	exon15			GCTACTGCCTTCT	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.3144+20G>A	chr1.hg19:g.114514596G>A		123.0	0.0		127.0	32.0	NM_152696	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	hg19	CCDS867.1	.	.	.	.	.	.	.	.	.	.	G	8.659	0.900152	0.17686	.	.	ENSG00000163349	ENST00000369559	T	0.46451	0.87	5.89	4.97	0.65823	.	.	.	.	.	T	0.10981	0.0268	N	0.08118	0	0.80722	D	1	B	0.31351	0.32	B	0.31812	0.136	T	0.11324	-1.0592	8	.	.	.	.	12.8971	0.58106	0.0796:0.0:0.9204:0.0	.	1055	Q86Z02-2	.	Y	1055	ENSP00000358572:C1055Y	.	C	+	2	0	HIPK1	114316119	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	4.289000	0.59013	1.474000	0.48178	0.563000	0.77884	TGC	.	.		0.517	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
SYCP1	6847	hgsc.bcm.edu	37	1	115487586	115487586	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:115487586C>T	ENST00000369522.3	+	25	2377	c.2137C>T	c.(2137-2139)Ctt>Ttt	p.L713F	SYCP1_ENST00000369518.1_Missense_Mutation_p.L713F	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	713					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGGTAGCACTTATGGAAAA	0.274																																					p.L713F		Atlas-SNP	.											.	SYCP1	149	.	0			c.C2137T						.						37.0	37.0	37.0					1																	115487586		2200	4282	6482	SO:0001583	missense	6847	exon25			GTAGCACTTATGG	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2137C>T	chr1.hg19:g.115487586C>T	ENSP00000358535:p.Leu713Phe	468.0	0.0		499.0	31.0	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682764	0.68157	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.58797	0.31;0.31;0.31	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000001	T	0.67711	0.2922	M	0.74258	2.255	0.49051	D	0.99974	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	T	0.71817	-0.4478	10	0.62326	D	0.03	-4.8495	11.2611	0.49083	0.0:0.9149:0.0:0.0851	.	713;713	B7ZLS9;Q15431	.;SYCP1_HUMAN	F	713	ENSP00000358535:L713F;ENSP00000410011:L713F;ENSP00000358531:L713F	ENSP00000358531:L713F	L	+	1	0	SYCP1	115289109	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.788000	0.55446	2.268000	0.75426	0.650000	0.86243	CTT	.	.		0.274	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
ZNF687	57592	hgsc.bcm.edu	37	1	151261604	151261604	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:151261604G>A	ENST00000368879.2	+	4	2426	c.2328G>A	c.(2326-2328)gtG>gtA	p.V776V		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	776					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTGGGGGTGTGAACTCCATCA	0.617																																					p.V776V		Atlas-SNP	.											.	ZNF687	94	.	0			c.G2328A						.						106.0	92.0	96.0					1																	151261604		2203	4300	6503	SO:0001819	synonymous_variant	57592	exon4			GGGTGTGAACTCC		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.2328G>A	chr1.hg19:g.151261604G>A		78.0	0.0		137.0	7.0	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	ENST00000368879.2	hg19																																																																																				.	.		0.617	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
OR10R2	343406	hgsc.bcm.edu	37	1	158450591	158450591	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:158450591G>C	ENST00000368152.1	+	1	924	c.924G>C	c.(922-924)atG>atC	p.M308I	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TAAACCCCATGGTTTATAGCC	0.393																																					p.M308I		Atlas-SNP	.											.	OR10R2	81	.	0			c.G924C						.						108.0	99.0	102.0					1																	158450591		2203	4300	6503	SO:0001583	missense	343406	exon1			CCCCATGGTTTAT	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.924G>C	chr1.hg19:g.158450591G>C	ENSP00000357134:p.Met308Ile	227.0	0.0		298.0	57.0	NM_001004472	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	hg19	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	g	1.742	-0.491558	0.04322	.	.	ENSG00000198965	ENST00000368152	T	0.28255	1.62	4.2	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02888	0.0086	N	0.01624	-0.795	0.22378	N	0.999155	B	0.06786	0.001	B	0.06405	0.002	T	0.44390	-0.9331	9	0.14252	T	0.57	.	5.3635	0.16101	0.1014:0.0:0.5898:0.3089	.	308	Q8NGX6	O10R2_HUMAN	I	308	ENSP00000357134:M308I	ENSP00000357134:M308I	M	+	3	0	OR10R2	156717215	0.038000	0.19896	0.996000	0.52242	0.390000	0.30446	-0.553000	0.06012	2.135000	0.66039	0.655000	0.94253	ATG	.	.		0.393	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472	
SPTA1	6708	hgsc.bcm.edu	37	1	158622440	158622440	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:158622440G>A	ENST00000368147.4	-	23	3372	c.3192C>T	c.(3190-3192)taC>taT	p.Y1064Y		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1064					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGAGGGAGCGGTATCTGGATG	0.423																																					p.Y1064Y		Atlas-SNP	.											.	SPTA1	720	.	0			c.C3192T						.						78.0	72.0	74.0					1																	158622440		1854	4099	5953	SO:0001819	synonymous_variant	6708	exon23			GGAGCGGTATCTG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3192C>T	chr1.hg19:g.158622440G>A		102.0	0.0		99.0	17.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	hg19	CCDS41423.1																																																																																			.	.		0.423	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
CD55	1604	hgsc.bcm.edu	37	1	207498067	207498067	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:207498067A>G	ENST00000367064.3	+	3	708	c.450A>G	c.(448-450)aaA>aaG	p.K150K	CD55_ENST00000367065.5_Silent_p.K150K|CD55_ENST00000367063.2_Silent_p.K150K|CD55_ENST00000367062.4_Silent_p.K150K|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000391920.4_Silent_p.K150K|CD55_ENST00000391921.4_Intron|CD55_ENST00000367067.4_Missense_Mutation_p.M122V|CD55_ENST00000314754.8_Silent_p.K150K	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	150	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	AGAATTTAAAATGGTCCACAG	0.368																																					p.K150K		Atlas-SNP	.											.	CD55	55	.	0			c.A450G						.						80.0	82.0	81.0					1																	207498067		2203	4300	6503	SO:0001819	synonymous_variant	1604	exon3			TTTAAAATGGTCC	BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.450A>G	chr1.hg19:g.207498067A>G		115.0	0.0		179.0	108.0	NM_001114752	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Silent	SNP	ENST00000367064.3	hg19	CCDS31006.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.006|0.006	-2.104425|-2.104425	0.00356|0.00356	.|.	.|.	ENSG00000196352|ENSG00000196352	ENST00000367067|ENST00000343420	T|.	0.03152|.	4.03|.	6.16|6.16	0.0513|0.0513	0.14297|0.14297	.|.	.|.	.|.	.|.	.|.	T|T	0.34542|0.34542	0.0901|0.0901	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30851|0.30851	-0.9964|-0.9964	6|4	0.02654|.	T|.	1|.	.|.	9.5294|9.5294	0.39185|0.39185	0.5446:0.0:0.4554:0.0|0.5446:0.0:0.4554:0.0	.|.	.|.	.|.	.|.	V|S	122|160	ENSP00000356034:M122V|.	ENSP00000356034:M122V|.	M|N	+|+	1|2	0|0	CD55|CD55	205564690|205564690	0.000000|0.000000	0.05858|0.05858	0.130000|0.130000	0.21974|0.21974	0.015000|0.015000	0.08874|0.08874	-1.065000|-1.065000	0.03458|0.03458	0.030000|0.030000	0.15379|0.15379	-0.263000|-0.263000	0.10527|0.10527	ATG|AAT	.	.		0.368	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
PLXNA2	5362	hgsc.bcm.edu	37	1	208202219	208202219	+	Silent	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:208202219C>A	ENST00000367033.3	-	30	6151	c.5394G>T	c.(5392-5394)ctG>ctT	p.L1798L	PLXNA2_ENST00000483048.1_5'UTR	NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1798					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TGGCATAGAGCAGCTTGTTGG	0.612																																					p.L1798L		Atlas-SNP	.											.	PLXNA2	178	.	0			c.G5394T						.						106.0	103.0	104.0					1																	208202219		2203	4300	6503	SO:0001819	synonymous_variant	5362	exon30			ATAGAGCAGCTTG	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.5394G>T	chr1.hg19:g.208202219C>A		106.0	0.0		131.0	33.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	ENST00000367033.3	hg19	CCDS31013.1																																																																																			.	.		0.612	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
FAM71A	149647	hgsc.bcm.edu	37	1	212798986	212798986	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:212798986A>G	ENST00000294829.3	+	1	1198	c.767A>G	c.(766-768)aAt>aGt	p.N256S	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	256						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		AATGTGCTCAATGCATCCATC	0.547																																					p.N256S		Atlas-SNP	.											.	FAM71A	87	.	0			c.A767G						.						101.0	109.0	106.0					1																	212798986		2203	4300	6503	SO:0001583	missense	149647	exon1			TGCTCAATGCATC		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.767A>G	chr1.hg19:g.212798986A>G	ENSP00000294829:p.Asn256Ser	53.0	0.0		87.0	17.0	NM_153606	Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	hg19	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	A	6.126	0.391525	0.11581	.	.	ENSG00000162771	ENST00000294829;ENST00000545975	T	0.03272	3.99	4.02	-0.867	0.10655	.	.	.	.	.	T	0.01765	0.0056	N	0.12182	0.205	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.47407	-0.9120	9	0.02654	T	1	1.6651	7.5677	0.27890	0.4329:0.0:0.5671:0.0	.	256	Q8IYT1	FA71A_HUMAN	S	256;31	ENSP00000294829:N256S	ENSP00000294829:N256S	N	+	2	0	FAM71A	210865609	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.163000	0.09997	-0.038000	0.13624	0.460000	0.39030	AAT	.	.		0.547	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606	
USH2A	7399	hgsc.bcm.edu	37	1	216420462	216420462	+	Silent	SNP	G	G	A	rs61747101		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:216420462G>A	ENST00000307340.3	-	13	2660	c.2274C>T	c.(2272-2274)ttC>ttT	p.F758F	USH2A_ENST00000366943.2_Silent_p.F758F|USH2A_ENST00000366942.3_Silent_p.F758F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	758	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAGGATTGCAGAATTTGTTCA	0.428										HNSCC(13;0.011)																											p.F758F		Atlas-SNP	.											.	USH2A	1168	.	0			c.C2274T						.						111.0	114.0	113.0					1																	216420462		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon13			ATTGCAGAATTTG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2274C>T	chr1.hg19:g.216420462G>A		125.0	0.0		138.0	11.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	G|0.024;C|0.976		0.428	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
EPRS	2058	hgsc.bcm.edu	37	1	220160734	220160734	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:220160734T>C	ENST00000366923.3	-	20	3057	c.2788A>G	c.(2788-2790)Ata>Gta	p.I930V	snoU13_ENST00000459217.1_RNA	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	930	3 X 57 AA approximate repeats.|WHEP-TRS 3.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TGAACAGCTATATCTACTTGA	0.378																																					p.I930V		Atlas-SNP	.											.	EPRS	140	.	0			c.A2788G						.						62.0	62.0	62.0					1																	220160734		2203	4300	6503	SO:0001583	missense	2058	exon20			CAGCTATATCTAC	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2788A>G	chr1.hg19:g.220160734T>C	ENSP00000355890:p.Ile930Val	67.0	0.0		79.0	13.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	hg19	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.499650	0.64298	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.28666	1.6	5.9	-11.8	0.00035	WHEP-TRS (3);S15/NS1, RNA-binding (2);	1.680160	0.02731	N	0.115118	T	0.10937	0.0267	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.18840	-1.0324	10	0.28530	T	0.3	1.6487	11.3	0.49300	0.0814:0.6065:0.2348:0.0773	.	954;937;930	E7EMN0;Q3KQZ8;P07814	.;.;SYEP_HUMAN	V	930;937;954	ENSP00000355890:I930V	ENSP00000355890:I930V	I	-	1	0	EPRS	218227357	0.000000	0.05858	0.000000	0.03702	0.893000	0.52053	-1.045000	0.03528	-2.716000	0.00391	0.460000	0.39030	ATA	.	.		0.378	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
KIF26B	55083	hgsc.bcm.edu	37	1	245809448	245809448	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:245809448T>A	ENST00000407071.2	+	10	2564	c.2124T>A	c.(2122-2124)caT>caA	p.H708Q	KIF26B_ENST00000366518.4_Missense_Mutation_p.H327Q	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	708	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCCGCCTGCATCTCATTGATC	0.498																																					p.H708Q		Atlas-SNP	.											.	KIF26B	343	.	0			c.T2124A						.						64.0	65.0	64.0					1																	245809448		1955	4160	6115	SO:0001583	missense	55083	exon10			CCTGCATCTCATT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2124T>A	chr1.hg19:g.245809448T>A	ENSP00000385545:p.His708Gln	72.0	0.0		85.0	6.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392018	0.62066	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.74315	-0.83;-0.83	5.78	0.597	0.17504	Kinesin, motor domain (5);	.	.	.	.	D	0.83912	0.5357	M	0.80616	2.505	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	T	0.82827	-0.0265	9	0.66056	D	0.02	.	10.1192	0.42609	0.0:0.5936:0.0:0.4064	.	327;708	B7WPD9;Q2KJY2	.;KI26B_HUMAN	Q	708;327;324	ENSP00000385545:H708Q;ENSP00000355475:H327Q	ENSP00000355475:H327Q	H	+	3	2	KIF26B	243876071	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.559000	0.36320	0.192000	0.20272	0.454000	0.30748	CAT	.	.		0.498	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
OR2T3	343173	hgsc.bcm.edu	37	1	248636988	248636988	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:248636988G>A	ENST00000359594.2	+	1	362	c.337G>A	c.(337-339)Gct>Act	p.A113T		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCTGACCCTGGCTGGAGCTGA	0.552																																					p.A113T		Atlas-SNP	.											.	OR2T3	79	.	0			c.G337A						.						122.0	112.0	115.0					1																	248636988		2195	4298	6493	SO:0001583	missense	343173	exon1			ACCCTGGCTGGAG		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.337G>A	chr1.hg19:g.248636988G>A	ENSP00000352604:p.Ala113Thr	374.0	0.0		525.0	91.0	NM_001005495	B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	hg19	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	g	9.761	1.170098	0.21621	.	.	ENSG00000196539	ENST00000359594	T	0.02050	4.48	2.65	-3.07	0.05363	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02649	0.0080	L	0.49126	1.545	0.09310	N	1	B	0.23442	0.085	B	0.20955	0.032	T	0.31888	-0.9927	9	0.42905	T	0.14	.	9.407	0.38469	0.1806:0.0:0.8194:0.0	.	113	Q8NH03	OR2T3_HUMAN	T	113	ENSP00000352604:A113T	ENSP00000352604:A113T	A	+	1	0	OR2T3	246703611	0.000000	0.05858	0.000000	0.03702	0.675000	0.39556	-2.090000	0.01356	-1.215000	0.02610	0.186000	0.17326	GCT	.	.		0.552	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495	
TPO	7173	hgsc.bcm.edu	37	2	1480955	1480955	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:1480955G>C	ENST00000345913.4	+	8	1008	c.917G>C	c.(916-918)gGg>gCg	p.G306A	TPO_ENST00000346956.3_Missense_Mutation_p.G306A|TPO_ENST00000329066.4_Missense_Mutation_p.G306A|TPO_ENST00000382201.3_Missense_Mutation_p.G306A|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.G306A|TPO_ENST00000382198.1_Intron|TPO_ENST00000349624.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	306					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCGCTCTTTGGGAACCTGTCC	0.711																																					p.G306A		Atlas-SNP	.											.	TPO	224	.	0			c.G917C						.						17.0	17.0	17.0					2																	1480955		2201	4294	6495	SO:0001583	missense	7173	exon8			TCTTTGGGAACCT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.917G>C	chr2.hg19:g.1480955G>C	ENSP00000318820:p.Gly306Ala	698.0	0.0		708.0	123.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	hg19	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489787	0.44249	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	T;T;T;T;T;T	0.68903	-0.33;-0.35;-0.31;-0.35;-0.29;-0.36	4.99	3.13	0.36017	.	0.480118	0.23606	N	0.046382	T	0.76912	0.4054	M	0.77103	2.36	0.80722	D	1	D;D;D	0.69078	0.996;0.996;0.997	P;P;P	0.61132	0.877;0.816;0.884	T	0.78247	-0.2278	10	0.66056	D	0.02	-31.9024	9.7654	0.40557	0.0771:0.1421:0.7808:0.0	.	306;306;306	P07202-4;P07202-2;P07202	.;.;PERT_HUMAN	A	306;306;306;306;306;235	ENSP00000337263:G306A;ENSP00000318820:G306A;ENSP00000263886:G306A;ENSP00000329869:G306A;ENSP00000371636:G306A;ENSP00000405788:G235A	ENSP00000329869:G306A	G	+	2	0	TPO	1459962	0.109000	0.22037	0.911000	0.35937	0.015000	0.08874	0.234000	0.17930	1.057000	0.40506	0.460000	0.39030	GGG	.	.		0.711	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
GREB1	9687	hgsc.bcm.edu	37	2	11750992	11750992	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:11750992A>T	ENST00000381486.2	+	18	3145	c.2845A>T	c.(2845-2847)Atg>Ttg	p.M949L	GREB1_ENST00000396123.1_5'Flank|GREB1_ENST00000234142.5_Missense_Mutation_p.M949L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	949						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CCACGGGCTCATGGTCCTGCT	0.677																																					p.M949L	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.A2845T						.						27.0	31.0	30.0					2																	11750992		2063	4191	6254	SO:0001583	missense	9687	exon18			GGGCTCATGGTCC		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2845A>T	chr2.hg19:g.11750992A>T	ENSP00000370896:p.Met949Leu	205.0	0.0		235.0	10.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	A	34	5.401334	0.96030	.	.	ENSG00000196208	ENST00000381486;ENST00000234142	T;T	0.48201	0.82;0.82	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.67429	0.2892	M	0.76170	2.325	0.80722	D	1	P	0.48407	0.91	D	0.62955	0.909	T	0.71384	-0.4609	10	0.72032	D	0.01	-19.5302	15.2741	0.73728	1.0:0.0:0.0:0.0	.	949	Q4ZG55	GREB1_HUMAN	L	949	ENSP00000370896:M949L;ENSP00000234142:M949L	ENSP00000234142:M949L	M	+	1	0	GREB1	11668443	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.825000	0.92029	2.006000	0.58801	0.460000	0.39030	ATG	.	.		0.677	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
LPIN1	23175	hgsc.bcm.edu	37	2	11911614	11911614	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:11911614G>A	ENST00000256720.2	+	4	498	c.405G>A	c.(403-405)acG>acA	p.T135T	LPIN1_ENST00000425416.2_Silent_p.T141T|LPIN1_ENST00000396098.1_Silent_p.T141T|LPIN1_ENST00000396099.1_Silent_p.T141T|LPIN1_ENST00000449576.2_Silent_p.T184T	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	135					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		ACCCCAGCACGCCAGCCCAAG	0.567																																					p.T184T		Atlas-SNP	.											LPIN1,colon,carcinoma,+1,1	LPIN1	99	.	0			c.G552A						.						55.0	56.0	55.0					2																	11911614		2203	4300	6503	SO:0001819	synonymous_variant	23175	exon5			CAGCACGCCAGCC	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.405G>A	chr2.hg19:g.11911614G>A		141.0	0.0		165.0	43.0	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Silent	SNP	ENST00000256720.2	hg19	CCDS1682.1																																																																																			.	.		0.567	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
WDR35	57539	hgsc.bcm.edu	37	2	20135328	20135328	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:20135328G>C	ENST00000345530.3	-	22	2599	c.2484C>G	c.(2482-2484)aaC>aaG	p.N828K	WDR35_ENST00000416055.2_Missense_Mutation_p.N393K|WDR35_ENST00000281405.4_Missense_Mutation_p.N817K	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	828					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCGTTCCTGGTTCCGTCCTT	0.353																																					p.N828K		Atlas-SNP	.											.	WDR35	92	.	0			c.C2484G						.						103.0	98.0	99.0					2																	20135328		2203	4300	6503	SO:0001583	missense	57539	exon22			TTCCTGGTTCCGT	AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.2484C>G	chr2.hg19:g.20135328G>C	ENSP00000314444:p.Asn828Lys	79.0	0.0		72.0	19.0	NM_001006657	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	hg19	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053258	0.75960	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	T;T;T;D	0.87334	-0.2;-0.19;-0.79;-2.24	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.93239	0.7846	M	0.88031	2.925	0.80722	D	1	D;D;D;D	0.69078	0.957;0.997;0.996;0.992	P;D;D;D	0.79784	0.791;0.993;0.916;0.922	D	0.92362	0.5898	10	0.34782	T	0.22	-20.488	10.8993	0.47043	0.087:0.0:0.913:0.0	.	828;817;828;393	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	K	828;817;393;363	ENSP00000314444:N828K;ENSP00000281405:N817K;ENSP00000399159:N393K;ENSP00000404409:N363K	ENSP00000281405:N817K	N	-	3	2	WDR35	19998809	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.773000	0.62331	2.415000	0.81967	0.491000	0.48974	AAC	.	.		0.353	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
KLHL29	114818	hgsc.bcm.edu	37	2	23865474	23865474	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:23865474C>A	ENST00000486442.1	+	5	1411	c.694C>A	c.(694-696)Ccc>Acc	p.P232T		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	232										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						CAGCCCTCAGCCCCTGGCCGT	0.706																																					p.P232T		Atlas-SNP	.											.	KLHL29	47	.	0			c.C694A						.						19.0	24.0	22.0					2																	23865474		692	1591	2283	SO:0001583	missense	114818	exon5			CCTCAGCCCCTGG		CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.694C>A	chr2.hg19:g.23865474C>A	ENSP00000420659:p.Pro232Thr	126.0	0.0		121.0	24.0	NM_052920	Q8N388|Q96BF0|Q96PW7	Missense_Mutation	SNP	ENST00000486442.1	hg19	CCDS54335.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.561104|4.561104	0.86335|0.86335	.|.	.|.	ENSG00000119771|ENSG00000119771	ENST00000486442|ENST00000288548	D|.	0.84516|.	-1.86|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.000000|.	0.64402|.	D|.	0.000009|.	T|T	0.59715|0.59715	0.2214|0.2214	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999999|0.999999	P;D;D|.	0.89917|.	0.608;0.971;1.0|.	B;P;D|.	0.76575|.	0.102;0.696;0.988|.	T|T	0.54207|0.54207	-0.8328|-0.8328	10|5	0.87932|.	D|.	0|.	.|.	19.0267|19.0267	0.92935|0.92935	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	12;12;259|.	Q96CT2;Q96CT2-2;Q6NT65|.	KLH29_HUMAN;.;.|.	T|R	232|71	ENSP00000420659:P232T|.	ENSP00000420659:P232T|.	P|S	+|+	1|3	0|2	KLHL29|KLHL29	23718979|23718979	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.438000|3.438000	0.52871|0.52871	2.584000|2.584000	0.87258|0.87258	0.561000|0.561000	0.74099|0.74099	CCC|AGC	.	.		0.706	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920	
CCDC85A	114800	hgsc.bcm.edu	37	2	56419881	56419881	+	Silent	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:56419881C>A	ENST00000407595.2	+	2	1048	c.546C>A	c.(544-546)ggC>ggA	p.G182G	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	182										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCTGCGCAGGCAGCCGCTGCT	0.617																																					p.G182G		Atlas-SNP	.											.	CCDC85A	70	.	0			c.C546A						.						24.0	32.0	29.0					2																	56419881		2113	4234	6347	SO:0001819	synonymous_variant	114800	exon2			CGCAGGCAGCCGC	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.546C>A	chr2.hg19:g.56419881C>A		202.0	0.0		190.0	56.0	NM_001080433		Silent	SNP	ENST00000407595.2	hg19	CCDS46290.1																																																																																			.	.		0.617	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1		
TTN	7273	hgsc.bcm.edu	37	2	179637884	179637884	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:179637884T>G	ENST00000591111.1	-	33	8031	c.7807A>C	c.(7807-7809)Aca>Cca	p.T2603P	TTN_ENST00000460472.2_Missense_Mutation_p.T2557P|TTN_ENST00000342992.6_Missense_Mutation_p.T2603P|TTN_ENST00000360870.5_Missense_Mutation_p.T2603P|TTN_ENST00000589042.1_Missense_Mutation_p.T2603P|TTN_ENST00000359218.5_Missense_Mutation_p.T2557P|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T2557P|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12926					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCGTAAAATGTGTATTTTCCT	0.308																																					p.T2603P		Atlas-SNP	.											.	TTN	18412	.	0			c.A7807C						.						53.0	55.0	54.0					2																	179637884		2203	4299	6502	SO:0001583	missense	7273	exon33			AAAATGTGTATTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7807A>C	chr2.hg19:g.179637884T>G	ENSP00000465570:p.Thr2603Pro	178.0	0.0		178.0	118.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.04	1.817957	0.32145	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.59	4.45	0.53987	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58949	0.2158	M	0.84511	2.7	0.23351	N	0.997859	B;B;B;B;P	0.49559	0.171;0.171;0.427;0.171;0.925	B;B;B;B;P	0.48840	0.283;0.283;0.283;0.283;0.592	T	0.56805	-0.7918	9	0.87932	D	0	.	8.6559	0.34062	0.0:0.1703:0.0:0.8297	.	2557;2557;2557;2603;2603	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	P	2603;2557;2557;2557;2557;2603	ENSP00000343764:T2603P;ENSP00000434586:T2557P;ENSP00000340554:T2557P;ENSP00000352154:T2557P;ENSP00000354117:T2603P	ENSP00000340554:T2557P	T	-	1	0	TTN	179346129	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	2.631000	0.46502	0.971000	0.38288	0.528000	0.53228	ACA	.	.		0.308	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SPATS2L	26010	hgsc.bcm.edu	37	2	201305388	201305388	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:201305388A>T	ENST00000358677.5	+	8	916	c.669A>T	c.(667-669)aaA>aaT	p.K223N	SPATS2L_ENST00000409988.3_Missense_Mutation_p.K223N|SPATS2L_ENST00000409755.3_Missense_Mutation_p.K253N|SPATS2L_ENST00000409151.1_Missense_Mutation_p.K231N|SPATS2L_ENST00000409718.1_Missense_Mutation_p.K223N|SPATS2L_ENST00000360760.5_Missense_Mutation_p.K154N|SPATS2L_ENST00000451764.2_Missense_Mutation_p.K223N|SPATS2L_ENST00000409140.3_Missense_Mutation_p.K223N|SPATS2L_ENST00000409385.1_Missense_Mutation_p.K163N	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	223						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						ATATTGAGAAATCAGTGAAGG	0.358																																					p.K223N		Atlas-SNP	.											.	SPATS2L	88	.	0			c.A669T						.						77.0	73.0	75.0					2																	201305388		1877	4111	5988	SO:0001583	missense	26010	exon8			TGAGAAATCAGTG	AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.669A>T	chr2.hg19:g.201305388A>T	ENSP00000351503:p.Lys223Asn	100.0	0.0		102.0	22.0	NM_001100423	A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Missense_Mutation	SNP	ENST00000358677.5	hg19	CCDS46483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.88|19.88	3.908517|3.908517	0.72868|0.72868	.|.	.|.	ENSG00000196141|ENSG00000196141	ENST00000409718;ENST00000358677;ENST00000409988;ENST00000409385;ENST00000451764;ENST00000360760;ENST00000453663;ENST00000409140;ENST00000409397;ENST00000409755;ENST00000409151;ENST00000449647;ENST00000438761|ENST00000366118	.|.	.|.	.|.	6.03|6.03	3.68|3.68	0.42216|0.42216	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.61664|0.61664	0.2365|0.2365	M|M	0.64170|0.64170	1.965|1.965	0.42936|0.42936	D|D	0.994332|0.994332	D;D;D|.	0.89917|.	1.0;0.999;1.0|.	D;D;D|.	0.87578|.	0.998;0.973;0.995|.	T|T	0.57556|0.57556	-0.7791|-0.7791	9|5	0.87932|.	D|.	0|.	-26.0019|-26.0019	8.9601|8.9601	0.35842|0.35842	0.7304:0.0:0.2696:0.0|0.7304:0.0:0.2696:0.0	.|.	253;154;223|.	B4DT67;Q9NUQ6-2;Q9NUQ6|.	.;.;SPS2L_HUMAN|.	N|I	223;223;223;163;223;154;154;223;154;253;231;154;149|6	.|.	ENSP00000351503:K223N|.	K|N	+|+	3|2	2|0	SPATS2L|SPATS2L	201013633|201013633	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.290000|1.290000	0.33319|0.33319	0.536000|0.536000	0.28733|0.28733	0.533000|0.533000	0.62120|0.62120	AAA|AAT	.	.		0.358	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336208.3	NM_015535	
STK11IP	114790	hgsc.bcm.edu	37	2	220480870	220480870	+	Silent	SNP	C	C	T	rs373252328	byFrequency	TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:220480870C>T	ENST00000456909.1	+	25	3312	c.3222C>T	c.(3220-3222)atC>atT	p.I1074I	STK11IP_ENST00000295641.10_Silent_p.I1085I			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	1085					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTTTTCCATCGGACTCCGGA	0.622													C|||	6	0.00119808	0.0038	0.0	5008	,	,		18227	0.001		0.0	False		,,,				2504	0.0				p.I1085I		Atlas-SNP	.											.	STK11IP	152	.	0			c.C3255T						.	C		2,4318		0,2,2158	42.0	48.0	46.0		3255	-2.7	1.0	2		46	0,8548		0,0,4274	no	coding-synonymous	STK11IP	NM_052902.2		0,2,6432	TT,TC,CC		0.0,0.0463,0.0155		1085/1100	220480870	2,12866	2160	4274	6434	SO:0001819	synonymous_variant	114790	exon25			TTCCATCGGACTC	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.3222C>T	chr2.hg19:g.220480870C>T		121.0	0.0		121.0	28.0	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	hg19																																																																																				.	.		0.622	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
UBE2F	140739	hgsc.bcm.edu	37	2	238925260	238925260	+	Silent	SNP	T	T	C	rs139771082		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr2:238925260T>C	ENST00000272930.4	+	5	461	c.267T>C	c.(265-267)gaT>gaC	p.D89D	UBE2F_ENST00000414443.1_Silent_p.D57D|UBE2F_ENST00000409633.1_Silent_p.D89D|UBE2F-SCLY_ENST00000449191.1_Silent_p.D89D|UBE2F_ENST00000409953.1_Silent_p.D65D|UBE2F_ENST00000409332.1_Silent_p.D67D	NM_001278305.1|NM_080678.2	NP_001265234.1|NP_542409.1	Q969M7	UBE2F_HUMAN	ubiquitin-conjugating enzyme E2F (putative)	89					protein neddylation (GO:0045116)		ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)			endometrium(1)|large_intestine(1)	2		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;6.7e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|Kidney(56;3.53e-09)|KIRC - Kidney renal clear cell carcinoma(57;9.79e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000136)|Lung(119;0.0126)|LUSC - Lung squamous cell carcinoma(224;0.0301)		AAGTTCCCGATGCGTACAACA	0.463																																					p.D89D		Atlas-SNP	.											.	UBE2F	11	.	0			c.T267C						.	T		0,4406		0,0,2203	139.0	143.0	142.0		267	-0.9	0.9	2	dbSNP_134	142	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	UBE2F	NM_080678.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		89/186	238925260	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140739	exon5			TCCCGATGCGTAC	BC010549	CCDS2523.1, CCDS63175.1, CCDS63176.1, CCDS63177.1	2q37.3	2008-02-05	2005-12-15		ENSG00000184182	ENSG00000184182		"""Ubiquitin-conjugating enzymes E2"""	12480	protein-coding gene	gene with protein product	"""NEDD8 conjugating enzyme"""					12477932	Standard	NM_080678		Approved	NCE2	uc031rrz.1	Q969M7	OTTHUMG00000133341	ENST00000272930.4:c.267T>C	chr2.hg19:g.238925260T>C		94.0	0.0		79.0	19.0	NM_080678	A8K1Z8|B4DDT9|B4DFI1|B4DMK3|B4DZU2|B8ZZG2|C9J212|H9KVB9	Silent	SNP	ENST00000272930.4	hg19	CCDS2523.1																																																																																			.	T|1.000;C|0.000		0.463	UBE2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257171.2	NM_080678	
IL17RE	132014	hgsc.bcm.edu	37	3	9955676	9955676	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:9955676A>G	ENST00000383814.3	+	13	1369	c.1264A>G	c.(1264-1266)Att>Gtt	p.I422V	IL17RE_ENST00000454190.2_Missense_Mutation_p.I422V|IL17RE_ENST00000421412.1_Missense_Mutation_p.I455V|IL17RE_ENST00000295980.3_Missense_Mutation_p.I422V	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	422					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		AGACCTCATCATTCCCTTCCT	0.577																																					p.I462V		Atlas-SNP	.											.	IL17RE	62	.	0			c.A1384G						.						148.0	141.0	143.0					3																	9955676		2203	4300	6503	SO:0001583	missense	132014	exon14			CTCATCATTCCCT	AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.1264A>G	chr3.hg19:g.9955676A>G	ENSP00000373325:p.Ile422Val	95.0	0.0		122.0	63.0	NM_153483	B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Missense_Mutation	SNP	ENST00000383814.3	hg19	CCDS2589.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.569411	0.28003	.	.	ENSG00000163701	ENST00000421412;ENST00000295980;ENST00000383814;ENST00000454190;ENST00000441648	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	5.32	1.39	0.22231	.	0.292675	0.28442	N	0.015335	T	0.06735	0.0172	N	0.17082	0.46	0.26253	N	0.978693	B;B	0.24721	0.11;0.006	B;B	0.20184	0.028;0.004	T	0.26710	-1.0095	10	0.44086	T	0.13	-3.4751	4.3306	0.11062	0.6412:0.1685:0.1903:0.0	.	422;422	Q8NFR9-3;Q8NFR9	.;I17RE_HUMAN	V	455;422;422;422;305	ENSP00000404916:I455V;ENSP00000295980:I422V;ENSP00000373325:I422V;ENSP00000388086:I422V	ENSP00000295980:I422V	I	+	1	0	IL17RE	9930676	1.000000	0.71417	0.958000	0.39756	0.781000	0.44180	0.725000	0.25970	0.084000	0.17077	0.459000	0.35465	ATT	.	.		0.577	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250529.1	NM_153480	
DYNC1LI1	51143	hgsc.bcm.edu	37	3	32570073	32570073	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:32570073C>A	ENST00000273130.4	-	12	1430	c.1327G>T	c.(1327-1329)Gtt>Ttt	p.V443F	DYNC1LI1_ENST00000432458.2_Missense_Mutation_p.V327F	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	443					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						TTTGCCAGAACGCCTTCACTT	0.413																																					p.V443F		Atlas-SNP	.											.	DYNC1LI1	23	.	0			c.G1327T						.						66.0	67.0	66.0					3																	32570073		2203	4300	6503	SO:0001583	missense	51143	exon12			CCAGAACGCCTTC	AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.1327G>T	chr3.hg19:g.32570073C>A	ENSP00000273130:p.Val443Phe	130.0	0.0		146.0	91.0	NM_016141	A2RRG7|Q53HC8|Q53HK7	Missense_Mutation	SNP	ENST00000273130.4	hg19	CCDS2654.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.432592	0.83776	.	.	ENSG00000144635	ENST00000273130;ENST00000432458	T;T	0.29917	1.55;1.55	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.63379	0.2506	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.67612	-0.5626	10	0.87932	D	0	-15.1813	19.975	0.97300	0.0:1.0:0.0:0.0	.	327;443	E9PHI6;Q9Y6G9	.;DC1L1_HUMAN	F	443;327	ENSP00000273130:V443F;ENSP00000407279:V327F	ENSP00000273130:V443F	V	-	1	0	DYNC1LI1	32545077	1.000000	0.71417	0.979000	0.43373	0.504000	0.33889	7.635000	0.83286	2.724000	0.93272	0.585000	0.79938	GTT	.	.		0.413	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253250.1	NM_016141	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	C	rs121913396|rs121913416		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:41266098A>C	ENST00000349496.5	+	3	375	c.95A>C	c.(94-96)gAc>gCc	p.D32A	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,128	CTNNB1	4904	.	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95C						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>C	chr3.hg19:g.41266098A>C	ENSP00000344456:p.Asp32Ala	148.0	1.0		161.0	10.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218742	0.79464	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	M	0.79614	2.46	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.73949	-0.3821	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	A	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25A;ENSP00000385604:D32A;ENSP00000412219:D32A;ENSP00000379486:D32A;ENSP00000344456:D32A;ENSP00000411226:D25A;ENSP00000379488:D32A;ENSP00000409302:D32A;ENSP00000401599:D32A	ENSP00000344456:D32A	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	A	rs121913416|rs121913400		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:41266101C>A	ENST00000349496.5	+	3	378	c.98C>A	c.(97-99)tCt>tAt	p.S33Y	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26Y|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,359	CTNNB1	4904	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98A						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>A	chr3.hg19:g.41266101C>A	ENSP00000344456:p.Ser33Tyr	148.0	0.0		160.0	22.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449496	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	Y	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26Y;ENSP00000385604:S33Y;ENSP00000412219:S33Y;ENSP00000379486:S33Y;ENSP00000344456:S33Y;ENSP00000411226:S26Y;ENSP00000379488:S33Y;ENSP00000409302:S33Y;ENSP00000401599:S33Y	ENSP00000344456:S33Y	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
MST1R	4486	hgsc.bcm.edu	37	3	49928959	49928959	+	Missense_Mutation	SNP	C	C	T	rs140250708		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:49928959C>T	ENST00000296474.3	-	16	3434	c.3407G>A	c.(3406-3408)cGt>cAt	p.R1136H	MST1R_ENST00000344206.4_Missense_Mutation_p.R1087H	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GTTCAGGCCACGCATGAGCAG	0.607																																					p.R1136H		Atlas-SNP	.											.	MST1R	205	.	0			c.G3407A						.	C	HIS/ARG	1,4405		0,1,2202	96.0	88.0	91.0		3407	4.2	0.9	3	dbSNP_134	91	0,8600		0,0,4300	no	missense	MST1R	NM_002447.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1136/1401	49928959	1,13005	2203	4300	6503	SO:0001583	missense	4486	exon16			AGGCCACGCATGA	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.3407G>A	chr3.hg19:g.49928959C>T	ENSP00000296474:p.Arg1136His	187.0	0.0		228.0	12.0	NM_002447	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	hg19	CCDS2807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	22.7|22.7	4.319341|4.319341	0.81469|0.81469	2.27E-4|2.27E-4	0.0|0.0	ENSG00000164078|ENSG00000164078	ENST00000296474;ENST00000344206|ENST00000434765;ENST00000440292	D;D|.	0.83250|.	-1.7;-1.7|.	5.08|5.08	4.21|4.21	0.49690|0.49690	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.143218|.	0.56097|.	N|.	0.000034|.	T|T	0.36441|0.36441	0.0967|0.0967	N|N	0.17379|0.17379	0.485|0.485	0.42428|0.42428	D|D	0.992669|0.992669	P|.	0.52061|.	0.95|.	P|.	0.49012|.	0.598|.	T|T	0.15321|0.15321	-1.0441|-1.0441	10|5	0.87932|.	D|.	0|.	-13.1317|-13.1317	5.7738|5.7738	0.18267|0.18267	0.0:0.6801:0.0:0.3199|0.0:0.6801:0.0:0.3199	.|.	1136|.	Q04912|.	RON_HUMAN|.	H|M	1136;1087|114;157	ENSP00000296474:R1136H;ENSP00000341325:R1087H|.	ENSP00000296474:R1136H|.	R|V	-|-	2|1	0|0	MST1R|MST1R	49903963|49903963	1.000000|1.000000	0.71417|0.71417	0.872000|0.872000	0.34217|0.34217	0.935000|0.935000	0.57460|0.57460	5.844000|5.844000	0.69430|0.69430	1.408000|1.408000	0.46895|0.46895	0.632000|0.632000	0.83419|0.83419	CGT|GTG	.	C|1.000;T|0.000		0.607	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
CADPS	8618	hgsc.bcm.edu	37	3	62648033	62648033	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:62648033G>A	ENST00000383710.4	-	4	1274	c.925C>T	c.(925-927)Cga>Tga	p.R309*	CADPS_ENST00000283269.9_Nonsense_Mutation_p.R309*|CADPS_ENST00000357948.3_Nonsense_Mutation_p.R309*|CADPS_ENST00000490353.2_Nonsense_Mutation_p.R309*	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	309					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TCCAGCTCTCGTCTGATCTGG	0.493																																					p.R309X		Atlas-SNP	.											.	CADPS	387	.	0			c.C925T						.						165.0	136.0	146.0					3																	62648033		2203	4300	6503	SO:0001587	stop_gained	8618	exon4			GCTCTCGTCTGAT	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.925C>T	chr3.hg19:g.62648033G>A	ENSP00000373215:p.Arg309*	61.0	0.0		65.0	34.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Nonsense_Mutation	SNP	ENST00000383710.4	hg19	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	G	40	8.385425	0.98789	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	.	.	.	5.54	3.67	0.42095	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4533	0.61184	0.0:0.0:0.7136:0.2864	.	.	.	.	X	309	.	ENSP00000283269:R309X	R	-	1	2	CADPS	62623073	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.924000	0.48876	0.643000	0.30638	0.655000	0.94253	CGA	.	.		0.493	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
HHLA2	11148	hgsc.bcm.edu	37	3	108076940	108076940	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:108076940G>A	ENST00000357759.5	+	6	1349	c.935G>A	c.(934-936)aGt>aAt	p.S312N	HHLA2_ENST00000489514.2_Missense_Mutation_p.S312N|HHLA2_ENST00000491820.1_Missense_Mutation_p.S312N|HHLA2_ENST00000467562.1_Missense_Mutation_p.S248N|HHLA2_ENST00000467761.1_Missense_Mutation_p.S312N	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	312	Ig-like V-type 2.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						CTTTCAGACAGTGGGGAATAT	0.353																																					p.S312N		Atlas-SNP	.											.	HHLA2	95	.	0			c.G935A						.						109.0	107.0	107.0					3																	108076940		1851	4086	5937	SO:0001583	missense	11148	exon6			CAGACAGTGGGGA	AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.935G>A	chr3.hg19:g.108076940G>A	ENSP00000350402:p.Ser312Asn	118.0	0.0		89.0	50.0	NM_007072	B4DKN2|D3DN60|Q9NWQ6	Missense_Mutation	SNP	ENST00000357759.5	hg19	CCDS46883.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848160	0.32699	.	.	ENSG00000114455	ENST00000491820;ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514	T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47	5.06	1.64	0.23874	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.192281	0.25783	N	0.028326	T	0.50343	0.1610	L	0.27053	0.805	0.21675	N	0.999598	B;B;B	0.31256	0.316;0.316;0.316	B;B;B	0.32022	0.139;0.139;0.139	T	0.29212	-1.0019	10	0.22706	T	0.39	-15.1011	5.6397	0.17557	0.414:0.0:0.586:0.0	.	248;312;312	B4DKN2;C9J7D0;Q9UM44	.;.;HHLA2_HUMAN	N	312;248;312;312;312	ENSP00000418284:S312N;ENSP00000418345:S248N;ENSP00000350402:S312N;ENSP00000419207:S312N;ENSP00000417856:S312N	ENSP00000350402:S312N	S	+	2	0	HHLA2	109559630	0.951000	0.32395	0.966000	0.40874	0.432000	0.31715	-0.119000	0.10676	0.590000	0.29694	0.650000	0.86243	AGT	.	.		0.353	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353924.1	NM_007072	
GOLGB1	2804	hgsc.bcm.edu	37	3	121410144	121410144	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:121410144T>C	ENST00000340645.5	-	14	8177	c.8052A>G	c.(8050-8052)ttA>ttG	p.L2684L	GOLGB1_ENST00000393667.3_Silent_p.L2689L	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2684					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GAAGATGCTTTAATTCTTTCT	0.393																																					p.L2689L		Atlas-SNP	.											.	GOLGB1	319	.	0			c.A8067G						.						223.0	225.0	225.0					3																	121410144		2203	4300	6503	SO:0001819	synonymous_variant	2804	exon14			ATGCTTTAATTCT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8052A>G	chr3.hg19:g.121410144T>C		72.0	0.0		75.0	24.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Silent	SNP	ENST00000340645.5	hg19	CCDS3004.1																																																																																			.	.		0.393	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
GOLGB1	2804	hgsc.bcm.edu	37	3	121417563	121417563	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:121417563T>C	ENST00000340645.5	-	13	1917	c.1792A>G	c.(1792-1794)Atg>Gtg	p.M598V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.M603V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	598					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATCTGTTTCATTTCTTTCTGG	0.403																																					p.M603V		Atlas-SNP	.											.	GOLGB1	319	.	0			c.A1807G						.						90.0	93.0	92.0					3																	121417563		2203	4299	6502	SO:0001583	missense	2804	exon13			GTTTCATTTCTTT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.1792A>G	chr3.hg19:g.121417563T>C	ENSP00000341848:p.Met598Val	139.0	0.0		126.0	34.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	7.353	0.623191	0.14193	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	T;T;T	0.19669	2.71;2.71;2.13	5.32	-1.33	0.09172	.	0.469306	0.20838	N	0.084751	T	0.09335	0.0230	N	0.17674	0.51	0.26262	N	0.978568	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.001;0.001;0.001	T	0.18808	-1.0325	10	0.28530	T	0.3	.	3.3626	0.07192	0.27:0.2274:0.0:0.5025	.	523;562;603;603;598	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	V	598;603;562;410	ENSP00000341848:M598V;ENSP00000377275:M603V;ENSP00000418231:M562V	ENSP00000341848:M598V	M	-	1	0	GOLGB1	122900253	0.000000	0.05858	0.121000	0.21740	0.956000	0.61745	-0.556000	0.05992	-0.364000	0.08088	0.533000	0.62120	ATG	.	.		0.403	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
COL6A5	256076	hgsc.bcm.edu	37	3	130098644	130098644	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:130098644G>T	ENST00000432398.2	+	4	1545	c.1051G>T	c.(1051-1053)Gat>Tat	p.D351Y	COL6A5_ENST00000265379.6_Missense_Mutation_p.D351Y	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	351	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CAGACCATCAGATGATGAGGT	0.488																																					p.D351Y		Atlas-SNP	.											.	COL6A5	205	.	0			c.G1051T						.						127.0	110.0	115.0					3																	130098644		692	1591	2283	SO:0001583	missense	256076	exon4			CCATCAGATGATG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1051G>T	chr3.hg19:g.130098644G>T	ENSP00000390895:p.Asp351Tyr	184.0	0.0		227.0	64.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	hg19		.	.	.	.	.	.	.	.	.	.	G	10.75	1.439338	0.25900	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.78816	-1.21;-1.21	5.34	3.56	0.40772	.	.	.	.	.	T	0.75436	0.3849	N	0.24115	0.695	0.09310	N	1	D	0.57571	0.98	P	0.58721	0.844	T	0.63985	-0.6513	9	0.59425	D	0.04	.	8.3447	0.32266	0.2459:0.0:0.7541:0.0	.	351	A8TX70-2	.	Y	351	ENSP00000390895:D351Y;ENSP00000265379:D351Y	ENSP00000265379:D351Y	D	+	1	0	COL6A5	131581334	0.000000	0.05858	0.001000	0.08648	0.797000	0.45037	0.619000	0.24388	0.641000	0.30601	0.455000	0.32223	GAT	.	.		0.488	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
COPB2	9276	hgsc.bcm.edu	37	3	139096979	139096979	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:139096979T>C	ENST00000333188.5	-	5	589	c.408A>G	c.(406-408)caA>caG	p.Q136Q	COPB2_ENST00000510491.1_5'Flank|COPB2_ENST00000507777.1_Silent_p.Q107Q	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	136					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						CTTCAAACACTTGTGAGCAAG	0.393																																					p.Q136Q		Atlas-SNP	.											.	COPB2	80	.	0			c.A408G						.						252.0	230.0	238.0					3																	139096979		2203	4300	6503	SO:0001819	synonymous_variant	9276	exon5			AAACACTTGTGAG	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.408A>G	chr3.hg19:g.139096979T>C		128.0	0.0		142.0	28.0	NM_004766	B4DZI8	Silent	SNP	ENST00000333188.5	hg19	CCDS3108.1																																																																																			.	.		0.393	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	
SI	6476	hgsc.bcm.edu	37	3	164783108	164783108	+	Missense_Mutation	SNP	G	G	A	rs200745562		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:164783108G>A	ENST00000264382.3	-	7	810	c.748C>T	c.(748-750)Cgt>Tgt	p.R250C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	250	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.R250C(2)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAATCATGACGAAATCTCTTA	0.343										HNSCC(35;0.089)																											p.R250C		Atlas-SNP	.											SI,colon,carcinoma,0,2	SI	500	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C748T						.						76.0	75.0	75.0					3																	164783108		2203	4300	6503	SO:0001583	missense	6476	exon7			CATGACGAAATCT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.748C>T	chr3.hg19:g.164783108G>A	ENSP00000264382:p.Arg250Cys	291.0	0.0		239.0	88.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	hg19	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035583	0.75617	.	.	ENSG00000090402	ENST00000264382	D	0.90955	-2.76	5.9	5.9	0.94986	Glycoside hydrolase-type carbohydrate-binding (1);	0.105792	0.64402	D	0.000003	D	0.97049	0.9036	H	0.97540	4.025	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.97789	1.0237	10	0.72032	D	0.01	.	14.5224	0.67859	0.0:0.0:0.7337:0.2663	.	250	P14410	SUIS_HUMAN	C	250	ENSP00000264382:R250C	ENSP00000264382:R250C	R	-	1	0	SI	166265802	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.105000	0.57797	2.788000	0.95919	0.650000	0.86243	CGT	.	.		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SPATA16	83893	hgsc.bcm.edu	37	3	172834953	172834953	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr3:172834953T>C	ENST00000351008.3	-	2	752	c.569A>G	c.(568-570)aAg>aGg	p.K190R		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	190					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			GGCGTATTTCTTTTGTCTATA	0.408																																					p.K190R		Atlas-SNP	.											.	SPATA16	111	.	0			c.A569G						.						145.0	142.0	143.0					3																	172834953		2203	4300	6503	SO:0001583	missense	83893	exon2			TATTTCTTTTGTC	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.569A>G	chr3.hg19:g.172834953T>C	ENSP00000341765:p.Lys190Arg	112.0	0.0		117.0	63.0	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	hg19	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.181172	0.78677	.	.	ENSG00000144962	ENST00000351008	T	0.77877	-1.13	5.7	5.7	0.88788	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000008	T	0.81880	0.4916	L	0.29908	0.895	0.33536	D	0.594221	D	0.89917	1.0	D	0.85130	0.997	D	0.87240	0.2266	10	0.87932	D	0	-18.3896	14.1991	0.65690	0.0:0.0:0.0:1.0	.	190	Q9BXB7	SPT16_HUMAN	R	190	ENSP00000341765:K190R	ENSP00000341765:K190R	K	-	2	0	SPATA16	174317647	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.714000	0.68422	2.162000	0.67917	0.528000	0.53228	AAG	.	.		0.408	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
CC2D2A	57545	hgsc.bcm.edu	37	4	15589442	15589442	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:15589442T>C	ENST00000503292.1	+	33	4249	c.4069T>C	c.(4069-4071)Ttt>Ctt	p.F1357L	CC2D2A_ENST00000424120.1_Missense_Mutation_p.F1357L|CC2D2A_ENST00000389652.5_Missense_Mutation_p.F1249L|CC2D2A_ENST00000413206.1_Missense_Mutation_p.F1357L	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	1357					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						TTGTCAGCAATTTCTTGATCT	0.388																																					p.F1357L		Atlas-SNP	.											.,2	CC2D2A	158	.	0			c.T4069C						.						72.0	66.0	68.0					4																	15589442		1852	4099	5951	SO:0001583	missense	57545	exon33			CAGCAATTTCTTG	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.4069T>C	chr4.hg19:g.15589442T>C	ENSP00000421809:p.Phe1357Leu	37.0	0.0		33.0	15.0	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	hg19	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485738	0.84854	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	5.8	5.8	0.92144	.	0.103416	0.64402	D	0.000002	D	0.84584	0.5504	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;0.964	D;P	0.91635	0.999;0.83	D	0.85048	0.0927	10	0.44086	T	0.13	.	16.1498	0.81605	0.0:0.0:0.0:1.0	.	1357;1249	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	L	1357;1357;1249;1249;1357;1249	ENSP00000403465:F1357L;ENSP00000398391:F1357L;ENSP00000421809:F1357L;ENSP00000374303:F1249L	ENSP00000374303:F1249L	F	+	1	0	CC2D2A	15198540	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	8.040000	0.89188	2.218000	0.71995	0.377000	0.23210	TTT	.	.		0.388	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
PCDH7	5099	hgsc.bcm.edu	37	4	30921954	30921954	+	Silent	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:30921954G>T	ENST00000543491.1	+	2	3354	c.3354G>T	c.(3352-3354)ccG>ccT	p.P1118P	PCDH7_ENST00000509925.1_3'UTR			O60245	PCDH7_HUMAN	protocadherin 7	0					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GGACCACGCCGGATGGCAGTG	0.527																																					p.P1118P		Atlas-SNP	.											.	PCDH7	215	.	0			c.G3354T						.						68.0	73.0	71.0					4																	30921954		2185	4291	6476	SO:0001819	synonymous_variant	5099	exon2			CACGCCGGATGGC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000543491.1:c.3354G>T	chr4.hg19:g.30921954G>T		90.0	0.0		82.0	31.0	NM_032457	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000543491.1	hg19	CCDS54753.1	.	.	.	.	.	.	.	.	.	.	G	8.324	0.825034	0.16678	.	.	ENSG00000169851	ENST00000511884	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4661	0.61254	0.0709:0.0:0.9291:0.0	.	.	.	.	X	808	.	.	G	+	1	0	PCDH7	30531052	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.477000	0.60223	2.788000	0.95919	0.650000	0.86243	GGA	.	.		0.527	PCDH7-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032457, NM_002589	
PPAT	5471	hgsc.bcm.edu	37	4	57261616	57261616	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:57261616T>G	ENST00000264220.2	-	11	1593	c.1456A>C	c.(1456-1458)Atg>Ctg	p.M486L	RP11-646I6.6_ENST00000602749.1_lincRNA	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	486					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	TCTTGGATCATAATATCGTGC	0.363																																					p.M486L		Atlas-SNP	.											.	PPAT	41	.	0			c.A1456C						.						105.0	100.0	102.0					4																	57261616		2203	4300	6503	SO:0001583	missense	5471	exon11			GGATCATAATATC		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.1456A>C	chr4.hg19:g.57261616T>G	ENSP00000264220:p.Met486Leu	275.0	0.0		192.0	66.0	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	hg19	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	T	0.183	-1.060553	0.01950	.	.	ENSG00000128059	ENST00000264220	.	.	.	4.68	-0.779	0.10973	.	1.077110	0.07182	N	0.854195	T	0.26304	0.0642	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24693	-1.0153	9	0.23891	T	0.37	0.0837	7.4708	0.27347	0.0:0.3997:0.0:0.6003	.	486	Q06203	PUR1_HUMAN	L	486	.	ENSP00000264220:M486L	M	-	1	0	PPAT	56956373	0.100000	0.21855	0.009000	0.14445	0.191000	0.23601	-0.231000	0.09069	-0.044000	0.13491	-0.263000	0.10527	ATG	.	.		0.363	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
LPHN3	23284	hgsc.bcm.edu	37	4	62845284	62845284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:62845284A>G	ENST00000514591.1	+	17	2934	c.2605A>G	c.(2605-2607)Agt>Ggt	p.S869G	LPHN3_ENST00000512091.2_Missense_Mutation_p.S869G|LPHN3_ENST00000509896.1_Missense_Mutation_p.S937G|LPHN3_ENST00000504896.1_Missense_Mutation_p.S869G|LPHN3_ENST00000508693.1_Missense_Mutation_p.S937G|LPHN3_ENST00000514996.1_Missense_Mutation_p.S869G|LPHN3_ENST00000506720.1_Missense_Mutation_p.S937G|LPHN3_ENST00000508946.1_Missense_Mutation_p.S869G|LPHN3_ENST00000506746.1_Missense_Mutation_p.S937G|LPHN3_ENST00000514157.1_Missense_Mutation_p.S869G|LPHN3_ENST00000545650.1_Missense_Mutation_p.S869G|LPHN3_ENST00000507164.1_Missense_Mutation_p.S937G|LPHN3_ENST00000506700.1_Missense_Mutation_p.S869G|LPHN3_ENST00000511324.1_Missense_Mutation_p.S937G|LPHN3_ENST00000507625.1_Missense_Mutation_p.S937G			Q9HAR2	LPHN3_HUMAN	latrophilin 3	856					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TTTCCAGCACAGTGATGCGGT	0.408																																					p.S869G		Atlas-SNP	.											.	LPHN3	800	.	0			c.A2605G						.						260.0	248.0	252.0					4																	62845284		1952	4157	6109	SO:0001583	missense	23284	exon15			CAGCACAGTGATG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2605A>G	chr4.hg19:g.62845284A>G	ENSP00000422533:p.Ser869Gly	124.0	0.0		104.0	39.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.864|8.864	0.947569|0.947569	0.18356|0.18356	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.71934	.|-0.59;-0.59;-0.61;-0.6;-0.58;-0.59;-0.59;-0.6;-0.58;-0.58;-0.59;-0.59;-0.59;-0.58;-0.57	5.5|5.5	4.32|4.32	0.51571|0.51571	.|.	.|0.292182	.|0.38778	.|N	.|0.001574	T|T	0.46870|0.46870	0.1415|0.1415	N|N	0.12853|0.12853	0.265|0.265	0.32366|0.32366	N|N	0.556455|0.556455	.|B;B;B	.|0.06786	.|0.001;0.001;0.001	.|B;B;B	.|0.04013	.|0.001;0.001;0.001	T|T	0.45308|0.45308	-0.9270|-0.9270	5|10	.|0.24483	.|T	.|0.36	.|.	5.4275|5.4275	0.16433|0.16433	0.6991:0.1483:0.1527:0.0|0.6991:0.1483:0.1527:0.0	.|.	.|869;856;869	.|E9PE04;Q9HAR2;Q9HAR2-2	.|.;LPHN3_HUMAN;.	R|G	326|869;869;937;937;869;869;856;869;937;937;937;869;869;869;937;937;869	.|ENSP00000423388:S869G;ENSP00000422533:S869G;ENSP00000423787:S937G;ENSP00000425033:S937G;ENSP00000424120:S869G;ENSP00000439831:S869G;ENSP00000421476:S937G;ENSP00000424030:S937G;ENSP00000421372:S937G;ENSP00000425201:S869G;ENSP00000423434:S869G;ENSP00000421627:S869G;ENSP00000420931:S937G;ENSP00000425884:S937G;ENSP00000424258:S869G	.|ENSP00000280009:S869G	Q|S	+|+	2|1	0|0	LPHN3|LPHN3	62527879|62527879	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.876000|0.876000	0.50452|0.50452	1.872000|1.872000	0.39549|0.39549	0.918000|0.918000	0.36919|0.36919	0.383000|0.383000	0.25322|0.25322	CAG|AGT	.	.		0.408	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
ARHGAP24	83478	hgsc.bcm.edu	37	4	86916340	86916340	+	Silent	SNP	G	G	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:86916340G>C	ENST00000395184.1	+	9	1999	c.1533G>C	c.(1531-1533)ctG>ctC	p.L511L	ARHGAP24_ENST00000264343.4_Silent_p.L418L|ARHGAP24_ENST00000395183.2_Silent_p.L416L	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	511					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		ATGTGACCCTGAGGGATAACA	0.488																																					p.L511L		Atlas-SNP	.											.	ARHGAP24	116	.	0			c.G1533C						.						122.0	111.0	115.0					4																	86916340		2203	4300	6503	SO:0001819	synonymous_variant	83478	exon9			GACCCTGAGGGAT	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.1533G>C	chr4.hg19:g.86916340G>C		135.0	0.0		100.0	42.0	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Silent	SNP	ENST00000395184.1	hg19	CCDS34025.1																																																																																			.	.		0.488	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
GAB1	2549	hgsc.bcm.edu	37	4	144359564	144359564	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:144359564A>T	ENST00000262994.4	+	4	1308	c.1006A>T	c.(1006-1008)Act>Tct	p.T336S	GAB1_ENST00000262995.4_Missense_Mutation_p.T336S|GAB1_ENST00000505913.1_Missense_Mutation_p.T233S	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	336					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					AAAGCTAGACACTATTCCAGA	0.473																																					p.T336S		Atlas-SNP	.											.	GAB1	80	.	0			c.A1006T						.						147.0	122.0	131.0					4																	144359564		2203	4300	6503	SO:0001583	missense	2549	exon4			CTAGACACTATTC	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1006A>T	chr4.hg19:g.144359564A>T	ENSP00000262994:p.Thr336Ser	102.0	0.0		79.0	44.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	hg19	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	A	9.958	1.222107	0.22457	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000505913	T;T;T	0.16897	2.31;2.31;2.31	5.8	-5.18	0.02840	.	0.700955	0.15342	N	0.267467	T	0.05227	0.0139	N	0.16903	0.455	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.38607	-0.9653	10	0.08381	T	0.77	-0.7723	0.6661	0.00851	0.3476:0.1057:0.2393:0.3075	.	336;336	Q13480;Q13480-2	GAB1_HUMAN;.	S	336;336;233	ENSP00000262995:T336S;ENSP00000262994:T336S;ENSP00000424554:T233S	ENSP00000262994:T336S	T	+	1	0	GAB1	144579014	0.994000	0.37717	0.074000	0.20217	0.476000	0.33039	0.684000	0.25364	-0.797000	0.04450	-0.290000	0.09829	ACT	.	.		0.473	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
FAM160A1	729830	hgsc.bcm.edu	37	4	152571280	152571280	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:152571280A>G	ENST00000505231.1	+	9	2246	c.2087A>G	c.(2086-2088)gAg>gGg	p.E696G	FAM160A1_ENST00000435205.1_Missense_Mutation_p.E696G			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	696	Glu-rich.									endometrium(2)|kidney(1)	3						TCAGAGGAGGAGTGGAATAGG	0.562																																					p.E696G		Atlas-SNP	.											.	FAM160A1	60	.	0			c.A2087G						.						63.0	76.0	72.0					4																	152571280		692	1591	2283	SO:0001583	missense	729830	exon11			AGGAGGAGTGGAA		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.2087A>G	chr4.hg19:g.152571280A>G	ENSP00000421580:p.Glu696Gly	98.0	0.0		62.0	4.0	NM_001109977	Q6ZUS2	Missense_Mutation	SNP	ENST00000505231.1	hg19	CCDS47146.1	.	.	.	.	.	.	.	.	.	.	A	8.662	0.900791	0.17686	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.13307	2.6;2.6	5.05	1.17	0.20885	.	.	.	.	.	T	0.12433	0.0302	L	0.56769	1.78	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.32981	-0.9886	9	0.28530	T	0.3	.	5.28	0.15670	0.5669:0.2842:0.1489:0.0	.	696	Q05DH4	F16A1_HUMAN	G	696	ENSP00000413196:E696G;ENSP00000421580:E696G	ENSP00000413196:E696G	E	+	2	0	FAM160A1	152790730	0.249000	0.23941	0.048000	0.18961	0.030000	0.12068	0.821000	0.27338	0.042000	0.15717	0.529000	0.55759	GAG	.	.		0.562	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1	NM_001109977	
MAN2A1	4124	hgsc.bcm.edu	37	5	109065183	109065183	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr5:109065183A>G	ENST00000261483.4	+	4	1728	c.676A>G	c.(676-678)Ata>Gta	p.I226V		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	226					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GTGGGATATTATAGATATTCA	0.303																																					p.I226V		Atlas-SNP	.											.	MAN2A1	136	.	0			c.A676G						.						97.0	100.0	99.0					5																	109065183		2202	4300	6502	SO:0001583	missense	4124	exon4			GATATTATAGATA		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.676A>G	chr5.hg19:g.109065183A>G	ENSP00000261483:p.Ile226Val	97.0	0.0		108.0	32.0	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	hg19	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297623	0.60086	.	.	ENSG00000112893	ENST00000261483	T	0.21932	1.98	5.83	5.83	0.93111	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	L	0.46157	1.445	0.53688	D	0.999975	B	0.33379	0.41	P	0.45276	0.475	T	0.04229	-1.0967	10	0.17369	T	0.5	-23.5895	16.1982	0.82046	1.0:0.0:0.0:0.0	.	226	Q16706	MA2A1_HUMAN	V	226	ENSP00000261483:I226V	ENSP00000261483:I226V	I	+	1	0	MAN2A1	109093082	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	3.722000	0.54948	2.226000	0.72624	0.533000	0.62120	ATA	.	.		0.303	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
KCNN2	3781	hgsc.bcm.edu	37	5	113798873	113798873	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr5:113798873C>G	ENST00000512097.3	+	5	2147	c.1129C>G	c.(1129-1131)Ctt>Gtt	p.L377V	KCNN2_ENST00000264773.3_Missense_Mutation_p.L377V|KCNN2_ENST00000507750.1_3'UTR|KCNN2_ENST00000503706.1_Missense_Mutation_p.L29V			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	377					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	AGTCTGCTTACTTACTGGAAT	0.388																																					p.L377V		Atlas-SNP	.											.	KCNN2	144	.	0			c.C1129G						.						256.0	217.0	230.0					5																	113798873		2202	4300	6502	SO:0001583	missense	3781	exon4			TGCTTACTTACTG	AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1129C>G	chr5.hg19:g.113798873C>G	ENSP00000427120:p.Leu377Val	106.0	0.0		98.0	19.0	NM_021614	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	ENST00000512097.3	hg19	CCDS4114.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180657	0.57800	.	.	ENSG00000080709	ENST00000512097;ENST00000264773;ENST00000503706	T;T;T	0.27890	1.64;1.64;1.64	5.63	5.63	0.86233	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.42494	0.1205	L	0.48877	1.53	0.80722	D	1	P	0.45474	0.859	P	0.51777	0.679	T	0.03403	-1.1040	10	0.31617	T	0.26	-2.5274	19.2915	0.94102	0.0:1.0:0.0:0.0	.	377	Q9H2S1	KCNN2_HUMAN	V	377;377;29	ENSP00000427120:L377V;ENSP00000264773:L377V;ENSP00000421439:L29V	ENSP00000264773:L377V	L	+	1	0	KCNN2	113826772	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.684000	0.84104	2.658000	0.90341	0.561000	0.74099	CTT	.	.		0.388	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614	
PSD2	84249	hgsc.bcm.edu	37	5	139218319	139218319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr5:139218319C>T	ENST00000274710.3	+	13	2135	c.1930C>T	c.(1930-1932)Cgg>Tgg	p.R644W		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	644					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGTTCTGTCGGCCCCTGCT	0.617																																					p.R644W		Atlas-SNP	.											.	PSD2	88	.	0			c.C1930T						.						56.0	53.0	54.0					5																	139218319		2203	4300	6503	SO:0001583	missense	84249	exon13			TTCTGTCGGCCCC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1930C>T	chr5.hg19:g.139218319C>T	ENSP00000274710:p.Arg644Trp	134.0	0.0		161.0	32.0	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	hg19	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150491	0.78001	.	.	ENSG00000146005	ENST00000274710	T	0.80566	-1.39	5.06	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.89832	0.6829	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.91268	0.5042	10	0.87932	D	0	.	13.3135	0.60394	0.2704:0.7296:0.0:0.0	.	644	Q9BQI7	PSD2_HUMAN	W	644	ENSP00000274710:R644W	ENSP00000274710:R644W	R	+	1	2	PSD2	139198503	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.851000	0.48302	2.514000	0.84764	0.561000	0.74099	CGG	.	.		0.617	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHGA9	56107	hgsc.bcm.edu	37	5	140783284	140783284	+	Silent	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr5:140783284G>T	ENST00000573521.1	+	1	765	c.765G>T	c.(763-765)gtG>gtT	p.V255V	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	255	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGAGAACGTGCCCCCAGGCA	0.473																																					p.V255V		Atlas-SNP	.											.	PCDHGA9	110	.	0			c.G765T						.						48.0	53.0	51.0					5																	140783284		1935	4128	6063	SO:0001819	synonymous_variant	56107	exon1			GAACGTGCCCCCA	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.765G>T	chr5.hg19:g.140783284G>T		170.0	0.0		172.0	110.0	NM_032089	A2RU65|Q9Y5C9	Silent	SNP	ENST00000573521.1	hg19	CCDS58981.1																																																																																			.	.		0.473	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921	
WWC1	23286	hgsc.bcm.edu	37	5	167826554	167826554	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr5:167826554G>A	ENST00000265293.4	+	5	1074	c.572G>A	c.(571-573)gGc>gAc	p.G191D	WWC1_ENST00000521089.1_Missense_Mutation_p.G191D	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	191					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		AAAGAGCGTGGCTTTCAGACC	0.582																																					p.G191D		Atlas-SNP	.											.	WWC1	98	.	0			c.G572A						.						99.0	88.0	92.0					5																	167826554		2203	4300	6503	SO:0001583	missense	23286	exon5			AGCGTGGCTTTCA	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.572G>A	chr5.hg19:g.167826554G>A	ENSP00000265293:p.Gly191Asp	251.0	0.0		246.0	52.0	NM_015238	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	ENST00000265293.4	hg19	CCDS4366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.0|25.0	4.588451|4.588451	0.86851|0.86851	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895	T;T|.	0.42900|.	1.02;0.96|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.068675|.	0.64402|.	D|.	0.000019|.	T|.	0.78984|.	0.4370|.	M|M	0.85197|0.85197	2.74|2.74	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;0.999|.	T|.	0.81366|.	-0.0965|.	10|.	0.56958|.	D|.	0.05|.	.|.	15.7065|15.7065	0.77588|0.77588	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	191;97;191|.	Q8IX03-2;B3KX05;Q8IX03|.	.;.;KIBRA_HUMAN|.	D|X	191|152	ENSP00000265293:G191D;ENSP00000427772:G191D|.	ENSP00000265293:G191D|.	G|W	+|+	2|3	0|0	WWC1|WWC1	167759132|167759132	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	8.115000|8.115000	0.89572|0.89572	2.415000|2.415000	0.81967|0.81967	0.563000|0.563000	0.77884|0.77884	GGC|TGG	.	.		0.582	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
VWA7	80737	hgsc.bcm.edu	37	6	31736938	31736938	+	Nonsense_Mutation	SNP	G	G	A	rs369133546		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:31736938G>A	ENST00000375688.4	-	10	1560	c.1360C>T	c.(1360-1362)Cga>Tga	p.R454*	VWA7_ENST00000447450.1_Nonsense_Mutation_p.R454*|VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Nonsense_Mutation_p.R454*			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	454	VWFA.					extracellular region (GO:0005576)											CGCCGAGCTCGACCCTGAACC	0.517																																					p.R454X		Atlas-SNP	.											.	.	.	.	0			c.C1360T						.	G	stop/ARG	0,3022		0,0,1511	156.0	111.0	127.0		1360	3.8	0.0	6		127	1,5417		0,1,2708	no	stop-gained	C6orf27	NM_025258.2		0,1,4219	AA,AG,GG		0.0185,0.0,0.0118		454/892	31736938	1,8439	1511	2709	4220	SO:0001587	stop_gained	80737	exon10			GAGCTCGACCCTG		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1360C>T	chr6.hg19:g.31736938G>A	ENSP00000364840:p.Arg454*	58.0	0.0		86.0	17.0	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Nonsense_Mutation	SNP	ENST00000375688.4	hg19	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	G	33	5.216607	0.95104	0.0	1.85E-4	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	.	.	.	5.65	3.8	0.43715	.	0.132928	0.48286	D	0.000196	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9585	7.0767	0.25209	0.0811:0.0:0.6286:0.2904	.	.	.	.	X	454	.	ENSP00000364838:R454X	R	-	1	2	C6orf27	31844917	0.104000	0.21937	0.046000	0.18839	0.108000	0.19459	1.079000	0.30766	1.388000	0.46506	0.462000	0.41574	CGA	.	.		0.517	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
GUCA1A	2978	hgsc.bcm.edu	37	6	42147077	42147077	+	Missense_Mutation	SNP	G	G	A	rs558249974		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:42147077G>A	ENST00000394237.1	+	6	1518	c.542G>A	c.(541-543)cGc>cAc	p.R181H	GUCA1A_ENST00000053469.4_Missense_Mutation_p.R181H|GUCA1A_ENST00000372958.1_Missense_Mutation_p.R181H|GUCA1A_ENST00000541991.1_Missense_Mutation_p.R181H			P43080	GUC1A_HUMAN	guanylate cyclase activator 1A (retina)	181					phototransduction, visible light (GO:0007603)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CGCATCGTGCGCAGGCTCCAG	0.642																																					p.R181H		Atlas-SNP	.											.	GUCA1A	18	.	0			c.G542A						.						30.0	28.0	29.0					6																	42147077		2203	4300	6503	SO:0001583	missense	2978	exon6			TCGTGCGCAGGCT		CCDS4864.1	6p21.1	2013-06-06			ENSG00000048545	ENSG00000048545		"""EF-hand domain containing"""	4678	protein-coding gene	gene with protein product	"""cone dystrophy 3"""	600364	"""chromosome 6 open reading frame 131"""	GUCA, GUCA1, C6orf131		9425234	Standard	NM_000409		Approved	GCAP, GCAP1, COD3, dJ139D8.6, CORD14	uc003orx.3	P43080	OTTHUMG00000014696	ENST00000394237.1:c.542G>A	chr6.hg19:g.42147077G>A	ENSP00000377784:p.Arg181His	216.0	0.0		329.0	21.0	NM_000409	B3KWT4|Q7Z6T1|Q9NU14	Missense_Mutation	SNP	ENST00000394237.1	hg19	CCDS4864.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235085	0.39498	.	.	ENSG00000048545	ENST00000541991;ENST00000372965;ENST00000053469;ENST00000394237;ENST00000372958	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	4.34	3.46	0.39613	.	0.877024	0.10146	N	0.710186	T	0.18676	0.0448	N	0.08118	0	0.30242	N	0.794948	B	0.16802	0.019	B	0.04013	0.001	T	0.09037	-1.0693	10	0.33940	T	0.23	.	6.1165	0.20130	0.104:0.1939:0.7022:0.0	.	181	P43080	GUC1A_HUMAN	H	181;185;181;181;181	ENSP00000437476:R181H;ENSP00000053469:R181H;ENSP00000377784:R181H;ENSP00000362049:R181H	ENSP00000053469:R181H	R	+	2	0	GUCA1A	42255055	0.406000	0.25344	0.982000	0.44146	0.942000	0.58702	1.283000	0.33237	0.811000	0.34303	0.561000	0.74099	CGC	.	.		0.642	GUCA1A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316582.1		
RIMS1	22999	hgsc.bcm.edu	37	6	73102465	73102465	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:73102465G>A	ENST00000521978.1	+	31	4571	c.4571G>A	c.(4570-4572)gGa>gAa	p.G1524E	RIMS1_ENST00000401910.3_Missense_Mutation_p.G844E|RIMS1_ENST00000522291.1_Missense_Mutation_p.G1123E|RIMS1_ENST00000425662.2_Missense_Mutation_p.G592E|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000523963.1_Missense_Mutation_p.G649E|RIMS1_ENST00000520567.1_Missense_Mutation_p.G1174E|RIMS1_ENST00000538414.1_Missense_Mutation_p.G330E|RIMS1_ENST00000348717.5_Missense_Mutation_p.G1307E|RIMS1_ENST00000491071.2_Missense_Mutation_p.G1347E|RIMS1_ENST00000517960.1_Missense_Mutation_p.G1307E|RIMS1_ENST00000518273.1_Missense_Mutation_p.G1203E|RIMS1_ENST00000414192.2_Missense_Mutation_p.G51E|RIMS1_ENST00000517827.1_Missense_Mutation_p.G658E|RIMS1_ENST00000264839.7_Missense_Mutation_p.G1373E	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1524					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GATGGATTGGGACCAGCCCAG	0.403																																					p.G1524E		Atlas-SNP	.											.	RIMS1	278	.	0			c.G4571A						.						97.0	92.0	94.0					6																	73102465		1844	4107	5951	SO:0001583	missense	22999	exon31			GATTGGGACCAGC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4571G>A	chr6.hg19:g.73102465G>A	ENSP00000428417:p.Gly1524Glu	118.0	0.0		87.0	6.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.203102|5.203102	0.95033|0.95033	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.81247	.|-1.42;1.34;1.26;1.35;1.84;1.9;1.91;1.15;1.22;1.86;1.63;-1.47;1.61;1.08;1.36;1.95	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.000000	.|0.64402	.|D	.|0.000008	D|D	0.90160|0.90160	0.6925|0.6925	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.898;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;P;D;D;D;D;D;D;D;D;D	.|0.97110	.|0.999;0.999;0.999;0.874;1.0;1.0;0.999;1.0;0.999;1.0;0.997;1.0;0.997	D|D	0.91174|0.91174	0.4971|0.4971	5|10	.|0.87932	.|D	.|0	-18.708|-18.708	19.3783|19.3783	0.94521|0.94521	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|148;330;658;649;1373;844;1123;427;1203;1307;600;1347;1524	.|B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN	N|E	442|1347;1373;1347;1307;1203;1123;1373;1307;1203;1174;1123;1524;844;649;592;689;658;572;330;51	.|ENSP00000430101:G1347E;ENSP00000275037:G1307E;ENSP00000264839:G1373E;ENSP00000429959:G1307E;ENSP00000430408:G1203E;ENSP00000430502:G1174E;ENSP00000430932:G1123E;ENSP00000428417:G1524E;ENSP00000385649:G844E;ENSP00000428328:G649E;ENSP00000411235:G592E;ENSP00000389503:G689E;ENSP00000428367:G658E;ENSP00000359448:G572E;ENSP00000439730:G330E;ENSP00000402273:G51E	.|ENSP00000264839:G1373E	D|G	+|+	1|2	0|0	RIMS1|RIMS1	73159186|73159186	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.582000|2.582000	0.87167|0.87167	0.591000|0.591000	0.81541|0.81541	GAC|GGA	.	.		0.403	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
ENPP3	5169	hgsc.bcm.edu	37	6	131996239	131996239	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:131996239A>G	ENST00000414305.1	+	10	1110	c.782A>G	c.(781-783)tAt>tGt	p.Y261C	ENPP3_ENST00000543135.1_Missense_Mutation_p.Y227C|ENPP3_ENST00000358229.5_Missense_Mutation_p.Y261C|ENPP3_ENST00000427148.2_3'UTR|ENPP3_ENST00000357639.3_Missense_Mutation_p.Y261C			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	261	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		ACAGCAATGTATCAAGGTTTA	0.403																																					p.Y261C		Atlas-SNP	.											.	ENPP3	117	.	0			c.A782G						.						92.0	89.0	90.0					6																	131996239		2203	4300	6503	SO:0001583	missense	5169	exon9			CAATGTATCAAGG	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.782A>G	chr6.hg19:g.131996239A>G	ENSP00000406261:p.Tyr261Cys	121.0	0.0		81.0	22.0	NM_005021	Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	hg19	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650063	0.67472	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000358229	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.52	5.52	0.82312	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.203901	0.34178	N	0.004181	T	0.78464	0.4287	M	0.76002	2.32	0.80722	D	1	D	0.64830	0.994	D	0.64687	0.928	T	0.80946	-0.1155	10	0.54805	T	0.06	-11.3445	14.6197	0.68574	1.0:0.0:0.0:0.0	.	261	O14638	ENPP3_HUMAN	C	261;261;227;261	ENSP00000406261:Y261C;ENSP00000350265:Y261C;ENSP00000440810:Y227C;ENSP00000350964:Y261C	ENSP00000350265:Y261C	Y	+	2	0	ENPP3	132037932	1.000000	0.71417	0.998000	0.56505	0.880000	0.50808	2.789000	0.47813	2.090000	0.63153	0.363000	0.22086	TAT	.	.		0.403	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
SYNE1	23345	hgsc.bcm.edu	37	6	152749436	152749436	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:152749436T>C	ENST00000367255.5	-	37	5481	c.4880A>G	c.(4879-4881)cAg>cGg	p.Q1627R	SYNE1_ENST00000448038.1_Missense_Mutation_p.Q1634R|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q1697R|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q1627R|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q1634R|SYNE1_ENST00000367253.4_Missense_Mutation_p.Q1627R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1627					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CGCAGCCTCCTGAACACAGGA	0.577										HNSCC(10;0.0054)																											p.Q1634R		Atlas-SNP	.											.	SYNE1	3227	.	0			c.A4901G						.						130.0	130.0	130.0					6																	152749436		2203	4300	6503	SO:0001583	missense	23345	exon37			GCCTCCTGAACAC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4880A>G	chr6.hg19:g.152749436T>C	ENSP00000356224:p.Gln1627Arg	35.0	0.0		26.0	7.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	9.522	1.108625	0.20714	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	5.87	4.71	0.59529	.	0.000000	0.56097	D	0.000028	T	0.22898	0.0553	L	0.47716	1.5	0.80722	D	1	P;B;B;B;B	0.38922	0.651;0.013;0.002;0.013;0.01	B;B;B;B;B	0.33521	0.165;0.003;0.007;0.003;0.005	T	0.03773	-1.1005	10	0.34782	T	0.22	.	11.8976	0.52665	0.0:0.0678:0.0:0.9322	.	1610;1627;1627;1627;1634	B3W695;Q8NF91;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	R	1627;1634;1627;1634;1697;1627	ENSP00000356224:Q1627R;ENSP00000396024:Q1634R;ENSP00000265368:Q1627R;ENSP00000390975:Q1634R;ENSP00000341887:Q1697R;ENSP00000356222:Q1627R	ENSP00000265368:Q1627R	Q	-	2	0	SYNE1	152791129	1.000000	0.71417	0.906000	0.35671	0.194000	0.23727	3.625000	0.54238	1.057000	0.40506	0.533000	0.62120	CAG	.	.		0.577	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu	37	6	152804308	152804308	+	Missense_Mutation	SNP	G	G	T	rs150409035		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:152804308G>T	ENST00000367255.5	-	14	1863	c.1262C>A	c.(1261-1263)gCg>gAg	p.A421E	SYNE1_ENST00000448038.1_Missense_Mutation_p.A428E|SYNE1_ENST00000367248.3_Missense_Mutation_p.A411E|SYNE1_ENST00000466159.2_Missense_Mutation_p.A421E|SYNE1_ENST00000341594.5_Missense_Mutation_p.A421E|SYNE1_ENST00000265368.4_Missense_Mutation_p.A421E|SYNE1_ENST00000423061.1_Missense_Mutation_p.A428E|SYNE1_ENST00000413186.2_Missense_Mutation_p.A421E|SYNE1_ENST00000367253.4_Missense_Mutation_p.A421E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	421					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGCCACCTCCGCTCTGTACAG	0.448										HNSCC(10;0.0054)																											p.A428E		Atlas-SNP	.											.	SYNE1	3227	.	0			c.C1283A						.						178.0	172.0	174.0					6																	152804308		2203	4300	6503	SO:0001583	missense	23345	exon14			ACCTCCGCTCTGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1262C>A	chr6.hg19:g.152804308G>T	ENSP00000356224:p.Ala421Glu	68.0	0.0		60.0	25.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781188	0.90282	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.92545	0.01;0.0;-0.08;-0.0;0.36;-2.81;-2.81;-2.91;-3.04;-3.06	5.87	5.87	0.94306	.	0.109437	0.40385	N	0.001104	D	0.94778	0.8314	M	0.76328	2.33	0.80722	D	1	D;D;D;D;D	0.71674	0.996;0.996;0.998;0.996;0.998	P;D;D;D;D	0.68765	0.88;0.912;0.922;0.912;0.96	D	0.91152	0.4954	10	0.17832	T	0.49	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	404;421;421;421;428	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	E	421;428;421;428;421;421;411;421;421;404	ENSP00000356224:A421E;ENSP00000396024:A428E;ENSP00000265368:A421E;ENSP00000390975:A428E;ENSP00000341887:A421E;ENSP00000356222:A421E;ENSP00000356217:A411E;ENSP00000414510:A421E;ENSP00000446021:A421E;ENSP00000441264:A404E	ENSP00000265368:A421E	A	-	2	0	SYNE1	152846001	1.000000	0.71417	0.988000	0.46212	0.921000	0.55340	7.472000	0.80996	2.941000	0.99782	0.655000	0.94253	GCG	.	G|1.000;A|0.000		0.448	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PDE10A	10846	hgsc.bcm.edu	37	6	165844911	165844911	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr6:165844911T>C	ENST00000366882.1	-	9	867	c.713A>G	c.(712-714)cAg>cGg	p.Q238R	PDE10A_ENST00000539869.2_Splice_Site_p.Q248R|PDE10A_ENST00000354448.4_Splice_Site_p.Q238R			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	238					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	AAGACTCACCTGCACCTGATG	0.418																																					p.Q248R	Esophageal Squamous(22;308 615 5753 12038 40624)	Atlas-SNP	.											.	PDE10A	154	.	0			c.A743G						.						115.0	119.0	117.0					6																	165844911		2203	4300	6503	SO:0001630	splice_region_variant	10846	exon8			CTCACCTGCACCT	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.714+1A>G	chr6.hg19:g.165844911T>C		324.0	0.0		216.0	53.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	hg19		.	.	.	.	.	.	.	.	.	.	T	19.40	3.819705	0.71028	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.67345	-0.26;-0.26	5.5	5.5	0.81552	GAF (1);	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	L	0.34521	1.04	0.54753	D	0.999981	P;B	0.37781	0.608;0.187	B;B	0.30401	0.115;0.052	T	0.38693	-0.9649	10	0.23891	T	0.37	.	15.6089	0.76699	0.0:0.0:0.0:1.0	.	248;238	Q9ULW9;Q9Y233	.;PDE10_HUMAN	R	238;266;248;238;237	ENSP00000355847:Q238R;ENSP00000346435:Q238R	ENSP00000341187:Q248R	Q	-	2	0	PDE10A	165764901	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.727000	0.84838	2.082000	0.62665	0.528000	0.53228	CAG	.	.		0.418	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		Missense_Mutation
ANLN	54443	hgsc.bcm.edu	37	7	36445824	36445824	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:36445824G>A	ENST00000265748.2	+	4	743	c.522G>A	c.(520-522)atG>atA	p.M174I	ANLN_ENST00000396068.2_Missense_Mutation_p.M174I	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	174	Nuclear localization.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						TCTCACCAATGCCATCAGAGG	0.458																																					p.M174I		Atlas-SNP	.											.	ANLN	101	.	0			c.G522A						.						77.0	78.0	78.0					7																	36445824		2203	4300	6503	SO:0001583	missense	54443	exon4			ACCAATGCCATCA	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.522G>A	chr7.hg19:g.36445824G>A	ENSP00000265748:p.Met174Ile	72.0	0.0		103.0	40.0	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	hg19	CCDS5447.1	.	.	.	.	.	.	.	.	.	.	G	8.675	0.903794	0.17760	.	.	ENSG00000011426	ENST00000265748;ENST00000396068;ENST00000424865	T;T;T	0.29655	2.77;2.75;1.56	5.34	5.34	0.76211	.	0.915503	0.09662	N	0.772375	T	0.29556	0.0737	L	0.47716	1.5	0.26719	N	0.970824	B;B;B;B	0.12013	0.005;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.002;0.001	T	0.06881	-1.0802	10	0.49607	T	0.09	1.1445	9.966	0.41725	0.0:0.1875:0.6822:0.1303	.	51;174;174;174	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	I	174;174;152	ENSP00000265748:M174I;ENSP00000379380:M174I;ENSP00000404979:M152I	ENSP00000265748:M174I	M	+	3	0	ANLN	36412349	0.995000	0.38212	0.545000	0.28153	0.084000	0.17831	1.122000	0.31295	2.657000	0.90304	0.557000	0.71058	ATG	.	.		0.458	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
ZNF273	10793	hgsc.bcm.edu	37	7	64363699	64363699	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:64363699T>C	ENST00000476120.1	+	1	75	c.4T>C	c.(4-6)Tcc>Ccc	p.S2P	ZNF273_ENST00000545510.1_5'UTR|ZNF273_ENST00000319636.5_5'UTR|ZNF273_ENST00000527278.1_Intron	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CTGCTCTATGTCCTCTGCTCC	0.597																																					p.S2P	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)	Atlas-SNP	.											.	ZNF273	45	.	0			c.T4C						.						54.0	55.0	55.0					7																	64363699		2203	4300	6503	SO:0001583	missense	10793	exon1			TCTATGTCCTCTG	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.4T>C	chr7.hg19:g.64363699T>C	ENSP00000418719:p.Ser2Pro	39.0	0.0		54.0	8.0	NM_021148	B3KQZ5|Q6P3V4	Missense_Mutation	SNP	ENST00000476120.1	hg19	CCDS5528.2	.	.	.	.	.	.	.	.	.	.	.	6.748	0.506806	0.12883	.	.	ENSG00000198039	ENST00000476120	T	0.07021	3.23	0.158	0.158	0.14942	.	.	.	.	.	T	0.04137	0.0115	N	0.08118	0	0.20307	N	0.999917	B	0.02656	0.0	B	0.01281	0.0	T	0.39643	-0.9604	8	0.87932	D	0	.	.	.	.	.	2	Q14593	ZN273_HUMAN	P	2	ENSP00000418719:S2P	ENSP00000433382:S2P	S	+	1	0	ZNF273	64001134	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	0.429000	0.21412	0.175000	0.19841	0.172000	0.16884	TCC	.	.		0.597	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313502.1		
NPTX2	4885	hgsc.bcm.edu	37	7	98254264	98254264	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:98254264T>C	ENST00000265634.3	+	3	839	c.674T>C	c.(673-675)tTc>tCc	p.F225S		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	225					synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CCAGATGCGTTCAAGGTGTCC	0.602																																					p.F225S		Atlas-SNP	.											.	NPTX2	45	.	0			c.T674C						.						239.0	193.0	209.0					7																	98254264		2203	4300	6503	SO:0001583	missense	4885	exon3			ATGCGTTCAAGGT		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.674T>C	chr7.hg19:g.98254264T>C	ENSP00000265634:p.Phe225Ser	49.0	0.0		76.0	17.0	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	hg19	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.775834	0.70107	.	.	ENSG00000106236	ENST00000265634	T	0.13901	2.55	5.57	5.57	0.84162	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	M	0.92367	3.3	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.58047	-0.7705	10	0.54805	T	0.06	-15.6153	14.9047	0.70709	0.0:0.0:0.0:1.0	.	225	P47972	NPTX2_HUMAN	S	225	ENSP00000265634:F225S	ENSP00000265634:F225S	F	+	2	0	NPTX2	98092200	1.000000	0.71417	0.992000	0.48379	0.240000	0.25518	6.248000	0.72418	2.116000	0.64780	0.459000	0.35465	TTC	.	.		0.602	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
GIGYF1	64599	hgsc.bcm.edu	37	7	100284400	100284400	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:100284400T>C	ENST00000275732.5	-	7	1775	c.566A>G	c.(565-567)gAg>gGg	p.E189G	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	189					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GCGGGCGTGCTCCTTCCTTGG	0.662																																					p.E189G		Atlas-SNP	.											.	GIGYF1	113	.	0			c.A566G						.						41.0	40.0	41.0					7																	100284400		2202	4300	6502	SO:0001583	missense	64599	exon7			GCGTGCTCCTTCC	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.566A>G	chr7.hg19:g.100284400T>C	ENSP00000275732:p.Glu189Gly	137.0	0.0		211.0	14.0	NM_022574	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	hg19	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	27.7	4.857550	0.91433	.	.	ENSG00000146830	ENST00000275732	D	0.84944	-1.92	4.96	4.96	0.65561	.	0.122413	0.53938	D	0.000048	D	0.83353	0.5236	L	0.52759	1.655	0.58432	D	0.999998	P	0.52463	0.953	P	0.47603	0.551	T	0.81645	-0.0839	10	0.28530	T	0.3	-21.7271	12.6263	0.56632	0.0:0.0:0.0:1.0	.	189	O75420	PERQ1_HUMAN	G	189	ENSP00000275732:E189G	ENSP00000275732:E189G	E	-	2	0	GIGYF1	100122336	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.994000	0.76251	2.079000	0.62486	0.460000	0.39030	GAG	.	.		0.662	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
RELN	5649	hgsc.bcm.edu	37	7	103126731	103126731	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:103126731G>A	ENST00000428762.1	-	61	10055	c.9896C>T	c.(9895-9897)gCc>gTc	p.A3299V	RELN_ENST00000343529.5_Missense_Mutation_p.A3299V|RELN_ENST00000473945.1_5'Flank|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.A3299V|RN7SKP86_ENST00000410454.1_RNA	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3299					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGCGTAGGGGGCCAGCTGCCC	0.517																																					p.A3299V	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.C9896T						.						91.0	89.0	89.0					7																	103126731		2203	4300	6503	SO:0001583	missense	5649	exon61			TAGGGGGCCAGCT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9896C>T	chr7.hg19:g.103126731G>A	ENSP00000392423:p.Ala3299Val	155.0	0.0		235.0	39.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	hg19	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093733	0.76870	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.23348	1.91;1.91;1.91	6.06	6.06	0.98353	.	0.279422	0.36066	N	0.002814	T	0.25754	0.0627	L	0.34521	1.04	0.44373	D	0.997273	B;B	0.16603	0.001;0.018	B;B	0.18871	0.023;0.017	T	0.01988	-1.1234	10	0.42905	T	0.14	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	3299;3299	P78509-2;P78509	.;RELN_HUMAN	V	3299;3299;3299;816;3299	ENSP00000392423:A3299V;ENSP00000345694:A3299V;ENSP00000388446:A3299V	ENSP00000345694:A3299V	A	-	2	0	RELN	102913967	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.649000	0.83500	2.879000	0.98667	0.650000	0.86243	GCC	.	.		0.517	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
LAMB1	3912	hgsc.bcm.edu	37	7	107569615	107569615	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:107569615A>G	ENST00000222399.6	-	31	5011	c.4781T>C	c.(4780-4782)aTg>aCg	p.M1594T	LAMB1_ENST00000393561.1_Missense_Mutation_p.M1618T|LAMB1_ENST00000474380.1_5'Flank	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1594	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TTCCTTTACCATATCTGCAGT	0.398																																					p.M1594T		Atlas-SNP	.											LAMB1,NS,carcinoma,0,1	LAMB1	185	.	0			c.T4781C						.						199.0	182.0	188.0					7																	107569615		2203	4300	6503	SO:0001583	missense	3912	exon31			TTTACCATATCTG	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4781T>C	chr7.hg19:g.107569615A>G	ENSP00000222399:p.Met1594Thr	74.0	1.0		107.0	22.0	NM_002291	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	hg19	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	A	6.349	0.432520	0.12045	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.77098	-1.07;-1.07	5.96	2.37	0.29283	Prefoldin (1);	.	.	.	.	T	0.63271	0.2497	L	0.37630	1.12	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.001;0.004;0.0	T	0.49523	-0.8931	9	0.14252	T	0.57	.	8.237	0.31631	0.6956:0.0:0.3044:0.0	.	1594;1618;891	P07942;G3XAI2;Q8TAS6	LAMB1_HUMAN;.;.	T	1618;1594	ENSP00000377191:M1618T;ENSP00000222399:M1594T	ENSP00000222399:M1594T	M	-	2	0	LAMB1	107356851	0.691000	0.27709	1.000000	0.80357	0.994000	0.84299	0.124000	0.15728	0.498000	0.27948	-0.274000	0.10170	ATG	.	.		0.398	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
AASS	10157	hgsc.bcm.edu	37	7	121716604	121716604	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:121716604A>C	ENST00000393376.1	-	23	2815	c.2720T>G	c.(2719-2721)aTa>aGa	p.I907R	AASS_ENST00000473553.1_5'UTR|AASS_ENST00000417368.2_Missense_Mutation_p.I907R			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	907	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TCGCTCCAATATTGGTCCATA	0.353																																					p.I907R		Atlas-SNP	.											.	AASS	123	.	0			c.T2720G						.						117.0	118.0	118.0					7																	121716604		2203	4300	6503	SO:0001583	missense	10157	exon24			TCCAATATTGGTC	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2720T>G	chr7.hg19:g.121716604A>C	ENSP00000377040:p.Ile907Arg	87.0	0.0		124.0	24.0	NM_005763	O95462	Missense_Mutation	SNP	ENST00000393376.1	hg19	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.135008	0.77662	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	T;T	0.44482	0.92;0.92	5.7	5.7	0.88788	.	0.146897	0.64402	D	0.000007	T	0.63815	0.2543	M	0.88570	2.965	0.58432	D	0.999999	P	0.41265	0.744	P	0.50378	0.639	T	0.70791	-0.4776	10	0.87932	D	0	-22.6427	15.6246	0.76845	1.0:0.0:0.0:0.0	.	907	Q9UDR5	AASS_HUMAN	R	907	ENSP00000377040:I907R;ENSP00000403768:I907R	ENSP00000377040:I907R	I	-	2	0	AASS	121503840	1.000000	0.71417	0.993000	0.49108	0.938000	0.57974	6.229000	0.72294	2.171000	0.68590	0.482000	0.46254	ATA	.	.		0.353	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
AGBL3	340351	hgsc.bcm.edu	37	7	134719335	134719335	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:134719335G>A	ENST00000436302.2	+	7	1246	c.993G>A	c.(991-993)acG>acA	p.T331T	AGBL3_ENST00000458078.1_Silent_p.T305T|AGBL3_ENST00000435976.2_Silent_p.T331T	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	331						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TGTGCCACACGCTTGCTAGGA	0.428																																					p.T331T		Atlas-SNP	.											.	AGBL3	45	.	0			c.G993A						.						179.0	136.0	149.0					7																	134719335		692	1591	2283	SO:0001819	synonymous_variant	340351	exon7			CCACACGCTTGCT	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.993G>A	chr7.hg19:g.134719335G>A		107.0	0.0		114.0	14.0	NM_178563	B7Z827|Q9H965	Silent	SNP	ENST00000436302.2	hg19	CCDS47718.1																																																																																			.	.		0.428	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
KCNH2	3757	hgsc.bcm.edu	37	7	150647095	150647095	+	Intron	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:150647095G>A	ENST00000262186.5	-	9	2800				KCNH2_ENST00000392968.2_Intron|KCNH2_ENST00000430723.3_Silent_p.A853A|KCNH2_ENST00000330883.4_Intron	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2						cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TCCTCTCCATGGCCCCGCTTG	0.577																																					p.A853A	GBM(137;110 1844 13671 20123 45161)	Atlas-SNP	.											.	KCNH2	157	.	0			c.C2559T						.						25.0	36.0	32.0					7																	150647095		1173	2206	3379	SO:0001627	intron_variant	3757	exon9			CTCCATGGCCCCG	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2398+160C>T	chr7.hg19:g.150647095G>A		86.0	0.0		148.0	6.0	NM_172056	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	ENST00000262186.5	hg19	CCDS5910.1																																																																																			.	.		0.577	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
UBE3C	9690	hgsc.bcm.edu	37	7	156974230	156974230	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr7:156974230A>G	ENST00000348165.5	+	7	995	c.635A>G	c.(634-636)tAt>tGt	p.Y212C	UBE3C_ENST00000389103.4_Missense_Mutation_p.Y169C	NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	212					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGGTCTCTATATTTGTTGATT	0.289																																					p.Y212C		Atlas-SNP	.											.	UBE3C	124	.	0			c.A635G						.						69.0	70.0	70.0					7																	156974230		2203	4300	6503	SO:0001583	missense	9690	exon7			CTCTATATTTGTT	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.635A>G	chr7.hg19:g.156974230A>G	ENSP00000309198:p.Tyr212Cys	107.0	0.0		184.0	29.0	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	hg19	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.186345	0.57909	.	.	ENSG00000009335	ENST00000348165;ENST00000389103	T	0.43294	0.95	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	M	0.65975	2.015	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.99	P;D;P	0.71870	0.887;0.975;0.784	T	0.63501	-0.6623	10	0.49607	T	0.09	-8.8462	14.6399	0.68717	1.0:0.0:0.0:0.0	.	212;212;169	Q15386;Q15386-2;Q15386-3	UBE3C_HUMAN;.;.	C	212;169	ENSP00000309198:Y212C	ENSP00000309198:Y212C	Y	+	2	0	UBE3C	156666991	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.358000	0.90090	1.870000	0.54199	0.455000	0.32223	TAT	.	.		0.289	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
PCM1	5108	hgsc.bcm.edu	37	8	17823507	17823507	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr8:17823507G>T	ENST00000519253.1	+	19	3106		c.e19-1		PCM1_ENST00000325083.8_Splice_Site|PCM1_ENST00000524226.1_Splice_Site			Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TCTTGTGTTAGGTGGAAGAAC	0.373			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																.		Atlas-SNP	.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1	120	.	0			c.2856-1G>T						.						68.0	63.0	64.0					8																	17823507		1868	4101	5969	SO:0001630	splice_region_variant	5108	exon19			GTGTTAGGTGGAA		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.2856-1G>T	chr8.hg19:g.17823507G>T		125.0	0.0		89.0	28.0	NM_006197	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Splice_Site	SNP	ENST00000519253.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.53	3.411791	0.62399	.	.	ENSG00000078674	ENST00000325083;ENST00000519253;ENST00000524226	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5471	0.99284	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCM1	17867787	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	7.573000	0.82421	2.941000	0.99782	0.655000	0.94253	.	.	.		0.373	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	Intron
WRN	7486	hgsc.bcm.edu	37	8	31004928	31004928	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr8:31004928A>G	ENST00000298139.5	+	30	3757	c.3508A>G	c.(3508-3510)Aaa>Gaa	p.K1170E		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1170	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ACATGCCAATAAAATGGATGT	0.343			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												p.K1170E	Ovarian(18;161 598 2706 14834 27543)	Atlas-SNP	.	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	WRN	116	.	0			c.A3508G						.						100.0	101.0	101.0					8																	31004928		2203	4300	6503	SO:0001583	missense	7486	exon30	Familial Cancer Database	WS, Adult Progeria	GCCAATAAAATGG		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3508A>G	chr8.hg19:g.31004928A>G	ENSP00000298139:p.Lys1170Glu	235.0	0.0		136.0	39.0	NM_000553	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	hg19	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	A	0.047	-1.264149	0.01433	.	.	ENSG00000165392	ENST00000298139	T	0.39056	1.1	5.17	-3.96	0.04106	HRDC-like (1);Helicase/RNase D C-terminal, HRDC domain (3);	0.892395	0.09812	N	0.752635	T	0.15435	0.0372	N	0.04820	-0.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.37454	-0.9705	10	0.02654	T	1	-2.0254	8.9677	0.35887	0.2321:0.1526:0.6154:0.0	.	580;1170	Q59F09;Q14191	.;WRN_HUMAN	E	1170	ENSP00000298139:K1170E	ENSP00000298139:K1170E	K	+	1	0	WRN	31124470	0.301000	0.24444	0.005000	0.12908	0.371000	0.29859	0.623000	0.24447	-0.512000	0.06505	-0.256000	0.11100	AAA	.	.		0.343	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		
C8orf86	389649	hgsc.bcm.edu	37	8	38386128	38386128	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr8:38386128G>A	ENST00000358138.1	-	1	52	c.28C>T	c.(28-30)Cca>Tca	p.P10S	C8orf86_ENST00000437935.2_Missense_Mutation_p.P10S	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	10										breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						TCCTCAGCTGGGAGGAGTCCC	0.547																																					p.P10S		Atlas-SNP	.											.	C8orf86	17	.	0			c.C28T						.						53.0	50.0	51.0					8																	38386128		2203	4300	6503	SO:0001583	missense	389649	exon1			CAGCTGGGAGGAG	BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.28C>T	chr8.hg19:g.38386128G>A	ENSP00000350856:p.Pro10Ser	37.0	0.0		45.0	13.0	NM_207412	A4QPB7	Missense_Mutation	SNP	ENST00000358138.1	hg19	CCDS6108.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664995	0.29604	.	.	ENSG00000196166	ENST00000358138;ENST00000437935	T;T	0.58060	0.44;0.36	4.67	-9.34	0.00636	.	.	.	.	.	T	0.23806	0.0576	N	0.08118	0	0.09310	N	1	B	0.22983	0.078	B	0.22386	0.039	T	0.33929	-0.9849	9	0.87932	D	0	.	4.2211	0.10558	0.0915:0.2837:0.4466:0.1782	.	10	Q6ZUL3	CH086_HUMAN	S	10	ENSP00000350856:P10S;ENSP00000389615:P10S	ENSP00000350856:P10S	P	-	1	0	C8orf86	38505285	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.205000	0.03014	-1.818000	0.01218	-0.868000	0.02995	CCA	.	.		0.547	C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376668.1	NM_207412	
PRKDC	5591	hgsc.bcm.edu	37	8	48767935	48767935	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr8:48767935C>T	ENST00000523565.1	-	50	6665		c.e50-1		PRKDC_ENST00000314191.2_Splice_Site|PRKDC_ENST00000338368.3_Splice_Site			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TAGGGACCCCCTGAAAAGGTA	0.343								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	Atlas-SNP	.											.	PRKDC	394	.	0			c.6609-1G>A						.						41.0	36.0	38.0					8																	48767935		1818	4073	5891	SO:0001630	splice_region_variant	5591	exon51			GACCCCCTGAAAA		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.6844-1G>A	chr8.hg19:g.48767935C>T		82.0	0.0		58.0	25.0	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Splice_Site	SNP	ENST00000523565.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.26	3.793479	0.70452	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.771	0.88493	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKDC	48930488	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	7.403000	0.79983	2.521000	0.84997	0.650000	0.86243	.	.	.		0.343	PRKDC-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000377896.1	NM_001081640	Intron
RBM12B	389677	hgsc.bcm.edu	37	8	94748356	94748356	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr8:94748356G>A	ENST00000399300.2	-	3	496	c.283C>T	c.(283-285)Cgt>Tgt	p.R95C	RBM12B_ENST00000517700.1_Missense_Mutation_p.R95C|RBM12B_ENST00000520961.1_Intron|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	95							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GATCCTGGACGCCCTCTTCCT	0.408																																					p.R95C		Atlas-SNP	.											.	RBM12B	78	.	0			c.C283T						.						182.0	174.0	177.0					8																	94748356		1865	4089	5954	SO:0001583	missense	389677	exon3			CTGGACGCCCTCT		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.283C>T	chr8.hg19:g.94748356G>A	ENSP00000382239:p.Arg95Cys	99.0	0.0		149.0	9.0	NM_203390	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	hg19	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600308	0.46423	.	.	ENSG00000183808	ENST00000399300;ENST00000517700;ENST00000519109;ENST00000518597;ENST00000520560	T;T;T;T;T	0.17370	2.84;2.89;2.28;2.3;2.34	5.51	4.62	0.57501	.	0.000000	0.47093	D	0.000246	T	0.18215	0.0437	N	0.24115	0.695	0.38891	D	0.957122	D	0.69078	0.997	P	0.50440	0.641	T	0.03684	-1.1013	10	0.72032	D	0.01	-12.0673	12.7592	0.57354	0.0:0.0:0.5289:0.4711	.	95	Q8IXT5	RB12B_HUMAN	C	95	ENSP00000382239:R95C;ENSP00000427729:R95C;ENSP00000430474:R95C;ENSP00000428269:R95C;ENSP00000429807:R95C	ENSP00000382239:R95C	R	-	1	0	RBM12B	94817532	0.706000	0.27856	1.000000	0.80357	0.970000	0.65996	1.067000	0.30616	1.269000	0.44280	0.655000	0.94253	CGT	.	.		0.408	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
ZNF16	7564	hgsc.bcm.edu	37	8	146156959	146156959	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr8:146156959T>C	ENST00000276816.4	-	4	1400	c.1214A>G	c.(1213-1215)tAt>tGt	p.Y405C	ZNF16_ENST00000394909.2_Missense_Mutation_p.Y405C	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	405					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		ATTACACTCATAAGGCTTCTC	0.527																																					p.Y405C		Atlas-SNP	.											.	ZNF16	80	.	0			c.A1214G						.						97.0	92.0	93.0					8																	146156959		2203	4300	6503	SO:0001583	missense	7564	exon3			CACTCATAAGGCT	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1214A>G	chr8.hg19:g.146156959T>C	ENSP00000276816:p.Tyr405Cys	140.0	0.0		173.0	44.0	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	hg19	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.673816	0.47781	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.25414	1.8;1.8	3.88	3.88	0.44766	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53367	0.1792	M	0.85462	2.755	0.09310	N	0.999995	D	0.89917	1.0	D	0.74023	0.982	T	0.45512	-0.9256	9	0.87932	D	0	.	11.8081	0.52167	0.0:0.0:0.0:1.0	.	405	P17020	ZNF16_HUMAN	C	405	ENSP00000276816:Y405C;ENSP00000378369:Y405C	ENSP00000276816:Y405C	Y	-	2	0	ZNF16	146127763	0.000000	0.05858	0.327000	0.25402	0.935000	0.57460	0.263000	0.18478	1.615000	0.50252	0.379000	0.24179	TAT	.	.		0.527	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
PDCD1LG2	80380	hgsc.bcm.edu	37	9	5535017	5535017	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:5535017T>A	ENST00000397747.3	+	3	576	c.328T>A	c.(328-330)Tgg>Agg	p.W110R	PDCD1LG2_ENST00000397745.2_Missense_Mutation_p.W110R	NM_025239.3	NP_079515.2	Q9BQ51	PD1L2_HUMAN	programmed cell death 1 ligand 2	110	Ig-like V-type.				immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(2)|lung(4)|prostate(2)	8	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)		TGGGGTCGCCTGGGACTACAA	0.512																																					p.W110R		Atlas-SNP	.											.	PDCD1LG2	16	.	0			c.T328A						.						62.0	56.0	58.0					9																	5535017		2203	4300	6503	SO:0001583	missense	80380	exon3			GTCGCCTGGGACT	AF344424	CCDS6465.1	9p24.2	2014-01-30			ENSG00000197646	ENSG00000197646		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	18731	protein-coding gene	gene with protein product	"""B7 dendritic cell molecule"""	605723				11224527	Standard	NM_025239		Approved	PD-L2, Btdc, PDL2, bA574F11.2, CD273, B7-DC	uc003zjg.4	Q9BQ51	OTTHUMG00000019504	ENST00000397747.3:c.328T>A	chr9.hg19:g.5535017T>A	ENSP00000380855:p.Trp110Arg	35.0	0.0		27.0	13.0	NM_025239	Q14CN8|Q5T7Z6|Q6JXL8|Q6JXL9	Missense_Mutation	SNP	ENST00000397747.3	hg19	CCDS6465.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.154811	0.57259	.	.	ENSG00000197646	ENST00000397745;ENST00000397747	T;T	0.02395	4.31;4.31	5.19	2.78	0.32641	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.408346	0.18771	N	0.131612	T	0.09202	0.0227	L	0.50919	1.6	0.28850	N	0.896102	D;D;D;D;D	0.89917	0.996;0.999;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.924;0.955;0.996;0.999;0.955	T	0.03423	-1.1038	10	0.45353	T	0.12	-0.1939	9.1241	0.36805	0.0:0.0:0.3931:0.6069	.	99;110;110;110;110	Q2LC89;A4GW21;Q9BQ51-3;Q9BQ51-2;Q9BQ51	.;.;.;.;PD1L2_HUMAN	R	110	ENSP00000380853:W110R;ENSP00000380855:W110R	ENSP00000380853:W110R	W	+	1	0	PDCD1LG2	5525017	0.997000	0.39634	0.996000	0.52242	0.811000	0.45836	1.220000	0.32491	0.984000	0.38629	0.459000	0.35465	TGG	.	.		0.512	PDCD1LG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051634.1	NM_025239	
CNTLN	54875	hgsc.bcm.edu	37	9	17394652	17394652	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:17394652G>C	ENST00000380647.3	+	15	2284	c.2200G>C	c.(2200-2202)Gaa>Caa	p.E734Q	CNTLN_ENST00000262360.5_Missense_Mutation_p.E734Q|CNTLN_ENST00000425824.1_Missense_Mutation_p.E734Q			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	734					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		ACAGCAACAAGAAGATACAGA	0.308																																					p.E734Q		Atlas-SNP	.											.	CNTLN	128	.	0			c.G2200C						.						66.0	62.0	63.0					9																	17394652		1799	4071	5870	SO:0001583	missense	54875	exon15			CAACAAGAAGATA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2200G>C	chr9.hg19:g.17394652G>C	ENSP00000370021:p.Glu734Gln	283.0	0.0		263.0	19.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	hg19	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.237395	0.22711	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.20069	2.1;2.1;2.36	5.37	5.37	0.77165	.	.	.	.	.	T	0.37210	0.0995	L	0.60455	1.87	0.32444	N	0.546271	D;D;D	0.71674	0.998;0.962;0.962	D;P;P	0.65684	0.937;0.764;0.764	T	0.30001	-0.9993	9	0.18710	T	0.47	.	12.1299	0.53936	0.0796:0.0:0.9204:0.0	.	734;734;734	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	Q	734	ENSP00000370021:E734Q;ENSP00000392798:E734Q;ENSP00000262360:E734Q	ENSP00000262360:E734Q	E	+	1	0	CNTLN	17384652	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	2.779000	0.47734	2.511000	0.84671	0.650000	0.86243	GAA	.	.		0.308	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
TLN1	7094	hgsc.bcm.edu	37	9	35717322	35717322	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:35717322T>A	ENST00000314888.9	-	19	2632	c.2279A>T	c.(2278-2280)gAt>gTt	p.D760V	TLN1_ENST00000540444.1_Missense_Mutation_p.D760V	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	760					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGTTGCCCATCCTCTGTAGC	0.612																																					p.D760V		Atlas-SNP	.											.	TLN1	185	.	0			c.A2279T						.						73.0	70.0	71.0					9																	35717322		2203	4300	6503	SO:0001583	missense	7094	exon19			TGCCCATCCTCTG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.2279A>T	chr9.hg19:g.35717322T>A	ENSP00000316029:p.Asp760Val	57.0	0.0		45.0	22.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.803632	0.90623	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.72615	-0.66;-0.67	5.6	5.6	0.85130	.	0.048591	0.85682	D	0.000000	T	0.71787	0.3381	M	0.81341	2.54	0.80722	D	1	P	0.43633	0.813	B	0.36567	0.228	T	0.78362	-0.2233	10	0.87932	D	0	-16.0705	15.7766	0.78224	0.0:0.0:0.0:1.0	.	760	Q9Y490	TLN1_HUMAN	V	760	ENSP00000316029:D760V;ENSP00000442981:D760V	ENSP00000316029:D760V	D	-	2	0	TLN1	35707322	1.000000	0.71417	0.984000	0.44739	0.998000	0.95712	6.269000	0.72558	2.143000	0.66587	0.459000	0.35465	GAT	.	.		0.612	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
FAM221B	392307	hgsc.bcm.edu	37	9	35819298	35819298	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:35819298T>G	ENST00000423537.2	-	5	1216	c.947A>C	c.(946-948)aAg>aCg	p.K316T	TMEM8B_ENST00000377996.1_Intron	NM_001012446.3	NP_001012448.2	A6H8Z2	F221B_HUMAN	family with sequence similarity 221, member B	316										endometrium(2)|kidney(1)|lung(4)	7						GGCCCGTCTCTTGAGCCAGAA	0.597																																					p.K316T		Atlas-SNP	.											.	FAM221B	38	.	0			c.A947C						.						202.0	200.0	200.0					9																	35819298		692	1591	2283	SO:0001583	missense	392307	exon5			CGTCTCTTGAGCC	BX648702	CCDS43799.1, CCDS43799.2	9p13.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000204930	ENSG00000204930			30762	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 128"""	C9orf128			Standard	NM_001012446		Approved		uc010mlc.2	A6H8Z2	OTTHUMG00000019880	ENST00000423537.2:c.947A>C	chr9.hg19:g.35819298T>G	ENSP00000415299:p.Lys316Thr	118.0	0.0		125.0	18.0	NM_001012446	Q5TCW2	Missense_Mutation	SNP	ENST00000423537.2	hg19	CCDS43799.2	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798257	0.31777	.	.	ENSG00000204930	ENST00000423537	T	0.15603	2.41	5.1	-4.36	0.03645	.	.	.	.	.	T	0.08802	0.0218	L	0.27053	0.805	0.22317	N	0.999203	B	0.12630	0.006	B	0.12837	0.008	T	0.34378	-0.9831	9	0.33141	T	0.24	-1.8824	3.2101	0.06680	0.1292:0.441:0.1599:0.2698	.	316	A6H8Z2	CI128_HUMAN	T	316	ENSP00000415299:K316T	ENSP00000415299:K316T	K	-	2	0	C9orf128	35809298	0.950000	0.32346	0.810000	0.32431	0.972000	0.66771	-0.013000	0.12678	-0.929000	0.03757	-1.386000	0.01163	AAG	.	.		0.597	FAM221B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355861.1	NM_001012446	
GKAP1	80318	hgsc.bcm.edu	37	9	86421241	86421241	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:86421241T>C	ENST00000376371.2	-	3	592	c.192A>G	c.(190-192)gaA>gaG	p.E64E	GKAP1_ENST00000376365.3_Silent_p.E64E	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	64					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						TCTGTTGCTGttccttctttt	0.378																																					p.E64E		Atlas-SNP	.											.	GKAP1	27	.	0			c.A192G						.						141.0	131.0	135.0					9																	86421241		2145	4173	6318	SO:0001819	synonymous_variant	80318	exon3			TTGCTGTTCCTTC	BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.192A>G	chr9.hg19:g.86421241T>C		37.0	0.0		35.0	11.0	NM_025211	Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Silent	SNP	ENST00000376371.2	hg19	CCDS35049.1																																																																																			.	.		0.378	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052839.2	NM_025211	
ROR2	4920	hgsc.bcm.edu	37	9	94486330	94486330	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:94486330G>A	ENST00000375708.3	-	9	2644	c.2446C>T	c.(2446-2448)Cag>Tag	p.Q816*	ROR2_ENST00000375715.1_Intron|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	816	Pro-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ACGTAGAGCTGCGGCGGGGGC	0.672																																					p.Q816X		Atlas-SNP	.											.	ROR2	167	.	0			c.C2446T						.						38.0	47.0	44.0					9																	94486330		2203	4298	6501	SO:0001587	stop_gained	4920	exon9			AGAGCTGCGGCGG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2446C>T	chr9.hg19:g.94486330G>A	ENSP00000364860:p.Gln816*	39.0	0.0		33.0	12.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Nonsense_Mutation	SNP	ENST00000375708.3	hg19	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	G	37	6.626304	0.97718	.	.	ENSG00000169071	ENST00000375708	.	.	.	4.52	4.52	0.55395	.	0.000000	0.39909	N	0.001222	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.4667	0.87634	0.0:0.0:1.0:0.0	.	.	.	.	X	816	.	ENSP00000364860:Q816X	Q	-	1	0	ROR2	93526151	1.000000	0.71417	0.997000	0.53966	0.574000	0.36063	9.548000	0.98103	2.345000	0.79718	0.462000	0.41574	CAG	.	.		0.672	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
DNAJC25	548645	hgsc.bcm.edu	37	9	114411923	114411923	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:114411923A>C	ENST00000313525.3	+	3	736	c.680A>C	c.(679-681)aAa>aCa	p.K227T	DNAJC25_ENST00000556107.1_Intron|DNAJC25-GNG10_ENST00000374294.3_Intron	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	227						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						AACATTATAAAAAGTAAAATA	0.358																																					p.K227T		Atlas-SNP	.											.	DNAJC25	20	.	0			c.A680C						.						36.0	37.0	37.0					9																	114411923		1804	4058	5862	SO:0001583	missense	548645	exon3			TTATAAAAAGTAA		CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.680A>C	chr9.hg19:g.114411923A>C	ENSP00000320650:p.Lys227Thr	182.0	0.0		170.0	77.0	NM_001015882	Q5QTD8|Q96BN9	Missense_Mutation	SNP	ENST00000313525.3	hg19	CCDS43862.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.234024	0.58886	.	.	ENSG00000059769	ENST00000313525	T	0.46451	0.87	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.62307	0.2417	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.62859	-0.6765	10	0.54805	T	0.06	-22.6788	15.3933	0.74767	1.0:0.0:0.0:0.0	.	227	Q9H1X3	DJC25_HUMAN	T	227	ENSP00000320650:K227T	ENSP00000320650:K227T	K	+	2	0	DNAJC25	113451744	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.888000	0.92464	2.371000	0.80710	0.533000	0.62120	AAA	.	.		0.358	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156218.3	NM_001015882	
SLC46A2	57864	hgsc.bcm.edu	37	9	115652456	115652456	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:115652456C>T	ENST00000374228.4	-	1	737	c.506G>A	c.(505-507)cGc>cAc	p.R169H		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	169					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						GCGCACAGAGCGGCGGCCCTC	0.672																																					p.R169H		Atlas-SNP	.											.	SLC46A2	30	.	0			c.G506A						.						17.0	22.0	20.0					9																	115652456		2201	4299	6500	SO:0001583	missense	57864	exon1			ACAGAGCGGCGGC	AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.506G>A	chr9.hg19:g.115652456C>T	ENSP00000363345:p.Arg169His	137.0	0.0		123.0	8.0	NM_033051	B1ALK1|Q86VT0|Q96NE2	Missense_Mutation	SNP	ENST00000374228.4	hg19	CCDS6786.1	.	.	.	.	.	.	.	.	.	.	C	33	5.256549	0.95336	.	.	ENSG00000119457	ENST00000374228	T	0.68765	-0.35	5.54	5.54	0.83059	Major facilitator superfamily domain, general substrate transporter (1);	0.095337	0.85682	D	0.000000	T	0.81088	0.4750	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82269	-0.0541	10	0.87932	D	0	-24.48	19.1516	0.93491	0.0:1.0:0.0:0.0	.	169	Q9BY10	TSCOT_HUMAN	H	169	ENSP00000363345:R169H	ENSP00000363345:R169H	R	-	2	0	SLC46A2	114692277	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.888000	0.69758	2.621000	0.88768	0.549000	0.68633	CGC	.	.		0.672	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051	
CERCAM	51148	hgsc.bcm.edu	37	9	131186523	131186523	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:131186523C>A	ENST00000372838.4	+	4	931	c.533C>A	c.(532-534)tCc>tAc	p.S178Y	CERCAM_ENST00000372842.1_Missense_Mutation_p.S100Y	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	178					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						ACCTACTACTCCAACTTCTGG	0.607																																					p.S178Y		Atlas-SNP	.											.	CERCAM	104	.	0			c.C533A						.						88.0	99.0	95.0					9																	131186523		2203	4300	6503	SO:0001583	missense	51148	exon4			ACTACTCCAACTT	AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.533C>A	chr9.hg19:g.131186523C>A	ENSP00000361929:p.Ser178Tyr	96.0	0.0		91.0	30.0	NM_016174	A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	hg19	CCDS6901.2	.	.	.	.	.	.	.	.	.	.	C	33	5.255502	0.95336	.	.	ENSG00000167123	ENST00000372842;ENST00000447915;ENST00000420512;ENST00000372838;ENST00000413863	T;T;T	0.26067	1.76;1.76;1.76	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.57975	0.2090	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.67741	-0.5592	10	0.87932	D	0	-10.4709	16.1793	0.81889	0.0:1.0:0.0:0.0	.	178	Q5T4B2	GT253_HUMAN	Y	100;100;100;178;131	ENSP00000361933:S100Y;ENSP00000416676:S100Y;ENSP00000361929:S178Y	ENSP00000361929:S178Y	S	+	2	0	CERCAM	130226344	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.609000	0.82925	2.385000	0.81259	0.467000	0.42956	TCC	.	.		0.607	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	NM_016174	
FAM73B	84895	hgsc.bcm.edu	37	9	131832663	131832663	+	Silent	SNP	C	C	T	rs375061896		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:131832663C>T	ENST00000358369.4	+	16	1939	c.1713C>T	c.(1711-1713)ccC>ccT	p.P571P	FAM73B_ENST00000277475.5_3'UTR|FAM73B_ENST00000406926.2_3'UTR	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	571					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						TGGGGGTGCCCGCGGCCAGCA	0.697																																					p.P571P		Atlas-SNP	.											.	FAM73B	37	.	0			c.C1713T						.																																			SO:0001819	synonymous_variant	84895	exon16			GGTGCCCGCGGCC	AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.1713C>T	chr9.hg19:g.131832663C>T		155.0	0.0		134.0	12.0	NM_032809	Q8NBM3|Q8TEJ6|Q969E6	Silent	SNP	ENST00000358369.4	hg19	CCDS6917.1																																																																																			.	.		0.697	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054542.7	NM_032809	
NOTCH1	4851	hgsc.bcm.edu	37	9	139395186	139395186	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr9:139395186C>T	ENST00000277541.6	-	31	5827	c.5752G>A	c.(5752-5754)Gcc>Acc	p.A1918T		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1918					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A1919T(1)|p.A1918T(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TGCAGGCTGGCGCCCTGGTAG	0.692			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.A1918T		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	NOTCH1_ENST00000277541,NS,carcinoma,0,2	NOTCH1	1980	.	2	Substitution - Missense(2)	endometrium(2)	c.G5752A						.						61.0	75.0	71.0					9																	139395186		2144	4268	6412	SO:0001583	missense	4851	exon31			GGCTGGCGCCCTG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5752G>A	chr9.hg19:g.139395186C>T	ENSP00000277541:p.Ala1918Thr	52.0	0.0		69.0	18.0	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	hg19	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661939	0.88251	.	.	ENSG00000148400	ENST00000277541	T	0.60672	0.17	4.62	4.62	0.57501	Ankyrin repeat-containing domain (3);	0.053761	0.64402	D	0.000001	T	0.65069	0.2656	M	0.84082	2.675	0.80722	D	1	D	0.62365	0.991	B	0.43916	0.436	T	0.75720	-0.3219	10	0.87932	D	0	.	16.9775	0.86317	0.0:1.0:0.0:0.0	.	1918	P46531	NOTC1_HUMAN	T	1918	ENSP00000277541:A1918T	ENSP00000277541:A1918T	A	-	1	0	NOTCH1	138515007	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	7.578000	0.82498	2.317000	0.78254	0.549000	0.68633	GCC	.	.		0.692	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
ANKRD26	22852	hgsc.bcm.edu	37	10	27342285	27342285	+	Missense_Mutation	SNP	C	C	A	rs138423863	byFrequency	TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr10:27342285C>A	ENST00000376087.4	-	16	1764	c.1599G>T	c.(1597-1599)gaG>gaT	p.E533D	ANKRD26_ENST00000436985.2_Missense_Mutation_p.E549D|ANKRD26_ENST00000376070.3_5'Flank	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	533					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CCCTTTCTTGCTCTTCTTCTG	0.294																																					p.E533D		Atlas-SNP	.											.	ANKRD26	179	.	0			c.G1599T						.						177.0	170.0	172.0					10																	27342285		1798	4062	5860	SO:0001583	missense	22852	exon16			TTCTTGCTCTTCT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1599G>T	chr10.hg19:g.27342285C>A	ENSP00000365255:p.Glu533Asp	71.0	0.0		70.0	22.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	hg19	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.405899	0.25378	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.36699	4.12;1.24	3.33	-2.02	0.07388	.	2.522110	0.03352	U	0.196392	T	0.29491	0.0735	L	0.52573	1.65	0.38414	D	0.946015	B;B;B	0.30851	0.297;0.197;0.034	B;B;B	0.27170	0.077;0.035;0.015	T	0.19418	-1.0306	10	0.56958	D	0.05	.	2.9844	0.05963	0.2385:0.3747:0.0:0.3868	.	533;533;549	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	D	533;549	ENSP00000365255:E533D;ENSP00000405112:E549D	ENSP00000365255:E533D	E	-	3	2	ANKRD26	27382291	0.836000	0.29430	0.014000	0.15608	0.035000	0.12851	-0.381000	0.07417	-0.394000	0.07727	0.484000	0.47621	GAG	.	.		0.294	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
NOC3L	64318	hgsc.bcm.edu	37	10	96116942	96116942	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr10:96116942C>T	ENST00000371361.3	-	4	597	c.497G>A	c.(496-498)aGg>aAg	p.R166K	NOC3L_ENST00000371350.1_Missense_Mutation_p.R166K|NOC3L_ENST00000463649.1_5'UTR	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	166					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TGGCTTCTCCCTAGTCTGTGG	0.323																																					p.R166K		Atlas-SNP	.											.	NOC3L	67	.	0			c.G497A						.						133.0	129.0	130.0					10																	96116942		2203	4300	6503	SO:0001583	missense	64318	exon4			TTCTCCCTAGTCT	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.497G>A	chr10.hg19:g.96116942C>T	ENSP00000360412:p.Arg166Lys	101.0	0.0		113.0	21.0	NM_022451	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	hg19	CCDS7433.1	.	.	.	.	.	.	.	.	.	.	C	8.350	0.830640	0.16820	.	.	ENSG00000173145	ENST00000371361;ENST00000371350	T;T	0.11930	2.73;2.73	5.18	5.18	0.71444	.	0.137834	0.64402	D	0.000006	T	0.07863	0.0197	N	0.19112	0.55	0.36518	D	0.87	B	0.28233	0.204	B	0.26310	0.068	T	0.09292	-1.0681	10	0.05721	T	0.95	-2.0234	12.2812	0.54765	0.2846:0.7154:0.0:0.0	.	166	Q8WTT2	NOC3L_HUMAN	K	166	ENSP00000360412:R166K;ENSP00000360401:R166K	ENSP00000360401:R166K	R	-	2	0	NOC3L	96106932	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.252000	0.72447	2.569000	0.86673	0.561000	0.74099	AGG	.	.		0.323	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
NEURL1	9148	hgsc.bcm.edu	37	10	105344941	105344941	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr10:105344941T>A	ENST00000369780.4	+	4	1707	c.1298T>A	c.(1297-1299)cTc>cAc	p.L433H	NEURL_ENST00000369777.2_Missense_Mutation_p.L416H	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		433	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTTTGGATGCTCTTCGGCCTG	0.697																																					p.L433H		Atlas-SNP	.											.	NEURL	38	.	0			c.T1298A						.						8.0	9.0	9.0					10																	105344941		2088	4133	6221	SO:0001583	missense	9148	exon4			GGATGCTCTTCGG																												ENST00000369780.4:c.1298T>A	chr10.hg19:g.105344941T>A	ENSP00000358795:p.Leu433His	46.0	0.0		48.0	5.0	NM_004210	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	hg19	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	T	18.56	3.650112	0.67472	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	4.82	4.82	0.62117	NEUZ (1);	0.107189	0.64402	D	0.000004	T	0.68531	0.3011	L	0.61218	1.895	0.45837	D	0.998707	D	0.69078	0.997	P	0.57283	0.817	T	0.73275	-0.4034	9	0.87932	D	0	-0.341	14.3726	0.66852	0.0:0.0:0.0:1.0	.	433	O76050	NEU1A_HUMAN	H	433;416	.	ENSP00000358792:L416H	L	+	2	0	NEURL	105334931	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	8.040000	0.89188	1.804000	0.52760	0.260000	0.18958	CTC	.	.		0.697	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
PNLIP	5406	hgsc.bcm.edu	37	10	118306864	118306864	+	Silent	SNP	A	A	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr10:118306864A>T	ENST00000369221.2	+	3	133	c.105A>T	c.(103-105)ggA>ggT	p.G35G	PNLIP_ENST00000470562.1_3'UTR	NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	35					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	CATGGTCAGGAATTACGGAAA	0.433																																					p.G35G		Atlas-SNP	.											.	PNLIP	166	.	0			c.A105T						.						93.0	90.0	91.0					10																	118306864		2203	4300	6503	SO:0001819	synonymous_variant	5406	exon3			GTCAGGAATTACG	BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.105A>T	chr10.hg19:g.118306864A>T		123.0	0.0		128.0	39.0	NM_000936	Q5VSQ2	Silent	SNP	ENST00000369221.2	hg19	CCDS7594.1																																																																																			.	.		0.433	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936	
KCNA4	3739	hgsc.bcm.edu	37	11	30033588	30033588	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:30033588T>A	ENST00000328224.6	-	2	1871	c.638A>T	c.(637-639)gAc>gTc	p.D213V	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	213					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GCGCAAAGGGTCAAAGTACTG	0.463																																					p.D213V		Atlas-SNP	.											.	KCNA4	158	.	0			c.A638T						.						69.0	65.0	66.0					11																	30033588		1872	4106	5978	SO:0001583	missense	3739	exon2			AAAGGGTCAAAGT	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.638A>T	chr11.hg19:g.30033588T>A	ENSP00000328511:p.Asp213Val	62.0	0.0		51.0	35.0	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	hg19	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	T	18.53	3.644769	0.67358	.	.	ENSG00000182255	ENST00000328224	T	0.78003	-1.14	4.81	4.81	0.61882	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.052911	0.64402	D	0.000001	D	0.89444	0.6717	M	0.91717	3.235	0.80722	D	1	D	0.69078	0.997	D	0.65987	0.94	D	0.91931	0.5555	10	0.87932	D	0	.	14.382	0.66916	0.0:0.0:0.0:1.0	.	213	P22459	KCNA4_HUMAN	V	213	ENSP00000328511:D213V	ENSP00000328511:D213V	D	-	2	0	KCNA4	29990164	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.008000	0.88588	1.808000	0.52836	0.459000	0.35465	GAC	.	.		0.463	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
WT1	7490	hgsc.bcm.edu	37	11	32450064	32450064	+	Missense_Mutation	SNP	T	T	G	rs142653301		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:32450064T>G	ENST00000379079.2	-	2	385	c.112A>C	c.(112-114)Atg>Ctg	p.M38L	WT1_ENST00000332351.3_Missense_Mutation_p.M250L|WT1_ENST00000448076.3_Missense_Mutation_p.M250L|WT1_ENST00000530998.1_Missense_Mutation_p.M38L	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	182	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.?(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGCTGGCCCATGGGATCCTCA	0.612			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.M250L		Atlas-SNP	.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	744	.	1	Unknown(1)	kidney(1)	c.A748C						.						87.0	67.0	74.0					11																	32450064		2202	4299	6501	SO:0001583	missense	7490	exon2	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	GGCCCATGGGATC		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.112A>C	chr11.hg19:g.32450064T>G	ENSP00000368370:p.Met38Leu	81.0	0.0		72.0	28.0	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	hg19	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	T	11.61	1.691120	0.30052	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076;ENST00000527775	T;T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43;-1.43	5.62	5.62	0.85841	Wilm&apos (1);s tumour protein, N-terminal (1);	0.344892	0.24899	U	0.034714	T	0.60741	0.2292	N	0.04018	-0.295	0.32431	N	0.54802	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.0;0.0	T	0.61505	-0.7049	10	0.18276	T	0.48	.	12.9355	0.58311	0.0:0.0:0.2044:0.7956	.	255;182;255;38;38	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	L	38;250;38;250;250;1	ENSP00000368370:M38L;ENSP00000331327:M250L;ENSP00000435307:M38L;ENSP00000415516:M250L;ENSP00000413452:M250L;ENSP00000435351:M1L	ENSP00000331327:M250L	M	-	1	0	WT1	32406640	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.663000	0.46774	2.279000	0.76181	0.459000	0.35465	ATG	.	T|1.000;C|0.000		0.612	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33572682	33572682	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:33572682G>A	ENST00000321505.4	+	4	2887	c.2707G>A	c.(2707-2709)Ggt>Agt	p.G903S	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.G909S|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.G909S			Q6ZVL6	K154L_HUMAN	KIAA1549-like	903						integral component of membrane (GO:0016021)											CGAAATGCTGGGTGTGTATGG	0.493																																					p.G903S		Atlas-SNP	.											.	.	.	.	0			c.G2707A						.						206.0	206.0	206.0					11																	33572682		2171	4270	6441	SO:0001583	missense	25758	exon4			ATGCTGGGTGTGT	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2707G>A	chr11.hg19:g.33572682G>A	ENSP00000315295:p.Gly903Ser	129.0	0.0		119.0	98.0	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	hg19	CCDS44565.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.245|8.245	0.807768|0.807768	0.16467|0.16467	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	6.06|6.06	2.94|2.94	0.34122|0.34122	.|.	0.721236|.	0.14787|.	N|.	0.298422|.	T|.	0.24044|.	0.0582|.	N|N	0.24115|0.24115	0.695|0.695	0.28889|0.28889	N|N	0.893961|0.893961	P;D|.	0.61697|.	0.842;0.99|.	B;P|.	0.61003|.	0.236;0.882|.	T|.	0.14783|.	-1.0460|.	9|.	0.32370|.	T|.	0.25|.	-9.2274|-9.2274	5.3107|5.3107	0.15829|0.15829	0.1989:0.2808:0.5202:0.0|0.1989:0.2808:0.5202:0.0	.|.	909;909|.	E9PAT2;Q6ZVL6-2|.	.;.|.	S|X	903;909;909;742|300	.|.	ENSP00000265654:G909S|.	G|W	+|+	1|3	0|0	C11orf41|C11orf41	33529258|33529258	0.021000|0.021000	0.18746|0.18746	0.993000|0.993000	0.49108|0.49108	0.716000|0.716000	0.41182|0.41182	0.819000|0.819000	0.27308|0.27308	1.569000|1.569000	0.49696|0.49696	0.655000|0.655000	0.94253|0.94253	GGT|TGG	.	.		0.493	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
RPS6KB2	6199	hgsc.bcm.edu	37	11	67200655	67200655	+	Missense_Mutation	SNP	G	G	A	rs536646745		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:67200655G>A	ENST00000312629.5	+	9	811	c.766G>A	c.(766-768)Ggg>Agg	p.G256R	AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	256	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GTGGAGCCTGGGGGCCCTGAT	0.682																																					p.G256R		Atlas-SNP	.											.	RPS6KB2	92	.	0			c.G766A						.						17.0	19.0	19.0					11																	67200655		1955	4125	6080	SO:0001583	missense	6199	exon9			AGCCTGGGGGCCC	AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.766G>A	chr11.hg19:g.67200655G>A	ENSP00000308413:p.Gly256Arg	76.0	0.0		39.0	13.0	NM_003952	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	hg19	CCDS41677.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891680	0.91889	.	.	ENSG00000175634	ENST00000312629	T	0.76578	-1.03	4.88	4.88	0.63580	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93926	0.8056	H	0.99752	4.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96819	0.9602	10	0.87932	D	0	.	17.8166	0.88637	0.0:0.0:1.0:0.0	.	256;256	Q9BRS0;Q9UBS0	.;KS6B2_HUMAN	R	256	ENSP00000308413:G256R	ENSP00000308413:G256R	G	+	1	0	RPS6KB2	66957231	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.942000	0.92970	2.521000	0.84997	0.561000	0.74099	GGG	.	.		0.682	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952	
XRRA1	143570	hgsc.bcm.edu	37	11	74563036	74563036	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:74563036C>T	ENST00000340360.6	-	13	1569	c.1238G>A	c.(1237-1239)cGa>cAa	p.R413Q	XRRA1_ENST00000527087.1_Intron|XRRA1_ENST00000321448.8_Missense_Mutation_p.R138Q	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1									p.R413L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						CACTATACCTCGTGTATGGGC	0.547																																					p.R413Q		Atlas-SNP	.											XRRA1,NS,carcinoma,0,1	XRRA1	46	.	1	Substitution - Missense(1)	prostate(1)	c.G1238A						.						116.0	115.0	115.0					11																	74563036		1996	4165	6161	SO:0001583	missense	143570	exon13			ATACCTCGTGTAT	AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.1238G>A	chr11.hg19:g.74563036C>T	ENSP00000339918:p.Arg413Gln	107.0	0.0		87.0	36.0	NM_182969		Missense_Mutation	SNP	ENST00000340360.6	hg19	CCDS44680.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893170	0.91889	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418	T;T	0.52526	0.66;1.42	6.07	3.9	0.45041	.	.	.	.	.	T	0.45836	0.1362	M	0.63428	1.95	0.80722	D	1	D;P;P	0.58970	0.984;0.576;0.777	P;B;B	0.44860	0.462;0.113;0.159	T	0.45804	-0.9236	9	0.42905	T	0.14	-16.5361	9.5643	0.39389	0.0:0.8189:0.0:0.1811	.	413;357;399	Q6P2D8;Q6P2D8-4;Q6P2D8-3	XRRA1_HUMAN;.;.	Q	413;138;399;357	ENSP00000339918:R413Q;ENSP00000319303:R138Q	ENSP00000319303:R138Q	R	-	2	0	XRRA1	74240684	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.431000	0.44775	1.582000	0.49881	0.585000	0.79938	CGA	.	.		0.547	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384715.1	NM_182969	
DLG2	1740	hgsc.bcm.edu	37	11	83177808	83177808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:83177808A>G	ENST00000532653.1	-	21	2605	c.2303T>C	c.(2302-2304)gTt>gCt	p.V768A	DLG2_ENST00000404783.3_Missense_Mutation_p.V264A|DLG2_ENST00000398309.2_Missense_Mutation_p.V786A|DLG2_ENST00000524982.1_Missense_Mutation_p.V782A|DLG2_ENST00000280241.8_Missense_Mutation_p.V825A|DLG2_ENST00000543673.1_Missense_Mutation_p.V891A|DLG2_ENST00000376104.2_Missense_Mutation_p.V891A|DLG2_ENST00000426717.2_Missense_Mutation_p.V250A|DLG2_ENST00000537455.1_Missense_Mutation_p.V536A|DLG2_ENST00000531015.1_Missense_Mutation_p.V753A|DLG2_ENST00000330014.6_Missense_Mutation_p.V707A|DLG2_ENST00000418306.2_Missense_Mutation_p.V665A|DLG2_ENST00000376106.3_Missense_Mutation_p.V250A			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	482					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GAGCTGGGCAACTTGTAACCG	0.443																																					p.V891A		Atlas-SNP	.											.	DLG2	448	.	0			c.T2672C						.						146.0	143.0	144.0					11																	83177808		1882	4104	5986	SO:0001583	missense	1740	exon26			TGGGCAACTTGTA	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2303T>C	chr11.hg19:g.83177808A>G	ENSP00000435849:p.Val768Ala	78.0	0.0		66.0	21.0	NM_001142699	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	hg19		.	.	.	.	.	.	.	.	.	.	A	12.02	1.813343	0.32053	.	.	ENSG00000150672	ENST00000398309;ENST00000426717;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000404783;ENST00000330014;ENST00000537455;ENST00000376106;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000457267	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.84	5.84	0.93424	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000013	T	0.35566	0.0936	L	0.28458	0.855	0.58432	D	0.999996	P;B;B;B;B;B;B;B	0.46784	0.884;0.001;0.0;0.0;0.0;0.001;0.132;0.001	P;B;B;B;B;B;B;B	0.45660	0.489;0.011;0.002;0.005;0.008;0.004;0.101;0.003	T	0.09037	-1.0693	9	.	.	.	.	11.2836	0.49210	0.9295:0.0:0.0705:0.0	.	753;768;782;707;264;891;786;665	E9PIW2;B7Z2T4;E9PN83;B7Z264;B5MCC5;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	A	786;250;891;665;891;825;264;707;536;250;782;768;891;753;138	ENSP00000381355:V786A;ENSP00000393049:V250A;ENSP00000365272:V891A;ENSP00000402275:V665A;ENSP00000441994:V891A;ENSP00000280241:V825A;ENSP00000385113:V264A;ENSP00000381353:V707A;ENSP00000443248:V536A;ENSP00000365274:V250A;ENSP00000432894:V782A;ENSP00000435849:V768A;ENSP00000433848:V753A;ENSP00000409133:V138A	.	V	-	2	0	DLG2	82855456	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.898000	0.63238	2.219000	0.72066	0.528000	0.53228	GTT	.	.		0.443	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364	
C11orf87	399947	hgsc.bcm.edu	37	11	109294946	109294946	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:109294946T>A	ENST00000327419.6	+	2	990	c.587T>A	c.(586-588)cTg>cAg	p.L196Q	RP11-708B6.2_ENST00000532929.1_RNA|RP11-708B6.2_ENST00000532992.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	196						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						ACGGTGGTACTGTCCTGATCG	0.577																																					p.L196Q		Atlas-SNP	.											.	C11orf87	37	.	0			c.T587A						.						33.0	32.0	32.0					11																	109294946		2201	4298	6499	SO:0001583	missense	399947	exon2			TGGTACTGTCCTG	AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.587T>A	chr11.hg19:g.109294946T>A	ENSP00000331581:p.Leu196Gln	86.0	0.0		57.0	20.0	NM_207645	B4E169	Missense_Mutation	SNP	ENST00000327419.6	hg19	CCDS31672.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083311	0.55861	.	.	ENSG00000185742	ENST00000327419	.	.	.	3.8	3.8	0.43715	.	0.316142	0.16595	U	0.207620	T	0.57227	0.2039	N	0.19112	0.55	0.40562	D	0.981223	D	0.76494	0.999	D	0.85130	0.997	T	0.62854	-0.6766	9	0.87932	D	0	-0.1988	12.3675	0.55236	0.0:0.0:0.0:1.0	.	196	Q6NUJ2	CK087_HUMAN	Q	196	.	ENSP00000331581:L196Q	L	+	2	0	C11orf87	108800156	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.016000	0.64041	1.956000	0.56807	0.533000	0.62120	CTG	.	.		0.577	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645	
TECTA	7007	hgsc.bcm.edu	37	11	121016430	121016430	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:121016430C>T	ENST00000392793.1	+	12	3981	c.3710C>T	c.(3709-3711)aCc>aTc	p.T1237I	TECTA_ENST00000478058.1_3'UTR|TECTA_ENST00000264037.2_Missense_Mutation_p.T1237I			O75443	TECTA_HUMAN	tectorin alpha	1237	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CAGAACAGCACCTATGGTCTG	0.542																																					p.T1237I		Atlas-SNP	.											.	TECTA	329	.	0			c.C3710T						.						154.0	124.0	134.0					11																	121016430		2203	4299	6502	SO:0001583	missense	7007	exon11			ACAGCACCTATGG	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3710C>T	chr11.hg19:g.121016430C>T	ENSP00000376543:p.Thr1237Ile	243.0	0.0		179.0	57.0	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	hg19	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463297	0.63513	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.67698	-0.28;-0.28	5.76	4.85	0.62838	von Willebrand factor, type D domain (3);	0.127800	0.53938	D	0.000042	T	0.66896	0.2836	M	0.73217	2.22	0.47659	D	0.999484	B	0.30193	0.272	B	0.34385	0.181	T	0.64765	-0.6330	10	0.32370	T	0.25	.	14.2129	0.65776	0.0:0.9285:0.0:0.0715	.	1237	O75443	TECTA_HUMAN	I	1237	ENSP00000376543:T1237I;ENSP00000264037:T1237I	ENSP00000264037:T1237I	T	+	2	0	TECTA	120521640	0.995000	0.38212	0.702000	0.30337	0.963000	0.63663	4.939000	0.63526	2.721000	0.93114	0.591000	0.81541	ACC	.	.		0.542	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
OR10S1	219873	hgsc.bcm.edu	37	11	123847992	123847992	+	Missense_Mutation	SNP	C	C	A	rs199683540		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:123847992C>A	ENST00000531945.1	-	1	496	c.407G>T	c.(406-408)cGc>cTc	p.R136L		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AGCCAGATAGCGGTCATAGGC	0.542																																					p.R136L		Atlas-SNP	.											.	OR10S1	78	.	0			c.G407T						.						100.0	83.0	88.0					11																	123847992		2202	4299	6501	SO:0001583	missense	219873	exon1			AGATAGCGGTCAT	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.407G>T	chr11.hg19:g.123847992C>A	ENSP00000431914:p.Arg136Leu	74.0	0.0		60.0	52.0	NM_001004474	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	hg19	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283685	0.80803	.	.	ENSG00000196248	ENST00000531945	T	0.77358	-1.09	4.74	3.84	0.44239	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38720	U	0.001587	D	0.91446	0.7300	H	0.97340	3.985	0.44834	D	0.997848	D	0.89917	1.0	D	0.72075	0.976	D	0.93549	0.6885	10	0.87932	D	0	-16.9097	12.6678	0.56851	0.0:0.9191:0.0:0.0809	.	136	Q8NGN2	O10S1_HUMAN	L	136	ENSP00000431914:R136L	ENSP00000431914:R136L	R	-	2	0	OR10S1	123353202	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	7.306000	0.78905	1.253000	0.44018	0.573000	0.79308	CGC	.	.		0.542	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474	
FAM90A1	55138	hgsc.bcm.edu	37	12	8376148	8376148	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:8376148T>A	ENST00000538603.1	-	6	887	c.329A>T	c.(328-330)cAa>cTa	p.Q110L	FAM90A1_ENST00000307435.6_Missense_Mutation_p.Q110L	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	110							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		CTGCGGGTCTTGTGGCCTGCA	0.542																																					p.Q110L		Atlas-SNP	.											.	FAM90A1	68	.	0			c.A329T						.						32.0	31.0	32.0					12																	8376148		2201	4297	6498	SO:0001583	missense	55138	exon6			GGGTCTTGTGGCC	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.329A>T	chr12.hg19:g.8376148T>A	ENSP00000445418:p.Gln110Leu	35.0	0.0		47.0	18.0	NM_018088	D3DUU9|Q9NVZ6	Missense_Mutation	SNP	ENST00000538603.1	hg19	CCDS31738.1	.	.	.	.	.	.	.	.	.	.	.	9.054	0.992835	0.18966	.	.	ENSG00000171847	ENST00000307435;ENST00000538603	T;T	0.13778	2.56;2.56	1.06	1.06	0.20224	.	.	.	.	.	T	0.09379	0.0231	L	0.38175	1.15	0.09310	N	1	B	0.29766	0.256	B	0.26310	0.068	T	0.29181	-1.0020	9	0.44086	T	0.13	-13.0793	4.2802	0.10829	0.0:0.0:0.0:1.0	.	110	Q86YD7	F90A1_HUMAN	L	110	ENSP00000307798:Q110L;ENSP00000445418:Q110L	ENSP00000307798:Q110L	Q	-	2	0	FAM90A1	8267415	0.011000	0.17503	0.031000	0.17742	0.072000	0.16883	0.260000	0.18424	0.721000	0.32231	0.172000	0.16884	CAA	.	.		0.542	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088	
GUCY2C	2984	hgsc.bcm.edu	37	12	14794100	14794100	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:14794100C>G	ENST00000261170.3	-	18	2120	c.1984G>C	c.(1984-1986)Gat>Cat	p.D662H		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	662	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CTGTACACATCTCCTTTCTGA	0.493																																					p.D662H		Atlas-SNP	.											.	GUCY2C	126	.	0			c.G1984C						.						140.0	112.0	121.0					12																	14794100		2203	4300	6503	SO:0001583	missense	2984	exon18			ACACATCTCCTTT		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1984G>C	chr12.hg19:g.14794100C>G	ENSP00000261170:p.Asp662His	87.0	0.0		80.0	8.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	hg19	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883343	0.72410	.	.	ENSG00000070019	ENST00000261170	D	0.88896	-2.44	5.34	5.34	0.76211	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96574	0.8882	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97744	1.0210	10	0.87932	D	0	.	19.0276	0.92939	0.0:1.0:0.0:0.0	.	662	P25092	GUC2C_HUMAN	H	662	ENSP00000261170:D662H	ENSP00000261170:D662H	D	-	1	0	GUCY2C	14685367	1.000000	0.71417	0.977000	0.42913	0.351000	0.29236	7.773000	0.85462	2.495000	0.84180	0.655000	0.94253	GAT	.	.		0.493	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
DDX11	1663	hgsc.bcm.edu	37	12	31247737	31247737	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:31247737A>G	ENST00000407793.2	+	14	1714	c.1463A>G	c.(1462-1464)gAc>gGc	p.D488G	DDX11_ENST00000542838.1_Missense_Mutation_p.D488G|DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000545668.1_Missense_Mutation_p.D488G|DDX11_ENST00000350437.4_Missense_Mutation_p.D488G|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Missense_Mutation_p.D462G	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	488					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AGCCAGATCGACAACATCAAC	0.483										Multiple Myeloma(12;0.14)																											p.D488G		Atlas-SNP	.											.	DDX11	188	.	0			c.A1463G						.						51.0	52.0	52.0					12																	31247737		2203	4297	6500	SO:0001583	missense	1663	exon14			AGATCGACAACAT	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1463A>G	chr12.hg19:g.31247737A>G	ENSP00000384703:p.Asp488Gly	241.0	1.0		268.0	133.0	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	hg19	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.528808	0.64860	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	3.23	3.23	0.37069	.	0.000000	0.85682	D	0.000000	T	0.73976	0.3656	M	0.90483	3.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.77635	-0.2514	10	0.72032	D	0.01	.	9.5852	0.39512	1.0:0.0:0.0:0.0	.	462;488;488;488	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	G	488;488;213;462;488;488	ENSP00000443426:D488G;ENSP00000384703:D488G;ENSP00000228264:D462G;ENSP00000440402:D488G;ENSP00000309965:D488G	ENSP00000228264:D462G	D	+	2	0	DDX11	31139004	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.902000	0.87389	1.335000	0.45486	0.414000	0.27820	GAC	.	.		0.483	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
INHBE	83729	hgsc.bcm.edu	37	12	57850290	57850290	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:57850290C>A	ENST00000266646.2	+	2	928	c.712C>A	c.(712-714)Ccc>Acc	p.P238T	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	238					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						GAGGAGGACCCCCACCTGTGA	0.622											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P238T	GBM(191;1808 2166 15720 36624 50371)	Atlas-SNP	.											.	INHBE	38	.	0			c.C712A						.						77.0	89.0	85.0					12																	57850290		2203	4300	6503	SO:0001583	missense	83729	exon2			AGGACCCCCACCT		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.712C>A	chr12.hg19:g.57850290C>A	ENSP00000266646:p.Pro238Thr	120.0	0.0	1026	132.0	6.0	NM_031479		Missense_Mutation	SNP	ENST00000266646.2	hg19	CCDS8939.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855354	0.51376	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	D;T	0.81908	-1.55;-1.26	4.79	4.79	0.61399	Transforming growth factor-beta, C-terminal (1);	0.187302	0.44097	D	0.000493	T	0.79149	0.4397	L	0.45581	1.43	0.40541	D	0.98102	B	0.19706	0.038	B	0.24394	0.053	T	0.74150	-0.3758	10	0.25106	T	0.35	-1.5374	17.1522	0.86781	0.0:1.0:0.0:0.0	.	238	P58166	INHBE_HUMAN	T	183;238	ENSP00000450212:P183T;ENSP00000266646:P238T	ENSP00000266646:P238T	P	+	1	0	INHBE	56136557	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.340000	0.65958	2.653000	0.90120	0.655000	0.94253	CCC	.	.		0.622	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479	
MARS	4141	hgsc.bcm.edu	37	12	57910274	57910274	+	Silent	SNP	G	G	A	rs373439522		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:57910274G>A	ENST00000262027.5	+	21	2747	c.2613G>A	c.(2611-2613)gcG>gcA	p.A871A	RN7SL312P_ENST00000582079.1_RNA|MIR616_ENST00000385293.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	871	WHEP-TRS.				gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	AGGTTGCTGCGGAGGTGGCGA	0.483																																					p.A871A		Atlas-SNP	.											.	MARS	84	.	0			c.G2613A						.	G		0,4406		0,0,2203	66.0	64.0	65.0		2613	-10.9	0.9	12		65	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MARS	NM_004990.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		871/901	57910274	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4141	exon21			TGCTGCGGAGGTG	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2613G>A	chr12.hg19:g.57910274G>A		244.0	0.0		302.0	76.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Silent	SNP	ENST00000262027.5	hg19	CCDS8942.1																																																																																			.	.		0.483	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
TMEM119	338773	hgsc.bcm.edu	37	12	108985575	108985575	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:108985575G>A	ENST00000392806.3	-	2	753	c.585C>T	c.(583-585)gaC>gaT	p.D195D		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	195					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						TCCTGGCTCCGTCCCCACCGC	0.682																																					p.D195D		Atlas-SNP	.											.	TMEM119	31	.	0			c.C585T						.						41.0	34.0	36.0					12																	108985575		2203	4300	6503	SO:0001819	synonymous_variant	338773	exon2			GGCTCCGTCCCCA	AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.585C>T	chr12.hg19:g.108985575G>A		47.0	0.0		50.0	26.0	NM_181724	Q6UXE5|Q8N2F5	Silent	SNP	ENST00000392806.3	hg19	CCDS9119.1																																																																																			.	.		0.682	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403900.1	NM_181724	
CDK8	1024	hgsc.bcm.edu	37	13	26911779	26911779	+	Splice_Site	SNP	A	A	T	rs371097459		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr13:26911779A>T	ENST00000381527.3	+	2	707	c.204A>T	c.(202-204)gcA>gcT	p.A68A	CDK8_ENST00000536792.1_Splice_Site_p.A68A	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	68	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		GAGAAATAGCAGTAAGTGAAG	0.299																																					p.A68A		Atlas-SNP	.											.	CDK8	61	.	0			c.A204T						.						89.0	101.0	97.0					13																	26911779		2203	4291	6494	SO:0001630	splice_region_variant	1024	exon2			AATAGCAGTAAGT	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.204+1A>T	chr13.hg19:g.26911779A>T		228.0	0.0		132.0	109.0	NM_001260	Q5VUF3|Q6ISB5	Silent	SNP	ENST00000381527.3	hg19	CCDS9317.1																																																																																			.	.		0.299	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1		Silent
NBEA	26960	hgsc.bcm.edu	37	13	36046629	36046629	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr13:36046629G>A	ENST00000400445.3	+	41	7075	c.6541G>A	c.(6541-6543)Gag>Aag	p.E2181K	NBEA_ENST00000540320.1_Missense_Mutation_p.E2181K|NBEA_ENST00000379939.2_Missense_Mutation_p.E2178K|NBEA_ENST00000310336.4_Missense_Mutation_p.E2181K	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2181					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AATCTACTTCGAGGTAGATGA	0.527																																					p.E2181K		Atlas-SNP	.											NBEA,colon,carcinoma,0,1	NBEA	340	.	0			c.G6541A						.						87.0	87.0	87.0					13																	36046629		1987	4170	6157	SO:0001583	missense	26960	exon41			TACTTCGAGGTAG	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6541G>A	chr13.hg19:g.36046629G>A	ENSP00000383295:p.Glu2181Lys	89.0	0.0		69.0	22.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	36	5.800512	0.96960	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.51	5.51	0.81932	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	T	0.50120	0.1597	M	0.80183	2.485	0.80722	D	1	P;P	0.46912	0.664;0.886	B;B	0.34824	0.085;0.19	T	0.59736	-0.7398	10	0.39692	T	0.17	.	19.4328	0.94778	0.0:0.0:1.0:0.0	.	2181;2178	Q8NFP9;Q5T321	NBEA_HUMAN;.	K	2181;2181;2178;2181;808	ENSP00000440951:E2181K;ENSP00000383295:E2181K;ENSP00000369271:E2178K;ENSP00000308534:E2181K	ENSP00000308534:E2181K	E	+	1	0	NBEA	34944629	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.584000	0.87258	0.563000	0.77884	GAG	.	.		0.527	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
EBPL	84650	hgsc.bcm.edu	37	13	50265487	50265487	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr13:50265487C>G	ENST00000242827.6	-	1	124	c.74G>C	c.(73-75)gGc>gCc	p.G25A	EBPL_ENST00000378270.5_Missense_Mutation_p.G25A|EBPL_ENST00000378272.5_Missense_Mutation_p.G25A|EBPL_ENST00000378268.1_Missense_Mutation_p.G25A|EBPL_ENST00000378282.5_Missense_Mutation_p.G25A|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378284.2_Missense_Mutation_p.G25A	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	25					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)			endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		cagggcgcagcccgccgccAG	0.761																																					p.G25A	NSCLC(39;857 1083 36109 42364 51411)	Atlas-SNP	.											.	EBPL	44	.	0			c.G74C						.						3.0	3.0	3.0					13																	50265487		1532	3209	4741	SO:0001583	missense	84650	exon1			GCGCAGCCCGCCG	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.74G>C	chr13.hg19:g.50265487C>G	ENSP00000242827:p.Gly25Ala	41.0	0.0		27.0	6.0	NM_032565	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	hg19	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.499296	0.26861	.	.	ENSG00000123179	ENST00000378272;ENST00000378284;ENST00000242827;ENST00000378274;ENST00000378270;ENST00000378282;ENST00000378268	D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38	3.7	3.7	0.42460	.	0.060996	0.64402	D	0.000006	D	0.93756	0.8004	N	0.11000	0.08	0.51233	D	0.999914	D;D	0.63046	0.989;0.992	P;P	0.56960	0.711;0.81	D	0.91042	0.4872	10	0.02654	T	1	-0.628	14.6852	0.69044	0.0:1.0:0.0:0.0	.	25;25	Q9BY08-2;Q9BY08	.;EBPL_HUMAN	A	25	ENSP00000367521:G25A;ENSP00000242827:G25A;ENSP00000367531:G25A;ENSP00000367516:G25A	ENSP00000242827:G25A	G	-	2	0	EBPL	49163488	0.994000	0.37717	0.080000	0.20451	0.226000	0.24999	2.378000	0.44309	2.072000	0.62099	0.543000	0.68304	GGC	.	.		0.761	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
RNASEH2B	79621	hgsc.bcm.edu	37	13	51504867	51504867	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr13:51504867T>G	ENST00000336617.3	+	4	692	c.293T>G	c.(292-294)cTc>cGc	p.L98R	RNASEH2B_ENST00000495244.2_3'UTR|RNASEH2B_ENST00000422660.1_Missense_Mutation_p.L98R	NM_024570.3	NP_078846.2	Q5TBB1	RNH2B_HUMAN	ribonuclease H2, subunit B	98					in utero embryonic development (GO:0001701)|negative regulation of gene expression (GO:0010629)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of DNA damage checkpoint (GO:2000001)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|ribonucleotide metabolic process (GO:0009259)|RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(2)|liver(1)|lung(1)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)		TTTCTGCTTCTCCACTACCTC	0.433																																					p.L98R		Atlas-SNP	.											.	RNASEH2B	26	.	0			c.T293G						.						213.0	208.0	209.0					13																	51504867		2203	4300	6503	SO:0001583	missense	79621	exon4			TGCTTCTCCACTA	AK021774	CCDS9425.1, CCDS45047.1	13q14.3	2014-09-17	2006-08-17	2006-08-17	ENSG00000136104	ENSG00000136104			25671	protein-coding gene	gene with protein product		610326	"""deleted in lymphocytic leukemia 8"", ""Aicardi-Goutieres syndrome 2"""	DLEU8, AGS2		16845400	Standard	NM_001142279		Approved	FLJ11712	uc001vfa.4	Q5TBB1	OTTHUMG00000016937	ENST00000336617.3:c.293T>G	chr13.hg19:g.51504867T>G	ENSP00000337623:p.Leu98Arg	59.0	0.0		51.0	7.0	NM_024570	G3XAJ1|Q05DR2|Q6PK48|Q9HAF7	Missense_Mutation	SNP	ENST00000336617.3	hg19	CCDS9425.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.105734	0.56291	.	.	ENSG00000136104	ENST00000336617;ENST00000539292;ENST00000422660	D;D	0.97731	-4.51;-4.51	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.98823	0.9603	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99667	1.0995	10	0.66056	D	0.02	-8.2014	13.4138	0.60958	0.0:0.0:0.0:1.0	.	98;98	G3XAJ1;Q5TBB1	.;RNH2B_HUMAN	R	98	ENSP00000337623:L98R;ENSP00000389877:L98R	ENSP00000337623:L98R	L	+	2	0	RNASEH2B	50402868	1.000000	0.71417	0.971000	0.41717	0.350000	0.29205	4.871000	0.63042	2.095000	0.63458	0.533000	0.62120	CTC	.	.		0.433	RNASEH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045006.3	NM_024570	
UGGT2	55757	hgsc.bcm.edu	37	13	96579477	96579477	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr13:96579477T>C	ENST00000376747.3	-	18	2161	c.2091A>G	c.(2089-2091)atA>atG	p.I697M		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	697					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CTGATGTAGATATTAAATTGA	0.284																																					p.I697M		Atlas-SNP	.											.	UGGT2	127	.	0			c.A2091G						.						65.0	68.0	67.0					13																	96579477		2202	4293	6495	SO:0001583	missense	55757	exon18			TGTAGATATTAAA	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2091A>G	chr13.hg19:g.96579477T>C	ENSP00000365938:p.Ile697Met	276.0	0.0		203.0	159.0	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	hg19	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294716	0.40594	.	.	ENSG00000102595	ENST00000376747	T	0.08370	3.1	5.95	0.596	0.17496	.	0.199911	0.52532	N	0.000061	T	0.08670	0.0215	M	0.74881	2.28	0.80722	D	1	B	0.34399	0.452	B	0.35312	0.2	T	0.19257	-1.0311	10	0.35671	T	0.21	-17.0339	1.1521	0.01788	0.2427:0.134:0.1263:0.497	.	697	Q9NYU1	UGGG2_HUMAN	M	697	ENSP00000365938:I697M	ENSP00000365938:I697M	I	-	3	3	UGGT2	95377478	0.996000	0.38824	0.972000	0.41901	0.988000	0.76386	0.223000	0.17719	-0.096000	0.12329	-0.274000	0.10170	ATA	.	.		0.284	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
PARP2	10038	hgsc.bcm.edu	37	14	20820473	20820473	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:20820473T>C	ENST00000250416.5	+	7	633	c.606T>C	c.(604-606)gaT>gaC	p.D202D	PARP2_ENST00000527915.1_Silent_p.D202D|PARP2_ENST00000429687.3_Silent_p.D189D	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	202					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		GAAAATATGATATGCTACAGA	0.343								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.D202D		Atlas-SNP	.											.	PARP2	92	.	0			c.T606C						.						108.0	98.0	101.0					14																	20820473		1845	4097	5942	SO:0001819	synonymous_variant	10038	exon7			ATATGATATGCTA	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.606T>C	chr14.hg19:g.20820473T>C		139.0	0.0		138.0	29.0	NM_005484	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Silent	SNP	ENST00000250416.5	hg19	CCDS41910.1																																																																																			.	.		0.343	PARP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000387847.2		
DHRS4L1	728635	hgsc.bcm.edu	37	14	24517955	24517955	+	RNA	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:24517955G>A	ENST00000558293.1	+	0	603					NR_102693.1																						CATAGAGCTGGCCCCAAGGAA	0.512																																					p.A204T		Atlas-SNP	.											.	.	.	.	0			c.G610A						.						164.0	163.0	164.0					14																	24517955		2203	4300	6503			728635	exon8			GAGCTGGCCCCAA																													chr14.hg19:g.24517955G>A		647.0	0.0		771.0	153.0	NM_001082488		Missense_Mutation	SNP	ENST00000558293.1	hg19		.	.	.	.	.	.	.	.	.	.	G	10.15	1.270983	0.23221	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.67	4.67	0.58626	NAD(P)-binding domain (1);	.	.	.	.	T	0.79997	0.4543	M	0.93594	3.435	0.45747	D	0.998640	D	0.57571	0.98	P	0.58660	0.843	D	0.87790	0.2618	7	0.87932	D	0	.	10.1886	0.43013	0.0:0.0:0.8016:0.1984	.	204	P0CG22	DR4L1_HUMAN	T	204	.	ENSP00000380255:A204T	A	+	1	0	AL136295.1	23587795	1.000000	0.71417	0.451000	0.26982	0.210000	0.24377	2.410000	0.44592	2.418000	0.82041	0.400000	0.26472	GCC	.	.		0.512	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
HECTD1	25831	hgsc.bcm.edu	37	14	31647288	31647288	+	Missense_Mutation	SNP	G	G	A	rs377423641		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:31647288G>A	ENST00000399332.1	-	3	801	c.313C>T	c.(313-315)Cgt>Tgt	p.R105C	HECTD1_ENST00000553700.1_Missense_Mutation_p.R105C	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	105					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ACAACCAAACGATTACAAAGT	0.413																																					p.R105C		Atlas-SNP	.											.	HECTD1	159	.	0			c.C313T						.						175.0	172.0	173.0					14																	31647288		1894	4131	6025	SO:0001583	missense	25831	exon3			CCAAACGATTACA	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.313C>T	chr14.hg19:g.31647288G>A	ENSP00000382269:p.Arg105Cys	122.0	0.0		143.0	7.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698510	0.88830	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	T;T;T	0.64991	-0.13;-0.13;-0.13	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	M	0.82630	2.6	0.80722	D	1	D	0.61697	0.99	B	0.40659	0.336	T	0.74645	-0.3596	10	0.87932	D	0	-9.8804	14.3921	0.66986	0.0:0.0:0.8523:0.1477	.	105	Q9ULT8	HECD1_HUMAN	C	105	ENSP00000450697:R105C;ENSP00000382269:R105C;ENSP00000452015:R105C	ENSP00000261312:R105C	R	-	1	0	HECTD1	30717039	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.158000	0.71851	2.624000	0.88883	0.484000	0.47621	CGT	.	.		0.413	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
SIX6	4990	hgsc.bcm.edu	37	14	60976223	60976223	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:60976223C>T	ENST00000327720.5	+	1	555	c.107C>T	c.(106-108)tCg>tTg	p.S36L		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	36					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		TTCCTCTGGTCGCTGCCCGTG	0.647																																					p.S36L		Atlas-SNP	.											.	SIX6	27	.	0			c.C107T						.						40.0	46.0	44.0					14																	60976223		2203	4299	6502	SO:0001583	missense	4990	exon1			TCTGGTCGCTGCC	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.107C>T	chr14.hg19:g.60976223C>T	ENSP00000328596:p.Ser36Leu	1246.0	2.0		1321.0	397.0	NM_007374	Q6NT42|Q9P1X8	Missense_Mutation	SNP	ENST00000327720.5	hg19	CCDS9747.1	.	.	.	.	.	.	.	.	.	.	C	36	5.722062	0.96839	.	.	ENSG00000184302	ENST00000327720	D	0.97378	-4.36	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.96777	3.88	0.80722	D	1	D	0.76494	0.999	D	0.63033	0.91	D	0.99312	1.0904	10	0.87932	D	0	.	18.891	0.92403	0.0:1.0:0.0:0.0	.	36	O95475	SIX6_HUMAN	L	36	ENSP00000328596:S36L	ENSP00000328596:S36L	S	+	2	0	SIX6	60045976	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.623000	0.83113	2.941000	0.99782	0.655000	0.94253	TCG	.	.		0.647	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2		
SIX4	51804	hgsc.bcm.edu	37	14	61180534	61180534	+	Missense_Mutation	SNP	G	G	A	rs374417781		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:61180534G>A	ENST00000216513.4	-	3	1996	c.1937C>T	c.(1936-1938)cCg>cTg	p.P646L		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	646					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GCTTGCCACCGGTGCAGACAT	0.453																																					p.P646L		Atlas-SNP	.											.	SIX4	69	.	0			c.C1937T						.	G	LEU/PRO	2,4404	4.2+/-10.8	0,2,2201	119.0	97.0	104.0		1937	5.4	1.0	14		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	SIX4	NM_017420.4	98	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	possibly-damaging	646/782	61180534	3,13003	2203	4300	6503	SO:0001583	missense	51804	exon3			GCCACCGGTGCAG	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1937C>T	chr14.hg19:g.61180534G>A	ENSP00000216513:p.Pro646Leu	107.0	0.0		97.0	4.0	NM_017420	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	hg19	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281504	0.59758	4.54E-4	1.16E-4	ENSG00000100625	ENST00000216513;ENST00000554079	D;T	0.92249	-3.0;0.65	5.41	5.41	0.78517	.	0.453038	0.24050	N	0.042006	D	0.93210	0.7837	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94344	0.7573	10	0.87932	D	0	.	19.5632	0.95380	0.0:0.0:1.0:0.0	.	646	Q9UIU6	SIX4_HUMAN	L	646;319	ENSP00000216513:P646L;ENSP00000451537:P319L	ENSP00000216513:P646L	P	-	2	0	SIX4	60250287	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	6.722000	0.74735	2.710000	0.92621	0.655000	0.94253	CCG	.	.		0.453	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
WDR89	112840	hgsc.bcm.edu	37	14	64065604	64065604	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:64065604T>C	ENST00000394942.2	-	2	1145	c.1057A>G	c.(1057-1059)Ata>Gta	p.I353V	CTD-2302E22.2_ENST00000553983.1_lincRNA|WDR89_ENST00000267522.3_Missense_Mutation_p.I353V	NM_001008726.2|NM_001258272.1|NM_080666.3	NP_001008726.1|NP_001245201.1|NP_542397.1	Q96FK6	WDR89_HUMAN	WD repeat domain 89	353										endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)		GTCTTCTCTATAGCTCCAGGT	0.393																																					p.I353V		Atlas-SNP	.											.	WDR89	22	.	0			c.A1057G						.						122.0	114.0	116.0					14																	64065604		2203	4300	6503	SO:0001583	missense	112840	exon3			TCTCTATAGCTCC	AF115513	CCDS9759.1	14q23.2	2013-01-09		2006-07-07	ENSG00000140006	ENSG00000140006		"""WD repeat domain containing"""	20489	protein-coding gene	gene with protein product				C14orf150			Standard	NM_080666		Approved	MGC9907	uc001xgi.4	Q96FK6	OTTHUMG00000140340	ENST00000394942.2:c.1057A>G	chr14.hg19:g.64065604T>C	ENSP00000378399:p.Ile353Val	68.0	0.0		82.0	10.0	NM_080666		Missense_Mutation	SNP	ENST00000394942.2	hg19	CCDS9759.1	.	.	.	.	.	.	.	.	.	.	T	4.931	0.172957	0.09391	.	.	ENSG00000140006	ENST00000394942;ENST00000267522	T;T	0.65364	-0.15;-0.15	5.65	-6.68	0.01778	WD40-repeat-containing domain (1);	1.194700	0.05653	N	0.585591	T	0.31009	0.0783	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26849	-1.0091	10	0.12766	T	0.61	.	8.4453	0.32838	0.1043:0.6051:0.1062:0.1844	.	353	Q96FK6	WDR89_HUMAN	V	353	ENSP00000378399:I353V;ENSP00000267522:I353V	ENSP00000267522:I353V	I	-	1	0	WDR89	63135357	0.000000	0.05858	0.321000	0.25320	0.762000	0.43233	-0.373000	0.07494	-1.363000	0.02164	-1.039000	0.02377	ATA	.	.		0.393	WDR89-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411879.2	NM_080666	
BATF	10538	hgsc.bcm.edu	37	14	75989066	75989066	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:75989066G>A	ENST00000286639.6	+	1	299	c.41G>A	c.(40-42)cGc>cAc	p.R14H	BATF_ENST00000555795.1_Intron|BATF_ENST00000555504.1_Missense_Mutation_p.R14H	NM_006399.3	NP_006390.1	Q16520	BATF_HUMAN	basic leucine zipper transcription factor, ATF-like	14					cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hematopoietic stem cell differentiation (GO:0060218)|isotype switching (GO:0045190)|lymphoid progenitor cell differentiation (GO:0002320)|myeloid dendritic cell differentiation (GO:0043011)|T-helper 17 cell differentiation (GO:0072539)|T-helper 17 cell lineage commitment (GO:0072540)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.028)		AGCTTCAGCCGCTCTCCTCCC	0.582																																					p.R14H		Atlas-SNP	.											.	BATF	12	.	0			c.G41A						.						81.0	74.0	76.0					14																	75989066		2203	4300	6503	SO:0001583	missense	10538	exon1			TCAGCCGCTCTCC	AF016898	CCDS9843.1	14q24	2013-01-10				ENSG00000156127		"""basic leucine zipper proteins"""	958	protein-coding gene	gene with protein product	"""activating transcription factor B"", ""SF-HT-activated gene 2"""	612476				8570175, 8630063	Standard	NM_006399		Approved	B-ATF, SFA-2, BATF1	uc001xrr.3	Q16520		ENST00000286639.6:c.41G>A	chr14.hg19:g.75989066G>A	ENSP00000286639:p.Arg14His	63.0	0.0		60.0	6.0	NM_006399		Missense_Mutation	SNP	ENST00000286639.6	hg19	CCDS9843.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986688	0.53934	.	.	ENSG00000156127	ENST00000286639;ENST00000555504	T	0.77877	-1.13	4.92	4.92	0.64577	.	0.132608	0.50627	D	0.000116	T	0.51822	0.1697	N	0.08118	0	0.36008	D	0.837863	P	0.36789	0.57	B	0.17098	0.017	T	0.64786	-0.6325	10	0.51188	T	0.08	-16.2395	9.6678	0.39994	0.1251:0.0:0.8749:0.0	.	14	Q16520	BATF_HUMAN	H	14	ENSP00000286639:R14H	ENSP00000286639:R14H	R	+	2	0	BATF	75058819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.801000	0.62532	2.715000	0.92844	0.655000	0.94253	CGC	.	.		0.582	BATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413669.1	NM_006399	
NRXN3	9369	hgsc.bcm.edu	37	14	79746796	79746796	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:79746796G>A	ENST00000557594.1	+	1	1115	c.162G>A	c.(160-162)caG>caA	p.Q54Q	NRXN3_ENST00000428277.2_Silent_p.Q54Q|NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000281127.7_Silent_p.Q54Q	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	54					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTCACTCTCAGCACGAGCACC	0.527																																					p.Q54Q		Atlas-SNP	.											.	NRXN3	342	.	0			c.G162A						.						210.0	182.0	192.0					14																	79746796		2203	4300	6503	SO:0001819	synonymous_variant	9369	exon1			CTCTCAGCACGAG	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.162G>A	chr14.hg19:g.79746796G>A		87.0	0.0		75.0	40.0	NM_138970	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000557594.1	hg19																																																																																				.	.		0.527	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
TRPM7	54822	hgsc.bcm.edu	37	15	50884532	50884532	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr15:50884532G>A	ENST00000313478.7	-	26	4181	c.3900C>T	c.(3898-3900)tcC>tcT	p.S1300S	TRPM7_ENST00000560955.1_Silent_p.S1300S	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1300					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GAGGAAGAGAGGAGCTAAGTG	0.353																																					p.S1300S		Atlas-SNP	.											.	TRPM7	145	.	0			c.C3900T						.						136.0	119.0	124.0					15																	50884532		1849	4085	5934	SO:0001819	synonymous_variant	54822	exon26			AAGAGAGGAGCTA	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3900C>T	chr15.hg19:g.50884532G>A		119.0	0.0		156.0	38.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Silent	SNP	ENST00000313478.7	hg19	CCDS42035.1																																																																																			.	.		0.353	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
ADAM10	102	hgsc.bcm.edu	37	15	58936148	58936148	+	Silent	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr15:58936148T>A	ENST00000260408.3	-	7	1208	c.765A>T	c.(763-765)acA>acT	p.T255T	ADAM10_ENST00000561288.1_Intron|ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000396140.2_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	255	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		TCTGGTAAATTGTATCAATCG	0.308																																					p.T255T		Atlas-SNP	.											.	ADAM10	59	.	0			c.A765T						.						116.0	116.0	116.0					15																	58936148		2192	4292	6484	SO:0001819	synonymous_variant	102	exon7			GTAAATTGTATCA	AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.765A>T	chr15.hg19:g.58936148T>A		98.0	0.0		99.0	10.0	NM_001110	B4DU28|Q10742|Q92650	Silent	SNP	ENST00000260408.3	hg19	CCDS10167.1																																																																																			.	.		0.308	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255880.2	NM_001110	
SLC24A1	9187	hgsc.bcm.edu	37	15	65943145	65943145	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr15:65943145G>A	ENST00000261892.6	+	7	2945	c.2658G>A	c.(2656-2658)gaG>gaA	p.E886E	SLC24A1_ENST00000544319.2_Silent_p.E772E|SLC24A1_ENST00000339868.6_Silent_p.E868E|SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000546330.1_Silent_p.E868E|SLC24A1_ENST00000537259.1_Silent_p.E868E|SLC24A1_ENST00000399033.4_Silent_p.E886E	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	886	Poly-Glu.				calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						aggaggaggaggaagaggagg	0.567																																					p.E886E		Atlas-SNP	.											.	SLC24A1	58	.	0			c.G2658A						.						44.0	49.0	48.0					15																	65943145		2194	4289	6483	SO:0001819	synonymous_variant	9187	exon7			GGAGGAGGAAGAG	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.2658G>A	chr15.hg19:g.65943145G>A		100.0	0.0		125.0	5.0	NM_004727	O43485|O75184|Q17RM9	Silent	SNP	ENST00000261892.6	hg19	CCDS45284.1																																																																																			.	.		0.567	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
GOLGA6B	55889	hgsc.bcm.edu	37	15	72955008	72955008	+	Missense_Mutation	SNP	G	G	C	rs199550549	byFrequency	TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr15:72955008G>C	ENST00000421285.3	+	11	1263	c.1263G>C	c.(1261-1263)gaG>gaC	p.E421D	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	421						Golgi apparatus (GO:0005794)		p.E421D(1)		NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						AGAAGGAGGAGAGGCTACAAA	0.587																																					p.E421D		Atlas-SNP	.											GOLGA6B,NS,malignant_melanoma,0,1	GOLGA6B	30	.	1	Substitution - Missense(1)	NS(1)	c.G1263C						.						1.0	1.0	1.0					15																	72955008		108	305	413	SO:0001583	missense	55889	exon11			GGAGGAGAGGCTA		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1263G>C	chr15.hg19:g.72955008G>C	ENSP00000408132:p.Glu421Asp	88.0	0.0		107.0	5.0	NM_018652	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	hg19	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	3.065	-0.192360	0.06259	.	.	ENSG00000215186	ENST00000421285	T	0.07444	3.19	.	.	.	.	.	.	.	.	T	0.06962	0.0177	L	0.47190	1.495	0.22888	N	0.99861	P	0.49961	0.93	B	0.40444	0.329	T	0.30208	-0.9986	8	0.62326	D	0.03	.	2.6645	0.05037	0.4931:0.0:0.5069:0.0	.	421	A6NDN3	GOG6B_HUMAN	D	421	ENSP00000408132:E421D	ENSP00000408132:E421D	E	+	3	2	GOLGA6B	70742062	0.998000	0.40836	0.134000	0.22075	0.265000	0.26407	0.636000	0.24644	0.088000	0.17205	0.089000	0.15464	GAG	.	G|1.000;|0.000		0.587	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652	
NPTN	27020	hgsc.bcm.edu	37	15	73889554	73889554	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr15:73889554C>A	ENST00000345330.4	-	2	445	c.248G>T	c.(247-249)cGg>cTg	p.R83L	NPTN_ENST00000287226.8_Missense_Mutation_p.R83L|NPTN_ENST00000564551.1_Intron|NPTN_ENST00000562924.1_Intron|NPTN_ENST00000351217.6_Intron|NPTN_ENST00000542234.1_Intron|NPTN_ENST00000545878.1_Missense_Mutation_p.R83L|NPTN_ENST00000563691.1_Missense_Mutation_p.R83L	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	83	Ig-like 1.				homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						ACGGCGCTTCCGAGCACCGTC	0.602																																					p.R83L	Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)	Atlas-SNP	.											.	NPTN	35	.	0			c.G248T						.						117.0	97.0	104.0					15																	73889554		2198	4297	6495	SO:0001583	missense	27020	exon2			CGCTTCCGAGCAC	AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.248G>T	chr15.hg19:g.73889554C>A	ENSP00000290401:p.Arg83Leu	155.0	0.0		213.0	47.0	NM_001161363	B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Missense_Mutation	SNP	ENST00000345330.4	hg19	CCDS10249.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.778437	0.90195	.	.	ENSG00000156642	ENST00000345330;ENST00000545878;ENST00000287226	T;T;T	0.68181	-0.31;-0.31;-0.31	5.61	5.61	0.85477	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.79656	0.4483	L	0.49256	1.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.79938	-0.1592	10	0.72032	D	0.01	.	20.0018	0.97417	0.0:1.0:0.0:0.0	.	83;83	Q9Y639-5;Q9Y639	.;NPTN_HUMAN	L	83	ENSP00000290401:R83L;ENSP00000444548:R83L;ENSP00000287226:R83L	ENSP00000287226:R83L	R	-	2	0	NPTN	71676607	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.684000	0.84104	2.793000	0.96121	0.655000	0.94253	CGG	.	.		0.602	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268980.1	NM_012428	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79090369	79090369	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr15:79090369A>G	ENST00000388820.4	-	3	753	c.543T>C	c.(541-543)caT>caC	p.H181H	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	181					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGTACACCACATGGGGCTGGG	0.622																																					p.H181H		Atlas-SNP	.											.	ADAMTS7	142	.	0			c.T543C						.						62.0	63.0	62.0					15																	79090369		2196	4293	6489	SO:0001819	synonymous_variant	11173	exon3			CACCACATGGGGC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.543T>C	chr15.hg19:g.79090369A>G		41.0	0.0		66.0	16.0	NM_014272	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	hg19	CCDS32303.1																																																																																			.	.		0.622	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
SCNN1G	6340	hgsc.bcm.edu	37	16	23200752	23200752	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:23200752G>A	ENST00000300061.2	+	3	521	c.378G>A	c.(376-378)aaG>aaA	p.K126K		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	126					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	AGGCCCTGAAGTCCCTGTATG	0.607																																					p.K126K		Atlas-SNP	.											.	SCNN1G	82	.	0			c.G378A						.						77.0	84.0	81.0					16																	23200752		2197	4300	6497	SO:0001819	synonymous_variant	6340	exon3			CCTGAAGTCCCTG	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.378G>A	chr16.hg19:g.23200752G>A		104.0	0.0		78.0	68.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Silent	SNP	ENST00000300061.2	hg19	CCDS10608.1																																																																																			.	.		0.607	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
SCNN1G	6340	hgsc.bcm.edu	37	16	23223412	23223412	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:23223412T>A	ENST00000300061.2	+	8	1377	c.1234T>A	c.(1234-1236)Tac>Aac	p.Y412N	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	412					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	GTGTGCCCAGTACAGCCAGCC	0.547																																					p.Y412N		Atlas-SNP	.											.	SCNN1G	82	.	0			c.T1234A						.						126.0	99.0	108.0					16																	23223412		2197	4300	6497	SO:0001583	missense	6340	exon8			GCCCAGTACAGCC	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1234T>A	chr16.hg19:g.23223412T>A	ENSP00000300061:p.Tyr412Asn	67.0	0.0		49.0	42.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	hg19	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451107	0.84209	.	.	ENSG00000166828	ENST00000300061	T	0.64438	-0.1	5.72	5.72	0.89469	.	0.412831	0.25538	N	0.029984	T	0.80768	0.4686	M	0.83774	2.66	0.50313	D	0.999865	D	0.89917	1.0	D	0.97110	1.0	D	0.83573	0.0113	10	0.72032	D	0.01	-5.3756	15.1903	0.73038	0.0:0.0:0.0:1.0	.	412	P51170	SCNNG_HUMAN	N	412	ENSP00000300061:Y412N	ENSP00000300061:Y412N	Y	+	1	0	SCNN1G	23130913	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.911000	0.69939	2.185000	0.69588	0.459000	0.35465	TAC	.	.		0.547	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
CDH11	1009	hgsc.bcm.edu	37	16	65005962	65005962	+	Silent	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:65005962G>T	ENST00000268603.4	-	10	2011	c.1396C>A	c.(1396-1398)Cgg>Agg	p.R466R	CDH11_ENST00000566827.1_Silent_p.R340R|CDH11_ENST00000394156.3_Silent_p.R466R	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	466	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TCCTGATGCCGATTGTCTGGG	0.478			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.R466R		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	CDH11,NS,carcinoma,0,1	CDH11	260	.	0			c.C1396A						.						86.0	75.0	79.0					16																	65005962		2203	4300	6503	SO:0001819	synonymous_variant	1009	exon10			GATGCCGATTGTC	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1396C>A	chr16.hg19:g.65005962G>T		158.0	0.0		93.0	71.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	hg19	CCDS10803.1																																																																																			.	.		0.478	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
DYNC1LI2	1783	hgsc.bcm.edu	37	16	66776358	66776358	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:66776358C>T	ENST00000258198.2	-	4	718	c.512G>A	c.(511-513)aGg>aAg	p.R171K	DYNC1LI2_ENST00000443351.2_Intron|DYNC1LI2_ENST00000379482.2_Missense_Mutation_p.R171K|DYNC1LI2_ENST00000440564.2_Missense_Mutation_p.R132K	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	171					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TTCCAGCTCCCTCATTTTTTC	0.388																																					p.R171K		Atlas-SNP	.											.	DYNC1LI2	37	.	0			c.G512A						.						99.0	101.0	101.0					16																	66776358		2200	4300	6500	SO:0001583	missense	1783	exon4			AGCTCCCTCATTT	AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.512G>A	chr16.hg19:g.66776358C>T	ENSP00000258198:p.Arg171Lys	76.0	0.0		53.0	21.0	NM_006141	A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	ENST00000258198.2	hg19	CCDS10818.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117435	0.37339	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000440564	T;T;T	0.17213	2.29;2.29;2.29	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.24122	0.0584	N	0.13352	0.335	0.80722	D	1	D;B;B	0.63046	0.992;0.003;0.019	D;B;B	0.76071	0.987;0.01;0.074	T	0.05937	-1.0855	10	0.10111	T	0.7	-1.7346	19.0071	0.92856	0.0:1.0:0.0:0.0	.	132;171;171	B4E2E0;B4DHD8;O43237	.;.;DC1L2_HUMAN	K	171;171;132	ENSP00000258198:R171K;ENSP00000368795:R171K;ENSP00000408566:R132K	ENSP00000258198:R171K	R	-	2	0	DYNC1LI2	65333859	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.786000	0.62425	2.793000	0.96121	0.563000	0.77884	AGG	.	.		0.388	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268846.1	NM_006141	
AARS	16	hgsc.bcm.edu	37	16	70304225	70304225	+	Silent	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:70304225C>A	ENST00000261772.8	-	6	833	c.690G>T	c.(688-690)ctG>ctT	p.L230L		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		GAAGAGGTTTCAGAATGCCAT	0.468																																					p.L230L		Atlas-SNP	.											.	AARS	62	.	0			c.G690T						.						162.0	132.0	142.0					16																	70304225		2198	4300	6498	SO:0001819	synonymous_variant	16	exon6			AGGTTTCAGAATG	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.690G>T	chr16.hg19:g.70304225C>A		94.0	0.0		90.0	69.0	NM_001605		Silent	SNP	ENST00000261772.8	hg19	CCDS32474.1																																																																																			.	.		0.468	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
SF3B3	23450	hgsc.bcm.edu	37	16	70588395	70588395	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:70588395A>G	ENST00000302516.5	+	12	1660	c.1449A>G	c.(1447-1449)ctA>ctG	p.L483L		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	483					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				ATGCCACCCTAGTGTTGTCCA	0.443																																					p.L483L		Atlas-SNP	.											.	SF3B3	99	.	0			c.A1449G						.						174.0	153.0	160.0					16																	70588395		2198	4300	6498	SO:0001819	synonymous_variant	23450	exon12			CACCCTAGTGTTG	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.1449A>G	chr16.hg19:g.70588395A>G		100.0	0.0		84.0	11.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	ENST00000302516.5	hg19	CCDS10894.1																																																																																			.	.		0.443	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
KLHL36	79786	hgsc.bcm.edu	37	16	84691009	84691009	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr16:84691009G>A	ENST00000564996.1	+	3	737	c.596G>A	c.(595-597)aGc>aAc	p.S199N	KLHL36_ENST00000258157.5_Missense_Mutation_p.S199N	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	199	BACK.				protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TACCTGAGCAGCAGCGAGGTG	0.642																																					p.S199N		Atlas-SNP	.											.	KLHL36	51	.	0			c.G596A						.						41.0	35.0	37.0					16																	84691009		2199	4300	6499	SO:0001583	missense	79786	exon3			TGAGCAGCAGCGA	AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.596G>A	chr16.hg19:g.84691009G>A	ENSP00000456743:p.Ser199Asn	47.0	0.0		24.0	11.0	NM_024731	Q8N5G6|Q9H9U6	Missense_Mutation	SNP	ENST00000564996.1	hg19	CCDS10948.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453358	0.84209	.	.	ENSG00000135686	ENST00000325279;ENST00000258157	T	0.70749	-0.51	5.42	5.42	0.78866	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.85239	0.5651	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.86468	0.1783	10	0.59425	D	0.04	.	18.2083	0.89861	0.0:0.0:1.0:0.0	.	199;199	Q8N4N3-2;Q8N4N3	.;KLH36_HUMAN	N	199	ENSP00000258157:S199N	ENSP00000258157:S199N	S	+	2	0	KLHL36	83248510	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	6.550000	0.73905	2.516000	0.84829	0.563000	0.77884	AGC	.	.		0.642	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269084.2		
MYO1C	4641	hgsc.bcm.edu	37	17	1371776	1371776	+	Silent	SNP	G	G	C	rs374091489		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:1371776G>C	ENST00000575158.1	-	26	2696	c.2520C>G	c.(2518-2520)gcC>gcG	p.A840A	MYO1C_ENST00000359786.5_Silent_p.A875A|MYO1C_ENST00000438665.2_Silent_p.A856A|MYO1C_ENST00000361007.2_Silent_p.A840A|MYO1C_ENST00000545534.2_Silent_p.A851A			Q12965	MYO1E_HUMAN	myosin IC	720	Myosin tail. {ECO:0000255}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CACTAGCCACGGCCTTCTGCT	0.587																																					p.A875A		Atlas-SNP	.											.	MYO1C	57	.	0			c.C2625G						.						103.0	89.0	94.0					17																	1371776		2203	4300	6503	SO:0001819	synonymous_variant	4641	exon26			AGCCACGGCCTTC	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.2520C>G	chr17.hg19:g.1371776G>C		50.0	0.0		60.0	8.0	NM_001080779	Q14778	Silent	SNP	ENST00000575158.1	hg19	CCDS11003.1																																																																																			.	.		0.587	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
SGSM2	9905	hgsc.bcm.edu	37	17	2276666	2276666	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:2276666A>G	ENST00000426855.2	+	16	1999	c.1824A>G	c.(1822-1824)gcA>gcG	p.A608A	SGSM2_ENST00000574563.1_Silent_p.A608A|RP1-59D14.5_ENST00000574290.1_RNA|SGSM2_ENST00000268989.3_Silent_p.A653A	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	608	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		AGGTGTTGGCAGAGTGGAAGG	0.657																																					p.A653A		Atlas-SNP	.											.	SGSM2	60	.	0			c.A1959G						.						122.0	92.0	102.0					17																	2276666		2203	4300	6503	SO:0001819	synonymous_variant	9905	exon17			GTTGGCAGAGTGG	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1824A>G	chr17.hg19:g.2276666A>G		53.0	0.0		56.0	17.0	NM_014853	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	hg19	CCDS45570.1																																																																																			.	.		0.657	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
MYH4	4622	hgsc.bcm.edu	37	17	10363528	10363528	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:10363528C>G	ENST00000255381.2	-	13	1368	c.1258G>C	c.(1258-1260)Gtg>Ctg	p.V420L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	420	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						ACCTGCTGCACAGTCTGGCCT	0.413																																					p.V420L		Atlas-SNP	.											.	MYH4	349	.	0			c.G1258C						.						123.0	113.0	116.0					17																	10363528		2203	4300	6503	SO:0001583	missense	4622	exon13			GCTGCACAGTCTG		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1258G>C	chr17.hg19:g.10363528C>G	ENSP00000255381:p.Val420Leu	134.0	0.0		124.0	9.0	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131563	0.77662	.	.	ENSG00000141048	ENST00000255381	T	0.71817	-0.6	5.56	5.56	0.83823	Myosin head, motor domain (2);	0.000000	0.33813	U	0.004538	T	0.73713	0.3622	M	0.75777	2.31	0.80722	D	1	B	0.02656	0.0	B	0.15052	0.012	T	0.69781	-0.5052	10	0.52906	T	0.07	.	19.8925	0.96935	0.0:1.0:0.0:0.0	.	420	Q9Y623	MYH4_HUMAN	L	420	ENSP00000255381:V420L	ENSP00000255381:V420L	V	-	1	0	MYH4	10304253	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.019000	0.70818	2.787000	0.95880	0.650000	0.86243	GTG	.	.		0.413	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
MYO18A	399687	hgsc.bcm.edu	37	17	27419423	27419423	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:27419423T>C	ENST00000527372.1	-	34	5305	c.5125A>G	c.(5125-5127)Atg>Gtg	p.M1709V	MYO18A_ENST00000533112.1_Missense_Mutation_p.M1672V|MYO18A_ENST00000354329.4_Missense_Mutation_p.M1709V|TIAF1_ENST00000408971.2_5'Flank|MYO18A_ENST00000529578.1_5'Flank|MYO18A_ENST00000531253.1_Missense_Mutation_p.M1709V	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1709					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TCCACCTCCATTGCTTTCCGT	0.622																																					p.M1709V	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.A5125G						.						50.0	56.0	54.0					17																	27419423		2203	4298	6501	SO:0001583	missense	399687	exon34			CCTCCATTGCTTT	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5125A>G	chr17.hg19:g.27419423T>C	ENSP00000437073:p.Met1709Val	36.0	0.0		43.0	11.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	hg19	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682274	0.68042	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;D;T;T	0.87571	-0.95;-2.27;-0.95;-0.95	5.2	5.2	0.72013	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.92374	0.7580	M	0.70595	2.14	0.37321	D	0.909576	D;D;D;P	0.58268	0.982;0.982;0.982;0.728	D;D;D;P	0.68943	0.961;0.961;0.961;0.501	D	0.94376	0.7600	10	0.62326	D	0.03	.	15.0435	0.71811	0.0:0.0:0.0:1.0	.	1312;1672;1709;1709	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	V	1709;1672;1672;1709;1709;605;605;1312	ENSP00000346291:M1709V;ENSP00000435932:M1672V;ENSP00000434228:M1709V;ENSP00000437073:M1709V	ENSP00000346291:M1709V	M	-	1	0	MYO18A	24443549	1.000000	0.71417	0.946000	0.38457	0.985000	0.73830	7.463000	0.80869	2.104000	0.64026	0.482000	0.46254	ATG	.	.		0.622	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
GGNBP2	79893	hgsc.bcm.edu	37	17	34916707	34916707	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:34916707T>C	ENST00000304718.4	+	5	839	c.523T>C	c.(523-525)Ttg>Ctg	p.L175L		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	175					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GCCAAAACCTTTGGGGTAAGT	0.318																																					p.L175L		Atlas-SNP	.											.	GGNBP2	72	.	0			c.T523C						.						73.0	74.0	74.0					17																	34916707		2203	4298	6501	SO:0001819	synonymous_variant	79893	exon5			AAACCTTTGGGGT	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.523T>C	chr17.hg19:g.34916707T>C		123.0	0.0		109.0	34.0	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Silent	SNP	ENST00000304718.4	hg19	CCDS11314.1																																																																																			.	.		0.318	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
TUBG2	27175	hgsc.bcm.edu	37	17	40817531	40817531	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:40817531C>T	ENST00000251412.7	+	7	843	c.644C>T	c.(643-645)aCa>aTa	p.T215I	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	215					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		CGGATTGCCACAGACCGCCTG	0.562																																					p.T215I		Atlas-SNP	.											.	TUBG2	43	.	0			c.C644T						.						181.0	173.0	176.0					17																	40817531		2203	4300	6503	SO:0001583	missense	27175	exon7			TTGCCACAGACCG	AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.644C>T	chr17.hg19:g.40817531C>T	ENSP00000251412:p.Thr215Ile	140.0	0.0		114.0	38.0	NM_016437	A6NDI4|Q32NB2	Missense_Mutation	SNP	ENST00000251412.7	hg19	CCDS32658.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611222	0.66558	.	.	ENSG00000037042	ENST00000251412	T	0.70164	-0.46	4.55	4.55	0.56014	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	T	0.70919	0.3279	M	0.76574	2.34	0.80722	D	1	B	0.25105	0.118	B	0.32149	0.141	T	0.73335	-0.4015	10	0.62326	D	0.03	-10.1674	17.6915	0.88269	0.0:1.0:0.0:0.0	.	215	Q9NRH3	TBG2_HUMAN	I	215	ENSP00000251412:T215I	ENSP00000251412:T215I	T	+	2	0	TUBG2	38071057	1.000000	0.71417	0.999000	0.59377	0.801000	0.45260	7.674000	0.83992	2.246000	0.74042	0.561000	0.74099	ACA	.	.		0.562	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452326.1	NM_016437	
NBR1	4077	hgsc.bcm.edu	37	17	41347008	41347008	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:41347008A>G	ENST00000422280.1	+	14	2161	c.1702A>G	c.(1702-1704)Ata>Gta	p.I568V	NBR1_ENST00000590996.1_Missense_Mutation_p.I568V|NBR1_ENST00000589872.1_Missense_Mutation_p.I568V|NBR1_ENST00000341165.6_Missense_Mutation_p.I568V|NBR1_ENST00000389312.4_Missense_Mutation_p.I568V|NBR1_ENST00000542611.1_Missense_Mutation_p.I547V	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	568	ATG8 family protein-binding.				macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GCTGTTGGATATAAACATTGT	0.438																																					p.I568V		Atlas-SNP	.											.	NBR1	55	.	0			c.A1702G						.						114.0	112.0	113.0					17																	41347008		1929	4118	6047	SO:0001583	missense	4077	exon14			TTGGATATAAACA	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1702A>G	chr17.hg19:g.41347008A>G	ENSP00000411250:p.Ile568Val	299.0	0.0		325.0	22.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	hg19	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.412723	0.83340	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.57595	0.96;0.39;0.96;0.96	5.75	5.75	0.90469	.	.	.	.	.	T	0.70150	0.3191	L	0.61387	1.9	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.80764	0.994;0.976;0.994	T	0.71922	-0.4446	9	0.56958	D	0.05	-9.5175	16.0539	0.80782	1.0:0.0:0.0:0.0	.	547;568;568	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	V	568;547;568;568;568	ENSP00000411250:I568V;ENSP00000437545:I547V;ENSP00000343479:I568V;ENSP00000373963:I568V	ENSP00000343479:I568V	I	+	1	0	NBR1	38600534	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.940000	0.75917	2.193000	0.70182	0.533000	0.62120	ATA	.	.		0.438	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
FMNL1	752	hgsc.bcm.edu	37	17	43310645	43310645	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:43310645C>A	ENST00000331495.3	+	4	718	c.382C>A	c.(382-384)Ctg>Atg	p.L128M	FMNL1_ENST00000592006.1_3'UTR|FMNL1_ENST00000328118.3_Missense_Mutation_p.L128M	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	128	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						GGAGACCTCCCTGAGGACCAA	0.617																																					p.L128M	GBM(164;1247 1997 8702 11086 51972)	Atlas-SNP	.											.	FMNL1	78	.	0			c.C382A						.						65.0	57.0	60.0					17																	43310645		2194	4285	6479	SO:0001583	missense	752	exon4			ACCTCCCTGAGGA	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.382C>A	chr17.hg19:g.43310645C>A	ENSP00000329219:p.Leu128Met	83.0	0.0		72.0	24.0	NM_005892	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	ENST00000331495.3	hg19	CCDS11497.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549235	0.45383	.	.	ENSG00000184922	ENST00000328118;ENST00000331495	D;D	0.96365	-3.99;-3.99	4.2	3.23	0.37069	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.270223	0.31020	N	0.008402	D	0.98077	0.9366	M	0.92169	3.28	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.97757	1.0218	10	0.87932	D	0	.	7.8429	0.29408	0.0:0.8066:0.0:0.1934	.	128;128	O95466-2;O95466	.;FMNL_HUMAN	M	128	ENSP00000327442:L128M;ENSP00000329219:L128M	ENSP00000327442:L128M	L	+	1	2	FMNL1	40666428	0.180000	0.23148	1.000000	0.80357	0.935000	0.57460	0.585000	0.23879	1.121000	0.41925	0.561000	0.74099	CTG	.	.		0.617	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892	
TEX2	55852	hgsc.bcm.edu	37	17	62291064	62291064	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:62291064T>A	ENST00000583097.1	-	2	686	c.514A>T	c.(514-516)Atc>Ttc	p.I172F	TEX2_ENST00000584379.1_Missense_Mutation_p.I172F|TEX2_ENST00000258991.3_Missense_Mutation_p.I172F			Q8IWB9	TEX2_HUMAN	testis expressed 2	172					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GATGAGAGGATGGGAGACTTA	0.542																																					p.I172F		Atlas-SNP	.											.	TEX2	89	.	0			c.A514T						.						58.0	51.0	53.0					17																	62291064		2203	4300	6503	SO:0001583	missense	55852	exon2			AGAGGATGGGAGA	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.514A>T	chr17.hg19:g.62291064T>A	ENSP00000462665:p.Ile172Phe	76.0	0.0		94.0	9.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	T	1.514	-0.548822	0.04024	.	.	ENSG00000136478	ENST00000258991	T	0.51325	0.71	5.82	-1.21	0.09524	.	0.563539	0.19645	N	0.109343	T	0.23611	0.0571	N	0.08118	0	0.19775	N	0.999957	B;B	0.26258	0.145;0.09	B;B	0.25759	0.063;0.029	T	0.14364	-1.0475	10	0.33940	T	0.23	-2.9811	10.2567	0.43401	0.0:0.5806:0.0:0.4194	.	172;172	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	F	172	ENSP00000258991:I172F	ENSP00000258991:I172F	I	-	1	0	TEX2	59644796	0.076000	0.21285	0.003000	0.11579	0.156000	0.22039	0.065000	0.14466	-0.429000	0.07329	-0.899000	0.02877	ATC	.	.		0.542	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
C17orf99	100141515	hgsc.bcm.edu	37	17	76157076	76157076	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:76157076A>G	ENST00000340363.5	+	3	166	c.111A>G	c.(109-111)gaA>gaG	p.E37E	C17orf99_ENST00000451352.3_3'UTR	NM_001163075.1	NP_001156547.1	Q6UX52	CQ099_HUMAN	chromosome 17 open reading frame 99	37						extracellular region (GO:0005576)											AAGTCCTGGAAGTTTTCCCCA	0.517																																					p.E37E		Atlas-SNP	.											.	.	.	.	0			c.A111G						.						35.0	33.0	33.0					17																	76157076		692	1591	2283	SO:0001819	synonymous_variant	100141515	exon3			CCTGGAAGTTTTC	AY358510	CCDS54171.1	17q25.3	2012-10-23			ENSG00000187997	ENSG00000187997			34490	protein-coding gene	gene with protein product							Standard	NM_001163075		Approved	GLPG464, UNQ464	uc002jus.4	Q6UX52	OTTHUMG00000153871	ENST00000340363.5:c.111A>G	chr17.hg19:g.76157076A>G		150.0	0.0		162.0	27.0	NM_001163075		Silent	SNP	ENST00000340363.5	hg19	CCDS54171.1																																																																																			.	.		0.517	C17orf99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332775.1	NM_001163075	
BAIAP2	10458	hgsc.bcm.edu	37	17	79077867	79077867	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr17:79077867C>T	ENST00000321300.6	+	9	1118	c.1025C>T	c.(1024-1026)cCc>cTc	p.P342L	BAIAP2_ENST00000575245.1_Missense_Mutation_p.P375L|BAIAP2_ENST00000575712.1_Missense_Mutation_p.P342L|BAIAP2_ENST00000416299.2_Missense_Mutation_p.P205L|BAIAP2_ENST00000435091.3_Missense_Mutation_p.P342L|BAIAP2_ENST00000392411.3_Missense_Mutation_p.P264L|BAIAP2_ENST00000321280.7_Missense_Mutation_p.P342L|BAIAP2_ENST00000428708.2_Missense_Mutation_p.P342L	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	342					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AACACACTCCCCGTGCGCAAG	0.627																																					p.P342L		Atlas-SNP	.											.	BAIAP2	74	.	0			c.C1025T						.						88.0	93.0	91.0					17																	79077867		2203	4300	6503	SO:0001583	missense	10458	exon9			CACTCCCCGTGCG	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1025C>T	chr17.hg19:g.79077867C>T	ENSP00000316338:p.Pro342Leu	204.0	0.0		222.0	66.0	NM_001144888	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	ENST00000321300.6	hg19	CCDS11775.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009412	0.75046	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411;ENST00000416299	T;T;T;T;T;T	0.35973	1.75;1.78;1.31;1.31;1.76;1.28	4.55	4.55	0.56014	.	0.053328	0.85682	D	0.000000	T	0.58177	0.2104	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0;1.0;0.996;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.928;0.999;0.999;0.999;0.929;0.999	T	0.55891	-0.8069	10	0.32370	T	0.25	-16.0987	17.4893	0.87699	0.0:1.0:0.0:0.0	.	205;264;343;342;342;342;342;342;342	B4DWA1;F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;.;BAIP2_HUMAN;.;.;.;.;.	L	342;342;342;342;264;205	ENSP00000316338:P342L;ENSP00000401022:P342L;ENSP00000413069:P342L;ENSP00000315685:P342L;ENSP00000376211:P264L;ENSP00000391837:P205L	ENSP00000315685:P342L	P	+	2	0	BAIAP2	76692462	1.000000	0.71417	0.989000	0.46669	0.470000	0.32858	6.938000	0.75904	2.361000	0.80049	0.462000	0.41574	CCC	.	.		0.627	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1		
DSG1	1828	hgsc.bcm.edu	37	18	28934321	28934321	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr18:28934321A>G	ENST00000257192.4	+	15	2374	c.2162A>G	c.(2161-2163)tAt>tGt	p.Y721C	RP11-534N16.1_ENST00000578119.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|DSG1_ENST00000462981.2_Missense_Mutation_p.Y80C	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	721					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TTGCTCATATATGACATCGAA	0.428																																					p.Y721C		Atlas-SNP	.											.	DSG1	176	.	0			c.A2162G						.						130.0	127.0	128.0					18																	28934321		2203	4300	6503	SO:0001583	missense	1828	exon15			TCATATATGACAT	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.2162A>G	chr18.hg19:g.28934321A>G	ENSP00000257192:p.Tyr721Cys	89.0	0.0		62.0	23.0	NM_001942	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	hg19	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	A	15.05	2.718160	0.48622	.	.	ENSG00000134760	ENST00000257192	D	0.87809	-2.3	6.04	6.04	0.98038	Cadherin, cytoplasmic domain (1);	0.000000	0.64402	D	0.000011	D	0.94368	0.8189	M	0.87456	2.885	0.53688	D	0.999973	D	0.89917	1.0	D	0.97110	1.0	D	0.95067	0.8201	10	0.87932	D	0	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	721	Q02413	DSG1_HUMAN	C	721	ENSP00000257192:Y721C	ENSP00000257192:Y721C	Y	+	2	0	DSG1	27188319	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	7.223000	0.78033	2.317000	0.78254	0.460000	0.39030	TAT	.	.		0.428	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942	
PIGN	23556	hgsc.bcm.edu	37	18	59777111	59777111	+	Silent	SNP	T	T	C	rs373958969		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr18:59777111T>C	ENST00000357637.5	-	17	1945	c.1530A>G	c.(1528-1530)gtA>gtG	p.V510V	PIGN_ENST00000400334.3_Silent_p.V510V	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	510					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ACAAACCATATACATAATATG	0.388																																					p.V510V		Atlas-SNP	.											.	PIGN	62	.	0			c.A1530G						.	T	,	1,3797		0,1,1898	152.0	147.0	149.0		1530,1530	-4.8	0.2	18		149	0,8238		0,0,4119	no	coding-synonymous,coding-synonymous	PIGN	NM_012327.5,NM_176787.4	,	0,1,6017	CC,CT,TT		0.0,0.0263,0.0083	,	510/932,510/932	59777111	1,12035	1899	4119	6018	SO:0001819	synonymous_variant	23556	exon17			ACCATATACATAA	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1530A>G	chr18.hg19:g.59777111T>C		240.0	1.0		180.0	138.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Silent	SNP	ENST00000357637.5	hg19	CCDS45879.1																																																																																			.	.		0.388	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
NETO1	81832	hgsc.bcm.edu	37	18	70526062	70526062	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr18:70526062A>T	ENST00000327305.6	-	4	1125	c.468T>A	c.(466-468)ccT>ccA	p.P156P	NETO1_ENST00000299430.2_Splice_Site_p.P155P|NETO1_ENST00000583169.1_Splice_Site_p.P156P|NETO1_ENST00000397929.1_Splice_Site_p.P155P|NETO1_ENST00000580049.1_5'UTR	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	156					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CTTACTTACCAGGTGTGAAAT	0.318																																					p.P156P		Atlas-SNP	.											.	NETO1	178	.	0			c.T468A						.						44.0	47.0	46.0					18																	70526062		2197	4296	6493	SO:0001630	splice_region_variant	81832	exon4			CTTACCAGGTGTG	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.469+1T>A	chr18.hg19:g.70526062A>T		151.0	0.0		112.0	47.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Silent	SNP	ENST00000327305.6	hg19	CCDS12000.1																																																																																			.	.		0.318	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	Silent
MUC16	94025	hgsc.bcm.edu	37	19	9038082	9038082	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:9038082G>T	ENST00000397910.4	-	8	36397	c.36194C>A	c.(36193-36195)tCc>tAc	p.S12065Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12067	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCTACCTGTGGAGCTGGGGAT	0.498																																					p.S12065Y		Atlas-SNP	.											.	MUC16	4315	.	0			c.C36194A						.						51.0	53.0	52.0					19																	9038082		1948	4126	6074	SO:0001583	missense	94025	exon8			CCTGTGGAGCTGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36194C>A	chr19.hg19:g.9038082G>T	ENSP00000381008:p.Ser12065Tyr	181.0	0.0		133.0	118.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	9.253	1.041272	0.19669	.	.	ENSG00000181143	ENST00000397910	T	0.02236	4.38	2.44	0.27	0.15635	.	.	.	.	.	T	0.06826	0.0174	M	0.70275	2.135	.	.	.	D	0.58268	0.982	P	0.59825	0.864	T	0.18209	-1.0344	8	0.87932	D	0	.	4.3176	0.11000	0.3487:0.0:0.6513:0.0	.	12065	B5ME49	.	Y	12065	ENSP00000381008:S12065Y	ENSP00000381008:S12065Y	S	-	2	0	MUC16	8899082	0.018000	0.18449	0.023000	0.16930	0.046000	0.14306	0.396000	0.20867	0.138000	0.18790	0.411000	0.27672	TCC	.	.		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF763	284390	hgsc.bcm.edu	37	19	12089204	12089204	+	Nonsense_Mutation	SNP	T	T	G	rs372060440		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:12089204T>G	ENST00000358987.3	+	4	592	c.465T>G	c.(463-465)taT>taG	p.Y155*	ZNF763_ENST00000538752.1_Nonsense_Mutation_p.Y175*|ZNF763_ENST00000343949.5_Nonsense_Mutation_p.Y158*|ZNF763_ENST00000592625.1_3'UTR|ZNF763_ENST00000590798.1_Nonsense_Mutation_p.Y175*|ZNF763_ENST00000545530.1_Nonsense_Mutation_p.Y33*			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						CCTTCAGATATCACCCCTCCT	0.418																																					p.Y158X		Atlas-SNP	.											.	ZNF763	31	.	0			c.T474G						.						131.0	134.0	133.0					19																	12089204		2196	4300	6496	SO:0001587	stop_gained	284390	exon4			CAGATATCACCCC	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.465T>G	chr19.hg19:g.12089204T>G	ENSP00000402017:p.Tyr155*	157.0	0.0		132.0	8.0	NM_001012753	B3KRU3|B4DRE7	Nonsense_Mutation	SNP	ENST00000358987.3	hg19		.	.	.	.	.	.	.	.	.	.	t	13.50	2.256868	0.39896	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	.	.	.	1.68	0.601	0.17529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0482	0.06160	0.0:0.2707:0.0:0.7293	.	.	.	.	X	175;158;33;155	.	ENSP00000369774:Y158X	Y	+	3	2	ZNF763	11950204	0.000000	0.05858	0.002000	0.10522	0.060000	0.15804	0.026000	0.13599	0.753000	0.32945	0.164000	0.16699	TAT	.	.		0.418	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753	
BRD4	23476	hgsc.bcm.edu	37	19	15350628	15350628	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:15350628A>G	ENST00000263377.2	-	16	3508	c.3287T>C	c.(3286-3288)cTg>cCg	p.L1096P		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1096	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGCAGCACGCAGCTCCTGGGA	0.672			T	C15orf55	lethal midline carcinoma of young people																																p.L1096P		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.T3287C						.						48.0	49.0	49.0					19																	15350628		2203	4300	6503	SO:0001583	missense	23476	exon16			GCACGCAGCTCCT	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3287T>C	chr19.hg19:g.15350628A>G	ENSP00000263377:p.Leu1096Pro	58.0	0.0		43.0	35.0	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	hg19	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.611850	0.28712	.	.	ENSG00000141867	ENST00000263377	T	0.33438	1.41	4.62	4.62	0.57501	.	0.000000	0.39834	N	0.001257	T	0.34658	0.0905	N	0.22421	0.69	0.80722	D	1	D	0.64830	0.994	P	0.56343	0.796	T	0.21793	-1.0235	10	0.87932	D	0	-5.7885	13.0172	0.58764	1.0:0.0:0.0:0.0	.	1096	O60885	BRD4_HUMAN	P	1096	ENSP00000263377:L1096P	ENSP00000263377:L1096P	L	-	2	0	BRD4	15211628	1.000000	0.71417	0.917000	0.36280	0.858000	0.48976	3.909000	0.56363	1.701000	0.51217	0.459000	0.35465	CTG	.	.		0.672	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
UNC13A	23025	hgsc.bcm.edu	37	19	17759295	17759295	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:17759295G>A	ENST00000519716.2	-	16	1760	c.1761C>T	c.(1759-1761)tgC>tgT	p.C587C	UNC13A_ENST00000551649.1_Silent_p.C587C|UNC13A_ENST00000252773.7_Silent_p.C587C|UNC13A_ENST00000428389.2_Silent_p.C675C|UNC13A_ENST00000550896.1_Silent_p.C585C|UNC13A_ENST00000552293.1_Silent_p.C587C	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	587					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						ACTTGACACCGCACTCGGTGC	0.677																																					p.C587C		Atlas-SNP	.											UNC13A_ENST00000519716,NS,carcinoma,0,2	UNC13A	299	.	0			c.C1761T						.						68.0	72.0	71.0					19																	17759295		2201	4300	6501	SO:0001819	synonymous_variant	23025	exon15			GACACCGCACTCG	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1761C>T	chr19.hg19:g.17759295G>A		37.0	0.0		38.0	34.0	NM_001080421	E5RHY9	Silent	SNP	ENST00000519716.2	hg19	CCDS46013.2																																																																																			.	.		0.677	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
GPATCH1	55094	hgsc.bcm.edu	37	19	33579137	33579137	+	Silent	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:33579137C>T	ENST00000170564.2	+	2	485	c.171C>T	c.(169-171)ttC>ttT	p.F57F		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	57					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					GTGGAGGTTTCTCTGCTGGAT	0.383																																					p.F57F	Pancreas(67;88 1713 4567 18227)	Atlas-SNP	.											GPATCH1,bladder,carcinoma,0,1	GPATCH1	79	.	0			c.C171T						.						102.0	106.0	105.0					19																	33579137		2203	4300	6503	SO:0001819	synonymous_variant	55094	exon2			AGGTTTCTCTGCT	AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.171C>T	chr19.hg19:g.33579137C>T		77.0	0.0		87.0	9.0	NM_018025	Q8IZV6|Q8N3B7|Q9NW94	Silent	SNP	ENST00000170564.2	hg19	CCDS12428.1																																																																																			.	.		0.383	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450834.1	NM_018025	
ZNF30	90075	hgsc.bcm.edu	37	19	35435284	35435284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:35435284A>G	ENST00000601142.1	+	5	1651	c.1414A>G	c.(1414-1416)Aca>Gca	p.T472A	ZNF30_ENST00000426813.2_Missense_Mutation_p.T391A|ZNF30_ENST00000303586.7_Missense_Mutation_p.T473A|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000439785.1_Missense_Mutation_p.T473A			P17039	ZNF30_HUMAN	zinc finger protein 30	472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		CGTACATCTCACACAGCATCG	0.438																																					p.T473A		Atlas-SNP	.											.	ZNF30	44	.	0			c.A1417G						.						72.0	75.0	74.0					19																	35435284		2202	4300	6502	SO:0001583	missense	90075	exon5			CATCTCACACAGC	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1414A>G	chr19.hg19:g.35435284A>G	ENSP00000469954:p.Thr472Ala	106.0	0.0		126.0	46.0	NM_001099438	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	hg19	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	a	0.013	-1.626963	0.00813	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813;ENST00000342559	T;T	0.07216	3.21;3.21	2.25	-4.49	0.03504	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03477	0.0100	N	0.17723	0.515	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.45190	-0.9278	9	0.08599	T	0.76	.	2.9778	0.05943	0.3482:0.0:0.3275:0.3243	.	473;472	P17039-2;P17039	.;ZNF30_HUMAN	A	473;472;391;181	ENSP00000403441:T473A;ENSP00000416457:T391A	ENSP00000303889:T472A	T	+	1	0	ZNF30	40127124	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.841000	0.27613	-2.025000	0.00935	-1.488000	0.00978	ACA	.	.		0.438	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
ZNF30	90075	hgsc.bcm.edu	37	19	35435313	35435313	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:35435313A>G	ENST00000601142.1	+	5	1680	c.1443A>G	c.(1441-1443)gtA>gtG	p.V481V	ZNF30_ENST00000426813.2_Silent_p.V400V|ZNF30_ENST00000303586.7_Silent_p.V482V|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000439785.1_Silent_p.V482V			P17039	ZNF30_HUMAN	zinc finger protein 30	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		ATACTGATGTAAAGCCCTATG	0.438																																					p.V482V		Atlas-SNP	.											.	ZNF30	44	.	0			c.A1446G						.						77.0	82.0	81.0					19																	35435313		2202	4300	6502	SO:0001819	synonymous_variant	90075	exon5			TGATGTAAAGCCC	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1443A>G	chr19.hg19:g.35435313A>G		101.0	0.0		130.0	45.0	NM_001099438	A5PLP1|A8K320|B4DIC0|Q6N068	Silent	SNP	ENST00000601142.1	hg19	CCDS46045.1																																																																																			.	.		0.438	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
ZNF607	84775	hgsc.bcm.edu	37	19	38202519	38202519	+	Start_Codon_SNP	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:38202519T>C	ENST00000355202.4	-	2	596	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CTD-2528L19.4_ENST00000586606.2_Start_Codon_SNP_p.M1V|ZNF607_ENST00000395835.3_Start_Codon_SNP_p.M1V	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			ACATAGGACATGGTTTGAGAC	0.418																																					p.M1V		Atlas-SNP	.											.	ZNF607	82	.	0			c.A1G						.						157.0	130.0	139.0					19																	38202519		2203	4300	6503	SO:0001582	initiator_codon_variant	84775	exon2			AGGACATGGTTTG	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.1A>G	chr19.hg19:g.38202519T>C	ENSP00000347338:p.Met1Val	86.0	0.0		130.0	66.0	NM_001172677	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	ENST00000355202.4	hg19	CCDS33006.1	.	.	.	.	.	.	.	.	.	.	T	6.920	0.539447	0.13250	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.04502	3.61;3.61	1.88	1.88	0.25563	Krueppel-associated box (1);	.	.	.	.	T	0.05593	0.0147	.	.	.	0.80722	D	1	P;B	0.34587	0.458;0.036	B;B	0.39152	0.292;0.007	T	0.37663	-0.9696	8	0.56958	D	0.05	.	5.8144	0.18484	0.0:0.0:0.0:1.0	.	1;1	Q96SK3;F5H141	ZN607_HUMAN;.	V	1	ENSP00000347338:M1V;ENSP00000438015:M1V	ENSP00000347338:M1V	M	-	1	0	ZNF607	42894359	0.988000	0.35896	0.755000	0.31263	0.029000	0.11900	2.000000	0.40816	1.125000	0.41998	0.460000	0.39030	ATG	.	.		0.418	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689	Missense_Mutation
PSG7	5676	hgsc.bcm.edu	37	19	43430643	43430643	+	RNA	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:43430643A>G	ENST00000406070.2	-	0	1031				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TCGGTCCCGTATTTCACATTG	0.517																																					p.I190T		Atlas-SNP	.											.	.	.	.	0			c.T569C						.						131.0	120.0	124.0					19																	43430643		2201	4296	6497			5676	exon3			TCCCGTATTTCAC			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		chr19.hg19:g.43430643A>G		73.0	0.0		109.0	52.0	NM_001206650	Q15232	Missense_Mutation	SNP	ENST00000406070.2	hg19																																																																																				.	.		0.517	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650	
ZNF155	7711	hgsc.bcm.edu	37	19	44500765	44500765	+	Silent	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:44500765A>G	ENST00000270014.2	+	5	884	c.756A>G	c.(754-756)aaA>aaG	p.K252K	RP11-15A1.7_ENST00000589021.1_RNA|ZNF155_ENST00000407951.2_Silent_p.K263K|RP11-15A1.7_ENST00000586860.1_RNA|ZNF155_ENST00000590615.1_Silent_p.K252K	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	252					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				TTCATCGTAAATTACACACAG	0.428																																					p.K263K	NSCLC(61;554 1277 20909 42067 42312)	Atlas-SNP	.											.	ZNF155	30	.	0			c.A789G						.						127.0	126.0	127.0					19																	44500765		2203	4300	6503	SO:0001819	synonymous_variant	7711	exon6			TCGTAAATTACAC	U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.756A>G	chr19.hg19:g.44500765A>G		121.0	0.0		183.0	37.0	NM_001260488	A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Silent	SNP	ENST00000270014.2	hg19	CCDS12634.1	.	.	.	.	.	.	.	.	.	.	A	2.320	-0.355877	0.05138	.	.	ENSG00000204920	ENST00000425747	.	.	.	2.59	-1.27	0.09347	.	.	.	.	.	T	0.17959	0.0431	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23013	-1.0200	5	0.23302	T	0.38	.	0.7484	0.00986	0.4572:0.1667:0.2122:0.1638	.	.	.	.	S	126	.	ENSP00000401576:N126S	N	+	2	0	ZNF155	49192605	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.402000	0.02499	-0.579000	0.05952	0.379000	0.24179	AAT	.	.		0.428	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	NM_003445	
SNRNP70	6625	hgsc.bcm.edu	37	19	49604657	49604657	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:49604657T>G	ENST00000598441.1	+	7	628	c.404T>G	c.(403-405)gTc>gGc	p.V135G	SNRNP70_ENST00000221448.5_Missense_Mutation_p.V135G			P08621	RU17_HUMAN	small nuclear ribonucleoprotein 70kDa (U1)	135	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	12						ATACACATGGTCTACAGTAAG	0.637																																					p.V135G		Atlas-SNP	.											.	SNRNP70	30	.	0			c.T404G						.						124.0	81.0	95.0					19																	49604657		2203	4300	6503	SO:0001583	missense	6625	exon7			ACATGGTCTACAG		CCDS12756.1, CCDS74417.1	19q13.3	2013-02-12	2008-10-29	2008-10-29		ENSG00000104852		"""RNA binding motif (RRM) containing"""	11150	protein-coding gene	gene with protein product		180740	"""small nuclear ribonucleoprotein 70kDa (RNP antigen)"""	RNPU1Z, RPU1, SNRP70			Standard	XM_005259177		Approved	U1-70K, Snp1	uc021uxh.1	P08621		ENST00000598441.1:c.404T>G	chr19.hg19:g.49604657T>G	ENSP00000472998:p.Val135Gly	70.0	0.0		114.0	7.0	NM_003089	B3KUA3|P78493|P78494|Q15364|Q15686|Q15687|Q15689|Q99377|Q9UE45|Q9UE46|Q9UE47|Q9UE48|Q9UFQ6	Missense_Mutation	SNP	ENST00000598441.1	hg19	CCDS12756.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.977889	0.74360	.	.	ENSG00000104852	ENST00000221448;ENST00000401730	T;T	0.19806	2.12;2.12	4.95	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.46112	0.1376	M	0.77616	2.38	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.67725	0.953;0.917	T	0.50996	-0.8761	10	0.87932	D	0	-19.3167	13.9272	0.63970	0.0:0.0:0.0:1.0	.	135;135	P08621;P08621-2	RU17_HUMAN;.	G	135	ENSP00000221448:V135G;ENSP00000385077:V135G	ENSP00000221448:V135G	V	+	2	0	SNRNP70	54296469	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.535000	0.82014	2.000000	0.58554	0.533000	0.62120	GTC	.	.		0.637	SNRNP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466266.1	NM_003089	
PTPRH	5794	hgsc.bcm.edu	37	19	55715250	55715250	+	Silent	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr19:55715250G>A	ENST00000376350.3	-	5	808	c.786C>T	c.(784-786)gtC>gtT	p.V262V	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	262	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CATCCACGGTGACTCTGGTGT	0.537																																					p.V262V		Atlas-SNP	.											.	PTPRH	139	.	0			c.C786T						.						227.0	195.0	206.0					19																	55715250		2203	4300	6503	SO:0001819	synonymous_variant	5794	exon5			CACGGTGACTCTG		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.786C>T	chr19.hg19:g.55715250G>A		120.0	0.0		164.0	31.0	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Silent	SNP	ENST00000376350.3	hg19	CCDS33110.1																																																																																			.	.		0.537	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
PLCB1	23236	hgsc.bcm.edu	37	20	8705358	8705358	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr20:8705358A>G	ENST00000338037.6	+	16	1664	c.1637A>G	c.(1636-1638)tAt>tGt	p.Y546C	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.Y546C|PLCB1_ENST00000378637.2_Missense_Mutation_p.Y546C	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	546	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CTGGTGAACTATATTCAGCCA	0.363																																					p.V546G		Atlas-SNP	.											.	PLCB1	394	.	0			c.T1637G						.						70.0	75.0	73.0					20																	8705358		2203	4300	6503	SO:0001583	missense	23236	exon16			TGAACTATATTCA	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1637A>G	chr20.hg19:g.8705358A>G	ENSP00000338185:p.Tyr546Cys	82.0	0.0		118.0	46.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	hg19	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.174884	0.78564	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.77098	-1.07;-1.07;-1.07	5.22	5.22	0.72569	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.063541	0.64402	D	0.000004	D	0.92760	0.7698	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95491	0.8569	10	0.87932	D	0	.	15.4026	0.74852	1.0:0.0:0.0:0.0	.	546;546	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	C	546;546;546;466;466	ENSP00000367908:Y546C;ENSP00000338185:Y546C;ENSP00000367904:Y546C	ENSP00000338185:Y546C	Y	+	2	0	PLCB1	8653358	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.339000	0.96797	2.095000	0.63458	0.460000	0.39030	TAT	.	.		0.363	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
CYP24A1	1591	hgsc.bcm.edu	37	20	52773780	52773780	+	Missense_Mutation	SNP	T	T	G	rs77167734		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr20:52773780T>G	ENST00000216862.3	-	11	1876	c.1483A>C	c.(1483-1485)Atg>Ctg	p.M495L	CYP24A1_ENST00000395954.3_Missense_Mutation_p.M353L|CYP24A1_ENST00000460643.1_5'UTR|CYP24A1_ENST00000395955.3_Missense_Mutation_p.M429L	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	495					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GAGTGTAGCATCTCAACAGGC	0.522																																					p.M495L		Atlas-SNP	.											.	CYP24A1	75	.	0			c.A1483C						.						80.0	67.0	72.0					20																	52773780		2203	4300	6503	SO:0001583	missense	1591	exon11			GTAGCATCTCAAC	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.1483A>C	chr20.hg19:g.52773780T>G	ENSP00000216862:p.Met495Leu	99.0	0.0		189.0	10.0	NM_000782	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	hg19	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	t	9.157	1.017805	0.19355	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.67523	-0.27;5.18;-0.27	5.53	5.53	0.82687	.	0.366494	0.35151	N	0.003407	T	0.51787	0.1695	N	0.17594	0.5	0.24752	N	0.99297	B;B;B	0.12630	0.006;0.002;0.0	B;B;B	0.12156	0.001;0.007;0.007	T	0.44345	-0.9334	10	0.37606	T	0.19	-18.0223	14.8619	0.70387	0.0:0.0:0.0:1.0	.	429;495;353	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	L	495;429;353	ENSP00000216862:M495L;ENSP00000379285:M429L;ENSP00000379284:M353L	ENSP00000216862:M495L	M	-	1	0	CYP24A1	52207187	0.828000	0.29307	1.000000	0.80357	0.041000	0.13682	1.949000	0.40313	2.094000	0.63399	0.524000	0.50904	ATG	.	.		0.522	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2		
HELZ2	85441	hgsc.bcm.edu	37	20	62196516	62196516	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr20:62196516T>C	ENST00000467148.1	-	8	3728	c.3659A>G	c.(3658-3660)aAt>aGt	p.N1220S	HELZ2_ENST00000427522.2_Missense_Mutation_p.N651S	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1220					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CACGGAGCCATTGATGGGGAC	0.652																																					p.N1220S		Atlas-SNP	.											.	.	.	.	0			c.A3659G						.						28.0	24.0	26.0					20																	62196516		2181	4293	6474	SO:0001583	missense	85441	exon9			GAGCCATTGATGG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3659A>G	chr20.hg19:g.62196516T>C	ENSP00000417401:p.Asn1220Ser	130.0	0.0		179.0	10.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.322541	0.41096	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.21734	1.99;1.99	4.77	4.77	0.60923	.	0.604046	0.16540	N	0.209980	T	0.20414	0.0491	L	0.46157	1.445	0.20074	N	0.999934	P;P	0.42692	0.488;0.787	B;B	0.36567	0.114;0.228	T	0.11446	-1.0587	10	0.62326	D	0.03	-15.513	14.2869	0.66251	0.0:0.0:0.0:1.0	.	1220;651	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	S	651;1220	ENSP00000393257:N651S;ENSP00000417401:N1220S	ENSP00000393257:N651S	N	-	2	0	RP4-697K14.7	61666960	0.999000	0.42202	0.244000	0.24202	0.937000	0.57800	4.365000	0.59486	1.782000	0.52362	0.397000	0.26171	AAT	.	.		0.652	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
TMPRSS6	164656	hgsc.bcm.edu	37	22	37485802	37485802	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr22:37485802C>T	ENST00000346753.3	-	7	795	c.679G>A	c.(679-681)Gtg>Atg	p.V227M	TMPRSS6_ENST00000406856.1_Missense_Mutation_p.V218M|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.V218M|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.V218M|TMPRSS6_ENST00000442782.2_Missense_Mutation_p.V227M	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	227	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						CCCTGGCCCACGTAGCTGTAG	0.667																																					p.V227M		Atlas-SNP	.											.	TMPRSS6	99	.	0			c.G679A						.						17.0	19.0	18.0					22																	37485802		2201	4297	6498	SO:0001583	missense	164656	exon7			GGCCCACGTAGCT	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.679G>A	chr22.hg19:g.37485802C>T	ENSP00000334962:p.Val227Met	219.0	0.0		256.0	70.0	NM_153609	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	hg19	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679863	0.47886	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782	D;D;D;D;T	0.91945	-2.94;-2.94;-2.94;-2.94;-0.95	4.28	2.11	0.27256	CUB (1);	0.165070	0.38720	N	0.001594	D	0.91171	0.7219	L	0.29908	0.895	0.41722	D	0.989516	D;D;D	0.76494	0.999;0.993;0.987	D;P;P	0.67382	0.951;0.759;0.579	D	0.88453	0.3050	10	0.33940	T	0.23	.	9.9163	0.41436	0.0:0.7605:0.0:0.2395	.	227;218;227	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	M	218;227;218;218;227	ENSP00000371211:V218M;ENSP00000334962:V227M;ENSP00000385453:V218M;ENSP00000384964:V218M;ENSP00000397691:V227M	ENSP00000334962:V227M	V	-	1	0	TMPRSS6	35815748	0.984000	0.35163	1.000000	0.80357	0.808000	0.45660	2.573000	0.46007	0.910000	0.36722	-0.463000	0.05309	GTG	.	.		0.667	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
C22orf46	79640	hgsc.bcm.edu	37	22	42086737	42086737	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr22:42086737C>T	ENST00000402966.1	+	1	191	c.106C>T	c.(106-108)Cct>Tct	p.P36S	C22orf46_ENST00000472110.2_Intron|NHP2L1_ENST00000463675.1_5'Flank|NHP2L1_ENST00000355257.3_5'Flank|NHP2L1_ENST00000402458.1_5'Flank|NHP2L1_ENST00000401959.1_5'Flank	NM_001142964.1	NP_001136436.1	C9J442	CV046_HUMAN	chromosome 22 open reading frame 46	36						extracellular region (GO:0005576)											CTGCAGGGACCCTCAGTGCTG	0.622																																					p.P36S		Atlas-SNP	.											.	C22orf46	4	.	0			c.C106T						.						96.0	83.0	87.0					22																	42086737		692	1591	2283	SO:0001583	missense	79640	exon1			AGGGACCCTCAGT	BC007210	CCDS46717.1	22q13.2	2011-01-25			ENSG00000184208	ENSG00000184208			26294	protein-coding gene	gene with protein product						12477932	Standard	NM_001142964		Approved	FLJ23584, CTA-216E10.6	uc003bax.1	C9J442	OTTHUMG00000151188	ENST00000402966.1:c.106C>T	chr22.hg19:g.42086737C>T	ENSP00000385467:p.Pro36Ser	87.0	0.0		79.0	33.0	NM_001142964		Missense_Mutation	SNP	ENST00000402966.1	hg19	CCDS46717.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.213748	0.39102	.	.	ENSG00000184208	ENST00000402966	D	0.82526	-1.62	4.47	4.47	0.54385	.	.	.	.	.	T	0.77512	0.4141	N	0.19112	0.55	0.23371	N	0.997811	P	0.50272	0.933	P	0.47470	0.548	T	0.70839	-0.4763	9	0.87932	D	0	.	12.8341	0.57763	0.0:1.0:0.0:0.0	.	36	C9J442	CV046_HUMAN	S	36	ENSP00000385467:P36S	ENSP00000385467:P36S	P	+	1	0	C22orf46	40416683	0.998000	0.40836	1.000000	0.80357	0.344000	0.29017	3.291000	0.51764	2.499000	0.84300	0.555000	0.69702	CCT	.	.		0.622	C22orf46-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000321678.2	NM_024588	
BEND2	139105	hgsc.bcm.edu	37	X	18189191	18189191	+	Silent	SNP	T	T	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:18189191T>C	ENST00000380033.4	-	13	2247	c.2115A>G	c.(2113-2115)caA>caG	p.Q705Q	BEND2_ENST00000380030.3_Silent_p.Q614Q	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	705	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						AGACGTTACTTTGGACCAGGA	0.438																																					p.Q705Q		Atlas-SNP	.											.	BEND2	108	.	0			c.A2115G						.						218.0	189.0	199.0					X																	18189191		2203	4300	6503	SO:0001819	synonymous_variant	139105	exon13			GTTACTTTGGACC	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2115A>G	chrX.hg19:g.18189191T>C		107.0	0.0		94.0	7.0	NM_153346	E9PFY2|Q4V9S2|Q5JXE5	Silent	SNP	ENST00000380033.4	hg19	CCDS14184.1																																																																																			.	.		0.438	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20187519	20187519	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:20187519C>T	ENST00000379565.3	-	16	1651		c.e16+1		RPS6KA3_ENST00000540702.1_Splice_Site|RPS6KA3_ENST00000479809.1_Splice_Site|RPS6KA3_ENST00000544447.1_Splice_Site|RPS6KA3_ENST00000379548.4_Splice_Site	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3						axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	AATCTACTTACATCCTTTAGA	0.318																																					.		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.1443+1G>A						.						154.0	149.0	151.0					X																	20187519		2203	4300	6503	SO:0001630	splice_region_variant	6197	exon17			TACTTACATCCTT	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1443+1G>A	chrX.hg19:g.20187519C>T		64.0	0.0		38.0	20.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Splice_Site	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.520373	0.85495	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4385	0.90654	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPS6KA3	20097440	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.715000	0.84713	2.382000	0.81193	0.600000	0.82982	.	.	.		0.318	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	Intron
FAM155B	27112	hgsc.bcm.edu	37	X	68748901	68748901	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:68748901G>T	ENST00000252338.4	+	2	969	c.927G>T	c.(925-927)tgG>tgT	p.W309C		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	309						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						GCCAGCGCTGGGTGCCCTGCA	0.582																																					p.W309C		Atlas-SNP	.											.	FAM155B	44	.	0			c.G927T						.						57.0	44.0	49.0					X																	68748901		2203	4300	6503	SO:0001583	missense	27112	exon2			GCGCTGGGTGCCC	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.927G>T	chrX.hg19:g.68748901G>T	ENSP00000252338:p.Trp309Cys	128.0	1.0		136.0	117.0	NM_015686	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	ENST00000252338.4	hg19	CCDS35317.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180620	0.57800	.	.	ENSG00000130054	ENST00000252338	T	0.11604	2.76	5.31	5.31	0.75309	.	0.189003	0.37348	N	0.002134	T	0.14270	0.0345	N	0.14661	0.345	0.58432	D	0.999999	D	0.69078	0.997	P	0.60236	0.871	T	0.04976	-1.0914	10	0.62326	D	0.03	-6.6114	11.2167	0.48830	0.0:0.1808:0.8192:0.0	.	309	O75949-2	.	C	309	ENSP00000252338:W309C	ENSP00000252338:W309C	W	+	3	0	FAM155B	68665626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.310000	0.59141	2.207000	0.71202	0.523000	0.50628	TGG	.	.		0.582	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
ACRC	93953	hgsc.bcm.edu	37	X	70811974	70811974	+	Missense_Mutation	SNP	A	A	G	rs36115715		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:70811974A>G	ENST00000373695.1	+	2	599	c.62A>G	c.(61-63)tAc>tGc	p.Y21C	ACRC_ENST00000373696.3_Missense_Mutation_p.Y21C			Q96QF7	ACRC_HUMAN	acidic repeat containing	21						nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TTTTGCAGTTACATCCTTAAT	0.373																																					p.Y21C		Atlas-SNP	.											.	ACRC	110	.	0			c.A62G						.						206.0	168.0	181.0					X																	70811974		2203	4299	6502	SO:0001583	missense	93953	exon3			GCAGTTACATCCT	AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.62A>G	chrX.hg19:g.70811974A>G	ENSP00000362799:p.Tyr21Cys	237.0	0.0		285.0	25.0	NM_052957	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	hg19	CCDS35326.1	.	.	.	.	.	.	.	.	.	.	A	3.429	-0.116547	0.06838	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.38722	1.12;1.12	2.49	-4.98	0.03019	.	.	.	.	.	T	0.20088	0.0483	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13629	-1.0502	9	0.87932	D	0	.	2.998	0.06004	0.2061:0.1561:0.4825:0.1554	rs36115715	21	Q96QF7	ACRC_HUMAN	C	21	ENSP00000362800:Y21C;ENSP00000362799:Y21C	ENSP00000362799:Y21C	Y	+	2	0	ACRC	70728699	0.001000	0.12720	0.000000	0.03702	0.035000	0.12851	-0.876000	0.04201	-2.515000	0.00501	-2.143000	0.00337	TAC	.	.		0.373	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1		
KIAA2022	340533	hgsc.bcm.edu	37	X	73963968	73963968	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:73963968G>A	ENST00000055682.6	-	3	1035	c.424C>T	c.(424-426)Cca>Tca	p.P142S		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	142					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GTCCGACTTGGCTGCATGAGA	0.483																																					p.P142S		Atlas-SNP	.											.	KIAA2022	262	.	0			c.C424T						.						87.0	77.0	80.0					X																	73963968		2203	4300	6503	SO:0001583	missense	340533	exon3			GACTTGGCTGCAT		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.424C>T	chrX.hg19:g.73963968G>A	ENSP00000055682:p.Pro142Ser	69.0	0.0		122.0	6.0	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	hg19	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689597	0.68271	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.36157	1.27;1.27	6.08	6.08	0.98989	.	0.431758	0.26692	N	0.022986	T	0.52419	0.1733	L	0.36672	1.1	0.54753	D	0.999989	D	0.76494	0.999	D	0.67382	0.951	T	0.51100	-0.8748	10	0.66056	D	0.02	-9.8297	19.5098	0.95137	0.0:0.0:1.0:0.0	.	142	Q5QGS0	K2022_HUMAN	S	142	ENSP00000362567:P142S;ENSP00000055682:P142S	ENSP00000055682:P142S	P	-	1	0	KIAA2022	73880693	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.562000	0.86427	0.600000	0.82982	CCA	.	.		0.483	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
PCDH11X	27328	hgsc.bcm.edu	37	X	91132817	91132817	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:91132817G>T	ENST00000373094.1	+	2	2423	c.1578G>T	c.(1576-1578)aaG>aaT	p.K526N	PCDH11X_ENST00000504220.2_Missense_Mutation_p.K526N|PCDH11X_ENST00000298274.8_Missense_Mutation_p.K526N|PCDH11X_ENST00000373088.1_Missense_Mutation_p.K526N|PCDH11X_ENST00000361655.2_Missense_Mutation_p.K526N|PCDH11X_ENST00000395337.2_Missense_Mutation_p.K526N|PCDH11X_ENST00000406881.1_Missense_Mutation_p.K526N|PCDH11X_ENST00000373097.1_Missense_Mutation_p.K526N|PCDH11X_ENST00000361724.1_Missense_Mutation_p.K526N	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTGTAGTGAAGAAACTAGATA	0.433																																					p.K526N	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.G1578T						.						61.0	57.0	58.0					X																	91132817		2203	4300	6503	SO:0001583	missense	27328	exon2			AGTGAAGAAACTA	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1578G>T	chrX.hg19:g.91132817G>T	ENSP00000362186:p.Lys526Asn	192.0	0.0		206.0	18.0	NM_001168363	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	hg19	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	3.054	-0.194801	0.06259	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42;0.42;0.42;0.42	5.38	2.1	0.27182	Cadherin (4);Cadherin-like (1);	0.216100	0.46145	N	0.000312	T	0.38904	0.1058	L	0.42529	1.33	0.36950	D	0.892834	B;B;B;B;B;B;B;B	0.17038	0.016;0.003;0.016;0.016;0.016;0.02;0.009;0.009	B;B;B;B;B;B;B;B	0.20384	0.012;0.007;0.017;0.017;0.017;0.029;0.012;0.012	T	0.24297	-1.0164	10	0.33940	T	0.23	.	5.445	0.16529	0.2542:0.0:0.5833:0.1625	.	526;526;526;526;526;526;526;526	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	N	526	ENSP00000378746:K526N;ENSP00000362186:K526N;ENSP00000362189:K526N;ENSP00000355040:K526N;ENSP00000362180:K526N;ENSP00000423762:K526N;ENSP00000355105:K526N;ENSP00000384758:K526N;ENSP00000298274:K526N	ENSP00000298274:K526N	K	+	3	2	PCDH11X	91019473	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	0.924000	0.28777	0.443000	0.26582	0.544000	0.68410	AAG	.	.		0.433	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
MCF2	4168	hgsc.bcm.edu	37	X	138729064	138729064	+	Splice_Site	DEL	T	T	-			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:138729064delT	ENST00000519895.1	-	3	191		c.e3-2		MCF2_ENST00000370578.4_Splice_Site|MCF2_ENST00000520602.1_Splice_Site|MCF2_ENST00000414978.1_Splice_Site	NM_001171876.1	NP_001165347.1	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					CCCGGCCACCTACAACAATAG	0.333																																					.		Atlas-INDEL	.											.	MCF2	432	.	0			c.26-1A>-						.						49.0	41.0	43.0					X																	138729064		1822	4071	5893	SO:0001630	splice_region_variant	4168	exon4			.		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000519895.1:c.26-2A>-	chrX.hg19:g.138729064delT		285.0	0.0		377.0	34.0	NM_001171876	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Splice_Site	DEL	ENST00000519895.1	hg19	CCDS55517.1																																																																																			.	.		0.333	MCF2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377602.1	NM_005369	Intron
LDOC1	23641	hgsc.bcm.edu	37	X	140271004	140271004	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:140271004A>G	ENST00000370526.2	-	1	306	c.203T>C	c.(202-204)aTc>aCc	p.I68T	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	68					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					CGTCTGCACGATAAACTCGGG	0.622																																					p.I68T		Atlas-SNP	.											.	LDOC1	26	.	0			c.T203C						.						67.0	58.0	61.0					X																	140271004		2203	4300	6503	SO:0001583	missense	23641	exon1			TGCACGATAAACT	AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.203T>C	chrX.hg19:g.140271004A>G	ENSP00000359557:p.Ile68Thr	63.0	0.0		87.0	11.0	NM_012317	Q6IAR6	Missense_Mutation	SNP	ENST00000370526.2	hg19	CCDS14672.1	.	.	.	.	.	.	.	.	.	.	.	14.85	2.657614	0.47467	.	.	ENSG00000182195	ENST00000370526	T	0.31247	1.5	3.67	3.67	0.42095	.	0.286062	0.24449	N	0.038425	T	0.40767	0.1130	L	0.55213	1.73	0.25260	N	0.989604	D	0.58268	0.982	P	0.57324	0.818	T	0.17167	-1.0378	10	0.87932	D	0	-5.0147	7.8896	0.29669	1.0:0.0:0.0:0.0	.	68	O95751	LDOC1_HUMAN	T	68	ENSP00000359557:I68T	ENSP00000359557:I68T	I	-	2	0	LDOC1	140098670	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	3.499000	0.53310	1.678000	0.50952	0.237000	0.17872	ATC	.	.		0.622	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058592.1	NM_012317	
L2HGDH	79944	hgsc.bcm.edu	37	14	50760900	50760900	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr14:50760900delT	ENST00000267436.4	-	4	870	c.473delA	c.(472-474)cagfs	p.Q158fs	L2HGDH_ENST00000555610.1_Frame_Shift_Del_p.Q158fs|L2HGDH_ENST00000421284.3_Frame_Shift_Del_p.Q158fs|L2HGDH_ENST00000261699.4_Frame_Shift_Del_p.Q158fs|L2HGDH_ENST00000555423.1_Frame_Shift_Del_p.Q158fs			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	158					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)			kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					GACACCATTCTGGAGGCCTTT	0.418																																					p.Q158fs		Atlas-INDEL	.											.	L2HGDH	33	.	0			c.474delG						.						96.0	92.0	93.0					14																	50760900		2203	4300	6503	SO:0001589	frameshift_variant	79944	exon4			.		CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.473delA	chr14.hg19:g.50760900delT	ENSP00000267436:p.Gln158fs	59.0	0.0		68.0	14.0	NM_024884	Q9BRR1	Frame_Shift_Del	DEL	ENST00000267436.4	hg19	CCDS9698.1																																																																																			.	.		0.418	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884	
PLCB3	5331	hgsc.bcm.edu	37	11	64032516	64032517	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr11:64032516_64032517insC	ENST00000540288.1	+	23	2849_2850	c.2746_2747insC	c.(2746-2748)tccfs	p.S916fs	PLCB3_ENST00000325234.5_Frame_Shift_Ins_p.S849fs|PLCB3_ENST00000279230.6_Frame_Shift_Ins_p.S916fs	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	916					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						ACTGGATGCCTCCCCCCGCCGG	0.703																																					p.S916fs		Atlas-INDEL	.											.	PLCB3	103	.	0			c.2746_2747insC						.																																			SO:0001589	frameshift_variant	5331	exon23			.	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2752dupC	chr11.hg19:g.64032522_64032522dupC	ENSP00000443631:p.Ser916fs	194.0	0.0		178.0	11.0	NM_000932	A5PKZ6|G5E960|Q8N1A4	Frame_Shift_Ins	INS	ENST00000540288.1	hg19	CCDS8064.1																																																																																			.	.		0.703	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
CMKLR1	1240	hgsc.bcm.edu	37	12	108686420	108686420	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr12:108686420delA	ENST00000312143.7	-	3	683	c.320delT	c.(319-321)ttcfs	p.F107fs	CMKLR1_ENST00000397688.2_Frame_Shift_Del_p.F105fs|CMKLR1_ENST00000412676.1_Frame_Shift_Del_p.F107fs|CMKLR1_ENST00000550402.1_Frame_Shift_Del_p.F107fs|CMKLR1_ENST00000552995.1_Frame_Shift_Del_p.F105fs	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	107					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.F105S(2)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						GGCTGTCCCGAAAACCCAGTG	0.517																																					p.F107fs		Atlas-INDEL	.											.	CMKLR1	67	.	2	Substitution - Missense(2)	lung(2)	c.321delC						.						134.0	140.0	138.0					12																	108686420		2130	4228	6358	SO:0001589	frameshift_variant	1240	exon3			.	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.320delT	chr12.hg19:g.108686420delA	ENSP00000311733:p.Phe107fs	215.0	0.0		256.0	50.0	NM_001142344	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Frame_Shift_Del	DEL	ENST00000312143.7	hg19	CCDS44965.1																																																																																			.	.		0.517	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1		
UGT2B4	7363	hgsc.bcm.edu	37	4	70361015	70361018	+	Frame_Shift_Del	DEL	ACAG	ACAG	-			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	ACAG	ACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr4:70361015_70361018delACAG	ENST00000305107.6	-	1	608_611	c.562_565delCTGT	c.(562-567)ctgttcfs	p.LF188fs	UGT2B4_ENST00000381096.3_Frame_Shift_Del_p.LF52fs|UGT2B4_ENST00000506580.1_Intron|UGT2B4_ENST00000512583.1_Frame_Shift_Del_p.LF188fs	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	188					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GAAGGAGGGAACAGAAGTCCTCCA	0.426																																					p.188_189del		Atlas-INDEL	.											.	UGT2B4	105	.	0			c.563_566del						.																																			SO:0001589	frameshift_variant	7363	exon1			.	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.562_565delCTGT	chr4.hg19:g.70361015_70361018delACAG	ENSP00000305221:p.Leu188fs	170.0	0.0		126.0	42.0	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Frame_Shift_Del	DEL	ENST00000305107.6	hg19	CCDS43234.1																																																																																			.	.		0.426	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
EFHC2	80258	hgsc.bcm.edu	37	X	44035625	44035625	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chrX:44035625delT	ENST00000420999.1	-	13	2038	c.1955delA	c.(1954-1956)aatfs	p.N652fs	EFHC2_ENST00000343571.3_5'UTR	NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	652							calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						GGGTAATACATTTTTTCTGCA	0.308																																					p.N652fs		Atlas-INDEL	.											.	EFHC2	81	.	0			c.1956delT						.						124.0	104.0	111.0					X																	44035625		1823	4079	5902	SO:0001589	frameshift_variant	80258	exon13			.	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.1955delA	chrX.hg19:g.44035625delT	ENSP00000404232:p.Asn652fs	59.0	0.0		99.0	34.0	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Frame_Shift_Del	DEL	ENST00000420999.1	hg19	CCDS55405.1																																																																																			.	.		0.308	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	
PIGV	55650	hgsc.bcm.edu	37	1	27124181	27124200	+	Frame_Shift_Del	DEL	CCCCACCAGGACAAAAGGTC	CCCCACCAGGACAAAAGGTC	-	rs370891890		TCGA-DD-AACP-01A-11D-A40R-10	TCGA-DD-AACP-10A-01D-A40U-10	CCCCACCAGGACAAAAGGTC	CCCCACCAGGACAAAAGGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1a97e7e-0519-436d-940f-2e59ec5f7a59	4d93e7d7-d828-4696-a682-754d76c9bb04	g.chr1:27124181_27124200delCCCCACCAGGACAAAAGGTC	ENST00000374145.1	+	4	2010_2029	c.1328_1347delCCCCACCAGGACAAAAGGTC	c.(1327-1347)tccccaccaggacaaaaggtcfs	p.SPPGQKV443fs	PIGV_ENST00000078527.4_Frame_Shift_Del_p.SPPGQKV443fs|PIGV_ENST00000449950.2_Frame_Shift_Del_p.SPPGQKV215fs	NM_001202554.1	NP_001189483.1	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class V	443					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		GCAGAGGACTCCCCACCAGGACAAAAGGTCCCCAGAAATC	0.486																																					p.443_449del		Atlas-INDEL	.											.	PIGV	47	.	0			c.1327_1346del						.																																			SO:0001589	frameshift_variant	55650	exon4			.	AK000484	CCDS287.1	1p36.11	2013-02-26	2006-06-28		ENSG00000060642	ENSG00000060642		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	26031	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 2"", ""dol-P-Man dependent GPI mannosyltransferase"""	610274	"""phosphatidylinositol glycan, class V"""			15623507	Standard	NM_017837		Approved	FLJ20477	uc001bmz.3	Q9NUD9	OTTHUMG00000004005	ENST00000374145.1:c.1328_1347delCCCCACCAGGACAAAAGGTC	chr1.hg19:g.27124181_27124200delCCCCACCAGGACAAAAGGTC	ENSP00000363260:p.Ser443fs	118.0	0.0		80.0	14.0	NM_001202554	D3DPL2|Q5JYG7|Q5JYG8|Q5JYG9|Q9NX26	Frame_Shift_Del	DEL	ENST00000374145.1	hg19	CCDS287.1																																																																																			.	.		0.486	PIGV-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011441.1	NM_017837	
