#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EMC1	23065	hgsc.bcm.edu	37	1	19571434	19571434	+	Silent	SNP	C	C	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:19571434C>A	ENST00000477853.1	-	2	228	c.186G>T	c.(184-186)gtG>gtT	p.V62V	EMC1_ENST00000356068.2_Silent_p.V62V|EMC1_ENST00000375199.3_Silent_p.V62V|EMC1_ENST00000375208.3_Silent_p.V62V	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	62						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											ATGCTGCAATCACATTCTTCT	0.458																																					p.V62V		Atlas-SNP	.											.	.	.	.	0			c.G186T						.						143.0	147.0	146.0					1																	19571434		2203	4300	6503	SO:0001819	synonymous_variant	23065	exon2			TGCAATCACATTC		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.186G>T	chr1.hg19:g.19571434C>A		255.0	0.0		255.0	109.0	NM_001271427	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Silent	SNP	ENST00000477853.1	hg19	CCDS190.1																																																																																			.	.		0.458	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
NBPF3	84224	hgsc.bcm.edu	37	1	21799392	21799392	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:21799392G>C	ENST00000318249.5	+	6	1068	c.718G>C	c.(718-720)Gaa>Caa	p.E240Q	NBPF3_ENST00000454000.2_Missense_Mutation_p.E170Q|NBPF3_ENST00000342104.5_Missense_Mutation_p.E240Q|NBPF3_ENST00000318220.6_Missense_Mutation_p.E184Q	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	240	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAAAGTACAGGAATTATATGC	0.413																																					p.K240Q		Atlas-SNP	.											.	NBPF3	55	.	0			c.A718C						.						135.0	145.0	142.0					1																	21799392		2203	4300	6503	SO:0001583	missense	84224	exon6			GTACAGGAATTAT	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.718G>C	chr1.hg19:g.21799392G>C	ENSP00000316782:p.Glu240Gln	110.0	0.0		93.0	10.0	NM_001256416	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	hg19	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	3.732	-0.055366	0.07362	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000417552;ENST00000342104;ENST00000434838	T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08	0.716	0.716	0.18191	DUF1220 (2);	.	.	.	.	T	0.21590	0.0520	M	0.69823	2.125	0.09310	N	1	P;D;P	0.71674	0.863;0.998;0.642	P;D;B	0.65987	0.696;0.94;0.265	T	0.05273	-1.0895	8	0.45353	T	0.12	.	.	.	.	.	170;240;240	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	Q	170;184;240;184;240;184	ENSP00000415711:E170Q;ENSP00000316739:E184Q;ENSP00000316782:E240Q;ENSP00000340336:E240Q;ENSP00000391865:E184Q	ENSP00000316739:E184Q	E	+	1	0	NBPF3	21671979	0.012000	0.17670	0.002000	0.10522	0.013000	0.08279	0.231000	0.17872	0.682000	0.31407	0.184000	0.17185	GAA	.	.		0.413	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	
RBBP4	5928	hgsc.bcm.edu	37	1	33145241	33145241	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:33145241G>A	ENST00000373493.5	+	12	1372	c.1213G>A	c.(1213-1215)Gca>Aca	p.A405T	RBBP4_ENST00000414241.3_Splice_Site_p.A404T|RBBP4_ENST00000458695.2_Splice_Site_p.A370T|RBBP4_ENST00000373485.1_Intron|RBBP4_ENST00000544435.1_Splice_Site_p.A153T	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4	405					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TTTTGGGCAGGCAGAGAACAT	0.388																																					p.A405T		Atlas-SNP	.											.	RBBP4	38	.	0			c.G1213A						.						118.0	117.0	118.0					1																	33145241		2203	4300	6503	SO:0001630	splice_region_variant	5928	exon12			GGGCAGGCAGAGA	BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.1213-1G>A	chr1.hg19:g.33145241G>A		54.0	0.0		67.0	29.0	NM_005610	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Missense_Mutation	SNP	ENST00000373493.5	hg19	CCDS366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.48|18.48	3.633258|3.633258	0.67015|0.67015	.|.	.|.	ENSG00000162521|ENSG00000162521	ENST00000414241;ENST00000373493;ENST00000544435;ENST00000458695|ENST00000463378	T;T;T;T|.	0.65364|.	-0.15;-0.15;-0.15;-0.15|.	5.3|5.3	5.3|5.3	0.74995|0.74995	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.047823|.	0.85682|.	D|.	0.000000|.	T|T	0.74489|0.74489	0.3723|0.3723	M|M	0.67700|0.67700	2.07|2.07	0.80722|0.80722	D|D	1|1	B;B|.	0.29378|.	0.087;0.243|.	B;B|.	0.30646|.	0.118;0.087|.	T|T	0.72934|0.72934	-0.4141|-0.4141	10|5	0.48119|.	T|.	0.1|.	.|.	18.3208|18.3208	0.90238|0.90238	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	404;405|.	Q09028-2;Q09028|.	.;RBBP4_HUMAN|.	T|D	404;405;153;370|205	ENSP00000398242:A404T;ENSP00000362592:A405T;ENSP00000442384:A153T;ENSP00000396057:A370T|.	ENSP00000362592:A405T|.	A|G	+|+	1|2	0|0	RBBP4|RBBP4	32917828|32917828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	8.928000|8.928000	0.92853|0.92853	2.646000|2.646000	0.89796|0.89796	0.557000|0.557000	0.71058|0.71058	GCA|GGC	.	.		0.388	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021957.3	NM_005610	Missense_Mutation
RBBP4	5928	hgsc.bcm.edu	37	1	33145248	33145248	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:33145248A>T	ENST00000373493.5	+	12	1379	c.1220A>T	c.(1219-1221)aAc>aTc	p.N407I	RBBP4_ENST00000414241.3_Missense_Mutation_p.N406I|RBBP4_ENST00000458695.2_Missense_Mutation_p.N372I|RBBP4_ENST00000373485.1_Intron|RBBP4_ENST00000544435.1_Missense_Mutation_p.N155I	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4	407					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CAGGCAGAGAACATTTATAAT	0.388																																					p.N407I		Atlas-SNP	.											.	RBBP4	38	.	0			c.A1220T						.						119.0	118.0	118.0					1																	33145248		2203	4300	6503	SO:0001583	missense	5928	exon12			CAGAGAACATTTA	BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.1220A>T	chr1.hg19:g.33145248A>T	ENSP00000362592:p.Asn407Ile	53.0	0.0		71.0	29.0	NM_005610	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Missense_Mutation	SNP	ENST00000373493.5	hg19	CCDS366.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	14.22|14.22|14.22	2.470740|2.470740|2.470740	0.43942|0.43942|0.43942	.|.|.	.|.|.	ENSG00000162521|ENSG00000162521|ENSG00000162521	ENST00000463378|ENST00000414241;ENST00000373493;ENST00000544435;ENST00000458695|ENST00000482190	.|T;T;T;T|T	.|0.66638|0.71341	.|-0.22;-0.22;-0.22;-0.22|-0.56	5.3|5.3|5.3	5.3|5.3|5.3	0.74995|0.74995|0.74995	.|WD40-repeat-containing domain (1);|.	.|0.127086|.	.|0.64402|.	.|D|.	.|0.000001|.	T|T|T	0.80884|0.80884|0.80884	0.4709|0.4709|0.4709	M|M|M	0.76727|0.76727|0.76727	2.345|2.345|2.345	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B;B|.	.|0.16166|.	.|0.016;0.002|.	.|B;B|.	.|0.18263|.	.|0.021;0.009|.	T|T|T	0.82641|0.82641|0.82641	-0.0357|-0.0357|-0.0357	5|10|7	.|0.46703|0.56958	.|T|D	.|0.11|0.05	.|.|.	14.7313|14.7313|14.7313	0.69383|0.69383|0.69383	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|406;407|.	.|Q09028-2;Q09028|.	.|.;RBBP4_HUMAN|.	D|I|S	207|406;407;155;372|147	.|ENSP00000398242:N406I;ENSP00000362592:N407I;ENSP00000442384:N155I;ENSP00000396057:N372I|ENSP00000436565:T147S	.|ENSP00000362592:N407I|ENSP00000436565:T147S	E|N|T	+|+|+	3|2|1	2|0|0	RBBP4|RBBP4|RBBP4	32917835|32917835|32917835	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.995000|0.995000|0.995000	0.86356|0.86356|0.86356	8.716000|8.716000|8.716000	0.91420|0.91420|0.91420	2.137000|2.137000|2.137000	0.66172|0.66172|0.66172	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	GAA|AAC|ACA	.	.		0.388	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021957.3	NM_005610	
LRRC7	57554	hgsc.bcm.edu	37	1	70504162	70504162	+	Silent	SNP	A	A	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:70504162A>G	ENST00000035383.5	+	19	2571	c.2541A>G	c.(2539-2541)agA>agG	p.R847R	LRRC7_ENST00000310961.5_Silent_p.R852R|LRRC7_ENST00000415775.2_Silent_p.R131R	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	847						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ATTGGACCAGAACCCCTAGTC	0.483																																					p.R847R		Atlas-SNP	.											.	LRRC7	400	.	0			c.A2541G						.						72.0	82.0	78.0					1																	70504162		2203	4300	6503	SO:0001819	synonymous_variant	57554	exon19			GACCAGAACCCCT		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2541A>G	chr1.hg19:g.70504162A>G		228.0	0.0		215.0	97.0	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	hg19	CCDS645.1																																																																																			.	.		0.483	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
SPTA1	6708	hgsc.bcm.edu	37	1	158648305	158648305	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:158648305G>C	ENST00000368147.4	-	6	878	c.698C>G	c.(697-699)cCc>cGc	p.P233R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	233					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGAATTAAGGGTAGGTCAGG	0.393																																					p.P233R		Atlas-SNP	.											.	SPTA1	720	.	0			c.C698G						.						68.0	64.0	65.0					1																	158648305		1871	4099	5970	SO:0001583	missense	6708	exon6			ATTAAGGGTAGGT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.698C>G	chr1.hg19:g.158648305G>C	ENSP00000357129:p.Pro233Arg	68.0	0.0		123.0	61.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775274	0.49786	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.53640	0.61;0.61	4.66	3.67	0.42095	.	0.271170	0.19816	N	0.105426	T	0.25344	0.0616	L	0.47716	1.5	0.19575	N	0.999968	B	0.30973	0.302	B	0.35770	0.21	T	0.04621	-1.0938	10	0.33940	T	0.23	.	10.0707	0.42330	0.0:0.0:0.6683:0.3317	.	233	P02549	SPTA1_HUMAN	R	233	ENSP00000357130:P233R;ENSP00000357129:P233R	ENSP00000357129:P233R	P	-	2	0	SPTA1	156914929	0.920000	0.31207	0.024000	0.17045	0.024000	0.10985	3.265000	0.51561	2.572000	0.86782	0.650000	0.86243	CCC	.	.		0.393	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
PFKFB2	5208	hgsc.bcm.edu	37	1	207228111	207228111	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:207228111A>G	ENST00000367080.3	+	2	173	c.49A>G	c.(49-51)Aaa>Gaa	p.K17E	YOD1_ENST00000367084.1_5'Flank|PFKFB2_ENST00000545806.1_5'UTR|PFKFB2_ENST00000411990.2_5'UTR|YOD1_ENST00000391927.1_5'Flank|PFKFB2_ENST00000367079.2_Missense_Mutation_p.K17E	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	17	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					CTATGAAACCAAAACCCCAAA	0.423																																					p.K17E		Atlas-SNP	.											.	PFKFB2	70	.	0			c.A49G						.						62.0	57.0	59.0					1																	207228111		2203	4300	6503	SO:0001583	missense	5208	exon2			GAAACCAAAACCC		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.49A>G	chr1.hg19:g.207228111A>G	ENSP00000356047:p.Lys17Glu	71.0	0.0		165.0	40.0	NM_001018053	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	hg19	CCDS31004.1	.	.	.	.	.	.	.	.	.	.	A	3.716	-0.058595	0.07317	.	.	ENSG00000123836	ENST00000367080;ENST00000367079	.	.	.	4.49	3.34	0.38264	.	0.641392	0.16258	N	0.222373	T	0.17916	0.0430	N	0.19112	0.55	0.19300	N	0.99998	B;B	0.24258	0.1;0.019	B;B	0.19148	0.024;0.017	T	0.28902	-1.0029	9	0.02654	T	1	.	8.1168	0.30948	0.784:0.216:0.0:0.0	.	17;17	Q5VVQ3;O60825	.;F262_HUMAN	E	17	.	ENSP00000356046:K17E	K	+	1	0	PFKFB2	205294734	0.206000	0.23470	0.003000	0.11579	0.138000	0.21146	1.848000	0.39309	0.675000	0.31264	0.533000	0.62120	AAA	.	.		0.423	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1		
RD3	343035	hgsc.bcm.edu	37	1	211654728	211654728	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:211654728G>A	ENST00000367002.4	-	2	1193	c.30C>T	c.(28-30)aaC>aaT	p.N10N	RD3_ENST00000484910.1_Intron	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	10					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)			p.N10N(1)		central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		ATGGGGCCTCGTTCCACCGAA	0.607																																					p.N10N		Atlas-SNP	.											RD3,colon,carcinoma,0,3	RD3	26	.	1	Substitution - coding silent(1)	ovary(1)	c.C30T						.						44.0	44.0	44.0					1																	211654728		2203	4300	6503	SO:0001819	synonymous_variant	343035	exon2			GGCCTCGTTCCAC	AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.30C>T	chr1.hg19:g.211654728G>A		85.0	0.0		158.0	43.0	NM_183059	A8K595	Silent	SNP	ENST00000367002.4	hg19	CCDS1498.1																																																																																			.	.		0.607	RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089837.1	NM_183059	
OR2M2	391194	hgsc.bcm.edu	37	1	248343509	248343509	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:248343509C>G	ENST00000359682.2	+	1	222	c.222C>G	c.(220-222)atC>atG	p.I74M		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCATGCTCATCTGCACCACCG	0.498																																					p.I74M		Atlas-SNP	.											.	OR2M2	149	.	0			c.C222G						.						265.0	256.0	259.0					1																	248343509		2203	4297	6500	SO:0001583	missense	391194	exon1			GCTCATCTGCACC	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.222C>G	chr1.hg19:g.248343509C>G	ENSP00000352710:p.Ile74Met	158.0	0.0		360.0	85.0	NM_001004688	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	hg19	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	c	6.199	0.404892	0.11754	.	.	ENSG00000198601	ENST00000359682	T	0.00433	7.43	2.03	-0.513	0.11962	GPCR, rhodopsin-like superfamily (1);	0.585147	0.12867	U	0.432637	T	0.00468	0.0015	M	0.85945	2.785	0.09310	N	1	B	0.28439	0.212	B	0.31869	0.137	T	0.41106	-0.9527	10	0.87932	D	0	.	2.7369	0.05242	0.3915:0.3667:0.0:0.2418	.	74	Q96R28	OR2M2_HUMAN	M	74	ENSP00000352710:I74M	ENSP00000352710:I74M	I	+	3	3	OR2M2	246410132	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.865000	0.04250	-0.276000	0.09206	0.454000	0.30748	ATC	.	.		0.498	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
VWA3B	200403	hgsc.bcm.edu	37	2	98852884	98852884	+	Silent	SNP	G	G	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr2:98852884G>T	ENST00000477737.1	+	18	2664	c.2460G>T	c.(2458-2460)ctG>ctT	p.L820L		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	820										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AGGAGTGGCTGGATGACAAAT	0.433																																					p.L820L		Atlas-SNP	.											.	VWA3B	138	.	0			c.G2460T						.						112.0	121.0	118.0					2																	98852884		1936	4151	6087	SO:0001819	synonymous_variant	200403	exon18			GTGGCTGGATGAC	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2460G>T	chr2.hg19:g.98852884G>T		163.0	0.0		162.0	63.0	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Silent	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	1.749	-0.489817	0.04352	.	.	ENSG00000168658	ENST00000473149	.	.	.	4.48	-3.27	0.05048	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.7091	0.02888	0.2591:0.2582:0.3516:0.131	.	.	.	.	X	231	.	.	G	+	1	0	VWA3B	98219316	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.470000	0.06639	-0.870000	0.04047	-3.009000	0.00075	GGA	.	.		0.433	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
SCRN3	79634	hgsc.bcm.edu	37	2	175292534	175292534	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr2:175292534G>T	ENST00000272732.6	+	8	1268	c.1186G>T	c.(1186-1188)Gtg>Ttg	p.V396L	SCRN3_ENST00000409673.3_Missense_Mutation_p.V389L|SCRN3_ENST00000548921.1_3'UTR	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	396							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			GCATCTTGATGTGGAGAAAAT	0.323																																					p.V396L		Atlas-SNP	.											.	SCRN3	76	.	0			c.G1186T						.						84.0	83.0	83.0					2																	175292534		2203	4296	6499	SO:0001583	missense	79634	exon8			CTTGATGTGGAGA	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.1186G>T	chr2.hg19:g.175292534G>T	ENSP00000272732:p.Val396Leu	342.0	0.0		398.0	208.0	NM_024583	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	hg19	CCDS2258.1	.	.	.	.	.	.	.	.	.	.	G	6.742	0.505792	0.12822	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	T;T	0.07800	3.16;3.16	5.63	3.36	0.38483	.	0.957919	0.08717	N	0.904091	T	0.04952	0.0133	N	0.08118	0	0.09310	N	1	B;B	0.12013	0.005;0.002	B;B	0.04013	0.001;0.001	T	0.46205	-0.9208	10	0.15499	T	0.54	-0.0209	10.8016	0.46491	0.2274:0.0:0.7726:0.0	.	389;396	B4DI11;Q0VDG4	.;SCRN3_HUMAN	L	389;396	ENSP00000387142:V389L;ENSP00000272732:V396L	ENSP00000272732:V396L	V	+	1	0	SCRN3	175000780	0.006000	0.16342	0.944000	0.38274	0.943000	0.58893	0.299000	0.19138	0.463000	0.27118	0.655000	0.94253	GTG	.	.		0.323	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	
GNAT1	2779	hgsc.bcm.edu	37	3	50232232	50232232	+	Silent	SNP	C	C	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr3:50232232C>A	ENST00000433068.1	+	8	953	c.897C>A	c.(895-897)atC>atA	p.I299I	GNAT1_ENST00000232461.3_Silent_p.I299I	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	299					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GCAACTACATCAAGGTGCAGT	0.627											OREG0015580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I299I		Atlas-SNP	.											.	GNAT1	39	.	0			c.C897A						.						76.0	64.0	68.0					3																	50232232		2203	4300	6503	SO:0001819	synonymous_variant	2779	exon8			CTACATCAAGGTG		CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.897C>A	chr3.hg19:g.50232232C>A		90.0	0.0	968	91.0	45.0	NM_144499	Q4VBN2	Silent	SNP	ENST00000433068.1	hg19	CCDS2812.1																																																																																			.	.		0.627	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	NM_000172	
SEMA3G	56920	hgsc.bcm.edu	37	3	52472194	52472194	+	Silent	SNP	G	G	T	rs371791154		TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr3:52472194G>T	ENST00000231721.2	-	14	1530	c.1531C>A	c.(1531-1533)Cgg>Agg	p.R511R		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	511	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R511W(1)		kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		ACACCCAGCCGAGAGCCCACG	0.647																																					p.R511R		Atlas-SNP	.											SEMA3G,NS,carcinoma,0,1	SEMA3G	58	.	1	Substitution - Missense(1)	lung(1)	c.C1531A						.						24.0	27.0	26.0					3																	52472194		2203	4299	6502	SO:0001819	synonymous_variant	56920	exon14			CCAGCCGAGAGCC		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1531C>A	chr3.hg19:g.52472194G>T		138.0	0.0		138.0	55.0	NM_020163	Q7L9D9|Q9H7Q3	Silent	SNP	ENST00000231721.2	hg19	CCDS2856.1																																																																																			.	.		0.647	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163	
GOLGB1	2804	hgsc.bcm.edu	37	3	121416741	121416741	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr3:121416741C>T	ENST00000340645.5	-	13	2739	c.2614G>A	c.(2614-2616)Gaa>Aaa	p.E872K	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E877K	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	872					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATTTCAAGTTCCTTCTGTGAA	0.433																																					p.E877K		Atlas-SNP	.											.	GOLGB1	319	.	0			c.G2629A						.						139.0	146.0	144.0					3																	121416741		2203	4299	6502	SO:0001583	missense	2804	exon13			CAAGTTCCTTCTG	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.2614G>A	chr3.hg19:g.121416741C>T	ENSP00000341848:p.Glu872Lys	83.0	0.0		107.0	62.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868893	0.51588	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	T;T;T	0.29142	2.18;2.18;1.58	5.35	5.35	0.76521	.	0.103582	0.44285	D	0.000475	T	0.47507	0.1449	L	0.60455	1.87	0.42961	D	0.994402	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.998	D;D;D;D;D	0.80764	0.986;0.991;0.994;0.991;0.915	T	0.22591	-1.0212	10	0.10902	T	0.67	.	14.4328	0.67261	0.0:1.0:0.0:0.0	.	797;836;877;877;872	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	K	872;877;836;684	ENSP00000341848:E872K;ENSP00000377275:E877K;ENSP00000418231:E836K	ENSP00000341848:E872K	E	-	1	0	GOLGB1	122899431	0.008000	0.16893	1.000000	0.80357	0.987000	0.75469	0.011000	0.13264	2.780000	0.95670	0.655000	0.94253	GAA	.	.		0.433	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
EPHB3	2049	hgsc.bcm.edu	37	3	184298884	184298884	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr3:184298884T>A	ENST00000330394.2	+	14	3115	c.2663T>A	c.(2662-2664)aTt>aAt	p.I888N	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	888	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TTCTCCCAGATTGTCAATACC	0.602																																					p.I888N		Atlas-SNP	.											.	EPHB3	114	.	0			c.T2663A						.						83.0	92.0	89.0					3																	184298884		2203	4300	6503	SO:0001583	missense	2049	exon14			CCCAGATTGTCAA	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.2663T>A	chr3.hg19:g.184298884T>A	ENSP00000332118:p.Ile888Asn	73.0	0.0		102.0	59.0	NM_004443	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	hg19	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.381227	0.61845	.	.	ENSG00000182580	ENST00000330394	D	0.85339	-1.97	3.99	3.99	0.46301	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94725	0.8298	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95985	0.8981	10	0.87932	D	0	.	12.786	0.57504	0.0:0.0:0.0:1.0	.	888	P54753	EPHB3_HUMAN	N	888	ENSP00000332118:I888N	ENSP00000332118:I888N	I	+	2	0	EPHB3	185781578	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	8.032000	0.88838	1.779000	0.52309	0.448000	0.29417	ATT	.	.		0.602	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
CRMP1	1400	hgsc.bcm.edu	37	4	5853138	5853138	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr4:5853138G>A	ENST00000397890.2	-	5	751	c.537C>T	c.(535-537)agC>agT	p.S179S	CRMP1_ENST00000512574.1_Silent_p.S177S|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Silent_p.S293S	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	179					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		GACCTACCTGGCTGTCGGACA	0.483																																					p.S293S		Atlas-SNP	.											.	CRMP1	118	.	0			c.C879T						.						209.0	191.0	197.0					4																	5853138		2203	4300	6503	SO:0001819	synonymous_variant	1400	exon5			TACCTGGCTGTCG	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.537C>T	chr4.hg19:g.5853138G>A		95.0	0.0		104.0	45.0	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	hg19	CCDS43207.1																																																																																			.	.		0.483	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
DCAF4L1	285429	hgsc.bcm.edu	37	4	41984060	41984060	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr4:41984060A>T	ENST00000333141.5	+	1	348	c.251A>T	c.(250-252)gAc>gTc	p.D84V		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	84										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						ACCAACAGCGACCAGCTCTTC	0.537																																					p.D84V		Atlas-SNP	.											.	DCAF4L1	70	.	0			c.A251T						.						90.0	78.0	82.0					4																	41984060		2203	4300	6503	SO:0001583	missense	285429	exon1			ACAGCGACCAGCT	BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.251A>T	chr4.hg19:g.41984060A>T	ENSP00000327796:p.Asp84Val	138.0	0.0		172.0	80.0	NM_001029955	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	hg19	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	A	17.83	3.484912	0.63962	.	.	ENSG00000182308	ENST00000333141	T	0.42900	0.96	0.688	0.688	0.18027	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.224065	0.53938	D	0.000056	T	0.31606	0.0802	L	0.57536	1.79	0.58432	D	0.99999	P	0.37233	0.588	B	0.26864	0.074	T	0.29941	-0.9995	9	0.87932	D	0	.	.	.	.	.	84	Q3SXM0	DC4L1_HUMAN	V	84	ENSP00000327796:D84V	ENSP00000327796:D84V	D	+	2	0	DCAF4L1	41678817	1.000000	0.71417	0.536000	0.28039	0.507000	0.33981	4.771000	0.62318	0.530000	0.28619	0.260000	0.18958	GAC	.	.		0.537	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955	
PRDM5	11107	hgsc.bcm.edu	37	4	121706177	121706177	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr4:121706177G>C	ENST00000264808.3	-	11	1498	c.1258C>G	c.(1258-1260)Cag>Gag	p.Q420E	PRDM5_ENST00000515109.1_Missense_Mutation_p.Q389E|PRDM5_ENST00000428209.2_Missense_Mutation_p.Q389E	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	420					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AGGTGTCTCTGTAAAGAAAAT	0.398																																					p.Q420E		Atlas-SNP	.											.	PRDM5	76	.	0			c.C1258G						.						97.0	90.0	92.0					4																	121706177		2203	4300	6503	SO:0001583	missense	11107	exon11			GTCTCTGTAAAGA	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1258C>G	chr4.hg19:g.121706177G>C	ENSP00000264808:p.Gln420Glu	45.0	0.0		36.0	21.0	NM_018699	Q0VAI9|Q0VAJ0|Q6NXQ7	Missense_Mutation	SNP	ENST00000264808.3	hg19	CCDS3716.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123623	0.37436	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	T;T;T	0.18016	2.24;2.24;2.24	5.31	4.46	0.54185	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.054557	0.85682	D	0.000000	T	0.11707	0.0285	N	0.21194	0.64	0.80722	D	1	B;P;B	0.38395	0.037;0.629;0.037	B;B;B	0.34242	0.062;0.178;0.038	T	0.11060	-1.0603	10	0.22109	T	0.4	-13.3319	15.3865	0.74706	0.0:0.0:0.8597:0.1403	.	389;389;420	Q0VAI9;Q9NQX1-2;Q9NQX1	.;.;PRDM5_HUMAN	E	420;389;389	ENSP00000264808:Q420E;ENSP00000422309:Q389E;ENSP00000404832:Q389E	ENSP00000264808:Q420E	Q	-	1	0	PRDM5	121925627	1.000000	0.71417	0.975000	0.42487	0.943000	0.58893	9.578000	0.98200	1.225000	0.43566	0.591000	0.81541	CAG	.	.		0.398	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2		
TRIML1	339976	hgsc.bcm.edu	37	4	189061721	189061721	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr4:189061721A>G	ENST00000332517.3	+	2	588	c.448A>G	c.(448-450)Aga>Gga	p.R150G	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	150					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GCGTGTAAGGAGAAAGGAAGC	0.468																																					p.R150G	Melanoma(31;213 1036 16579 23968 32372)	Atlas-SNP	.											.	TRIML1	126	.	0			c.A448G						.						166.0	156.0	159.0					4																	189061721		2203	4300	6503	SO:0001583	missense	339976	exon2			GTAAGGAGAAAGG	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.448A>G	chr4.hg19:g.189061721A>G	ENSP00000327738:p.Arg150Gly	113.0	0.0		67.0	63.0	NM_178556	Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	hg19	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	A	6.708	0.499399	0.12762	.	.	ENSG00000184108	ENST00000332517	T	0.63417	-0.04	4.74	4.74	0.60224	.	1.271710	0.05378	N	0.536602	T	0.54663	0.1872	L	0.36672	1.1	0.09310	N	1	B	0.19817	0.039	B	0.14578	0.011	T	0.35624	-0.9781	10	0.23891	T	0.37	-15.2049	11.2026	0.48749	1.0:0.0:0.0:0.0	.	150	Q8N9V2	TRIML_HUMAN	G	150	ENSP00000327738:R150G	ENSP00000327738:R150G	R	+	1	2	TRIML1	189298715	0.000000	0.05858	0.165000	0.22776	0.004000	0.04260	0.768000	0.26590	2.075000	0.62263	0.533000	0.62120	AGA	.	.		0.468	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	
TMED9	54732	hgsc.bcm.edu	37	5	177021211	177021211	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr5:177021211G>A	ENST00000332598.6	+	4	540	c.483G>A	c.(481-483)ttG>ttA	p.L161L		NM_017510.4	NP_059980.2	Q9BVK6	TMED9_HUMAN	transmembrane emp24 protein transport domain containing 9	161					COPI coating of Golgi vesicle (GO:0048205)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network transport vesicle (GO:0030140)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(2)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGACAAGTTGAGTGAGTTGC	0.512																																					p.L161L		Atlas-SNP	.											.	TMED9	18	.	0			c.G483A						.						110.0	97.0	101.0					5																	177021211		2203	4300	6503	SO:0001819	synonymous_variant	54732	exon4			CAAGTTGAGTGAG	AF441399	CCDS4428.1	5q35.3	2008-02-05			ENSG00000184840	ENSG00000184840			24878	protein-coding gene	gene with protein product						12477932	Standard	NM_017510		Approved	HSGP25L2G	uc003mhx.3	Q9BVK6	OTTHUMG00000130859	ENST00000332598.6:c.483G>A	chr5.hg19:g.177021211G>A		199.0	0.0		214.0	95.0	NM_017510	Q14437|Q8WZ61	Silent	SNP	ENST00000332598.6	hg19	CCDS4428.1																																																																																			.	.		0.512	TMED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253433.1	NM_017510	
OR2W1	26692	hgsc.bcm.edu	37	6	29012190	29012190	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr6:29012190T>C	ENST00000377175.1	-	1	827	c.763A>G	c.(763-765)Att>Gtt	p.I255V		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						ATGTAGATAATAGTTCCATAG	0.463																																					p.I255V		Atlas-SNP	.											.	OR2W1	36	.	0			c.A763G						.						150.0	131.0	138.0					6																	29012190		1511	2709	4220	SO:0001583	missense	26692	exon1			AGATAATAGTTCC	AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.763A>G	chr6.hg19:g.29012190T>C	ENSP00000366380:p.Ile255Val	168.0	0.0		200.0	98.0	NM_030903	B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	ENST00000377175.1	hg19	CCDS4656.1	.	.	.	.	.	.	.	.	.	.	T	8.625	0.892289	0.17613	.	.	ENSG00000204704	ENST00000377175	T	0.00115	8.71	4.79	0.724	0.18236	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000092	T	0.00012	0.0000	N	0.11845	0.185	0.31829	N	0.624996	B	0.10296	0.003	B	0.14023	0.01	T	0.01626	-1.1309	10	0.10111	T	0.7	.	5.1656	0.15084	0.0:0.179:0.2302:0.5908	.	255	Q9Y3N9	OR2W1_HUMAN	V	255	ENSP00000366380:I255V	ENSP00000366380:I255V	I	-	1	0	OR2W1	29120169	0.000000	0.05858	0.998000	0.56505	0.991000	0.79684	-1.988000	0.01482	0.190000	0.20209	0.482000	0.46254	ATT	.	.		0.463	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076053.2		
MTRF1L	54516	hgsc.bcm.edu	37	6	153316444	153316444	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr6:153316444A>C	ENST00000367233.5	-	3	349	c.350T>G	c.(349-351)cTt>cGt	p.L117R	MTRF1L_ENST00000367231.5_Missense_Mutation_p.L117R|MTRF1L_ENST00000464135.1_Intron|MTRF1L_ENST00000367230.1_Missense_Mutation_p.L117R	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	117						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		GGGAACCAAAAGTAAGATAAT	0.294																																					p.L117R		Atlas-SNP	.											.	MTRF1L	21	.	0			c.T350G						.						24.0	24.0	24.0					6																	153316444		2192	4293	6485	SO:0001583	missense	54516	exon3			ACCAAAAGTAAGA	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.350T>G	chr6.hg19:g.153316444A>C	ENSP00000356202:p.Leu117Arg	134.0	0.0		174.0	71.0	NM_019041	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	hg19	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.526299	0.44969	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771	T;T;T;T	0.50813	0.73;0.73;0.73;2.65	5.43	5.43	0.79202	Peptide chain release factor (2);	0.061987	0.64402	D	0.000004	T	0.63803	0.2542	M	0.86420	2.815	0.50632	D	0.999885	D;D;D;D	0.76494	0.998;0.997;0.999;0.998	D;D;D;D	0.71656	0.964;0.949;0.967;0.974	T	0.72017	-0.4417	10	0.87932	D	0	-19.4498	11.2595	0.49074	0.8632:0.0:0.0:0.1368	.	117;117;117;117	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	R	117;117;117;4	ENSP00000356202:L117R;ENSP00000356200:L117R;ENSP00000356199:L117R;ENSP00000414383:L4R	ENSP00000356199:L117R	L	-	2	0	MTRF1L	153358137	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.526000	0.53509	2.062000	0.61559	0.477000	0.44152	CTT	.	.		0.294	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
ZNF716	441234	hgsc.bcm.edu	37	7	57529237	57529237	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr7:57529237G>T	ENST00000420713.1	+	4	1182	c.1070G>T	c.(1069-1071)tGt>tTt	p.C357F		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						TGTGAAGAATGTGGGAAAGCC	0.398																																					p.C357F		Atlas-SNP	.											.	ZNF716	207	.	0			c.G1070T						.						68.0	69.0	69.0					7																	57529237		692	1591	2283	SO:0001583	missense	441234	exon4			AAGAATGTGGGAA	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1070G>T	chr7.hg19:g.57529237G>T	ENSP00000394248:p.Cys357Phe	134.0	0.0		172.0	76.0	NM_001159279		Missense_Mutation	SNP	ENST00000420713.1	hg19	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840559	0.32513	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	D	0.85861	-2.04	0.109	0.109	0.14578	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92459	0.7606	H	0.94264	3.515	0.37001	D	0.895288	D	0.69078	0.997	D	0.79108	0.992	D	0.90456	0.4442	9	0.87932	D	0	.	5.9913	0.19465	6.0E-4:0.0:0.9994:0.0	.	345	A6NP11	ZN716_HUMAN	F	357;345	ENSP00000394248:C357F	ENSP00000387687:C345F	C	+	2	0	ZNF716	57533179	1.000000	0.71417	0.009000	0.14445	0.009000	0.06853	4.919000	0.63383	0.181000	0.19994	0.184000	0.17185	TGT	.	.		0.398	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279	
TECPR1	25851	hgsc.bcm.edu	37	7	97863048	97863048	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr7:97863048T>C	ENST00000447648.2	-	11	1656	c.1357A>G	c.(1357-1359)Acc>Gcc	p.T453A	TECPR1_ENST00000542604.1_Missense_Mutation_p.T383A|TECPR1_ENST00000379795.3_Missense_Mutation_p.T453A			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	453					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCTTCTGCGGTCCTGCCAGCC	0.672																																					p.T453A		Atlas-SNP	.											.	TECPR1	77	.	0			c.A1357G						.						20.0	25.0	23.0					7																	97863048		2027	4176	6203	SO:0001583	missense	25851	exon11			CTGCGGTCCTGCC		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.1357A>G	chr7.hg19:g.97863048T>C	ENSP00000404923:p.Thr453Ala	113.0	0.0		162.0	54.0	NM_015395	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	hg19	CCDS47648.1	.	.	.	.	.	.	.	.	.	.	T	1.890	-0.455758	0.04540	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	T;T;T	0.29655	1.56;1.57;1.57	4.14	-0.212	0.13169	.	1.622620	0.03237	N	0.179720	T	0.19127	0.0459	N	0.22421	0.69	0.09310	N	1	B;B	0.20671	0.047;0.001	B;B	0.18263	0.021;0.002	T	0.16600	-1.0397	10	0.07482	T	0.82	-5.2761	7.7384	0.28827	0.0:0.0835:0.3161:0.6004	.	383;453	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	A	453;453;383	ENSP00000404923:T453A;ENSP00000369121:T453A;ENSP00000441121:T383A	ENSP00000369121:T453A	T	-	1	0	TECPR1	97700984	0.001000	0.12720	0.018000	0.16275	0.018000	0.09664	0.805000	0.27112	0.111000	0.17947	0.379000	0.24179	ACC	.	.		0.672	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395	
NEIL2	252969	hgsc.bcm.edu	37	8	11637363	11637363	+	Missense_Mutation	SNP	G	G	A	rs147360797		TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr8:11637363G>A	ENST00000284503.6	+	3	994	c.395G>A	c.(394-396)cGt>cAt	p.R132H	NEIL2_ENST00000436750.3_Missense_Mutation_p.R132H|NEIL2_ENST00000403422.3_Missense_Mutation_p.R71H|NEIL2_ENST00000455213.2_Missense_Mutation_p.R132H|NEIL2_ENST00000528323.1_Intron	NM_145043.2	NP_659480.1	Q969S2	NEIL2_HUMAN	nei endonuclease VIII-like 2 (E. coli)	132					base-excision repair (GO:0006284)|nucleotide-excision repair (GO:0006289)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)		AGGTGGCTGCGTGTCAGCTTT	0.577								Base excision repair (BER), DNA glycosylases																													p.R132H		Atlas-SNP	.											.	NEIL2	14	.	0			c.G395A						.	G	HIS/ARG,HIS/ARG,,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	84.0	85.0		395,212,,395	2.4	0.4	8	dbSNP_134	85	0,8600		0,0,4300	no	missense,missense,intron,missense	NEIL2	NM_001135746.1,NM_001135747.1,NM_001135748.1,NM_145043.2	29,29,,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,,probably-damaging	132/333,71/272,,132/333	11637363	1,13005	2203	4300	6503	SO:0001583	missense	252969	exon3			GGCTGCGTGTCAG	AK056206	CCDS5984.1, CCDS47802.1, CCDS47803.1	8p23.1	2010-04-27	2010-04-27		ENSG00000154328	ENSG00000154328			18956	protein-coding gene	gene with protein product		608933	"""nei like 2 (E. coli)"""			12097317, 17686777	Standard	NM_145043		Approved	NEH2, FLJ31644, MGC2832, MGC4505	uc003wue.2	Q969S2	OTTHUMG00000090753	ENST00000284503.6:c.395G>A	chr8.hg19:g.11637363G>A	ENSP00000284503:p.Arg132His	81.0	0.0		49.0	39.0	NM_001135746	B4DFR7|Q7Z3Q7|Q8N842|Q8NG52	Missense_Mutation	SNP	ENST00000284503.6	hg19	CCDS5984.1	.	.	.	.	.	.	.	.	.	.	G	8.671	0.902754	0.17760	2.27E-4	0.0	ENSG00000154328	ENST00000530433;ENST00000455213;ENST00000403422;ENST00000436750;ENST00000284503;ENST00000382309	T;T;T;T	0.13778	2.56;3.25;2.56;2.56	4.72	2.44	0.29823	DNA glycosylase/AP lyase, catalytic domain (2);	0.328143	0.30911	N	0.008628	T	0.10508	0.0257	L	0.43152	1.355	0.23831	N	0.99672	B	0.18863	0.031	B	0.12837	0.008	T	0.20306	-1.0279	10	0.62326	D	0.03	-13.0699	4.8675	0.13616	0.5972:0.0:0.4028:0.0	.	132	Q969S2	NEIL2_HUMAN	H	132;132;71;132;132;117	ENSP00000397538:R132H;ENSP00000384070:R71H;ENSP00000394023:R132H;ENSP00000284503:R132H	ENSP00000284503:R132H	R	+	2	0	NEIL2	11674772	0.981000	0.34729	0.407000	0.26434	0.009000	0.06853	3.069000	0.50026	0.957000	0.37930	-0.367000	0.07326	CGT	.	G|1.000;A|0.000		0.577	NEIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207583.3	NM_145043	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110477316	110477316	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr8:110477316T>A	ENST00000378402.5	+	49	8359	c.8255T>A	c.(8254-8256)gTa>gAa	p.V2752E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2752					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCCAACTGTGTAGCTTTGGGA	0.473										HNSCC(38;0.096)																											p.V2752E		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.T8255A						.						151.0	149.0	150.0					8																	110477316		1925	4135	6060	SO:0001583	missense	93035	exon49			ACTGTGTAGCTTT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8255T>A	chr8.hg19:g.110477316T>A	ENSP00000367655:p.Val2752Glu	158.0	0.0		265.0	77.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.464112	0.43736	.	.	ENSG00000205038	ENST00000378402	D	0.87179	-2.22	5.83	0.678	0.17969	.	0.208381	0.40818	N	0.001001	T	0.80412	0.4618	L	0.52573	1.65	0.31124	N	0.708562	B	0.28933	0.228	B	0.23716	0.048	T	0.75539	-0.3282	10	0.66056	D	0.02	.	8.5466	0.33426	0.0:0.4415:0.0:0.5585	.	2752	Q86WI1	PKHL1_HUMAN	E	2752	ENSP00000367655:V2752E	ENSP00000367655:V2752E	V	+	2	0	PKHD1L1	110546492	0.990000	0.36364	0.999000	0.59377	0.993000	0.82548	0.409000	0.21082	0.095000	0.17434	-0.376000	0.06991	GTA	.	.		0.473	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
KLF9	687	hgsc.bcm.edu	37	9	73028153	73028153	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr9:73028153C>T	ENST00000377126.2	-	1	1387	c.127G>A	c.(127-129)Gtg>Atg	p.V43M		NM_001206.2	NP_001197.1	Q13886	KLF9_HUMAN	Kruppel-like factor 9	43					cellular response to thyroid hormone stimulus (GO:0097067)|embryo implantation (GO:0007566)|progesterone receptor signaling pathway (GO:0050847)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	9						TCCTTGGTCACCTCGCGCTCA	0.632																																					p.V43M		Atlas-SNP	.											.	KLF9	16	.	0			c.G127A						.						50.0	40.0	43.0					9																	73028153		2203	4300	6503	SO:0001583	missense	687	exon1			TGGTCACCTCGCG	BC069431	CCDS6633.1	9q21.11	2013-01-08	2004-11-29	2004-12-01	ENSG00000119138	ENSG00000119138		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	1123	protein-coding gene	gene with protein product		602902	"""basic transcription element binding protein 1"""	BTEB1		1356762	Standard	NM_001206		Approved		uc004aht.3	Q13886	OTTHUMG00000019991	ENST00000377126.2:c.127G>A	chr9.hg19:g.73028153C>T	ENSP00000366330:p.Val43Met	68.0	0.0		60.0	25.0	NM_001206	B2R943|Q16196	Missense_Mutation	SNP	ENST00000377126.2	hg19	CCDS6633.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326636	0.41197	.	.	ENSG00000119138	ENST00000377126	T	0.04917	3.53	4.85	4.85	0.62838	.	0.596324	0.14987	N	0.286898	T	0.04770	0.0129	N	0.14661	0.345	0.27395	N	0.955014	B	0.26845	0.161	B	0.24541	0.054	T	0.34229	-0.9837	10	0.32370	T	0.25	.	12.6348	0.56677	0.0:0.833:0.167:0.0	.	43	Q13886	KLF9_HUMAN	M	43	ENSP00000366330:V43M	ENSP00000366330:V43M	V	-	1	0	KLF9	72217973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.279000	0.43435	2.250000	0.74265	0.557000	0.71058	GTG	.	.		0.632	KLF9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052602.1	NM_001206	
ARID5B	84159	hgsc.bcm.edu	37	10	63852733	63852733	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr10:63852733C>G	ENST00000279873.7	+	10	3921	c.3511C>G	c.(3511-3513)Caa>Gaa	p.Q1171E	ARID5B_ENST00000309334.5_Missense_Mutation_p.Q928E	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1171					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TATAAATCCTCAAGCTGCCTT	0.517																																					p.Q1171E		Atlas-SNP	.											.	ARID5B	125	.	0			c.C3511G						.						115.0	119.0	118.0					10																	63852733		2203	4300	6503	SO:0001583	missense	84159	exon10			AATCCTCAAGCTG	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3511C>G	chr10.hg19:g.63852733C>G	ENSP00000279873:p.Gln1171Glu	45.0	0.0		66.0	34.0	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	hg19	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624031	0.66901	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.60548	0.25;0.18	5.87	5.87	0.94306	.	0.051979	0.85682	D	0.000000	T	0.67813	0.2933	M	0.65975	2.015	0.54753	D	0.999984	D	0.60160	0.987	P	0.49887	0.625	T	0.71203	-0.4662	10	0.87932	D	0	-17.7233	20.2033	0.98269	0.0:1.0:0.0:0.0	.	1171	Q14865	ARI5B_HUMAN	E	1171;928	ENSP00000279873:Q1171E;ENSP00000308862:Q928E	ENSP00000279873:Q1171E	Q	+	1	0	ARID5B	63522739	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.400000	0.52594	2.779000	0.95612	0.655000	0.94253	CAA	.	.		0.517	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
DNA2	1763	hgsc.bcm.edu	37	10	70192255	70192255	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr10:70192255G>A	ENST00000358410.3	-	11	1709	c.1659C>T	c.(1657-1659)gtC>gtT	p.V553V	DNA2_ENST00000399179.2_Silent_p.V553V|DNA2_ENST00000399180.2_Silent_p.V639V	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	553	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						ATTCTGGAAGGACCGACAAGT	0.333																																					p.V553V		Atlas-SNP	.											.	DNA2	76	.	0			c.C1659T						.						26.0	24.0	25.0					10																	70192255		1829	4071	5900	SO:0001819	synonymous_variant	1763	exon11			TGGAAGGACCGAC	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.1659C>T	chr10.hg19:g.70192255G>A		328.0	0.0		346.0	135.0	NM_001080449	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Silent	SNP	ENST00000358410.3	hg19																																																																																				.	.		0.333	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
DUSP13	51207	hgsc.bcm.edu	37	10	76867822	76867822	+	Missense_Mutation	SNP	G	G	T	rs201419297		TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr10:76867822G>T	ENST00000372702.3	-	2	358	c.295C>A	c.(295-297)Cct>Act	p.P99T	DUSP13_ENST00000491677.2_5'UTR|DUSP13_ENST00000607131.1_Intron|DUSP13_ENST00000607009.1_5'UTR|DUSP13_ENST00000372700.3_Intron			Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	108					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TCAAAATCAGGGAGGTCGTGG	0.622																																					p.P99T	NSCLC(174;1655 2059 12324 40663 42963)	Atlas-SNP	.											.	DUSP13	82	.	0			c.C295A						.						42.0	51.0	48.0					10																	76867822		2058	4185	6243	SO:0001583	missense	51207	exon2			AATCAGGGAGGTC	AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000372702.3:c.295C>A	chr10.hg19:g.76867822G>T	ENSP00000361787:p.Pro99Thr	119.0	0.0		142.0	58.0	NM_001007271	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	ENST00000372702.3	hg19	CCDS53542.1	.	.	.	.	.	.	.	.	.	.	G	30	5.050143	0.93740	.	.	ENSG00000079393	ENST00000372702	D	0.84660	-1.88	5.35	5.35	0.76521	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	.	.	.	.	D	0.92639	0.7661	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	D	0.70935	0.971	D	0.92597	0.6088	9	0.52906	T	0.07	.	17.983	0.89147	0.0:0.0:1.0:0.0	.	99	Q6B8I1	MDSP_HUMAN	T	99	ENSP00000361787:P99T	ENSP00000361787:P99T	P	-	1	0	DUSP13	76537828	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.900000	0.92551	2.781000	0.95711	0.655000	0.94253	CCT	.	G|0.998;A|0.002		0.622	DUSP13-012	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401503.3		
CD81	975	hgsc.bcm.edu	37	11	2416745	2416745	+	Missense_Mutation	SNP	G	G	A	rs538164293		TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr11:2416745G>A	ENST00000263645.5	+	5	710	c.454G>A	c.(454-456)Gag>Aag	p.E152K	CD81_ENST00000524805.1_3'UTR|CD81_ENST00000492627.1_Missense_Mutation_p.E81K|CD81_ENST00000481687.1_Missense_Mutation_p.E158K|CD81_ENST00000381036.3_Missense_Mutation_p.E190K|CD81_ENST00000526072.1_Missense_Mutation_p.E81K	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	152					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		GACCTTCCACGAGACGGTGCG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		13972	0.0		0.001	False		,,,				2504	0.0				p.E152K		Atlas-SNP	.											.	CD81	11	.	0			c.G454A						.						64.0	61.0	62.0					11																	2416745		2201	4298	6499	SO:0001583	missense	975	exon5			TTCCACGAGACGG		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.454G>A	chr11.hg19:g.2416745G>A	ENSP00000263645:p.Glu152Lys	108.0	0.0		116.0	58.0	NM_004356	P18582|Q5U0J6	Missense_Mutation	SNP	ENST00000263645.5	hg19	CCDS7734.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184139	0.38609	.	.	ENSG00000110651	ENST00000475945;ENST00000263645;ENST00000533417;ENST00000492627;ENST00000527343;ENST00000381036;ENST00000492252;ENST00000526072;ENST00000481687	T;T;D;T;T;T;T;T;T	0.86562	-1.26;-1.26;-2.14;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	3.65	3.65	0.41850	Tetraspanin, EC2 domain (1);CD81 extracellular domain (1);	0.118955	0.56097	D	0.000036	T	0.72969	0.3527	N	0.16903	0.455	0.80722	D	1	P;P	0.47545	0.897;0.811	B;B	0.39339	0.297;0.109	T	0.71328	-0.4626	10	0.11485	T	0.65	.	11.05	0.47880	0.0:0.0:1.0:0.0	.	190;152	A6NMH8;P60033	.;CD81_HUMAN	K	81;152;147;81;141;190;145;81;158	ENSP00000433178:E81K;ENSP00000263645:E152K;ENSP00000435633:E147K;ENSP00000437242:E81K;ENSP00000433767:E141K;ENSP00000370424:E190K;ENSP00000432249:E145K;ENSP00000431780:E81K;ENSP00000432033:E158K	ENSP00000263645:E152K	E	+	1	0	CD81	2373321	1.000000	0.71417	0.997000	0.53966	0.689000	0.40095	3.620000	0.54203	2.060000	0.61445	0.561000	0.74099	GAG	.	.		0.657	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027357.4	NM_004356	
IPO7	10527	hgsc.bcm.edu	37	11	9452513	9452513	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr11:9452513T>G	ENST00000379719.3	+	16	1986	c.1844T>G	c.(1843-1845)aTt>aGt	p.I615S	CTD-2371O3.2_ENST00000531111.1_RNA|SNORA23_ENST00000365128.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	615					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CTGAATACAATTGATACACTT	0.373																																					p.I615S		Atlas-SNP	.											.	IPO7	72	.	0			c.T1844G						.						98.0	90.0	92.0					11																	9452513		2201	4295	6496	SO:0001583	missense	10527	exon16			ATACAATTGATAC	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1844T>G	chr11.hg19:g.9452513T>G	ENSP00000369042:p.Ile615Ser	95.0	0.0		78.0	31.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	hg19	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.699270	0.88830	.	.	ENSG00000205339	ENST00000379719	T	0.71698	-0.59	5.53	5.53	0.82687	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85062	0.5611	M	0.85197	2.74	0.80722	D	1	D	0.69078	0.997	D	0.68765	0.96	D	0.87609	0.2502	10	0.72032	D	0.01	.	15.6512	0.77095	0.0:0.0:0.0:1.0	.	615	O95373	IPO7_HUMAN	S	615	ENSP00000369042:I615S	ENSP00000369042:I615S	I	+	2	0	IPO7	9409089	1.000000	0.71417	0.717000	0.30585	0.996000	0.88848	8.040000	0.89188	2.113000	0.64589	0.528000	0.53228	ATT	.	.		0.373	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
LRRC4C	57689	hgsc.bcm.edu	37	11	40137427	40137427	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr11:40137427A>G	ENST00000278198.2	-	2	2379	c.416T>C	c.(415-417)aTc>aCc	p.I139T	LRRC4C_ENST00000530763.1_Missense_Mutation_p.I139T|LRRC4C_ENST00000527150.1_Missense_Mutation_p.I139T|LRRC4C_ENST00000528697.1_Missense_Mutation_p.I139T			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	139					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TCCATTCGGGATGGTAGTAAG	0.428																																					p.I139T		Atlas-SNP	.											.	LRRC4C	190	.	0			c.T416C						.						69.0	71.0	70.0					11																	40137427		2203	4300	6503	SO:0001583	missense	57689	exon7			TTCGGGATGGTAG	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.416T>C	chr11.hg19:g.40137427A>G	ENSP00000278198:p.Ile139Thr	107.0	0.0		123.0	45.0	NM_001258419	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	hg19	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.988134	0.53934	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.97876	0.9302	M	0.94101	3.495	0.80722	D	1	D	0.64830	0.994	D	0.71184	0.972	D	0.98911	1.0780	10	0.87932	D	0	.	15.3632	0.74499	1.0:0.0:0.0:0.0	.	139	Q9HCJ2	LRC4C_HUMAN	T	139	ENSP00000278198:I139T;ENSP00000436976:I139T;ENSP00000437132:I139T;ENSP00000434761:I139T	ENSP00000278198:I139T	I	-	2	0	LRRC4C	40094003	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.222000	0.72286	0.528000	0.53228	ATC	.	.		0.428	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
TENM4	26011	hgsc.bcm.edu	37	11	78387281	78387281	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr11:78387281G>A	ENST00000278550.7	-	30	5874	c.5412C>T	c.(5410-5412)atC>atT	p.I1804I		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1804					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GGCCGTTGTCGATGGGCAGCG	0.672																																					p.I1804I		Atlas-SNP	.											.	.	.	.	0			c.C5412T						.						23.0	28.0	26.0					11																	78387281		2132	4230	6362	SO:0001819	synonymous_variant	26011	exon30			GTTGTCGATGGGC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5412C>T	chr11.hg19:g.78387281G>A		67.0	0.0		71.0	29.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	hg19	CCDS44688.1																																																																																			.	.		0.672	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
SPSB2	84727	hgsc.bcm.edu	37	12	6981831	6981831	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr12:6981831G>A	ENST00000524270.1	-	2	421	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W	LRRC23_ENST00000433346.1_5'Flank|SPSB2_ENST00000523102.1_Missense_Mutation_p.R79W|SPSB2_ENST00000519357.1_Missense_Mutation_p.R79W|RPL13P5_ENST00000412023.1_RNA	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2	79	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						CTCTTACCCCGGGCCCCATCA	0.647											OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R79W		Atlas-SNP	.											.	SPSB2	11	.	0			c.C235T						.						39.0	47.0	44.0					12																	6981831		2201	4300	6501	SO:0001583	missense	84727	exon2			TACCCCGGGCCCC	AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.235C>T	chr12.hg19:g.6981831G>A	ENSP00000428338:p.Arg79Trp	72.0	0.0	638	71.0	29.0	NM_032641	B7Z4W1|D3DUT0	Missense_Mutation	SNP	ENST00000524270.1	hg19	CCDS8567.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056372	0.36277	.	.	ENSG00000111671	ENST00000523102;ENST00000524270;ENST00000519357;ENST00000432205	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	3.84	2.94	0.34122	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000010	T	0.82121	0.4968	H	0.94183	3.505	0.41234	D	0.986593	D;B	0.89917	1.0;0.446	D;B	0.97110	1.0;0.034	D	0.84307	0.0508	10	0.87932	D	0	.	9.362	0.38201	0.1086:0.0:0.8914:0.0	.	79;79	B7Z4W1;Q99619	.;SPSB2_HUMAN	W	79	ENSP00000430872:R79W;ENSP00000428338:R79W;ENSP00000431037:R79W;ENSP00000428458:R79W	ENSP00000428458:R79W	R	-	1	2	SPSB2	6852092	1.000000	0.71417	0.896000	0.35187	0.025000	0.11179	2.132000	0.42083	0.947000	0.37659	-0.251000	0.11542	CGG	.	.		0.647	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375721.1	NM_032641	
CUX2	23316	hgsc.bcm.edu	37	12	111744831	111744831	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr12:111744831G>A	ENST00000261726.6	+	11	1119	c.965G>A	c.(964-966)aGc>aAc	p.S322N		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	322					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CACCTCCAGAGCTCACTGCAG	0.662																																					p.S322N		Atlas-SNP	.											.	CUX2	145	.	0			c.G965A						.						34.0	39.0	37.0					12																	111744831		2005	4174	6179	SO:0001583	missense	23316	exon11			TCCAGAGCTCACT	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.965G>A	chr12.hg19:g.111744831G>A	ENSP00000261726:p.Ser322Asn	57.0	0.0		65.0	24.0	NM_015267	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	hg19	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	G	5.674	0.308957	0.10733	.	.	ENSG00000111249	ENST00000261726	T	0.44083	0.93	5.3	-2.0	0.07433	.	0.453060	0.26485	N	0.024102	T	0.13157	0.0319	N	0.02357	-0.585	0.20074	N	0.999939	B	0.02656	0.0	B	0.01281	0.0	T	0.27262	-1.0079	10	0.13853	T	0.58	-7.4032	7.2769	0.26290	0.4924:0.1193:0.3883:0.0	.	322	O14529	CUX2_HUMAN	N	322	ENSP00000261726:S322N	ENSP00000261726:S322N	S	+	2	0	CUX2	110229214	0.998000	0.40836	0.326000	0.25389	0.398000	0.30690	0.543000	0.23237	-0.647000	0.05444	-0.366000	0.07423	AGC	.	.		0.662	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
RPH3A	22895	hgsc.bcm.edu	37	12	113303258	113303258	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr12:113303258G>A	ENST00000389385.4	+	6	767	c.270G>A	c.(268-270)gtG>gtA	p.V90V	RPH3A_ENST00000420983.2_Silent_p.V90V|RPH3A_ENST00000543106.2_Silent_p.V90V|RPH3A_ENST00000551052.1_Silent_p.V86V|RPH3A_ENST00000415485.3_Silent_p.V90V|RPH3A_ENST00000447659.2_Silent_p.V41V|RPH3A_ENST00000548866.1_Silent_p.V41V	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	90	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GGAAGAACGTGGCTGGAGATG	0.532																																					p.V90V		Atlas-SNP	.											.	RPH3A	98	.	0			c.G270A						.						208.0	182.0	191.0					12																	113303258		2203	4300	6503	SO:0001819	synonymous_variant	22895	exon6			GAACGTGGCTGGA	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.270G>A	chr12.hg19:g.113303258G>A		113.0	0.0		97.0	40.0	NM_001143854	B7Z3C3|Q96AE0	Silent	SNP	ENST00000389385.4	hg19	CCDS44979.1																																																																																			.	.		0.532	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
DNAH10	196385	hgsc.bcm.edu	37	12	124343733	124343733	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr12:124343733A>T	ENST00000409039.3	+	37	6338	c.6313A>T	c.(6313-6315)Acc>Tcc	p.T2105S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2105	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GACCATGTTAACCCGCCACAC	0.512																																					p.T2105S		Atlas-SNP	.											.	DNAH10	888	.	0			c.A6313T						.						34.0	36.0	36.0					12																	124343733		1895	4114	6009	SO:0001583	missense	196385	exon37			ATGTTAACCCGCC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6313A>T	chr12.hg19:g.124343733A>T	ENSP00000386770:p.Thr2105Ser	63.0	0.0		127.0	12.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	21.6	4.166405	0.78339	.	.	ENSG00000197653	ENST00000409039	T	0.38722	1.12	5.4	4.25	0.50352	ATPase, AAA+ type, core (1);	0.000000	0.64402	U	0.000005	T	0.54870	0.1885	M	0.65677	2.01	0.44207	D	0.997035	D	0.56035	0.974	P	0.57911	0.829	T	0.53683	-0.8404	10	0.44086	T	0.13	.	11.1109	0.48232	0.9275:0.0:0.0725:0.0	.	2105	Q8IVF4	DYH10_HUMAN	S	2105	ENSP00000386770:T2105S	ENSP00000386770:T2105S	T	+	1	0	DNAH10	122909686	1.000000	0.71417	0.292000	0.24919	0.885000	0.51271	9.238000	0.95380	0.894000	0.36317	0.456000	0.33151	ACC	.	.		0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
FOXG1	2290	hgsc.bcm.edu	37	14	29237712	29237712	+	Silent	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr14:29237712G>A	ENST00000313071.4	+	1	1426	c.1227G>A	c.(1225-1227)ctG>ctA	p.L409L	FOXG1_ENST00000382535.3_Silent_p.L409L	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	409					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CCGTCAACCTGCTCGCGGGCC	0.687																																					p.L409L		Atlas-SNP	.											FOXG1,caecum,carcinoma,0,1	FOXG1	92	.	0			c.G1227A						.						50.0	41.0	44.0					14																	29237712		2203	4300	6503	SO:0001819	synonymous_variant	2290	exon1			CAACCTGCTCGCG		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1227G>A	chr14.hg19:g.29237712G>A		95.0	0.0		88.0	32.0	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	hg19	CCDS9636.1																																																																																			.	.		0.687	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
PSMC6	5706	hgsc.bcm.edu	37	14	53194276	53194276	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr14:53194276G>T	ENST00000606149.1	+	14	1127	c.1111G>T	c.(1111-1113)Gtc>Ttc	p.V371F	PSMC6_ENST00000445930.2_Missense_Mutation_p.V385F|STYX_ENST00000442123.2_5'Flank|PSMC6_ENST00000557557.1_3'UTR|STYX_ENST00000354586.4_5'Flank	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	371					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					CATGAAAGCAGTCAGAAAAGT	0.373																																					p.V385F		Atlas-SNP	.											.	PSMC6	71	.	0			c.G1153T						.						71.0	70.0	70.0					14																	53194276		2203	4300	6503	SO:0001583	missense	5706	exon14			AAAGCAGTCAGAA		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.1111G>T	chr14.hg19:g.53194276G>T	ENSP00000475721:p.Val371Phe	136.0	0.0		100.0	68.0	NM_002806	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	ENST00000606149.1	hg19		.	.	.	.	.	.	.	.	.	.	G	26.8	4.767923	0.90020	.	.	ENSG00000100519	ENST00000445930	D	0.94966	-3.57	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.96128	0.8738	L	0.53617	1.68	0.80722	D	1	D	0.61080	0.989	P	0.61800	0.894	D	0.96450	0.9333	10	0.87932	D	0	.	19.3235	0.94252	0.0:0.0:1.0:0.0	.	371	P62333	PRS10_HUMAN	F	385	ENSP00000401802:V385F	ENSP00000401802:V385F	V	+	1	0	PSMC6	52264026	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.385000	0.97223	2.627000	0.88993	0.650000	0.86243	GTC	.	.		0.373	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1	NM_002806	
KCNH5	27133	hgsc.bcm.edu	37	14	63483654	63483654	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr14:63483654C>T	ENST00000322893.7	-	2	360	c.92G>A	c.(91-93)gGa>gAa	p.G31E	KCNH5_ENST00000420622.2_Missense_Mutation_p.G31E|KCNH5_ENST00000394964.2_5'UTR|KCNH5_ENST00000394968.1_5'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	31	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CTGGGCATTTCCCAGTAAGAA	0.368																																					p.G31E		Atlas-SNP	.											.	KCNH5	320	.	0			c.G92A						.						86.0	81.0	82.0					14																	63483654		2203	4299	6502	SO:0001583	missense	27133	exon2			GCATTTCCCAGTA	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.92G>A	chr14.hg19:g.63483654C>T	ENSP00000321427:p.Gly31Glu	91.0	0.0		46.0	37.0	NM_172375	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	hg19	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860679	0.91433	.	.	ENSG00000140015	ENST00000322893;ENST00000420622	D;D	0.99032	-5.35;-5.13	5.29	5.29	0.74685	PAS (1);	0.000000	0.85682	D	0.000000	D	0.99184	0.9717	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.81914	0.875;0.995	D	0.99863	1.1086	10	0.87932	D	0	.	18.928	0.92553	0.0:1.0:0.0:0.0	.	31;31	Q8NCM2-2;Q8NCM2	.;KCNH5_HUMAN	E	31	ENSP00000321427:G31E;ENSP00000395439:G31E	ENSP00000321427:G31E	G	-	2	0	KCNH5	62553407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.482000	0.83794	0.591000	0.81541	GGA	.	.		0.368	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
TECPR2	9895	hgsc.bcm.edu	37	14	102918935	102918935	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr14:102918935A>G	ENST00000359520.7	+	16	3837	c.3611A>G	c.(3610-3612)cAc>cGc	p.H1204R	TECPR2_ENST00000558678.1_Missense_Mutation_p.H1204R	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1204					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						ACGGGCATGCACTGGACCAGG	0.652																																					p.H1204R		Atlas-SNP	.											.	TECPR2	114	.	0			c.A3611G						.						16.0	13.0	14.0					14																	102918935		2194	4287	6481	SO:0001583	missense	9895	exon16			GCATGCACTGGAC	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.3611A>G	chr14.hg19:g.102918935A>G	ENSP00000352510:p.His1204Arg	113.0	0.0		55.0	37.0	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	hg19	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.459539	0.84317	.	.	ENSG00000196663	ENST00000359520	T	0.14516	2.5	5.83	5.83	0.93111	.	0.052058	0.85682	D	0.000000	T	0.21801	0.0525	N	0.17082	0.46	0.58432	D	0.999998	D;D;D	0.71674	0.996;0.996;0.998	D;D;D	0.67548	0.924;0.93;0.952	T	0.06092	-1.0846	10	0.37606	T	0.19	.	16.2009	0.82078	1.0:0.0:0.0:0.0	.	387;1204;1204	B4DSD3;A5PKY3;O15040	.;.;TCPR2_HUMAN	R	1204	ENSP00000352510:H1204R	ENSP00000352510:H1204R	H	+	2	0	TECPR2	101988688	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.879000	0.92398	2.235000	0.73313	0.533000	0.62120	CAC	.	.		0.652	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
SPTBN5	51332	hgsc.bcm.edu	37	15	42145951	42145951	+	Missense_Mutation	SNP	C	C	T	rs548461931	byFrequency	TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr15:42145951C>T	ENST00000320955.6	-	58	10036	c.9809G>A	c.(9808-9810)cGg>cAg	p.R3270Q	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3270					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CGTCTGTAGCCGTGCCACCTC	0.657													C|||	2	0.000399361	0.0	0.0	5008	,	,		17352	0.0		0.0	False		,,,				2504	0.002				p.R3235Q		Atlas-SNP	.											SPTBN5,colon,carcinoma,0,1	SPTBN5	171	.	0			c.G9704A						.						28.0	32.0	31.0					15																	42145951		2034	4164	6198	SO:0001583	missense	51332	exon58			TGTAGCCGTGCCA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.9809G>A	chr15.hg19:g.42145951C>T	ENSP00000317790:p.Arg3270Gln	30.0	0.0		32.0	16.0	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	hg19		.	.	.	.	.	.	.	.	.	.	.	13.84	2.356035	0.41700	.	.	ENSG00000137877	ENST00000320955	T	0.47528	0.84	4.5	-1.04	0.10068	.	0.218004	0.27482	N	0.019171	T	0.24812	0.0602	N	0.16790	0.44	0.09310	N	1	B	0.33000	0.393	B	0.27608	0.081	T	0.10291	-1.0636	10	0.52906	T	0.07	.	8.3695	0.32406	0.0:0.5803:0.0:0.4197	.	3270	Q9NRC6	SPTN5_HUMAN	Q	3270	ENSP00000317790:R3270Q	ENSP00000317790:R3270Q	R	-	2	0	SPTBN5	39933243	0.000000	0.05858	0.000000	0.03702	0.292000	0.27327	-0.719000	0.04974	-0.426000	0.07360	0.313000	0.20887	CGG	.	.		0.657	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
ABCA3	21	hgsc.bcm.edu	37	16	2336731	2336731	+	Missense_Mutation	SNP	C	C	T	rs565777051		TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr16:2336731C>T	ENST00000301732.5	-	22	3942	c.3242G>A	c.(3241-3243)cGg>cAg	p.R1081Q	ABCA3_ENST00000382381.3_Missense_Mutation_p.R1023Q	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1081					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CAGGGCGCTCCGGGGCTGGGG	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18733	0.0		0.0	False		,,,				2504	0.0				p.R1081Q		Atlas-SNP	.											.	ABCA3	176	.	0			c.G3242A						.						76.0	81.0	80.0					16																	2336731		2198	4300	6498	SO:0001583	missense	21	exon22			GCGCTCCGGGGCT	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.3242G>A	chr16.hg19:g.2336731C>T	ENSP00000301732:p.Arg1081Gln	68.0	0.0		138.0	28.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	hg19	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045894	0.36085	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.86956	-2.19	4.26	4.26	0.50523	.	0.059441	0.64402	N	0.000003	T	0.77980	0.4212	L	0.34521	1.04	0.80722	D	1	P;B	0.35628	0.513;0.02	B;B	0.26416	0.069;0.017	T	0.76383	-0.2979	10	0.18276	T	0.48	.	15.8306	0.78745	0.0:1.0:0.0:0.0	.	1085;1081	Q4LE27;Q99758	.;ABCA3_HUMAN	Q	1081;1085	ENSP00000301732:R1081Q	ENSP00000301732:R1081Q	R	-	2	0	ABCA3	2276732	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.260000	0.78391	2.388000	0.81334	0.555000	0.69702	CGG	.	.		0.652	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
SRRM2	23524	hgsc.bcm.edu	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	SRRM2_ENST00000574593.1_3'UTR|AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																					p.S2625S		Atlas-SNP	.											.	SRRM2	263	.	0			c.C7875T						.						141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon12			CTCCTCCTCTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	chr16.hg19:g.2819139C>T		54.0	0.0		108.0	7.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	hg19	CCDS32373.1																																																																																			.	.		0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
RBL2	5934	hgsc.bcm.edu	37	16	53488620	53488620	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr16:53488620G>C	ENST00000262133.6	+	8	1182	c.1045G>C	c.(1045-1047)Gat>Cat	p.D349H	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Missense_Mutation_p.D133H	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	349					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGGGAATTTAGATGAGCGGAT	0.428																																					p.D349H		Atlas-SNP	.											.	RBL2	115	.	0			c.G1045C						.						137.0	134.0	135.0					16																	53488620		2198	4300	6498	SO:0001583	missense	5934	exon8			AATTTAGATGAGC	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1045G>C	chr16.hg19:g.53488620G>C	ENSP00000262133:p.Asp349His	98.0	0.0		69.0	62.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	hg19	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837443	0.50951	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000379935;ENST00000544545	D;D;D	0.98313	-4.86;-4.23;-3.57	5.5	4.55	0.56014	.	0.048907	0.85682	D	0.000000	D	0.98957	0.9645	M	0.87827	2.91	0.58432	D	0.999997	D;D;D;D	0.89917	0.991;1.0;1.0;1.0	P;D;D;D	0.97110	0.707;0.999;1.0;0.998	D	0.99612	1.0981	10	0.87932	D	0	-20.3931	14.4673	0.67492	0.071:0.0:0.929:0.0	.	133;349;59;349	B7Z913;Q8NE70;E9PG04;Q08999	.;.;.;RBL2_HUMAN	H	349;275;59;133	ENSP00000262133:D349H;ENSP00000443744:D275H;ENSP00000444685:D133H	ENSP00000262133:D349H	D	+	1	0	RBL2	52046121	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	9.636000	0.98440	1.324000	0.45282	-0.300000	0.09419	GAT	.	.		0.428	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
TP53	7157	hgsc.bcm.edu	37	17	7578554	7578554	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr17:7578554A>T	ENST00000269305.4	-	5	565	c.376T>A	c.(376-378)Tac>Aac	p.Y126N	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site_p.Y126N|TP53_ENST00000413465.2_Splice_Site_p.Y126N|TP53_ENST00000359597.4_Splice_Site_p.Y126N|TP53_ENST00000445888.2_Splice_Site_p.Y126N|TP53_ENST00000420246.2_Splice_Site_p.Y126N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	126	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y126D(9)|p.0?(8)|p.Y126N(6)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.Y33D(2)|p.V73fs*9(1)|p.?(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGGGAGTACTGTAGGAAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y126N	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,1	TP53	33396	.	40	Substitution - Missense(17)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(4)|Insertion - In frame(1)|Unknown(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(6)|upper_aerodigestive_tract(4)|large_intestine(4)|lung(4)|prostate(4)|bone(4)|breast(3)|ovary(2)|stomach(1)|liver(1)|oesophagus(1)	c.T376A	GRCh37	CI004819	TP53	I		.						42.0	43.0	43.0					17																	7578554		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGGAGTACTGTAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1T>A	chr17.hg19:g.7578554A>T		54.0	0.0		51.0	47.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.639687	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.961;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-28.2517	13.8301	0.63375	1.0:0.0:0.0:0.0	.	87;126;126;33;126;126;126	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	126;126;126;126;126;126;115;33;33;126;126	ENSP00000410739:Y126N;ENSP00000352610:Y126N;ENSP00000269305:Y126N;ENSP00000398846:Y126N;ENSP00000391127:Y126N;ENSP00000391478:Y126N;ENSP00000423862:Y33N;ENSP00000424104:Y126N;ENSP00000426252:Y126N	ENSP00000269305:Y126N	Y	-	1	0	TP53	7519279	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.240000	0.95396	2.206000	0.71126	0.533000	0.62120	TAC	.	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Missense_Mutation
MPRIP	23164	hgsc.bcm.edu	37	17	17061859	17061859	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr17:17061859G>A	ENST00000341712.4	+	14	1589	c.1589G>A	c.(1588-1590)cGc>cAc	p.R530H	MPRIP_ENST00000395804.3_Missense_Mutation_p.R530H|MPRIP_ENST00000395811.5_Missense_Mutation_p.R530H|MPRIP_ENST00000444976.1_Missense_Mutation_p.R492H			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	530						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AAGAGGAGCCGCGCACGGGAG	0.647																																					p.R530H		Atlas-SNP	.											.	MPRIP	87	.	0			c.G1589A						.						16.0	19.0	18.0					17																	17061859		2201	4294	6495	SO:0001583	missense	23164	exon14			GGAGCCGCGCACG	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.1589G>A	chr17.hg19:g.17061859G>A	ENSP00000342379:p.Arg530His	100.0	0.0		114.0	66.0	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	hg19	CCDS32578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.57|18.57	3.651700|3.651700	0.67472|0.67472	.|.	.|.	ENSG00000133030|ENSG00000133030	ENST00000423885|ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	.|T;T;T;T	.|0.29917	.|1.55;1.87;1.86;1.86	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|.	.|.	.|.	.|.	T|T	0.36635|0.36635	0.0974|0.0974	M|M	0.80183|0.80183	2.485|2.485	0.58432|0.58432	D|D	0.999998|0.999998	.|P;P	.|0.48998	.|0.796;0.918	.|B;B	.|0.33042	.|0.119;0.157	T|T	0.53542|0.53542	-0.8424|-0.8424	5|9	.|0.87932	.|D	.|0	.|.	19.6557|19.6557	0.95837|0.95837	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|530;530	.|Q6WCQ1-2;Q6WCQ1	.|.;MPRIP_HUMAN	T|H	17|492;530;530;530	.|ENSP00000400189:R492H;ENSP00000379156:R530H;ENSP00000379149:R530H;ENSP00000342379:R530H	.|ENSP00000342379:R530H	A|R	+|+	1|2	0|0	MPRIP|MPRIP	17002584|17002584	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.554000|0.554000	0.35429|0.35429	9.134000|9.134000	0.94467|0.94467	2.657000|2.657000	0.90304|0.90304	0.563000|0.563000	0.77884|0.77884	GCG|CGC	.	.		0.647	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324355	39324355	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr17:39324355A>T	ENST00000391356.2	-	1	69	c.70T>A	c.(70-72)Tgc>Agc	p.C24S		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	24					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGGCGGCAGCAGCTCTCCTGG	0.637																																					p.C24S		Atlas-SNP	.											.	KRTAP4-3	40	.	0			c.T70A						.						27.0	31.0	30.0					17																	39324355		2196	4298	6494	SO:0001583	missense	85290	exon1			GGCAGCAGCTCTC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.70T>A	chr17.hg19:g.39324355A>T	ENSP00000375151:p.Cys24Ser	117.0	0.0		160.0	17.0	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	hg19	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	12.63	1.996334	0.35226	.	.	ENSG00000196156	ENST00000391356	T	0.04406	3.63	5.15	5.15	0.70609	.	.	.	.	.	T	0.22627	0.0546	M	0.82323	2.585	0.43703	D	0.996168	D	0.89917	1.0	D	0.83275	0.996	T	0.00724	-1.1593	9	0.49607	T	0.09	.	13.2133	0.59839	1.0:0.0:0.0:0.0	.	24	Q9BYR4	KRA43_HUMAN	S	24	ENSP00000375151:C24S	ENSP00000375151:C24S	C	-	1	0	KRTAP4-3	36577881	0.767000	0.28508	0.753000	0.31225	0.100000	0.18952	1.312000	0.33574	2.039000	0.60335	0.533000	0.62120	TGC	.	.		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
EFCAB13	124989	hgsc.bcm.edu	37	17	45507195	45507195	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr17:45507195C>G	ENST00000331493.2	+	24	2917	c.2506C>G	c.(2506-2508)Ctc>Gtc	p.L836V	EFCAB13_ENST00000517484.1_Missense_Mutation_p.L740V	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	836						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										TACACAGATACTCTTAGCTAC	0.373																																					p.L836V		Atlas-SNP	.											.	.	.	.	0			c.C2506G						.						188.0	172.0	177.0					17																	45507195		2203	4300	6503	SO:0001583	missense	124989	exon24			CAGATACTCTTAG	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.2506C>G	chr17.hg19:g.45507195C>G	ENSP00000332111:p.Leu836Val	87.0	0.0		108.0	9.0	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	hg19	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	.	9.430	1.085247	0.20390	.	.	ENSG00000178852	ENST00000331493;ENST00000517484	T;D	0.81908	1.73;-1.55	2.56	1.59	0.23543	.	1.021530	0.07849	N	0.964366	T	0.70684	0.3252	L	0.27053	0.805	0.24730	N	0.9931	P;P	0.50156	0.932;0.865	B;B	0.42112	0.3;0.376	T	0.59500	-0.7443	10	0.23302	T	0.38	-2.6706	5.3245	0.15898	0.0:0.836:0.0:0.164	.	836;740	Q8IY85;G3V128	CQ057_HUMAN;.	V	836;740	ENSP00000332111:L836V;ENSP00000430048:L740V	ENSP00000332111:L836V	L	+	1	0	C17orf57	42862194	0.999000	0.42202	0.890000	0.34922	0.253000	0.25986	0.694000	0.25512	0.663000	0.31027	0.187000	0.17357	CTC	.	.		0.373	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
BSG	682	hgsc.bcm.edu	37	19	580781	580781	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr19:580781A>G	ENST00000333511.3	+	5	861	c.791A>G	c.(790-792)aAg>aGg	p.K264R	BSG_ENST00000353555.4_Splice_Site_p.K148R|BSG_ENST00000346916.4_Splice_Site_p.K84R|BSG_ENST00000545507.2_Splice_Site_p.K55R	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)	264	Ig-like V-type.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGAGGACAAGGTGAGAAGC	0.627																																					p.K264R		Atlas-SNP	.											.	BSG	48	.	0			c.A791G						.						48.0	49.0	49.0					19																	580781		2200	4299	6499	SO:0001630	splice_region_variant	682	exon5			AGGACAAGGTGAG	L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613		ENST00000333511.3:c.792+1A>G	chr19.hg19:g.580781A>G		64.0	0.0		94.0	6.0	NM_001728	A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Missense_Mutation	SNP	ENST00000333511.3	hg19	CCDS12033.1	.	.	.	.	.	.	.	.	.	.	A	11.50	1.656638	0.29425	.	.	ENSG00000172270	ENST00000346916;ENST00000545507;ENST00000333511;ENST00000353555	T;T;T	0.67523	-0.27;-0.27;-0.27	3.6	3.6	0.41247	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.720750	0.01835	N	0.034952	T	0.45577	0.1349	N	0.02765	-0.5	0.18873	N	0.999986	B;B;B;B;B	0.15719	0.005;0.014;0.006;0.014;0.0	B;B;B;B;B	0.15052	0.007;0.012;0.012;0.012;0.0	T	0.37174	-0.9717	10	0.16420	T	0.52	-25.4539	10.4328	0.44417	1.0:0.0:0.0:0.0	.	148;264;148;264;84	P35613-2;B4DNE1;Q54A51;P35613;A6NJW1	.;.;.;BASI_HUMAN;.	R	84;55;264;148	ENSP00000344707:K84R;ENSP00000333769:K264R;ENSP00000343809:K148R	ENSP00000333769:K264R	K	+	2	0	BSG	531781	0.450000	0.25697	0.418000	0.26571	0.087000	0.18053	1.155000	0.31700	1.409000	0.46915	0.379000	0.24179	AAG	.	.		0.627	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438630.2	NM_001728	Missense_Mutation
C19orf26	255057	hgsc.bcm.edu	37	19	1235018	1235018	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr19:1235018G>A	ENST00000382477.2	-	5	693	c.419C>T	c.(418-420)aCg>aTg	p.T140M	C19orf26_ENST00000590083.1_Missense_Mutation_p.T146M|C19orf26_ENST00000215376.6_Missense_Mutation_p.T140M			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	140						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGTCCTGCGTCTTGCGGCT	0.701										HNSCC(14;0.022)																											p.T146M		Atlas-SNP	.											.	C19orf26	31	.	0			c.C437T						.						22.0	25.0	24.0					19																	1235018		2196	4296	6492	SO:0001583	missense	255057	exon5			TCCTGCGTCTTGC	BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.419C>T	chr19.hg19:g.1235018G>A	ENSP00000371917:p.Thr140Met	73.0	0.0		84.0	35.0	NM_152769	O43385	Missense_Mutation	SNP	ENST00000382477.2	hg19		.	.	.	.	.	.	.	.	.	.	G	13.67	2.306661	0.40795	.	.	ENSG00000099625	ENST00000382477;ENST00000215376	.	.	.	3.64	3.64	0.41730	.	0.659654	0.14689	N	0.304255	T	0.19685	0.0473	N	0.19112	0.55	0.22446	N	0.999095	P	0.50710	0.938	B	0.41723	0.365	T	0.07462	-1.0771	9	0.72032	D	0.01	.	8.4625	0.32936	0.1115:0.0:0.8885:0.0	.	140	Q8N350-2	.	M	140	.	ENSP00000215376:T140M	T	-	2	0	C19orf26	1186018	0.997000	0.39634	0.107000	0.21349	0.095000	0.18619	4.848000	0.62874	2.026000	0.59711	0.561000	0.74099	ACG	.	.		0.701	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_152769	
SIGLEC10	89790	hgsc.bcm.edu	37	19	51920435	51920435	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr19:51920435C>T	ENST00000339313.5	-	2	438	c.322G>A	c.(322-324)Gcg>Acg	p.A108T	SIGLEC10_ENST00000432469.2_Missense_Mutation_p.A108T|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.A108T|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.A108T|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.A108T|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.A108T|CTD-2616J11.2_ENST00000532688.1_RNA|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.A108T|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.A108T|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.A108T			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	108	Ig-like V-type.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		TGCATCTGCGCGTCTCTGATC	0.517																																					p.A108T		Atlas-SNP	.											.	SIGLEC10	112	.	0			c.G322A						.						69.0	69.0	69.0					19																	51920435		2203	4300	6503	SO:0001583	missense	89790	exon2			TCTGCGCGTCTCT	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.322G>A	chr19.hg19:g.51920435C>T	ENSP00000345243:p.Ala108Thr	126.0	0.0		148.0	57.0	NM_001171161	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	hg19	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	19.60	3.857497	0.71834	.	.	ENSG00000142512	ENST00000353836;ENST00000432469;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313;ENST00000530476	T;T;T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	4.92	4.92	0.64577	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.610455	0.15571	N	0.255453	T	0.78046	0.4222	M	0.80422	2.495	0.09310	N	1	D;D;D;P;D;D;D	0.89917	0.99;0.999;0.999;0.873;1.0;0.998;0.995	P;D;P;B;D;P;D	0.69142	0.831;0.962;0.872;0.319;0.928;0.823;0.961	T	0.68938	-0.5277	10	0.32370	T	0.25	.	13.6027	0.62029	0.0:1.0:0.0:0.0	.	108;108;108;108;108;108;108	C9JM10;E9PL79;C9JJ33;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;SIG10_HUMAN	T	108;108;108;108;108;108;108;108;108;75	ENSP00000342389:A108T;ENSP00000396742:A108T;ENSP00000395475:A108T;ENSP00000348646:A108T;ENSP00000408387:A108T;ENSP00000431444:A108T;ENSP00000389132:A108T;ENSP00000414324:A108T;ENSP00000345243:A108T;ENSP00000433838:A75T	ENSP00000345243:A108T	A	-	1	0	SIGLEC10	56612247	0.005000	0.15991	0.008000	0.14137	0.012000	0.07955	2.222000	0.42926	2.272000	0.75746	0.313000	0.20887	GCG	.	.		0.517	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
MT-ND5	4540	hgsc.bcm.edu	37	M	12496	12496	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chrM:12496T>C	ENST00000361567.2	+	1	160	c.160T>C	c.(160-162)Ttc>Ctc	p.F54L	MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	54					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCACAACAATATTCATGTGCC	0.418																																					p.F54L		Atlas-SNP	.											.	.	.	.	0			c.T160C						.																																			SO:0001583	missense	0	exon1			ACAATATTCATGT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.160T>C	chrM.hg19:g.12496T>C	ENSP00000354813:p.Phe54Leu	10.0	0.0		14.0	4.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.418	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
GORAB	92344	hgsc.bcm.edu	37	1	170511631	170511636	+	Splice_Site	DEL	GGCAAG	GGCAAG	-			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	GGCAAG	GGCAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr1:170511631_170511636delGGCAAG	ENST00000367763.3	+	3	514_519	c.494_499delGGCAAG	c.(493-501)tggcaagaa>taa	p.165_167WQE>*	GORAB_ENST00000367762.1_Splice_Site_p.165_167WQE>*	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	165						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						TTGCCCCCTAGGCAAGAAAAATCTCG	0.369																																					p.165_166del		Atlas-INDEL	.											.	GORAB	41	.	0			c.495_498del						.																																			SO:0001630	splice_region_variant	92344	exon3			.	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.495-1GGCAAG>-	chr1.hg19:g.170511631_170511636delGGCAAG		244.0	0.0		524.0	68.0	NM_152281	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Frame_Shift_Del	DEL	ENST00000367763.3	hg19	CCDS1289.1																																																																																			.	.		0.369	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	In_Frame_Del
GEMIN2	8487	hgsc.bcm.edu	37	14	39601242	39601244	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-DD-AACS-01A-11D-A40R-10	TCGA-DD-AACS-10A-01D-A40U-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8d9f3207-beef-4207-90c3-219a58374551	957b73a6-e2d4-4b9b-b4c1-b4a9baa467c7	g.chr14:39601242_39601244delAAG	ENST00000308317.6	+	8	797_799	c.714_716delAAG	c.(712-717)gcaaga>gca	p.R240del	GEMIN2_ENST00000250379.8_In_Frame_Del_p.R225del|GEMIN2_ENST00000396249.2_In_Frame_Del_p.R240del	NM_003616.2	NP_003607.1	O14893	GEMI2_HUMAN	gem (nuclear organelle) associated protein 2	240					gene expression (GO:0010467)|mRNA processing (GO:0006397)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)											GGCAGCTTGCAAGAAGGTGCTCT	0.384																																					p.238_239del		Atlas-INDEL	.											.	.	.	.	0			c.713_715del						.																																			SO:0001651	inframe_deletion	8487	exon8			.	AF027150	CCDS9669.1, CCDS32068.1, CCDS41946.1	14q21.1	2011-08-04	2011-08-04	2011-08-04	ENSG00000092208	ENSG00000092208			10884	protein-coding gene	gene with protein product		602595	"""survival of motor neuron protein interacting protein 1"""	SIP1		9323130, 9323129, 11121410	Standard	NM_003616		Approved		uc001wuq.3	O14893	OTTHUMG00000028816	ENST00000308317.6:c.714_716delAAG	chr14.hg19:g.39601245_39601247delAAG	ENSP00000308533:p.Arg240del	46.0	0.0		48.0	17.0	NM_003616	B2R9W8|Q2M3B3|Q9H4F5|Q9NS77|Q9NS78|Q9NS79	In_Frame_Del	DEL	ENST00000308317.6	hg19	CCDS9669.1																																																																																			.	.		0.384	GEMIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276730.2		
