#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPA2	6118	hgsc.bcm.edu	37	1	28224153	28224153	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:28224153T>A	ENST00000373912.3	-	5	698	c.399A>T	c.(397-399)agA>agT	p.R133S	RPA2_ENST00000373909.3_Missense_Mutation_p.R141S|RPA2_ENST00000313433.7_Missense_Mutation_p.R221S	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa	133	Arg/Lys-rich (basic).				base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGAAAAGATCTCAGGTGGC	0.343								Direct reversal of damage;Nucleotide excision repair (NER)																													p.R133S		Atlas-SNP	.											.	RPA2	34	.	0			c.A399T						.						69.0	73.0	72.0					1																	28224153		2203	4300	6503	SO:0001583	missense	6118	exon5			AAAAGATCTCAGG	BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.399A>T	chr1.hg19:g.28224153T>A	ENSP00000363021:p.Arg133Ser	168.0	0.0		140.0	54.0	NM_002946	Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	ENST00000373912.3	hg19	CCDS314.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109663	0.77096	.	.	ENSG00000117748	ENST00000373912;ENST00000373909;ENST00000313433;ENST00000444045	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.0	-3.89	0.04193	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.000000	0.85682	D	0.000000	T	0.28962	0.0719	L	0.55017	1.72	0.48632	D	0.999684	D;D	0.71674	0.998;0.994	D;P	0.72625	0.978;0.842	T	0.22312	-1.0220	10	0.66056	D	0.02	-15.9008	4.367	0.11228	0.1132:0.4816:0.1148:0.2903	.	133;141	P15927;P15927-2	RFA2_HUMAN;.	S	133;141;221;137	ENSP00000363021:R133S;ENSP00000363017:R141S;ENSP00000363015:R221S;ENSP00000387649:R137S	ENSP00000363015:R221S	R	-	3	2	RPA2	28096740	0.347000	0.24853	0.992000	0.48379	0.997000	0.91878	-0.641000	0.05434	-0.281000	0.09141	0.454000	0.30748	AGA	.	.		0.343	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011179.1	NM_002946	
PHC2	1912	hgsc.bcm.edu	37	1	33832762	33832762	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:33832762T>G	ENST00000257118.5	-	6	984	c.931A>C	c.(931-933)Agc>Cgc	p.S311R	PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Missense_Mutation_p.S282R|PHC2_ENST00000419414.2_Missense_Mutation_p.S311R	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	311					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ACCGTCCGGCTGAGCCCAGCC	0.592																																					p.S311R		Atlas-SNP	.											.	PHC2	78	.	0			c.A931C						.						80.0	80.0	80.0					1																	33832762		2203	4300	6503	SO:0001583	missense	1912	exon6			TCCGGCTGAGCCC	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.931A>C	chr1.hg19:g.33832762T>G	ENSP00000257118:p.Ser311Arg	99.0	0.0		92.0	31.0	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	hg19	CCDS378.1	.	.	.	.	.	.	.	.	.	.	T	12.56	1.973168	0.34848	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	T;T;T	0.33216	1.79;1.42;1.83	5.88	-2.99	0.05497	.	0.525534	0.22971	N	0.053421	T	0.18341	0.0440	L	0.46157	1.445	0.52501	D	0.999954	P;B;B	0.37955	0.612;0.412;0.167	B;B;B	0.28553	0.091;0.091;0.057	T	0.17592	-1.0364	10	0.15499	T	0.54	0.0168	12.9202	0.58228	0.0:0.6588:0.0:0.3412	.	311;282;311	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	R	282;311;311	ENSP00000389436:S282R;ENSP00000257118:S311R;ENSP00000391440:S311R	ENSP00000257118:S311R	S	-	1	0	PHC2	33605349	0.987000	0.35691	0.561000	0.28357	0.916000	0.54674	0.454000	0.21827	-0.575000	0.05982	-0.256000	0.11100	AGC	.	.		0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
NCDN	23154	hgsc.bcm.edu	37	1	36026670	36026670	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:36026670C>G	ENST00000373243.2	+	3	1301	c.918C>G	c.(916-918)ttC>ttG	p.F306L	NCDN_ENST00000356090.4_Missense_Mutation_p.F306L|NCDN_ENST00000373253.3_Missense_Mutation_p.F289L	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	306					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGAGCAAGTTCCTGGCCCTGC	0.677																																					p.F306L		Atlas-SNP	.											.	NCDN	79	.	0			c.C918G						.						28.0	27.0	27.0					1																	36026670		2203	4294	6497	SO:0001583	missense	23154	exon3			CAAGTTCCTGGCC	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.918C>G	chr1.hg19:g.36026670C>G	ENSP00000362340:p.Phe306Leu	71.0	0.0		76.0	24.0	NM_014284	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Missense_Mutation	SNP	ENST00000373243.2	hg19	CCDS392.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969056	0.74131	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243	T;T;T	0.68479	-0.33;-0.33;-0.33	4.76	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	L	0.61218	1.895	0.80722	D	1	D	0.71674	0.998	D	0.67103	0.949	T	0.74575	-0.3620	10	0.48119	T	0.1	.	9.6584	0.39941	0.0:0.8795:0.0:0.1205	.	306	Q9UBB6	NCDN_HUMAN	L	289;306;306	ENSP00000362350:F289L;ENSP00000348394:F306L;ENSP00000362340:F306L	ENSP00000348394:F306L	F	+	3	2	NCDN	35799257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.349000	0.66010	1.025000	0.39708	0.561000	0.74099	TTC	.	.		0.677	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
C8A	731	hgsc.bcm.edu	37	1	57340763	57340763	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:57340763A>G	ENST00000361249.3	+	3	409	c.313A>G	c.(313-315)Aca>Gca	p.T105A		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	105	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GTGTAAGGAGACAGGTGAGTA	0.478																																					p.T105A		Atlas-SNP	.											.	C8A	103	.	0			c.A313G						.						77.0	69.0	72.0					1																	57340763		2203	4300	6503	SO:0001583	missense	731	exon3			AAGGAGACAGGTG	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.313A>G	chr1.hg19:g.57340763A>G	ENSP00000354458:p.Thr105Ala	68.0	0.0		73.0	36.0	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	hg19	CCDS606.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085720	0.55861	.	.	ENSG00000157131	ENST00000361249	D	0.95377	-3.69	5.22	2.74	0.32292	.	0.266945	0.43747	D	0.000537	D	0.93141	0.7816	L	0.55213	1.73	0.35610	D	0.808619	P	0.41978	0.767	B	0.42245	0.381	D	0.93964	0.7243	10	0.66056	D	0.02	-12.4741	10.1722	0.42917	0.721:0.0:0.0:0.279	.	105	P07357	CO8A_HUMAN	A	105	ENSP00000354458:T105A	ENSP00000354458:T105A	T	+	1	0	C8A	57113351	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.798000	0.47884	0.986000	0.38683	0.528000	0.53228	ACA	.	.		0.478	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
ZZZ3	26009	hgsc.bcm.edu	37	1	78098130	78098130	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:78098130A>G	ENST00000370801.3	-	5	1385	c.910T>C	c.(910-912)Ttt>Ctt	p.F304L	ZZZ3_ENST00000370798.1_Intron|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	304					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						GTTTCAGAAAAGGGCCCTGTA	0.453																																					p.F304L		Atlas-SNP	.											.	ZZZ3	80	.	0			c.T910C						.						109.0	106.0	107.0					1																	78098130		2203	4300	6503	SO:0001583	missense	26009	exon5			CAGAAAAGGGCCC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.910T>C	chr1.hg19:g.78098130A>G	ENSP00000359837:p.Phe304Leu	86.0	0.0		64.0	26.0	NM_015534	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	hg19	CCDS677.1	.	.	.	.	.	.	.	.	.	.	A	0.116	-1.132011	0.01756	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.49	-4.11	0.03928	.	0.812643	0.11566	N	0.551269	T	0.08447	0.0210	N	0.11427	0.14	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.28744	-1.0034	8	.	.	.	.	1.2163	0.01915	0.2412:0.1735:0.1321:0.4532	.	304;304;304	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	L	304	.	.	F	-	1	0	ZZZ3	77870718	0.957000	0.32711	0.915000	0.36163	0.486000	0.33341	0.271000	0.18626	-0.711000	0.04995	-0.336000	0.08194	TTT	.	.		0.453	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	NM_015534	
ABCA4	24	hgsc.bcm.edu	37	1	94466454	94466454	+	Silent	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:94466454C>G	ENST00000370225.3	-	47	6503	c.6417G>C	c.(6415-6417)cgG>cgC	p.R2139R	ABCA4_ENST00000536513.1_Silent_p.R409R|ABCA4_ENST00000535881.1_Silent_p.R258R|ABCA4_ENST00000465352.1_5'Flank	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	2139	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> W (in STGD1). {ECO:0000269|PubMed:11527935}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGATGGCCAGCCGGGTACACA	0.577																																					p.R2139R		Atlas-SNP	.											.	ABCA4	275	.	0			c.G6417C						.						147.0	114.0	125.0					1																	94466454		2203	4300	6503	SO:0001819	synonymous_variant	24	exon47			GGCCAGCCGGGTA	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.6417G>C	chr1.hg19:g.94466454C>G		89.0	0.0		101.0	35.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	hg19	CCDS747.1																																																																																			.	.		0.577	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
TRIM46	80128	hgsc.bcm.edu	37	1	155147913	155147913	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:155147913A>C	ENST00000334634.4	+	2	115	c.115A>C	c.(115-117)Atg>Ctg	p.M39L	TRIM46_ENST00000368382.1_Missense_Mutation_p.M16L|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368383.3_Missense_Mutation_p.M39L|KRTCAP2_ENST00000490672.1_5'Flank|TRIM46_ENST00000468878.1_3'UTR|KRTCAP2_ENST00000295682.4_5'Flank|TRIM46_ENST00000545012.1_Intron|TRIM46_ENST00000543729.1_Missense_Mutation_p.M46L|TRIM46_ENST00000392451.2_Missense_Mutation_p.M39L|TRIM46_ENST00000368385.4_Missense_Mutation_p.M39L	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	39						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGTCAAGAGATGTACAAGCA	0.582																																					p.M39L		Atlas-SNP	.											.	TRIM46	79	.	0			c.A115C						.						154.0	123.0	134.0					1																	155147913		2203	4300	6503	SO:0001583	missense	80128	exon2			CAAGAGATGTACA		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.115A>C	chr1.hg19:g.155147913A>C	ENSP00000334657:p.Met39Leu	116.0	0.0		214.0	61.0	NM_025058	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	hg19	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	A	2.643	-0.283740	0.05642	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	4.44	3.21	0.36854	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, C3HC4 RING-type (1);	0.109105	0.64402	D	0.000008	T	0.32376	0.0827	N	0.00926	-1.1	0.80722	D	1	B;B;B;B;B;B	0.16396	0.009;0.008;0.017;0.011;0.008;0.009	B;B;B;B;B;B	0.17433	0.007;0.007;0.018;0.012;0.007;0.01	T	0.53027	-0.8496	10	0.02654	T	1	.	4.8439	0.13503	0.6232:0.1917:0.0:0.185	.	26;39;26;16;39;39	F5H5Z2;Q5VT61;B7Z3S2;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;.;.;TRI46_HUMAN;.	L	46;26;39;39;39;16;39	ENSP00000442719:M46L;ENSP00000357369:M39L;ENSP00000376245:M39L;ENSP00000357367:M39L;ENSP00000357366:M16L;ENSP00000334657:M39L	ENSP00000334657:M39L	M	+	1	0	TRIM46	153414537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.265000	0.43311	1.766000	0.52107	0.477000	0.44152	ATG	.	.		0.582	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058	
CD1B	910	hgsc.bcm.edu	37	1	158301196	158301196	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:158301196A>T	ENST00000368168.3	-	1	125	c.18T>A	c.(16-18)ttT>ttA	p.F6L		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	6					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					CTAACAGTTGAAATGGCAGCA	0.468																																					p.F6L		Atlas-SNP	.											.	CD1B	78	.	0			c.T18A						.						75.0	68.0	70.0					1																	158301196		2203	4300	6503	SO:0001583	missense	910	exon1			CAGTTGAAATGGC	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.18T>A	chr1.hg19:g.158301196A>T	ENSP00000357150:p.Phe6Leu	195.0	0.0		280.0	80.0	NM_001764	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	hg19	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	A	5.432	0.264859	0.10294	.	.	ENSG00000158485	ENST00000368168	T	0.01203	5.18	3.14	-2.21	0.06973	.	1.032930	0.07807	N	0.957420	T	0.00073	0.0002	N	0.00063	-2.32	0.09310	N	1	B;B	0.16802	0.019;0.0	B;B	0.19666	0.026;0.0	T	0.44143	-0.9347	10	0.02654	T	1	-3.9768	0.2938	0.00262	0.3607:0.2001:0.2445:0.1947	.	6;6	B4E0D2;P29016	.;CD1B_HUMAN	L	6	ENSP00000357150:F6L	ENSP00000357150:F6L	F	-	3	2	CD1B	156567820	0.000000	0.05858	0.001000	0.08648	0.714000	0.41099	-0.420000	0.07062	-0.486000	0.06744	0.528000	0.53228	TTT	.	.		0.468	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764	
APOBEC4	403314	hgsc.bcm.edu	37	1	183617328	183617328	+	Missense_Mutation	SNP	C	C	G	rs576114883		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:183617328C>G	ENST00000308641.4	-	2	860	c.589G>C	c.(589-591)Gtt>Ctt	p.V197L	RGL1_ENST00000536277.1_Intron|APOBEC4_ENST00000481562.1_Intron|RGL1_ENST00000304685.4_Intron	NM_203454.2	NP_982279.1	Q8WW27	ABEC4_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)	197					mRNA processing (GO:0006397)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)	p.V197F(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(6)|skin(1)	21						CTGTGGAGAACAGAATGCCAG	0.507																																					p.V197L		Atlas-SNP	.											APOBEC4,NS,carcinoma,0,1	APOBEC4	45	.	1	Substitution - Missense(1)	kidney(1)	c.G589C						.						63.0	65.0	64.0					1																	183617328		2203	4300	6503	SO:0001583	missense	403314	exon2			GGAGAACAGAATG	BC021711	CCDS1358.1	1q25.3	2008-02-05	2005-10-27	2005-10-27	ENSG00000173627	ENSG00000173627		"""Apolipoprotein B mRNA editing enzymes"""	32152	protein-coding gene	gene with protein product		609908	"""chromosome 1 open reading frame 169"""	C1orf169		16082223	Standard	NM_203454		Approved	MGC26594, FLJ25691, RP1-127C7.4	uc001gqn.3	Q8WW27	OTTHUMG00000035459	ENST00000308641.4:c.589G>C	chr1.hg19:g.183617328C>G	ENSP00000310622:p.Val197Leu	94.0	0.0		149.0	49.0	NM_203454	Q8N7F6	Missense_Mutation	SNP	ENST00000308641.4	hg19	CCDS1358.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.904261	0.00512	.	.	ENSG00000173627	ENST00000308641	T	0.61392	0.11	5.15	3.21	0.36854	.	0.242203	0.28225	N	0.016123	T	0.22742	0.0549	N	0.01352	-0.895	0.23120	N	0.998269	B	0.02656	0.0	B	0.04013	0.001	T	0.28713	-1.0035	10	0.02654	T	1	-11.8308	10.4785	0.44678	0.0:0.2662:0.5924:0.1413	.	197	Q8WW27	ABEC4_HUMAN	L	197	ENSP00000310622:V197L	ENSP00000310622:V197L	V	-	1	0	APOBEC4	181883951	1.000000	0.71417	0.995000	0.50966	0.182000	0.23217	1.341000	0.33907	0.518000	0.28383	-0.147000	0.13772	GTT	.	.		0.507	APOBEC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086126.1	NM_203454	
LGR6	59352	hgsc.bcm.edu	37	1	202163206	202163206	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:202163206C>A	ENST00000367278.3	+	1	178	c.89C>A	c.(88-90)cCg>cAg	p.P30Q		NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	30	LRRNT.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						cagcccggcccggggcccacc	0.781																																					p.P30Q		Atlas-SNP	.											.	LGR6	102	.	0			c.C89A						.						4.0	4.0	4.0					1																	202163206		1461	3215	4676	SO:0001583	missense	59352	exon1			CCGGCCCGGGGCC	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.89C>A	chr1.hg19:g.202163206C>A	ENSP00000356247:p.Pro30Gln	12.0	0.0		28.0	18.0	NM_001017403	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	hg19	CCDS30971.1	.	.	.	.	.	.	.	.	.	.	C	2.278	-0.365291	0.05103	.	.	ENSG00000133067	ENST00000367278	T	0.60797	0.16	3.86	1.82	0.25136	.	0.414870	0.20151	U	0.098147	T	0.40909	0.1136	N	0.22421	0.69	0.09310	N	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.28618	-1.0038	10	0.45353	T	0.12	.	10.7022	0.45934	0.3446:0.6554:0.0:0.0	.	30	Q9HBX8	LGR6_HUMAN	Q	30	ENSP00000356247:P30Q	ENSP00000356247:P30Q	P	+	2	0	LGR6	200429829	0.009000	0.17119	0.018000	0.16275	0.150000	0.21749	2.483000	0.45233	0.169000	0.19679	0.305000	0.20034	CCG	.	.		0.781	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
NUP133	55746	hgsc.bcm.edu	37	1	229633911	229633912	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:229633911_229633912CC>AA	ENST00000261396.3	-	6	881_882	c.790_791GG>TT	c.(790-792)GGa>TTa	p.G264L	NUP133_ENST00000537506.1_Missense_Mutation_p.G248L	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	264					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.G264*(1)		NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				AGATAAAATTCCAAAAAGAGAA	0.356																																					p.G264V|p.G264X		Atlas-SNP	.											.|NUP133,colon,carcinoma,0,1	NUP133	111	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G791T|c.G790T						.																																			SO:0001583	missense	55746	exon6			AAAATTCCAAAAA|AAATTCCAAAAAG		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.790_791delinsAA	chr1.hg19:g.229633911_229633912delinsAA	ENSP00000261396:p.Gly264Leu	113.0	0.0		163.0|164.0	46.0|47.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1																																																																																			.	.		0.356	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
CEP170	9859	hgsc.bcm.edu	37	1	243328222	243328222	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:243328222T>A	ENST00000366542.1	-	13	3091	c.3040A>T	c.(3040-3042)Aga>Tga	p.R1014*	CEP170_ENST00000366544.1_Nonsense_Mutation_p.R916*|CEP170_ENST00000366543.1_Nonsense_Mutation_p.R916*|CEP170_ENST00000490813.1_5'Flank|RP11-261C10.4_ENST00000422938.1_RNA|RP11-261C10.4_ENST00000437499.1_RNA	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	1014	Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TGTCTTATTCTCCCACTGGAC	0.403																																					p.R1014X		Atlas-SNP	.											.	CEP170	153	.	0			c.A3040T						.						154.0	137.0	142.0					1																	243328222		1903	4116	6019	SO:0001587	stop_gained	9859	exon13			TTATTCTCCCACT	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.3040A>T	chr1.hg19:g.243328222T>A	ENSP00000355500:p.Arg1014*	361.0	0.0		484.0	255.0	NM_014812	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Nonsense_Mutation	SNP	ENST00000366542.1	hg19	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	T	31	5.078262	0.94000	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543	.	.	.	4.37	3.21	0.36854	.	0.108685	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9387	10.3055	0.43678	0.0:0.0:0.166:0.834	.	.	.	.	X	1014;916;916	.	ENSP00000355500:R1014X	R	-	1	2	CEP170	241394845	1.000000	0.71417	0.977000	0.42913	0.597000	0.36814	2.064000	0.41432	0.680000	0.31366	0.454000	0.30748	AGA	.	.		0.403	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
OR2W5	441932	hgsc.bcm.edu	37	1	247655265	247655265	+	RNA	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr1:247655265A>G	ENST00000522351.1	+	0	896							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCTCTTCTACACCATCGTCAT	0.522																																					p.H279R		Atlas-SNP	.											.	OR2W5	97	.	0			c.A836G						.						121.0	109.0	113.0					1																	247655265		2203	4300	6503			441932	exon1			TTCTACACCATCG			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		chr1.hg19:g.247655265A>G		168.0	0.0		241.0	70.0	NM_001004698	B9EH85	Missense_Mutation	SNP	ENST00000522351.1	hg19																																																																																				.	.		0.522	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698	
EIF2AK2	5610	hgsc.bcm.edu	37	2	37349710	37349710	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:37349710T>C	ENST00000233057.4	-	12	1328	c.1006A>G	c.(1006-1008)Acc>Gcc	p.T336A	EIF2AK2_ENST00000405334.1_Missense_Mutation_p.T295A|EIF2AK2_ENST00000395127.2_Missense_Mutation_p.T336A	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	336	2 X 13 AA approximate repeats.|Interaction with TRAF5.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				TCATCACTGGTCTCAGGATCA	0.373																																					p.T336A		Atlas-SNP	.											.	EIF2AK2	54	.	0			c.A1006G						.						173.0	159.0	164.0					2																	37349710		2203	4300	6503	SO:0001583	missense	5610	exon12			CACTGGTCTCAGG	BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.1006A>G	chr2.hg19:g.37349710T>C	ENSP00000233057:p.Thr336Ala	74.0	0.0		111.0	49.0	NM_001135651	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Missense_Mutation	SNP	ENST00000233057.4	hg19	CCDS1786.1	.	.	.	.	.	.	.	.	.	.	T	0.839	-0.742478	0.03088	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334	T;T;T	0.76060	-0.95;-0.95;-0.99	2.53	-0.322	0.12713	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	3.067170	0.01163	N	0.006689	T	0.53965	0.1829	N	0.13299	0.325	0.09310	N	1	B;B;B	0.12013	0.004;0.0;0.005	B;B;B	0.08055	0.003;0.001;0.002	T	0.41910	-0.9482	10	0.08837	T	0.75	3.372	5.1114	0.14811	0.0:0.1223:0.1964:0.6813	.	336;336;295	Q8IW76;P19525;E9PC80	.;E2AK2_HUMAN;.	A	336;336;295	ENSP00000233057:T336A;ENSP00000378559:T336A;ENSP00000385014:T295A	ENSP00000233057:T336A	T	-	1	0	EIF2AK2	37203214	0.010000	0.17322	0.047000	0.18901	0.093000	0.18481	0.324000	0.19610	0.013000	0.14918	0.477000	0.44152	ACC	.	.		0.373	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2	NM_002759	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	159.0	0.0		205.0	13.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
RETSAT	54884	hgsc.bcm.edu	37	2	85571364	85571364	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:85571364G>A	ENST00000295802.4	-	8	1476	c.1364C>T	c.(1363-1365)cCa>cTa	p.P455L	RETSAT_ENST00000263854.6_Missense_Mutation_p.P455L|RETSAT_ENST00000475624.2_5'UTR|RETSAT_ENST00000457495.2_Missense_Mutation_p.P394L	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	455					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	AGCCCCACCTGGGAATCGGTC	0.607																																					p.P455L		Atlas-SNP	.											.	RETSAT	56	.	0			c.C1364T						.						70.0	72.0	71.0					2																	85571364		2203	4300	6503	SO:0001583	missense	54884	exon8			CCACCTGGGAATC	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1364C>T	chr2.hg19:g.85571364G>A	ENSP00000295802:p.Pro455Leu	118.0	0.0		136.0	64.0	NM_017750	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	hg19	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.392273|4.392273	0.83011|0.83011	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000295802;ENST00000263854;ENST00000457495|ENST00000449375	T;T|.	0.32988|.	1.43;1.43|.	4.58|4.58	4.58|4.58	0.56647|0.56647	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.82678|.	0.5089|.	M|M	0.89478|0.89478	3.035|3.035	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.83275|.	0.994;0.994;0.996|.	D|.	0.86103|.	0.1557|.	10|.	0.87932|.	D|.	0|.	-3.2977|-3.2977	15.2265|15.2265	0.73357|0.73357	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	394;394;455|.	G5E9N3;B4DKE1;Q6NUM9|.	.;.;RETST_HUMAN|.	L|X	455;455;394|244	ENSP00000295802:P455L;ENSP00000405040:P394L|.	ENSP00000263854:P455L|.	P|Q	-|-	2|1	0|0	RETSAT|RETSAT	85424875|85424875	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	5.498000|5.498000	0.66931|0.66931	2.252000|2.252000	0.74401|0.74401	0.561000|0.561000	0.74099|0.74099	CCA|CAG	.	.		0.607	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
KCNJ3	3760	hgsc.bcm.edu	37	2	155711241	155711241	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:155711241A>G	ENST00000295101.2	+	3	1399	c.922A>G	c.(922-924)Atg>Gtg	p.M308V	KCNJ3_ENST00000493505.1_3'UTR|KCNJ3_ENST00000544049.1_Silent_p.G235G	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	308					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	TCTTGTAGGGATGACTTGTCA	0.348																																					p.M308V		Atlas-SNP	.											.	KCNJ3	126	.	0			c.A922G						.						94.0	96.0	96.0					2																	155711241		2203	4300	6503	SO:0001583	missense	3760	exon3			GTAGGGATGACTT	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.922A>G	chr2.hg19:g.155711241A>G	ENSP00000295101:p.Met308Val	83.0	0.0		59.0	25.0	NM_002239	B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	hg19	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.119505	0.56505	.	.	ENSG00000162989	ENST00000295101	D	0.93763	-3.28	5.7	5.7	0.88788	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.035544	0.85682	D	0.000000	D	0.95175	0.8436	M	0.91972	3.26	0.80722	D	1	P	0.41265	0.744	B	0.42495	0.389	D	0.95750	0.8791	10	0.72032	D	0.01	.	15.1574	0.72755	1.0:0.0:0.0:0.0	.	308	P48549	IRK3_HUMAN	V	308	ENSP00000295101:M308V	ENSP00000295101:M308V	M	+	1	0	KCNJ3	155419487	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.339000	0.96797	2.184000	0.69523	0.528000	0.53228	ATG	.	.		0.348	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
SP100	6672	hgsc.bcm.edu	37	2	231368974	231368974	+	Silent	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:231368974G>A	ENST00000264052.5	+	21	2194	c.1839G>A	c.(1837-1839)aaG>aaA	p.K613K	RN7SL834P_ENST00000461450.2_RNA|SP100_ENST00000340126.4_Silent_p.K613K|SP100_ENST00000409112.1_Silent_p.K613K	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	613	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GTGAGGTGAAGGGCACTCTAT	0.383																																					p.K613K		Atlas-SNP	.											.	SP100	167	.	0			c.G1839A						.						168.0	172.0	170.0					2																	231368974		2203	4300	6503	SO:0001819	synonymous_variant	6672	exon21			GGTGAAGGGCACT	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1839G>A	chr2.hg19:g.231368974G>A		123.0	0.0		113.0	35.0	NM_001080391	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Silent	SNP	ENST00000264052.5	hg19	CCDS2477.1																																																																																			.	.		0.383	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	
CLASP2	23122	hgsc.bcm.edu	37	3	33759454	33759454	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:33759454T>A	ENST00000468888.2	-	1	87	c.41A>T	c.(40-42)cAg>cTg	p.Q14L	CLASP2_ENST00000307312.7_5'UTR|CLASP2_ENST00000399362.4_Missense_Mutation_p.Q14L|CLASP2_ENST00000359576.5_Missense_Mutation_p.Q14L			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	0					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						GTCCTTCTGCTGCACCTGGGC	0.726																																					p.Q14L		Atlas-SNP	.											.	CLASP2	138	.	0			c.A41T						.						3.0	4.0	4.0					3																	33759454		1570	3576	5146	SO:0001583	missense	23122	exon1			TTCTGCTGCACCT	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.41A>T	chr3.hg19:g.33759454T>A	ENSP00000419974:p.Gln14Leu	98.0	0.0		90.0	37.0	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	hg19		.	.	.	.	.	.	.	.	.	.	T	15.95	2.982539	0.53827	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576	T;T;T	0.64085	-0.08;-0.08;-0.08	4.09	-0.376	0.12505	.	0.547964	0.15178	N	0.276247	T	0.29556	0.0737	N	0.01668	-0.77	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03566	-1.1024	10	0.27082	T	0.32	1.3447	9.4237	0.38567	0.5562:0.0:0.0:0.4438	.	14	F5H604	.	L	14	ENSP00000419974:Q14L;ENSP00000382297:Q14L;ENSP00000352581:Q14L	ENSP00000352581:Q14L	Q	-	2	0	CLASP2	33734458	0.952000	0.32445	0.997000	0.53966	0.994000	0.84299	1.374000	0.34283	-0.170000	0.10816	0.459000	0.35465	CAG	.	.		0.726	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266107	41266107	+	Missense_Mutation	SNP	T	T	G	rs121913416		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:41266107T>G	ENST00000349496.5	+	3	384	c.104T>G	c.(103-105)aTc>aGc	p.I35S	CTNNB1_ENST00000453024.1_Missense_Mutation_p.I28S|CTNNB1_ENST00000405570.1_Missense_Mutation_p.I35S|CTNNB1_ENST00000396183.3_Missense_Mutation_p.I35S|CTNNB1_ENST00000396185.3_Missense_Mutation_p.I35S	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	35			I -> S (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.I35S(20)|p.I35T(13)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35N(1)|p.I35_G38del(1)|p.I35K(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GACTCTGGAATCCATTCTGGT	0.493		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.I35S	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	169	Deletion - In frame(107)|Substitution - Missense(35)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(3)	liver(118)|large_intestine(19)|salivary_gland(12)|stomach(7)|soft_tissue(2)|small_intestine(2)|endometrium(2)|skin(2)|adrenal_gland(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|pituitary(1)|kidney(1)	c.T104G						.						95.0	80.0	85.0					3																	41266107		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGAATCCATTC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.104T>G	chr3.hg19:g.41266107T>G	ENSP00000344456:p.Ile35Ser	138.0	0.0		141.0	48.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.188620	0.78789	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	M	0.79614	2.46	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.73949	-0.3821	10	0.87932	D	0	-3.5499	16.0677	0.80897	0.0:0.0:0.0:1.0	.	35	P35222	CTNB1_HUMAN	S	28;35;35;35;35;28;35;35;35	ENSP00000400508:I28S;ENSP00000385604:I35S;ENSP00000412219:I35S;ENSP00000379486:I35S;ENSP00000344456:I35S;ENSP00000411226:I28S;ENSP00000379488:I35S;ENSP00000409302:I35S;ENSP00000401599:I35S	ENSP00000344456:I35S	I	+	2	0	CTNNB1	41241111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	ATC	.	.		0.493	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
MST1R	4486	hgsc.bcm.edu	37	3	49936356	49936356	+	Missense_Mutation	SNP	C	C	T	rs148258933		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:49936356C>T	ENST00000296474.3	-	3	1519	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	MST1R_ENST00000344206.4_Missense_Mutation_p.V498M|CTD-2330K9.2_ENST00000435478.1_RNA	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	498	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TCCCGCTGCACGGGCTGCCCA	0.592																																					p.V498M		Atlas-SNP	.											.	MST1R	205	.	0			c.G1492A						.	C	MET/VAL	0,4406		0,0,2203	94.0	95.0	94.0		1492	-2.1	0.0	3	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	missense	MST1R	NM_002447.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	498/1401	49936356	1,13005	2203	4300	6503	SO:0001583	missense	4486	exon3			GCTGCACGGGCTG	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1492G>A	chr3.hg19:g.49936356C>T	ENSP00000296474:p.Val498Met	209.0	0.0		191.0	87.0	NM_001244937	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	hg19	CCDS2807.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021501	0.54576	0.0	1.16E-4	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.12569	2.67;2.67	5.93	-2.06	0.07298	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.582492	0.18236	N	0.147391	T	0.32102	0.0818	M	0.80183	2.485	0.09310	N	1	D;D;D	0.89917	1.0;0.991;0.994	D;D;P	0.73380	0.98;0.911;0.903	T	0.08186	-1.0734	10	0.87932	D	0	0.3246	9.2444	0.37515	0.1068:0.7876:0.0:0.1055	.	498;498;498	Q04912-6;Q04912-5;Q04912	.;.;RON_HUMAN	M	498	ENSP00000296474:V498M;ENSP00000341325:V498M	ENSP00000296474:V498M	V	-	1	0	MST1R	49911360	0.000000	0.05858	0.011000	0.14972	0.711000	0.40976	-0.324000	0.07986	-0.805000	0.04404	0.561000	0.74099	GTG	.	C|1.000;T|0.000		0.592	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
DNAH1	25981	hgsc.bcm.edu	37	3	52356615	52356615	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:52356615C>A	ENST00000420323.2	+	2	418	c.157C>A	c.(157-159)Cca>Aca	p.P53T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	53	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGGAAATCCTCCAGCCCTTGA	0.607																																					p.P53T		Atlas-SNP	.											.	DNAH1	534	.	0			c.C157A						.						56.0	60.0	59.0					3																	52356615		1872	4091	5963	SO:0001583	missense	25981	exon2			AATCCTCCAGCCC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.157C>A	chr3.hg19:g.52356615C>A	ENSP00000401514:p.Pro53Thr	85.0	0.0		79.0	33.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	9.990	1.230557	0.22542	.	.	ENSG00000114841	ENST00000420323	T	0.26810	1.71	3.37	2.46	0.29980	.	2.465280	0.01785	N	0.031966	T	0.24314	0.0589	L	0.44542	1.39	0.09310	N	1	B;B	0.30281	0.079;0.275	B;B	0.33254	0.011;0.16	T	0.19614	-1.0300	10	0.23891	T	0.37	.	4.7207	0.12917	0.0:0.6502:0.2281:0.1217	.	53;53	C9JXH6;Q9P2D7-3	.;.	T	53	ENSP00000401514:P53T	ENSP00000401514:P53T	P	+	1	0	DNAH1	52331655	0.003000	0.15002	0.050000	0.19076	0.275000	0.26752	0.401000	0.20948	0.965000	0.38133	0.491000	0.48974	CCA	.	.		0.607	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
TKT	7086	hgsc.bcm.edu	37	3	53267208	53267208	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:53267208T>C	ENST00000462138.1	-	6	800	c.712A>G	c.(712-714)Atc>Gtc	p.I238V	TKT_ENST00000423525.2_Missense_Mutation_p.I238V|TKT_ENST00000423516.1_Missense_Mutation_p.I246V|TKT_ENST00000461139.1_5'Flank|TKT_ENST00000296289.6_Missense_Mutation_p.I191V			P29401	TKT_HUMAN	transketolase	238					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		TTGGCAATGATGGCTGTTGGC	0.617																																					p.I246V	Colon(133;1506 2347 35238 42177)	Atlas-SNP	.											.	TKT	38	.	0			c.A736G						.						107.0	93.0	98.0					3																	53267208		2203	4300	6503	SO:0001583	missense	7086	exon7			CAATGATGGCTGT		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.712A>G	chr3.hg19:g.53267208T>C	ENSP00000417773:p.Ile238Val	70.0	0.0		91.0	37.0	NM_001258028	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	hg19	CCDS2871.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.264783	0.40095	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.9	0.874	0.19124	Transketolase, N-terminal (1);	0.140001	0.64402	N	0.000005	T	0.33235	0.0856	M	0.62266	1.93	0.58432	D	0.999999	B;B;B	0.10296	0.002;0.003;0.003	B;B;B	0.20577	0.005;0.03;0.014	T	0.14671	-1.0464	10	0.41790	T	0.15	-26.8545	10.2209	0.43196	0.0:0.3227:0.0:0.6773	.	246;155;238	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	V	238;238;246;191;72	ENSP00000417773:I238V;ENSP00000405455:I238V;ENSP00000391481:I246V;ENSP00000296289:I191V	ENSP00000296289:I191V	I	-	1	0	TKT	53242248	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	3.518000	0.53451	0.156000	0.19299	0.528000	0.53228	ATC	.	.		0.617	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
MRPS22	56945	hgsc.bcm.edu	37	3	139074588	139074588	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:139074588C>A	ENST00000495075.1	+	9	1375	c.943C>A	c.(943-945)Caa>Aaa	p.Q315K	MRPS22_ENST00000478464.1_Missense_Mutation_p.Q274K|MRPS22_ENST00000310776.4_Missense_Mutation_p.Q315K|MRPS22_ENST00000465056.1_Missense_Mutation_p.Q314K			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	315						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						CCAGTCGGCTCAAGGGGCCAA	0.423																																					p.Q315K		Atlas-SNP	.											.	MRPS22	40	.	0			c.C943A						.						72.0	72.0	72.0					3																	139074588		2203	4300	6503	SO:0001583	missense	56945	exon7			TCGGCTCAAGGGG	AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.943C>A	chr3.hg19:g.139074588C>A	ENSP00000418008:p.Gln315Lys	196.0	0.0		178.0	83.0	NM_020191	Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	hg19	CCDS3107.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.31|18.31	3.596833|3.596833	0.66332|0.66332	.|.	.|.	ENSG00000175110|ENSG00000184432	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000478464|ENST00000503326	D;D;D;D|.	0.82619|.	-1.63;-1.63;-1.62;-1.61|.	5.76|5.76	3.68|3.68	0.42216|0.42216	.|.	0.269566|.	0.41712|.	D|.	0.000834|.	T|.	0.35566|.	0.0936|.	N|N	0.12569|0.12569	0.235|0.235	0.80722|0.80722	D|D	1|1	B;B;B|.	0.10296|.	0.001;0.003;0.002|.	B;B;B|.	0.10450|.	0.002;0.005;0.002|.	T|.	0.06807|.	-1.0806|.	10|.	0.06099|.	T|.	0.92|.	-6.8611|-6.8611	8.1915|8.1915	0.31370|0.31370	0.3994:0.4882:0.1124:0.0|0.3994:0.4882:0.1124:0.0	.|.	274;314;315|.	G5E9W7;G5E9V5;P82650|.	.;.;RT22_HUMAN|.	K|L	315;315;314;274|96	ENSP00000418008:Q315K;ENSP00000310785:Q315K;ENSP00000418233:Q314K;ENSP00000419303:Q274K|.	ENSP00000310785:Q315K|.	Q|X	+|-	1|2	0|2	MRPS22|COPB2	140557278|140557278	0.990000|0.990000	0.36364|0.36364	0.985000|0.985000	0.45067|0.45067	0.980000|0.980000	0.70556|0.70556	1.570000|1.570000	0.36439|0.36439	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	CAA|TGA	.	.		0.423	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1	NM_020191	
CCNL1	57018	hgsc.bcm.edu	37	3	156867722	156867722	+	Silent	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:156867722T>C	ENST00000295926.3	-	8	1042	c.924A>G	c.(922-924)gtA>gtG	p.V308V	CCNL1_ENST00000479052.1_5'Flank|CCNL1_ENST00000461804.1_Silent_p.V308V	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	308					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			CTTGTAAGGCTACTTTTCTTT	0.403																																					p.V308V		Atlas-SNP	.											.	CCNL1	53	.	0			c.A924G						.						117.0	120.0	119.0					3																	156867722		2203	4300	6503	SO:0001819	synonymous_variant	57018	exon8			TAAGGCTACTTTT	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.924A>G	chr3.hg19:g.156867722T>C		149.0	0.0		140.0	50.0	NM_020307	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Silent	SNP	ENST00000295926.3	hg19	CCDS3178.1																																																																																			.	.		0.403	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	NM_020307	
SERPINI1	5274	hgsc.bcm.edu	37	3	167542319	167542319	+	Silent	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:167542319A>G	ENST00000295777.5	+	8	1556	c.1125A>G	c.(1123-1125)ccA>ccG	p.P375P	SERPINI1_ENST00000488374.1_3'UTR|SERPINI1_ENST00000446050.2_Silent_p.P375P	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	375					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						TCGACCATCCATTTTTCTTTC	0.323																																					p.P375P		Atlas-SNP	.											.	SERPINI1	52	.	0			c.A1125G						.						121.0	116.0	118.0					3																	167542319		2203	4300	6503	SO:0001819	synonymous_variant	5274	exon8			CCATCCATTTTTC	Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.1125A>G	chr3.hg19:g.167542319A>G		75.0	0.0		82.0	35.0	NM_005025	A8K217|D3DNP1|Q6AHZ4	Silent	SNP	ENST00000295777.5	hg19	CCDS3203.1	.	.	.	.	.	.	.	.	.	.	A	6.502	0.460851	0.12342	.	.	ENSG00000163536	ENST00000466865	.	.	.	5.57	3.05	0.35203	.	.	.	.	.	T	0.55721	0.1938	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46721	-0.9171	4	.	.	.	.	7.407	0.26995	0.7436:0.0:0.0738:0.1827	.	.	.	.	V	84	.	.	I	+	1	0	SERPINI1	169025013	0.977000	0.34250	1.000000	0.80357	0.697000	0.40408	0.140000	0.16056	0.392000	0.25172	-1.431000	0.01090	ATT	.	.		0.323	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351056.1		
FETUB	26998	hgsc.bcm.edu	37	3	186364073	186364073	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr3:186364073A>T	ENST00000265029.3	+	5	732	c.631A>T	c.(631-633)Att>Ttt	p.I211F	FETUB_ENST00000382136.3_Missense_Mutation_p.I174F|FETUB_ENST00000450521.1_Missense_Mutation_p.I211F|FETUB_ENST00000382134.3_Missense_Mutation_p.I146F|RP11-134F2.2_ENST00000455926.1_RNA|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000539949.1_Missense_Mutation_p.I63F	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	211	Cystatin fetuin-B-type 2. {ECO:0000255|PROSITE-ProRule:PRU00862}.				binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		GGAATACTTAATTAAAGAATC	0.418																																					p.I211F		Atlas-SNP	.											.	FETUB	53	.	0			c.A631T						.						145.0	153.0	150.0					3																	186364073		2203	4300	6503	SO:0001583	missense	26998	exon5			TACTTAATTAAAG	AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.631A>T	chr3.hg19:g.186364073A>T	ENSP00000265029:p.Ile211Phe	115.0	0.0		134.0	59.0	NM_014375	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	ENST00000265029.3	hg19	CCDS3279.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.627381	0.46944	.	.	ENSG00000090512	ENST00000450521;ENST00000431018;ENST00000539949;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	4.97	2.55	0.30701	Proteinase inhibitor I25, cystatin (2);	0.218413	0.32624	N	0.005854	T	0.54351	0.1853	M	0.87180	2.865	0.49051	D	0.999742	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.77557	0.99;0.989;0.989	T	0.54186	-0.8331	10	0.87932	D	0	-21.1983	6.7585	0.23528	0.836:0.0:0.164:0.0	.	174;146;211	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	F	211;63;63;211;146;174	ENSP00000404288:I211F;ENSP00000396581:I63F;ENSP00000443704:I63F;ENSP00000265029:I211F;ENSP00000371569:I146F;ENSP00000371571:I174F	ENSP00000265029:I211F	I	+	1	0	FETUB	187846767	0.991000	0.36638	0.524000	0.27887	0.471000	0.32888	0.637000	0.24659	0.455000	0.26910	-0.242000	0.12053	ATT	.	.		0.418	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375	
PCDH7	5099	hgsc.bcm.edu	37	4	30732375	30732375	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:30732375A>T	ENST00000361762.2	+	2	4183	c.3175A>T	c.(3175-3177)Atg>Ttg	p.M1059L	PCDH7_ENST00000543491.1_Intron	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	1059					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CTTCTTTCAGATGCGTCTACA	0.363																																					p.M1059L		Atlas-SNP	.											.	PCDH7	215	.	0			c.A3175T						.						179.0	172.0	174.0					4																	30732375		2203	4300	6503	SO:0001630	splice_region_variant	5099	exon2			TTTCAGATGCGTC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.3175-1A>T	chr4.hg19:g.30732375A>T		69.0	0.0		63.0	19.0	NM_002589	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	A	9.082	0.999611	0.19121	.	.	ENSG00000169851	ENST00000361762	T	0.47528	0.84	5.5	5.5	0.81552	.	.	.	.	.	T	0.23688	0.0573	N	0.03608	-0.345	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.13872	-1.0493	8	.	.	.	.	12.0002	0.53226	1.0:0.0:0.0:0.0	.	1059	O60245	PCDH7_HUMAN	L	1059	ENSP00000355243:M1059L	.	M	+	1	0	PCDH7	30341473	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.842000	0.62831	2.099000	0.63709	0.533000	0.62120	ATG	.	.		0.363	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	Missense_Mutation
ARAP2	116984	hgsc.bcm.edu	37	4	36230968	36230968	+	Silent	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:36230968C>T	ENST00000303965.4	-	2	630	c.141G>A	c.(139-141)caG>caA	p.Q47Q		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	47	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTCCAATTTTCTGCAGCAGGC	0.373																																					p.Q47Q		Atlas-SNP	.											.	ARAP2	210	.	0			c.G141A						.						66.0	68.0	68.0					4																	36230968		2203	4300	6503	SO:0001819	synonymous_variant	116984	exon2			AATTTTCTGCAGC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.141G>A	chr4.hg19:g.36230968C>T		168.0	0.0		168.0	67.0	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	ENST00000303965.4	hg19	CCDS3441.1																																																																																			.	.		0.373	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
FRYL	285527	hgsc.bcm.edu	37	4	48636346	48636346	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:48636346C>A	ENST00000503238.1	-	1	81	c.82G>T	c.(82-84)Gct>Tct	p.A28S	FRYL_ENST00000358350.4_Missense_Mutation_p.A28S|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.A28S|FRYL_ENST00000507711.1_Missense_Mutation_p.A28S|FRYL_ENST00000514783.1_5'Flank			O94915	FRYL_HUMAN	FRY-like	28					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TTCTTTTCAGCTTGAACAGCA	0.353																																					p.A28S		Atlas-SNP	.											.	FRYL	242	.	0			c.G82T						.						114.0	106.0	109.0					4																	48636346		1856	4093	5949	SO:0001583	missense	285527	exon4			TTTCAGCTTGAAC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.82G>T	chr4.hg19:g.48636346C>A	ENSP00000426064:p.Ala28Ser	240.0	0.0		229.0	91.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361678	0.61403	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000505759	T;T;T;T	0.61274	1.08;1.08;1.08;0.12	5.0	5.0	0.66597	.	0.000000	0.64402	U	0.000003	T	0.52757	0.1754	L	0.40543	1.245	0.80722	D	1	B;B;B	0.33238	0.395;0.02;0.403	B;B;B	0.33890	0.172;0.006;0.145	T	0.55755	-0.8091	10	0.51188	T	0.08	.	18.659	0.91465	0.0:1.0:0.0:0.0	.	79;28;28	Q6ZNE6;F2Z2S2;O94915	.;.;FRYL_HUMAN	S	28;28;28;28;120	ENSP00000426064:A28S;ENSP00000351113:A28S;ENSP00000441114:A28S;ENSP00000421584:A28S	ENSP00000351113:A28S	A	-	1	0	FRYL	48331103	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.670000	0.68088	2.475000	0.83589	0.650000	0.86243	GCT	.	.		0.353	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FRYL	285527	hgsc.bcm.edu	37	4	48636368	48636368	+	Silent	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:48636368G>T	ENST00000503238.1	-	1	59	c.60C>A	c.(58-60)ctC>ctA	p.L20L	FRYL_ENST00000358350.4_Silent_p.L20L|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Silent_p.L20L|FRYL_ENST00000507711.1_Silent_p.L20L|FRYL_ENST00000514783.1_5'Flank			O94915	FRYL_HUMAN	FRY-like	20					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ATTCTGCAAAGAGGCTCTTGA	0.373																																					p.L20L		Atlas-SNP	.											.	FRYL	242	.	0			c.C60A						.						119.0	111.0	113.0					4																	48636368		1846	4090	5936	SO:0001819	synonymous_variant	285527	exon4			TGCAAAGAGGCTC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.60C>A	chr4.hg19:g.48636368G>T		237.0	0.0		229.0	97.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	hg19	CCDS43227.1																																																																																			.	.		0.373	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
AFM	173	hgsc.bcm.edu	37	4	74364862	74364862	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:74364862C>T	ENST00000226355.3	+	11	1414	c.1321C>T	c.(1321-1323)Caa>Taa	p.Q441*		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	441	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GATAGCTCCCCAACTCTCCAC	0.428																																					p.Q441X		Atlas-SNP	.											.	AFM	101	.	0			c.C1321T						.						188.0	166.0	173.0					4																	74364862		2203	4300	6503	SO:0001587	stop_gained	173	exon11			GCTCCCCAACTCT	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.1321C>T	chr4.hg19:g.74364862C>T	ENSP00000226355:p.Gln441*	97.0	0.0		75.0	23.0	NM_001133	A8K3E1|Q32MR3|Q4W5C5	Nonsense_Mutation	SNP	ENST00000226355.3	hg19	CCDS3557.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319814	0.60634	.	.	ENSG00000079557	ENST00000226355	.	.	.	5.55	4.65	0.58169	.	0.232350	0.35838	N	0.002956	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.5644	0.50796	0.0:0.8203:0.1797:0.0	.	.	.	.	X	441	.	ENSP00000226355:Q441X	Q	+	1	0	AFM	74583726	0.937000	0.31787	0.383000	0.26132	0.056000	0.15407	1.918000	0.40006	2.610000	0.88304	0.655000	0.94253	CAA	.	.		0.428	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2		
SLC7A11	23657	hgsc.bcm.edu	37	4	139153531	139153531	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:139153531G>A	ENST00000280612.5	-	3	689	c.410C>T	c.(409-411)gCa>gTa	p.A137V		NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	137					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	AGCAGTAGCTGCAGGGCTAAA	0.363																																					p.A137V		Atlas-SNP	.											.	SLC7A11	40	.	0			c.C410T						.						43.0	43.0	43.0					4																	139153531		2203	4300	6503	SO:0001583	missense	23657	exon3			GTAGCTGCAGGGC	AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.410C>T	chr4.hg19:g.139153531G>A	ENSP00000280612:p.Ala137Val	206.0	0.0		224.0	110.0	NM_014331	A8K2U4	Missense_Mutation	SNP	ENST00000280612.5	hg19	CCDS3742.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.848782	0.71603	.	.	ENSG00000151012	ENST00000280612	D	0.88741	-2.42	5.64	3.86	0.44501	Amino acid permease domain (1);	0.095612	0.64402	D	0.000001	D	0.88440	0.6437	M	0.62723	1.935	0.58432	D	0.999997	B	0.28667	0.219	B	0.33121	0.158	D	0.85667	0.1292	10	0.59425	D	0.04	.	15.9042	0.79406	0.0:0.2646:0.7354:0.0	.	137	Q9UPY5	XCT_HUMAN	V	137	ENSP00000280612:A137V	ENSP00000280612:A137V	A	-	2	0	SLC7A11	139372981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.640000	0.83355	0.700000	0.31782	0.655000	0.94253	GCA	.	.		0.363	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257251.2		
CCRN4L	25819	hgsc.bcm.edu	37	4	139966514	139966514	+	Silent	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr4:139966514G>T	ENST00000280614.2	+	3	1375	c.1182G>T	c.(1180-1182)ctG>ctT	p.L394L	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	394					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					CTCTCGATCTGCTCACTGAAG	0.473																																					p.L394L	Ovarian(144;566 1842 19130 21379 22209)	Atlas-SNP	.											.	CCRN4L	22	.	0			c.G1182T						.						106.0	103.0	104.0					4																	139966514		2203	4300	6503	SO:0001819	synonymous_variant	25819	exon3			CGATCTGCTCACT	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.1182G>T	chr4.hg19:g.139966514G>T		112.0	0.0		92.0	4.0	NM_012118	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Silent	SNP	ENST00000280614.2	hg19	CCDS3743.1																																																																																			.	.		0.473	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33616019	33616019	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:33616019C>T	ENST00000504830.1	-	15	2637	c.2302G>A	c.(2302-2304)Gca>Aca	p.A768T	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.A683T|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	768	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACAGTCCCTGCCAGCTTATAG	0.483										HNSCC(64;0.19)																											p.A768T		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.G2302A						.						145.0	130.0	135.0					5																	33616019		2203	4300	6503	SO:0001583	missense	81792	exon15			TCCCTGCCAGCTT	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2302G>A	chr5.hg19:g.33616019C>T	ENSP00000422554:p.Ala768Thr	75.0	0.0		99.0	36.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	hg19	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288539	0.95517	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.54071	0.59;0.59	5.51	5.51	0.81932	ADAM-TS Spacer 1 (1);	0.157093	0.56097	D	0.000031	T	0.81375	0.4809	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.982;0.988	D	0.85328	0.1088	10	0.46703	T	0.11	.	19.015	0.92890	0.0:1.0:0.0:0.0	.	683;768	P58397-3;P58397	.;ATS12_HUMAN	T	768;683	ENSP00000422554:A768T;ENSP00000344847:A683T	ENSP00000344847:A683T	A	-	1	0	ADAMTS12	33651776	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	7.741000	0.84997	2.558000	0.86282	0.561000	0.74099	GCA	.	.		0.483	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
SPEF2	79925	hgsc.bcm.edu	37	5	35807283	35807283	+	Silent	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:35807283T>C	ENST00000356031.3	+	36	5461	c.5307T>C	c.(5305-5307)atT>atC	p.I1769I	SPEF2_ENST00000440995.2_Silent_p.I1764I|SPEF2_ENST00000303129.4_Silent_p.I566I|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1769					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGGAGCCAATTGAAGTCGCTG	0.363																																					p.I1769I		Atlas-SNP	.											.	SPEF2	324	.	0			c.T5307C						.						144.0	140.0	141.0					5																	35807283		1812	4083	5895	SO:0001819	synonymous_variant	79925	exon36			GCCAATTGAAGTC	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.5307T>C	chr5.hg19:g.35807283T>C		91.0	0.0		85.0	34.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	hg19	CCDS43309.1																																																																																			.	.		0.363	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
CARD6	84674	hgsc.bcm.edu	37	5	40843445	40843445	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:40843445G>A	ENST00000254691.5	+	2	674	c.475G>A	c.(475-477)Gct>Act	p.A159T	CARD6_ENST00000381677.3_Missense_Mutation_p.A159T	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	159					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						TAGGGAAACAGCTTTGTCTGC	0.408																																					p.A159T		Atlas-SNP	.											.	CARD6	141	.	0			c.G475A						.						59.0	61.0	60.0					5																	40843445		2203	4300	6503	SO:0001583	missense	84674	exon2			GAAACAGCTTTGT	AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.475G>A	chr5.hg19:g.40843445G>A	ENSP00000254691:p.Ala159Thr	157.0	0.0		168.0	59.0	NM_032587	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	hg19	CCDS3935.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257480	0.59321	.	.	ENSG00000132357	ENST00000254691;ENST00000381677;ENST00000444789;ENST00000509771	T;T	0.32272	2.68;1.46	5.12	2.22	0.28083	.	0.779066	0.11238	N	0.584886	T	0.21186	0.0510	L	0.32530	0.975	0.09310	N	1	B	0.26081	0.141	B	0.27170	0.077	T	0.17258	-1.0375	10	0.36615	T	0.2	-2.8775	5.3231	0.15891	0.0943:0.0:0.5411:0.3646	.	159	Q9BX69	CARD6_HUMAN	T	159	ENSP00000254691:A159T;ENSP00000371093:A159T	ENSP00000254691:A159T	A	+	1	0	CARD6	40879202	0.000000	0.05858	0.019000	0.16419	0.025000	0.11179	0.491000	0.22419	1.372000	0.46190	-0.182000	0.12963	GCT	.	.		0.408	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
SLCO6A1	133482	hgsc.bcm.edu	37	5	101748694	101748694	+	Splice_Site	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:101748694C>G	ENST00000506729.1	-	9	1797	c.1626G>C	c.(1624-1626)aaG>aaC	p.K542N	SLCO6A1_ENST00000379810.1_Splice_Site_p.K289N|SLCO6A1_ENST00000379807.3_Splice_Site_p.K542N|SLCO6A1_ENST00000389019.3_Splice_Site_p.K480N|SLCO6A1_ENST00000513675.1_Splice_Site_p.K289N			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	542	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		aaataatTACCTTTTTTTGGT	0.234																																					p.K542N		Atlas-SNP	.											.	SLCO6A1	153	.	0			c.G1626C						.						9.0	9.0	9.0					5																	101748694		2106	4220	6326	SO:0001630	splice_region_variant	133482	exon9			AATTACCTTTTTT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1626+1G>C	chr5.hg19:g.101748694C>G		301.0	1.0		290.0	129.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	hg19	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831131	0.32329	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.04758	3.56;3.56;3.56;3.56;3.56	5.17	3.27	0.37495	Major facilitator superfamily domain, general substrate transporter (1);Protease inhibitor, Kazal-type (1);	0.284988	0.28712	N	0.014390	T	0.19604	0.0471	M	0.85945	2.785	0.42524	D	0.993019	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.79108	0.982;0.992;0.99	T	0.00299	-1.1836	9	.	.	.	.	7.0636	0.25139	0.0:0.7265:0.1722:0.1013	.	480;289;542	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	N	542;542;480;289;289	ENSP00000421339:K542N;ENSP00000369135:K542N;ENSP00000373671:K480N;ENSP00000421990:K289N;ENSP00000369138:K289N	.	K	-	3	2	SLCO6A1	101776593	0.992000	0.36948	0.833000	0.33012	0.109000	0.19521	0.645000	0.24782	0.649000	0.30751	0.655000	0.94253	AAG	.	.		0.234	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	Missense_Mutation
FBN2	2201	hgsc.bcm.edu	37	5	127744443	127744443	+	Silent	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:127744443A>G	ENST00000508053.1	-	14	1976	c.1002T>C	c.(1000-1002)tgT>tgC	p.C334C	FBN2_ENST00000262464.4_Silent_p.C334C|FBN2_ENST00000508989.1_Silent_p.C301C			P35556	FBN2_HUMAN	fibrillin 2	334	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGGTGTTGGAACATTCACCAG	0.438																																					p.C334C		Atlas-SNP	.											.	FBN2	858	.	0			c.T1002C						.						153.0	132.0	139.0					5																	127744443		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon8			GTTGGAACATTCA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1002T>C	chr5.hg19:g.127744443A>G		266.0	0.0		258.0	109.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	hg19	CCDS34222.1																																																																																			.	.		0.438	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
PDLIM4	8572	hgsc.bcm.edu	37	5	131607555	131607555	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:131607555G>A	ENST00000253754.3	+	6	806	c.742G>A	c.(742-744)Ggc>Agc	p.G248S	PDLIM4_ENST00000379018.3_Intron|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	248							zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCCGCTGAGCGGCCTGCAGGG	0.726																																					p.G248S		Atlas-SNP	.											.	PDLIM4	22	.	0			c.G742A						.						11.0	14.0	13.0					5																	131607555		2177	4238	6415	SO:0001583	missense	8572	exon6			CTGAGCGGCCTGC	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.742G>A	chr5.hg19:g.131607555G>A	ENSP00000253754:p.Gly248Ser	65.0	0.0		74.0	37.0	NM_003687	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Missense_Mutation	SNP	ENST00000253754.3	hg19	CCDS4152.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791317	0.50102	.	.	ENSG00000131435	ENST00000253754	T	0.41065	1.01	5.09	4.01	0.46588	.	0.055489	0.64402	D	0.000001	T	0.23649	0.0572	N	0.25647	0.755	0.80722	D	1	P	0.40083	0.702	B	0.25987	0.065	T	0.08638	-1.0712	10	0.17369	T	0.5	-14.0795	14.4103	0.67111	0.0847:0.0:0.9153:0.0	.	248	P50479	PDLI4_HUMAN	S	248	ENSP00000253754:G248S	ENSP00000253754:G248S	G	+	1	0	PDLIM4	131635454	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	5.045000	0.64220	2.359000	0.80004	0.655000	0.94253	GGC	.	.		0.726	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2	NM_003687	
PROB1	389333	hgsc.bcm.edu	37	5	138728471	138728471	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:138728471C>T	ENST00000434752.2	-	1	2414	c.2300G>A	c.(2299-2301)cGc>cAc	p.R767H	MZB1_ENST00000302125.8_5'Flank|MZB1_ENST00000412103.2_5'Flank|MZB1_ENST00000457570.2_5'Flank	NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	767	Pro-rich.																GGGGACCAGGCGCTGGGCCTC	0.751																																					p.R767H		Atlas-SNP	.											.	.	.	.	0			c.G2300A						.						8.0	10.0	10.0					5																	138728471		688	1583	2271	SO:0001583	missense	389333	exon1			ACCAGGCGCTGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.2300G>A	chr5.hg19:g.138728471C>T	ENSP00000416033:p.Arg767His	72.0	0.0		87.0	38.0	NM_001161546	B4E007	Missense_Mutation	SNP	ENST00000434752.2	hg19	CCDS54909.1	.	.	.	.	.	.	.	.	.	.	C	4.529	0.098150	0.08681	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.17	3.3	0.37823	.	.	.	.	.	T	0.29749	0.0743	N	0.24115	0.695	0.24417	N	0.994631	B	0.20988	0.05	B	0.20384	0.029	T	0.21280	-1.0250	8	0.49607	T	0.09	-4.6573	10.1845	0.42988	0.0:0.9005:0.0:0.0995	.	767	E7EW31	CE065_HUMAN	H	767	.	ENSP00000416033:R767H	R	-	2	0	AC135457.1	138756370	0.001000	0.12720	0.060000	0.19600	0.006000	0.05464	0.831000	0.27476	1.107000	0.41642	-0.254000	0.11334	CGC	.	.		0.751	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
PCDHB16	57717	hgsc.bcm.edu	37	5	140562423	140562423	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:140562423G>C	ENST00000361016.2	+	1	1444	c.289G>C	c.(289-291)Ggt>Cgt	p.G97R		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCTATGCGGTCCCACTGA	0.443																																					p.G97R		Atlas-SNP	.											.	PCDHB16	159	.	0			c.G289C						.						56.0	58.0	57.0					5																	140562423		2203	4300	6503	SO:0001583	missense	57717	exon1			CTATGCGGTCCCA	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.289G>C	chr5.hg19:g.140562423G>C	ENSP00000354293:p.Gly97Arg	132.0	0.0		127.0	62.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574987	0.65878	.	.	ENSG00000196963	ENST00000361016	T	0.30981	1.51	4.84	3.96	0.45880	Cadherin, N-terminal (1);Cadherin (1);	0.000000	0.35040	N	0.003486	T	0.57504	0.2058	M	0.81682	2.555	0.27215	N	0.959804	D	0.76494	0.999	D	0.87578	0.998	T	0.57763	-0.7755	10	0.66056	D	0.02	.	14.9729	0.71249	0.0:0.1437:0.8563:0.0	.	97	Q9NRJ7	PCDBG_HUMAN	R	97	ENSP00000354293:G97R	ENSP00000354293:G97R	G	+	1	0	PCDHB16	140542607	0.005000	0.15991	0.009000	0.14445	0.672000	0.39443	1.172000	0.31908	0.991000	0.38814	0.655000	0.94253	GGT	.	.		0.443	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
TCOF1	6949	hgsc.bcm.edu	37	5	149753925	149753925	+	Silent	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:149753925G>A	ENST00000504761.2	+	8	1059	c.1059G>A	c.(1057-1059)acG>acA	p.T353T	TCOF1_ENST00000323668.7_Silent_p.T276T|TCOF1_ENST00000377797.3_Silent_p.T353T|TCOF1_ENST00000513346.1_Silent_p.T353T|TCOF1_ENST00000445265.2_Silent_p.T276T|TCOF1_ENST00000439160.2_Silent_p.T353T|TCOF1_ENST00000394269.3_Silent_p.T353T|TCOF1_ENST00000451292.1_Silent_p.T353T			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	353					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGAGGAGACGCCAGCTGCCA	0.632																																					p.T353T		Atlas-SNP	.											.	TCOF1	154	.	0			c.G1059A						.						23.0	17.0	19.0					5																	149753925		2172	4256	6428	SO:0001819	synonymous_variant	6949	exon8			GGAGACGCCAGCT		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.1059G>A	chr5.hg19:g.149753925G>A		216.0	0.0		238.0	96.0	NM_001135243	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Silent	SNP	ENST00000504761.2	hg19	CCDS54936.1																																																																																			.	.		0.632	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
GALNT10	55568	hgsc.bcm.edu	37	5	153795396	153795396	+	Silent	SNP	C	C	T	rs145718506		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:153795396C>T	ENST00000297107.6	+	11	1694	c.1557C>T	c.(1555-1557)acC>acT	p.T519T	GALNT10_ENST00000377657.3_Silent_p.T192T|SAP30L-AS1_ENST00000519727.1_RNA|GALNT10_ENST00000377661.2_Silent_p.T457T|SAP30L-AS1_ENST00000524264.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	519	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CCCAGCACACCAAGAAGTTCT	0.527																																					p.T519T		Atlas-SNP	.											.	GALNT10	70	.	0			c.C1557T						.						125.0	118.0	120.0					5																	153795396		2203	4300	6503	SO:0001819	synonymous_variant	55568	exon11			GCACACCAAGAAG	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1557C>T	chr5.hg19:g.153795396C>T		267.0	1.0		292.0	112.0	NM_198321	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Silent	SNP	ENST00000297107.6	hg19	CCDS4325.1																																																																																			.	C|0.999;G|0.001		0.527	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	
ATP10B	23120	hgsc.bcm.edu	37	5	160059155	160059155	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:160059155A>G	ENST00000327245.5	-	13	2447	c.1601T>C	c.(1600-1602)gTg>gCg	p.V534A	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	534					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTGAAGGCCACAGGAGGCTG	0.552																																					p.V534A		Atlas-SNP	.											.	ATP10B	201	.	0			c.T1601C						.						57.0	60.0	59.0					5																	160059155		1900	4128	6028	SO:0001583	missense	23120	exon13			AAGGCCACAGGAG	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1601T>C	chr5.hg19:g.160059155A>G	ENSP00000313600:p.Val534Ala	55.0	0.0		60.0	28.0	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	hg19	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	A	10.71	1.427275	0.25726	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	T;T	0.42513	0.97;2.07	5.3	5.3	0.74995	HAD-like domain (1);	0.153524	0.43110	D	0.000611	T	0.51227	0.1662	L	0.31207	0.915	0.41053	D	0.985313	D;P	0.76494	0.999;0.775	D;B	0.80764	0.994;0.426	T	0.48779	-0.9005	9	.	.	.	.	14.4591	0.67438	1.0:0.0:0.0:0.0	.	142;534	Q2YDW8;O94823	.;AT10B_HUMAN	A	534;142	ENSP00000313600:V534A;ENSP00000431081:V142A	.	V	-	2	0	ATP10B	159991733	1.000000	0.71417	0.997000	0.53966	0.877000	0.50540	4.844000	0.62846	2.000000	0.58554	0.533000	0.62120	GTG	.	.		0.552	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
FLT4	2324	hgsc.bcm.edu	37	5	180043367	180043367	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:180043367A>T	ENST00000261937.6	-	23	3297	c.3219T>A	c.(3217-3219)agT>agA	p.S1073R	FLT4_ENST00000393347.3_Splice_Site_p.S1073R|FLT4_ENST00000502649.1_Splice_Site_p.S1073R	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1073	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGCACTCACACTGCCCTTGC	0.607																																					p.S1073R	Colon(97;1075 1466 27033 27547 35871)	Atlas-SNP	.											.	FLT4	356	.	0			c.T3219A						.						115.0	103.0	107.0					5																	180043367		2203	4300	6503	SO:0001630	splice_region_variant	2324	exon23			ACTCACACTGCCC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3219+1T>A	chr5.hg19:g.180043367A>T		78.0	0.0		57.0	19.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	hg19	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.121663	0.37436	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000512795	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	3.19	-6.38	0.01957	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.73148	0.3550	L	0.28192	0.835	0.44168	D	0.996978	B;B	0.27229	0.172;0.172	B;B	0.38755	0.281;0.281	T	0.56001	-0.8051	8	.	.	.	.	13.0451	0.58922	0.4616:0.0:0.5384:0.0	.	1073;1073	E9PD35;P35916	.;VGFR3_HUMAN	R	1073;1073;1073;111	ENSP00000261937:S1073R;ENSP00000377016:S1073R;ENSP00000426057:S1073R;ENSP00000421535:S111R	.	S	-	3	2	FLT4	179975973	0.000000	0.05858	0.707000	0.30419	0.678000	0.39670	-1.980000	0.01492	-2.377000	0.00597	-1.369000	0.01192	AGT	.	.		0.607	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		Missense_Mutation
CD83	9308	hgsc.bcm.edu	37	6	14118190	14118190	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:14118190T>C	ENST00000379153.3	+	2	218	c.47T>C	c.(46-48)cTg>cCg	p.L16P		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	16					defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				GCCTACAGCCTGGCTCCCGCG	0.682																																					p.L16P		Atlas-SNP	.											.	CD83	23	.	0			c.T47C						.						22.0	23.0	23.0					6																	14118190		2203	4300	6503	SO:0001583	missense	9308	exon2			ACAGCCTGGCTCC	Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.47T>C	chr6.hg19:g.14118190T>C	ENSP00000368450:p.Leu16Pro	41.0	0.0		54.0	27.0	NM_004233	Q5THX9	Missense_Mutation	SNP	ENST00000379153.3	hg19	CCDS4532.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.589937	0.46214	.	.	ENSG00000112149	ENST00000379153	T	0.53640	0.61	4.74	3.54	0.40534	.	0.831157	0.10016	N	0.726548	T	0.48943	0.1528	L	0.58101	1.795	0.51233	D	0.999917	D	0.63046	0.992	D	0.64144	0.922	T	0.43180	-0.9407	10	0.66056	D	0.02	-14.2866	8.3337	0.32202	0.0:0.0:0.2005:0.7995	.	16	Q01151	CD83_HUMAN	P	16	ENSP00000368450:L16P	ENSP00000368450:L16P	L	+	2	0	CD83	14226169	1.000000	0.71417	0.924000	0.36721	0.225000	0.24961	3.739000	0.55075	0.633000	0.30452	0.402000	0.26972	CTG	.	.		0.682	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
SLC35B2	347734	hgsc.bcm.edu	37	6	44224447	44224447	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:44224447G>T	ENST00000393812.3	-	2	323	c.180C>A	c.(178-180)ttC>ttA	p.F60L	SLC35B2_ENST00000495706.1_Intron|SLC35B2_ENST00000393810.1_Missense_Mutation_p.F60L|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000537814.1_Intron|SLC35B2_ENST00000538577.1_Nonsense_Mutation_p.S19*	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	60					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCTTCCGCCTGAAGTACTGCA	0.547																																					p.F60L		Atlas-SNP	.											.	SLC35B2	40	.	0			c.C180A						.						121.0	129.0	127.0					6																	44224447		2203	4300	6503	SO:0001583	missense	347734	exon2			CCGCCTGAAGTAC	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.180C>A	chr6.hg19:g.44224447G>T	ENSP00000377401:p.Phe60Leu	188.0	0.0		214.0	91.0	NM_178148	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	ENST00000393812.3	hg19	CCDS34462.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	37|37	6.227525|6.227525	0.97394|0.97394	.|.	.|.	ENSG00000157593|ENSG00000157593	ENST00000393810;ENST00000393812;ENST00000341553|ENST00000538577	T|.	0.26810|.	1.71|.	4.02|4.02	0.995|0.995	0.19838|0.19838	.|.	0.692137|.	0.14639|.	N|.	0.307359|.	T|.	0.18425|.	0.0442|.	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.06092|.	-1.0846|.	10|.	0.26408|0.26408	T|T	0.33|0.33	-16.7379|-16.7379	4.8954|4.8954	0.13748|0.13748	0.1671:0.0:0.5276:0.3053|0.1671:0.0:0.5276:0.3053	.|.	60|.	Q8TB61|.	S35B2_HUMAN|.	L|X	60|19	ENSP00000377401:F60L|.	ENSP00000342455:F60L|ENSP00000443845:S19X	F|S	-|-	3|2	2|0	SLC35B2|SLC35B2	44332425|44332425	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.920000|0.920000	0.55202|0.55202	1.086000|1.086000	0.30853|0.30853	-0.015000|-0.015000	0.14150|0.14150	-0.291000|-0.291000	0.09656|0.09656	TTC|TCA	.	.		0.547	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
CEP57L1	285753	hgsc.bcm.edu	37	6	109481821	109481821	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:109481821T>G	ENST00000517392.1	+	10	1489	c.1063T>G	c.(1063-1065)Tca>Gca	p.S355A	CEP57L1_ENST00000407272.1_Missense_Mutation_p.S355A|CEP57L1_ENST00000520883.1_Missense_Mutation_p.S255A|CEP57L1_ENST00000336977.4_Missense_Mutation_p.S255A|CEP57L1_ENST00000523787.1_Missense_Mutation_p.S358A|CEP57L1_ENST00000359793.3_Missense_Mutation_p.S355A|CEP57L1_ENST00000368968.2_Missense_Mutation_p.S355A|CEP57L1_ENST00000368970.2_Missense_Mutation_p.S372A|CEP57L1_ENST00000521522.1_Missense_Mutation_p.S302A	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	355					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						TGAAAGTCATTCAGTCTGTGA	0.333																																					p.S355A		Atlas-SNP	.											.	CEP57L1	24	.	0			c.T1063G						.						86.0	84.0	84.0					6																	109481821		2203	4298	6501	SO:0001583	missense	285753	exon10			AGTCATTCAGTCT	AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.1063T>G	chr6.hg19:g.109481821T>G	ENSP00000427844:p.Ser355Ala	398.0	0.0		362.0	173.0	NM_001271853	G5E992	Missense_Mutation	SNP	ENST00000517392.1	hg19	CCDS5071.1	.	.	.	.	.	.	.	.	.	.	T	0.079	-1.187619	0.01620	.	.	ENSG00000183137	ENST00000517392;ENST00000407272;ENST00000336977;ENST00000521522;ENST00000368968;ENST00000368970;ENST00000520883;ENST00000523787;ENST00000359793;ENST00000523174	T;T;T;T;T;T;T;T;T	0.43294	0.99;0.99;0.96;0.95;0.99;0.95;0.96;0.99;0.99	5.19	2.82	0.32997	.	0.713091	0.13499	N	0.383388	T	0.14313	0.0346	L	0.50919	1.6	0.09310	N	1	B;B	0.13594	0.008;0.008	B;B	0.16289	0.015;0.009	T	0.14448	-1.0472	10	0.33940	T	0.23	-0.5491	3.2066	0.06667	0.1336:0.0802:0.4054:0.3809	.	355;355	Q8IYX8;G5E992	CE57L_HUMAN;.	A	355;355;255;302;355;372;255;358;355;136	ENSP00000427844:S355A;ENSP00000383936:S355A;ENSP00000337392:S255A;ENSP00000428344:S302A;ENSP00000357964:S355A;ENSP00000357966:S372A;ENSP00000430011:S255A;ENSP00000430529:S358A;ENSP00000352841:S355A	ENSP00000337392:S255A	S	+	1	0	CEP57L1	109588514	0.001000	0.12720	0.023000	0.16930	0.142000	0.21351	0.668000	0.25127	1.069000	0.40788	0.528000	0.53228	TCA	.	.		0.333	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041734.4	NM_173830	
SLC22A16	85413	hgsc.bcm.edu	37	6	110763848	110763848	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:110763848C>A	ENST00000368919.3	-	4	848	c.782G>T	c.(781-783)gGa>gTa	p.G261V	SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000439654.1_Missense_Mutation_p.G261V|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000330550.4_Missense_Mutation_p.G227V	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	261					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	GACCAAGTATCCTGTCAAAGC	0.502																																					p.G261V		Atlas-SNP	.											.	SLC22A16	81	.	0			c.G782T						.						98.0	96.0	96.0					6																	110763848		2203	4300	6503	SO:0001583	missense	85413	exon4			AAGTATCCTGTCA		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.782G>T	chr6.hg19:g.110763848C>A	ENSP00000357915:p.Gly261Val	106.0	0.0		112.0	46.0	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	hg19	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.813713	0.70912	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378	T;T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07;0.07	4.54	3.65	0.41850	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.104543	0.64402	D	0.000003	T	0.69886	0.3161	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.99	T	0.76708	-0.2860	10	0.87932	D	0	.	14.6209	0.68584	0.0:0.8528:0.1472:0.0	.	261;227	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	V	261;178;227;261;91;218	ENSP00000357915:G261V;ENSP00000395642:G178V;ENSP00000328583:G227V;ENSP00000408799:G261V;ENSP00000409306:G91V;ENSP00000416310:G218V	ENSP00000328583:G227V	G	-	2	0	SLC22A16	110870541	1.000000	0.71417	0.419000	0.26584	0.917000	0.54804	4.295000	0.59049	0.992000	0.38840	0.655000	0.94253	GGA	.	.		0.502	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
NCOA7	135112	hgsc.bcm.edu	37	6	126199417	126199417	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:126199417C>G	ENST00000368357.3	+	6	712	c.360C>G	c.(358-360)aaC>aaG	p.N120K	NCOA7_ENST00000229634.9_Missense_Mutation_p.N16K|RN7SKP56_ENST00000410513.1_RNA|NCOA7_ENST00000392477.2_Missense_Mutation_p.N120K	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	120					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		AGGCTGGAAACCAGGACACCC	0.318																																					p.N120K		Atlas-SNP	.											.	NCOA7	92	.	0			c.C360G						.						88.0	81.0	83.0					6																	126199417		2203	4300	6503	SO:0001583	missense	135112	exon6			TGGAAACCAGGAC	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.360C>G	chr6.hg19:g.126199417C>G	ENSP00000357341:p.Asn120Lys	115.0	0.0		104.0	46.0	NM_001199619	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	hg19	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.403278	0.42613	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000417494;ENST00000229634	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.58	2.85	0.33270	Peptidoglycan-binding Lysin subgroup (1);Peptidoglycan-binding lysin domain (1);	0.372102	0.33792	N	0.004552	T	0.05593	0.0147	N	0.02225	-0.63	0.26556	N	0.973827	B;B;B;B	0.20164	0.042;0.034;0.01;0.007	B;B;B;B	0.22152	0.038;0.023;0.022;0.024	T	0.32981	-0.9886	10	0.45353	T	0.12	-19.4636	9.7919	0.40710	0.0:0.7009:0.0:0.2991	.	120;120;120;120	B3KXK4;Q8NI08-2;Q8NI08-4;Q8NI08	.;.;.;NCOA7_HUMAN	K	120;120;120;16	ENSP00000357341:N120K;ENSP00000376269:N120K;ENSP00000406363:N120K;ENSP00000229634:N16K	ENSP00000229634:N16K	N	+	3	2	NCOA7	126241110	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.905000	0.39878	0.403000	0.25479	0.655000	0.94253	AAC	.	.		0.318	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
IL20RA	53832	hgsc.bcm.edu	37	6	137330583	137330583	+	Silent	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:137330583G>T	ENST00000316649.5	-	4	685	c.450C>A	c.(448-450)tcC>tcA	p.S150S	IL20RA_ENST00000541547.1_Silent_p.S101S|IL20RA_ENST00000367748.1_Silent_p.S39S|IL20RA_ENST00000468393.1_5'UTR|IL20RA_ENST00000367746.3_Silent_p.S150S	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	150	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		CAACAGAAATGGACTTCTCAT	0.428																																					p.S150S		Atlas-SNP	.											.	IL20RA	54	.	0			c.C450A						.						121.0	115.0	117.0					6																	137330583		2203	4300	6503	SO:0001819	synonymous_variant	53832	exon4			AGAAATGGACTTC	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.450C>A	chr6.hg19:g.137330583G>T		89.0	0.0		96.0	33.0	NM_014432	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Silent	SNP	ENST00000316649.5	hg19	CCDS5181.1																																																																																			.	.		0.428	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432	
FNDC1	84624	hgsc.bcm.edu	37	6	159672391	159672391	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:159672391C>A	ENST00000297267.9	+	17	5092	c.4892C>A	c.(4891-4893)gCa>gAa	p.A1631E	FNDC1_ENST00000340366.6_Missense_Mutation_p.A1568E	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1631					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CTGACTGATGCACTGGATCAC	0.512																																					p.A1631E		Atlas-SNP	.											.	FNDC1	250	.	0			c.C4892A						.						75.0	72.0	73.0					6																	159672391		2037	4188	6225	SO:0001583	missense	84624	exon17			CTGATGCACTGGA	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.4892C>A	chr6.hg19:g.159672391C>A	ENSP00000297267:p.Ala1631Glu	74.0	0.0		107.0	36.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	hg19	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.8|29.8	5.038978|5.038978	0.93630|0.93630	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.15952|.	2.38;3.2|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.180079|.	0.48767|.	D|.	0.000176|.	T|.	0.69851|.	0.3157|.	M|M	0.68952|0.68952	2.095|2.095	0.54753|0.54753	D|D	0.999987|0.999987	D|.	0.89917|.	1.0|.	D|.	0.74348|.	0.983|.	T|.	0.67515|.	-0.5651|.	9|.	.|.	.|.	.|.	-11.5313|-11.5313	19.4668|19.4668	0.94946|0.94946	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1631|.	Q4ZHG4|.	FNDC1_HUMAN|.	E|X	1631;1568|1526	ENSP00000297267:A1631E;ENSP00000342460:A1568E|.	.|.	A|C	+|+	2|3	0|2	FNDC1|FNDC1	159592381|159592381	1.000000|1.000000	0.71417|0.71417	0.885000|0.885000	0.34714|0.34714	0.989000|0.989000	0.77384|0.77384	5.858000|5.858000	0.69532|0.69532	2.613000|2.613000	0.88420|0.88420	0.585000|0.585000	0.79938|0.79938	GCA|TGC	.	.		0.512	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
IKZF1	10320	hgsc.bcm.edu	37	7	50450271	50450271	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr7:50450271C>T	ENST00000331340.3	+	5	610	c.455C>T	c.(454-456)gCc>gTc	p.A152V	IKZF1_ENST00000349824.4_Intron|IKZF1_ENST00000440768.2_Missense_Mutation_p.A152V|IKZF1_ENST00000438033.1_Missense_Mutation_p.A65V|IKZF1_ENST00000439701.1_Missense_Mutation_p.A152V|IKZF1_ENST00000343574.5_Missense_Mutation_p.A65V|IKZF1_ENST00000359197.5_Missense_Mutation_p.A152V|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000357364.4_Missense_Mutation_p.A152V	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	152					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CAGTGCGGGGCCTCATTCACC	0.602			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.A152V		Atlas-SNP	.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	IKZF1	613	.	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)	c.C455T						.						32.0	37.0	35.0					7																	50450271		2131	4255	6386	SO:0001583	missense	10320	exon5			GCGGGGCCTCATT	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.455C>T	chr7.hg19:g.50450271C>T	ENSP00000331614:p.Ala152Val	53.0	0.0		64.0	24.0	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	hg19		.	.	.	.	.	.	.	.	.	.	C	34	5.330018	0.95733	.	.	ENSG00000185811	ENST00000343574;ENST00000359197;ENST00000440768;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;2.2;1.21;1.21	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.64886	0.2639	.	.	.	0.80722	D	1	D;D;P	0.76494	0.999;0.966;0.608	D;P;P	0.85130	0.997;0.801;0.722	T	0.62918	-0.6752	9	0.52906	T	0.07	-22.7845	20.6634	0.99662	0.0:1.0:0.0:0.0	.	65;152;152	Q13422-2;Q13422-7;Q13422	.;.;IKZF1_HUMAN	V	65;152;152;152;152;65;152	ENSP00000342750:A65V;ENSP00000352123:A152V;ENSP00000401507:A152V;ENSP00000349928:A152V;ENSP00000331614:A152V;ENSP00000396554:A65V;ENSP00000413025:A152V	ENSP00000331614:A152V	A	+	2	0	IKZF1	50417765	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.815000	0.86186	2.894000	0.99253	0.655000	0.94253	GCC	.	.		0.602	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
RUNDC3B	154661	hgsc.bcm.edu	37	7	87369128	87369128	+	Silent	SNP	A	A	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr7:87369128A>C	ENST00000338056.3	+	6	942	c.531A>C	c.(529-531)gcA>gcC	p.A177A	RUNDC3B_ENST00000493037.1_Silent_p.A160A|RUNDC3B_ENST00000394654.3_Silent_p.A160A|RUNDC3B_ENST00000496000.1_3'UTR	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	177	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					AAGATGGAGCAATTGTCTTGG	0.318																																					p.A177A		Atlas-SNP	.											.	RUNDC3B	63	.	0			c.A531C						.						66.0	65.0	66.0					7																	87369128		2203	4300	6503	SO:0001819	synonymous_variant	154661	exon6			TGGAGCAATTGTC		CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.531A>C	chr7.hg19:g.87369128A>C		66.0	0.0		57.0	20.0	NM_138290	B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Silent	SNP	ENST00000338056.3	hg19	CCDS5609.1																																																																																			.	.		0.318	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253679.1	NM_138290	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121652900	121652900	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr7:121652900A>T	ENST00000393386.2	+	12	4211	c.3800A>T	c.(3799-3801)gAg>gTg	p.E1267V	PTPRZ1_ENST00000483028.1_3'UTR|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1267					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TATGCAAGTGAGAAATATGAA	0.398																																					p.E1267V		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.A3800T						.						92.0	93.0	93.0					7																	121652900		2203	4300	6503	SO:0001583	missense	5803	exon12			CAAGTGAGAAATA	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3800A>T	chr7.hg19:g.121652900A>T	ENSP00000377047:p.Glu1267Val	94.0	0.0		91.0	36.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	hg19	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.621581	0.28889	.	.	ENSG00000106278	ENST00000393386	T	0.52754	0.65	5.16	5.16	0.70880	.	0.208441	0.33401	N	0.004954	T	0.49372	0.1553	M	0.62723	1.935	0.80722	D	1	P	0.43477	0.808	B	0.41860	0.368	T	0.54807	-0.8238	10	0.52906	T	0.07	.	15.1545	0.72730	1.0:0.0:0.0:0.0	.	1267	P23471	PTPRZ_HUMAN	V	1267	ENSP00000377047:E1267V	ENSP00000377047:E1267V	E	+	2	0	PTPRZ1	121440136	1.000000	0.71417	0.993000	0.49108	0.458000	0.32498	6.533000	0.73829	2.160000	0.67779	0.454000	0.30748	GAG	.	.		0.398	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
ZMAT4	79698	hgsc.bcm.edu	37	8	40532253	40532253	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr8:40532253C>A	ENST00000297737.6	-	5	693	c.547G>T	c.(547-549)Ggg>Tgg	p.G183W	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	183						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			AGGGTTGTCCCCAGTTGTTCT	0.473																																					p.G183W		Atlas-SNP	.											.	ZMAT4	47	.	0			c.G547T						.						148.0	137.0	141.0					8																	40532253		2203	4300	6503	SO:0001583	missense	79698	exon5			TTGTCCCCAGTTG	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.547G>T	chr8.hg19:g.40532253C>A	ENSP00000297737:p.Gly183Trp	105.0	0.0		100.0	42.0	NM_024645	Q8WUT8	Missense_Mutation	SNP	ENST00000297737.6	hg19	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951155	0.53186	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	T;T	0.54479	0.7;0.57	5.85	4.98	0.66077	.	0.088880	0.85682	D	0.000000	T	0.77452	0.4132	M	0.91510	3.215	0.52501	D	0.999958	D	0.89917	1.0	D	0.79784	0.993	T	0.83041	-0.0157	10	0.87932	D	0	-19.7587	13.9182	0.63914	0.0:0.926:0.0:0.074	.	183	Q9H898	ZMAT4_HUMAN	W	183	ENSP00000297737:G183W;ENSP00000428423:G183W	ENSP00000297737:G183W	G	-	1	0	ZMAT4	40651410	1.000000	0.71417	0.866000	0.34008	0.261000	0.26267	7.404000	0.79996	1.485000	0.48380	-0.252000	0.11476	GGG	.	.		0.473	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645	
KIAA1429	25962	hgsc.bcm.edu	37	8	95508121	95508121	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr8:95508121T>C	ENST00000297591.5	-	19	4459		c.e19-2		KIAA1429_ENST00000437199.1_Splice_Site	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TGAATGTTCCTAGATACAAAT	0.373																																					.		Atlas-SNP	.											.	KIAA1429	176	.	0			c.4384-2A>G						.						72.0	65.0	68.0					8																	95508121		2203	4300	6503	SO:0001630	splice_region_variant	25962	exon20			TGTTCCTAGATAC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4384-2A>G	chr8.hg19:g.95508121T>C		59.0	0.0		61.0	23.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Splice_Site	SNP	ENST00000297591.5	hg19	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.141614	0.57044	.	.	ENSG00000164944	ENST00000297591	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.12	0.48284	0.1382:0.0:0.0:0.8618	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA1429	95577297	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	7.148000	0.77389	2.020000	0.59435	0.528000	0.53228	.	.	.		0.373	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	Intron
COL14A1	7373	hgsc.bcm.edu	37	8	121282378	121282378	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr8:121282378G>A	ENST00000297848.3	+	26	3448	c.3178G>A	c.(3178-3180)Gga>Aga	p.G1060R	COL14A1_ENST00000309791.4_Missense_Mutation_p.G1060R|COL14A1_ENST00000247781.3_Missense_Mutation_p.G965R|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CAGCACTGTTGGAGCCCTGAA	0.383																																					p.G1060R		Atlas-SNP	.											.	COL14A1	292	.	0			c.G3178A						.						90.0	85.0	87.0					8																	121282378		2203	4299	6502	SO:0001583	missense	7373	exon26			ACTGTTGGAGCCC		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3178G>A	chr8.hg19:g.121282378G>A	ENSP00000297848:p.Gly1060Arg	85.0	0.0		83.0	35.0	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	hg19	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849903	0.91277	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	T;T;T	0.77620	-1.11;-1.11;-1.11	5.21	5.21	0.72293	von Willebrand factor, type A (3);	0.051819	0.85682	D	0.000000	D	0.84561	0.5499	L	0.42529	1.33	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.85113	0.0964	10	0.59425	D	0.04	.	18.9528	0.92646	0.0:0.0:1.0:0.0	.	1060	Q05707	COEA1_HUMAN	R	1060;1060;965	ENSP00000311809:G1060R;ENSP00000297848:G1060R;ENSP00000247781:G965R	ENSP00000247781:G965R	G	+	1	0	COL14A1	121351559	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.657000	0.98554	2.716000	0.92895	0.561000	0.74099	GGA	.	.		0.383	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
KLHL38	340359	hgsc.bcm.edu	37	8	124664197	124664197	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr8:124664197T>C	ENST00000325995.7	-	1	993	c.970A>G	c.(970-972)Aag>Gag	p.K324E	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	324										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						GCAGAGGCCTTGTACAGCCGT	0.582																																					p.K324E		Atlas-SNP	.											.	KLHL38	81	.	0			c.A970G						.						67.0	70.0	69.0					8																	124664197		2017	4171	6188	SO:0001583	missense	340359	exon1			AGGCCTTGTACAG		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.970A>G	chr8.hg19:g.124664197T>C	ENSP00000321475:p.Lys324Glu	80.0	0.0		109.0	50.0	NM_001081675	A0PK12	Missense_Mutation	SNP	ENST00000325995.7	hg19	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	T	14.02	2.411100	0.42817	.	.	ENSG00000175946	ENST00000325995	T	0.65916	-0.18	5.18	5.18	0.71444	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.50956	0.1646	L	0.32530	0.975	0.52099	D	0.999942	P	0.37985	0.613	B	0.38264	0.269	T	0.46898	-0.9158	10	0.13108	T	0.6	.	15.3281	0.74182	0.0:0.0:0.0:1.0	.	324	Q2WGJ6	KLH38_HUMAN	E	324	ENSP00000321475:K324E	ENSP00000321475:K324E	K	-	1	0	KLHL38	124733378	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	6.092000	0.71414	2.079000	0.62486	0.459000	0.35465	AAG	.	.		0.582	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1		
PRUNE2	158471	hgsc.bcm.edu	37	9	79318782	79318782	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:79318782C>T	ENST00000376718.3	-	9	7870	c.7747G>A	c.(7747-7749)Gaa>Aaa	p.E2583K	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E2224K	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2583					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGCCCTGTTTCTTTGGAACCT	0.418																																					p.E2583K		Atlas-SNP	.											.	PRUNE2	331	.	0			c.G7747A						.						145.0	134.0	137.0					9																	79318782		1568	3582	5150	SO:0001583	missense	158471	exon9			CTGTTTCTTTGGA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7747G>A	chr9.hg19:g.79318782C>T	ENSP00000365908:p.Glu2583Lys	101.0	0.0		84.0	36.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.75|10.75	1.438340|1.438340	0.25900|0.25900	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.51071|.	0.72;0.73|.	5.63|5.63	3.73|3.73	0.42828|0.42828	.|.	0.319252|.	0.27354|.	N|.	0.019760|.	T|T	0.63768|0.63768	0.2539|0.2539	L|L	0.56769|0.56769	1.78|1.78	0.46954|0.46954	D|D	0.999264|0.999264	P;P|.	0.39282|.	0.617;0.666|.	B;B|.	0.35039|.	0.173;0.194|.	T|T	0.62817|0.62817	-0.6774|-0.6774	10|5	0.66056|.	D|.	0.02|.	-6.7965|-6.7965	13.4498|13.4498	0.61163|0.61163	0.0:0.4449:0.555:0.0|0.0:0.4449:0.555:0.0	.|.	2583;2583|.	Q8WUY3-3;Q8WUY3|.	.;PRUN2_HUMAN|.	K|K	2583;2224;2582|1904	ENSP00000365908:E2583K;ENSP00000397425:E2224K|.	ENSP00000365908:E2583K|.	E|R	-|-	1|2	0|0	PRUNE2|PRUNE2	78508602|78508602	0.891000|0.891000	0.30450|0.30450	0.035000|0.035000	0.18076|0.18076	0.006000|0.006000	0.05464|0.05464	1.099000|1.099000	0.31013|0.31013	1.356000|1.356000	0.45884|0.45884	0.591000|0.591000	0.81541|0.81541	GAA|AGA	.	.		0.418	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
GNAQ	2776	hgsc.bcm.edu	37	9	80537145	80537145	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:80537145T>G	ENST00000286548.4	-	2	475	c.253A>C	c.(253-255)Acg>Ccg	p.T85P		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	85					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						TGCATGGCCGTGAAGATGTTC	0.468			Mis		uveal melanoma																																p.T85P		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	GNAQ	384	.	0			c.A253C						.						239.0	199.0	213.0					9																	80537145		2203	4300	6503	SO:0001583	missense	2776	exon2			TGGCCGTGAAGAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.253A>C	chr9.hg19:g.80537145T>G	ENSP00000286548:p.Thr85Pro	67.0	0.0		57.0	20.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.161484	0.78226	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.88741	-2.42;-2.42	5.87	5.87	0.94306	G protein alpha subunit, helical insertion (2);	0.045905	0.85682	D	0.000000	D	0.93641	0.7969	M	0.83012	2.62	0.80722	D	1	B	0.22851	0.076	P	0.45119	0.47	D	0.92582	0.6075	10	0.72032	D	0.01	.	16.2813	0.82687	0.0:0.0:0.0:1.0	.	85	P50148	GNAQ_HUMAN	P	85;56	ENSP00000286548:T85P;ENSP00000391501:T56P	ENSP00000286548:T85P	T	-	1	0	GNAQ	79726965	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.040000	0.89188	2.244000	0.73946	0.533000	0.62120	ACG	.	.		0.468	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
FBP2	8789	hgsc.bcm.edu	37	9	97325637	97325637	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:97325637C>A	ENST00000375337.3	-	6	878	c.812G>T	c.(811-813)aGc>aTc	p.S271I	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	271					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				GCCCTTAGGGCTCTTCTGGTT	0.602																																					p.S271I		Atlas-SNP	.											.	FBP2	26	.	0			c.G812T						.						124.0	110.0	115.0					9																	97325637		2203	4300	6503	SO:0001583	missense	8789	exon6			TTAGGGCTCTTCT	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.812G>T	chr9.hg19:g.97325637C>A	ENSP00000364486:p.Ser271Ile	91.0	0.0		64.0	27.0	NM_003837	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	hg19	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	.	19.14	3.770242	0.69992	.	.	ENSG00000130957	ENST00000375337	T	0.72942	-0.7	4.82	2.98	0.34508	.	0.209991	0.64402	D	0.000020	D	0.82462	0.5042	M	0.83774	2.66	0.80722	D	1	D	0.64830	0.994	D	0.67548	0.952	D	0.83458	0.0052	10	0.87932	D	0	-7.7843	11.0091	0.47652	0.0:0.8485:0.0:0.1515	.	271	O00757	F16P2_HUMAN	I	271	ENSP00000364486:S271I	ENSP00000364486:S271I	S	-	2	0	FBP2	96365458	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	3.041000	0.49807	0.650000	0.30769	-0.384000	0.06662	AGC	.	.		0.602	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837	
OR13C3	138803	hgsc.bcm.edu	37	9	107298521	107298521	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:107298521G>A	ENST00000374781.2	-	1	616	c.574C>T	c.(574-576)Ctt>Ttt	p.L192F		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						CTCATGGCAAGTAATGTTTGC	0.453																																					p.L192F	GBM(86;1248 1274 14222 15028 46219)	Atlas-SNP	.											.	OR13C3	45	.	0			c.C574T						.						137.0	137.0	137.0					9																	107298521		2203	4300	6503	SO:0001583	missense	138803	exon1			TGGCAAGTAATGT		CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.574C>T	chr9.hg19:g.107298521G>A	ENSP00000363913:p.Leu192Phe	124.0	0.0		169.0	81.0	NM_001001961	Q5VVG1|Q6IF52	Missense_Mutation	SNP	ENST00000374781.2	hg19	CCDS35089.1	.	.	.	.	.	.	.	.	.	.	G	9.337	1.062024	0.19987	.	.	ENSG00000204246	ENST00000374781	T	0.00145	8.67	4.45	3.55	0.40652	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37219	N	0.002197	T	0.00144	0.0004	L	0.35288	1.05	0.20403	N	0.999907	P	0.37061	0.58	B	0.41036	0.346	T	0.38650	-0.9651	10	0.35671	T	0.21	.	10.1372	0.42715	0.0982:0.0:0.9018:0.0	.	192	Q8NGS6	O13C3_HUMAN	F	192	ENSP00000363913:L192F	ENSP00000363913:L192F	L	-	1	0	OR13C3	106338342	0.268000	0.24133	0.960000	0.40013	0.227000	0.25037	0.775000	0.26689	1.221000	0.43506	0.591000	0.81541	CTT	.	.		0.453	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053477.2		
OR1L3	26735	hgsc.bcm.edu	37	9	125437750	125437750	+	Silent	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:125437750C>A	ENST00000304820.2	+	1	436	c.342C>A	c.(340-342)ctC>ctA	p.L114L		NM_001005234.1	NP_001005234.1	Q8NH93	OR1L3_HUMAN	olfactory receptor, family 1, subfamily L, member 3	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	16						ATAGTTATCTCCTGGCGGCTA	0.433																																					p.L114L		Atlas-SNP	.											.	OR1L3	51	.	0			c.C342A						.						153.0	154.0	154.0					9																	125437750		2203	4300	6503	SO:0001819	synonymous_variant	26735	exon1			TTATCTCCTGGCG		CCDS35128.1	9q33.2	2013-09-20			ENSG00000171481	ENSG00000171481		"""GPCR / Class A : Olfactory receptors"""	8215	protein-coding gene	gene with protein product							Standard	NM_001005234		Approved	OR9-D	uc011lzb.2	Q8NH93	OTTHUMG00000020619	ENST00000304820.2:c.342C>A	chr9.hg19:g.125437750C>A		62.0	0.0		76.0	25.0	NM_001005234	B2RNF4|Q6IFN1	Silent	SNP	ENST00000304820.2	hg19	CCDS35128.1																																																																																			.	.		0.433	OR1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053950.1		
NR5A1	2516	hgsc.bcm.edu	37	9	127253385	127253385	+	Silent	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:127253385G>A	ENST00000373588.4	-	6	1309	c.1113C>T	c.(1111-1113)ctC>ctT	p.L371L		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	371	Important for dimerization.				adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						TGATGAACTTGAGGCAGACAA	0.652																																					p.L371L		Atlas-SNP	.											.	NR5A1	32	.	0			c.C1113T						.						17.0	18.0	17.0					9																	127253385		2200	4298	6498	SO:0001819	synonymous_variant	2516	exon6			GAACTTGAGGCAG	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.1113C>T	chr9.hg19:g.127253385G>A		131.0	0.0		131.0	53.0	NM_004959	O15196|Q5T6F5	Silent	SNP	ENST00000373588.4	hg19	CCDS6856.1																																																																																			.	.		0.652	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
RALGDS	5900	hgsc.bcm.edu	37	9	135983386	135983386	+	Silent	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr9:135983386G>A	ENST00000372050.3	-	6	1207	c.1186C>T	c.(1186-1188)Ctg>Ttg	p.L396L	RALGDS_ENST00000542690.1_Silent_p.L467L|RALGDS_ENST00000372062.3_Silent_p.L367L|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000372047.3_Silent_p.L384L|RALGDS_ENST00000393160.3_Silent_p.L341L|RALGDS_ENST00000393157.3_Silent_p.L395L	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	396	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		GCATCCATCAGTGTAAACTGC	0.592			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																p.L396L	Melanoma(189;762 2088 15384 21931 52515)	Atlas-SNP	.		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	.	RALGDS	75	.	0			c.C1186T						.						77.0	62.0	67.0					9																	135983386		2203	4299	6502	SO:0001819	synonymous_variant	5900	exon6			CCATCAGTGTAAA	AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.1186C>T	chr9.hg19:g.135983386G>A		74.0	0.0		67.0	26.0	NM_006266	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Silent	SNP	ENST00000372050.3	hg19	CCDS6959.1																																																																																			.	.		0.592	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1	NM_006266	
TAF3	83860	hgsc.bcm.edu	37	10	8051233	8051233	+	Silent	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:8051233C>T	ENST00000344293.5	+	5	2714	c.2508C>T	c.(2506-2508)tcC>tcT	p.S836S		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	836					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						ccgccgcctccGGGGCCAGTG	0.751																																					p.S836S		Atlas-SNP	.											.	TAF3	93	.	0			c.C2508T						.						7.0	7.0	7.0					10																	8051233		1524	3380	4904	SO:0001819	synonymous_variant	83860	exon5			CGCCTCCGGGGCC	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2508C>T	chr10.hg19:g.8051233C>T		49.0	0.0		51.0	29.0	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Silent	SNP	ENST00000344293.5	hg19	CCDS41487.1																																																																																			.	.		0.751	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
KIAA1217	56243	hgsc.bcm.edu	37	10	24832401	24832401	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:24832401A>G	ENST00000376454.3	+	19	4232	c.4202A>G	c.(4201-4203)cAt>cGt	p.H1401R	KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.H1084R|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396446.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1401					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGGGAGGTGCATGATATTGTT	0.458																																					p.H1401R		Atlas-SNP	.											.	KIAA1217	235	.	0			c.A4202G						.						92.0	91.0	91.0					10																	24832401		2203	4300	6503	SO:0001583	missense	56243	exon19			AGGTGCATGATAT	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4202A>G	chr10.hg19:g.24832401A>G	ENSP00000365637:p.His1401Arg	138.0	0.0		113.0	55.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	hg19	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	A	0.603	-0.828264	0.02734	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.29655	1.98;1.56	5.66	-2.54	0.06307	.	0.558711	0.18634	N	0.135510	T	0.11324	0.0276	N	0.04880	-0.145	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.004;0.004;0.001	T	0.35943	-0.9768	10	0.07482	T	0.82	.	11.8256	0.52265	0.6774:0.0:0.3226:0.0	.	1084;1084;1401	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	R	1084;1401;1084;1084	ENSP00000365637:H1401R;ENSP00000365634:H1084R	ENSP00000365634:H1084R	H	+	2	0	KIAA1217	24872407	0.660000	0.27420	0.014000	0.15608	0.014000	0.08584	1.429000	0.34903	-0.359000	0.08150	-0.366000	0.07423	CAT	.	.		0.458	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
SVIL	6840	hgsc.bcm.edu	37	10	29818721	29818721	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:29818721T>G	ENST00000355867.4	-	12	2911	c.2159A>C	c.(2158-2160)aAc>aCc	p.N720T	SVIL_ENST00000375398.2_Missense_Mutation_p.N720T|SVIL_ENST00000375400.3_Missense_Mutation_p.N326T	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	720					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CACAGCTGTGTTTCTTGAGCG	0.483																																					p.N720T		Atlas-SNP	.											.	SVIL	226	.	0			c.A2159C						.						123.0	111.0	115.0					10																	29818721		2203	4300	6503	SO:0001583	missense	6840	exon12			GCTGTGTTTCTTG	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2159A>C	chr10.hg19:g.29818721T>G	ENSP00000348128:p.Asn720Thr	68.0	0.0		64.0	28.0	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	hg19	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	T	7.792	0.711711	0.15306	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.57107	0.42;0.42;0.42	5.14	1.41	0.22369	.	0.171432	0.64402	D	0.000009	T	0.51143	0.1657	M	0.75264	2.295	0.21445	N	0.999689	P;P	0.48089	0.905;0.749	P;B	0.45610	0.487;0.345	T	0.46541	-0.9184	9	.	.	.	-15.5244	5.7999	0.18408	0.0:0.2287:0.1314:0.64	.	326;720	O95425-2;O95425	.;SVIL_HUMAN	T	326;720;720	ENSP00000364549:N326T;ENSP00000364547:N720T;ENSP00000348128:N720T	.	N	-	2	0	SVIL	29858727	0.999000	0.42202	0.000000	0.03702	0.021000	0.10359	3.128000	0.50492	0.050000	0.15949	-0.347000	0.07816	AAC	.	.		0.483	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
GJD4	219770	hgsc.bcm.edu	37	10	35897329	35897329	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:35897329T>A	ENST00000321660.1	+	2	1046	c.888T>A	c.(886-888)agT>agA	p.S296R	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	296					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						AGGATGAGAGTGAGGTGACAT	0.711																																					p.S296R		Atlas-SNP	.											.	GJD4	38	.	0			c.T888A						.						16.0	17.0	17.0					10																	35897329		2069	4082	6151	SO:0001583	missense	219770	exon2			TGAGAGTGAGGTG	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.888T>A	chr10.hg19:g.35897329T>A	ENSP00000315070:p.Ser296Arg	68.0	0.0		65.0	26.0	NM_153368	Q8N2R7	Missense_Mutation	SNP	ENST00000321660.1	hg19	CCDS7191.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.173242	0.78452	.	.	ENSG00000177291	ENST00000321660	D	0.98135	-4.74	5.86	-5.48	0.02592	.	19.071300	0.00166	N	0.000000	D	0.93844	0.8031	L	0.32530	0.975	0.09310	N	1	B	0.34290	0.447	B	0.26094	0.066	D	0.89009	0.3427	10	0.40728	T	0.16	.	10.6215	0.45483	0.0:0.5915:0.1295:0.279	.	296	Q96KN9	CXD4_HUMAN	R	296	ENSP00000315070:S296R	ENSP00000315070:S296R	S	+	3	2	GJD4	35937335	0.001000	0.12720	0.117000	0.21633	0.282000	0.26991	-1.065000	0.03458	-0.794000	0.04468	-0.274000	0.10170	AGT	.	.		0.711	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047576.1	NM_153368	
PCDH15	65217	hgsc.bcm.edu	37	10	55780163	55780163	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:55780163T>A	ENST00000320301.6	-	20	2934	c.2540A>T	c.(2539-2541)gAc>gTc	p.D847V	PCDH15_ENST00000437009.1_Missense_Mutation_p.D776V|PCDH15_ENST00000395445.1_Missense_Mutation_p.D854V|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.D847V|PCDH15_ENST00000395432.2_Missense_Mutation_p.D810V|PCDH15_ENST00000395430.1_Missense_Mutation_p.D847V|PCDH15_ENST00000395433.1_Missense_Mutation_p.D825V|PCDH15_ENST00000373965.2_Missense_Mutation_p.D854V|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.D847V|PCDH15_ENST00000395438.1_Missense_Mutation_p.D847V|PCDH15_ENST00000409834.1_Missense_Mutation_p.D458V|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000414778.1_Missense_Mutation_p.D852V	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	847	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGCTCCAAGGTCGACATCTTT	0.398										HNSCC(58;0.16)																											p.D852V		Atlas-SNP	.											PCDH15_ENST00000417177,colon,carcinoma,-1,4	PCDH15	1715	.	0			c.A2555T						.						128.0	128.0	128.0					10																	55780163		2203	4298	6501	SO:0001583	missense	65217	exon21			CCAAGGTCGACAT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2540A>T	chr10.hg19:g.55780163T>A	ENSP00000322604:p.Asp847Val	65.0	0.0		74.0	22.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	hg19	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.425635	0.83667	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.92	5.92	0.95590	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.90403	0.6996	H	0.95816	3.725	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.999;0.999;1.0;0.995;0.998;0.999;0.999;0.998;0.992;0.999	D	0.93098	0.6506	9	0.87932	D	0	.	16.0292	0.80564	0.0:0.0:0.0:1.0	.	825;847;847;852;776;810;847;847;854;854;847;852;847;847	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	V	854;852;847;847;458;854;810;847;825;847;847;852;776;847	ENSP00000363076:D854V;ENSP00000410304:D852V;ENSP00000378826:D847V;ENSP00000386693:D458V;ENSP00000378832:D854V;ENSP00000378820:D810V;ENSP00000354950:D847V;ENSP00000378821:D825V;ENSP00000322604:D847V;ENSP00000378818:D847V;ENSP00000412628:D776V;ENSP00000363066:D847V	ENSP00000322604:D847V	D	-	2	0	PCDH15	55450169	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.274000	0.78538	2.254000	0.74563	0.528000	0.53228	GAC	.	.		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
LRRTM3	347731	hgsc.bcm.edu	37	10	68686716	68686716	+	Silent	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:68686716A>G	ENST00000361320.4	+	2	620	c.42A>G	c.(40-42)gtA>gtG	p.V14V	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	14					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						GATCAGCTGTAGCACTGGTTA	0.418																																					p.V14V		Atlas-SNP	.											.	LRRTM3	241	.	0			c.A42G						.						85.0	79.0	81.0					10																	68686716		2203	4300	6503	SO:0001819	synonymous_variant	347731	exon2			AGCTGTAGCACTG	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.42A>G	chr10.hg19:g.68686716A>G		98.0	0.0		85.0	36.0	NM_178011	A8K2A3|Q2NKX7|Q6N0A3	Silent	SNP	ENST00000361320.4	hg19	CCDS7270.1																																																																																			.	.		0.418	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011	
TYSND1	219743	hgsc.bcm.edu	37	10	71905831	71905831	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr10:71905831G>C	ENST00000287078.6	-	1	511	c.512C>G	c.(511-513)tCg>tGg	p.S171W	TYSND1_ENST00000494143.1_5'Flank|TYSND1_ENST00000335494.5_Missense_Mutation_p.S171W	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	171					protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						CTCGTCCTCCGACACTTCGTC	0.706																																					p.S171W		Atlas-SNP	.											TYSND1,NS,carcinoma,0,1	TYSND1	20	.	0			c.C512G						.						21.0	22.0	21.0					10																	71905831		2198	4286	6484	SO:0001583	missense	219743	exon1			TCCTCCGACACTT	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.512C>G	chr10.hg19:g.71905831G>C	ENSP00000287078:p.Ser171Trp	101.0	1.0		132.0	55.0	NM_173555	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Missense_Mutation	SNP	ENST00000287078.6	hg19	CCDS31213.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.542848	0.27563	.	.	ENSG00000156521	ENST00000287078;ENST00000335494	T;T	0.68181	-0.31;-0.31	3.93	3.02	0.34903	.	0.678025	0.14678	N	0.304895	T	0.71896	0.3394	L	0.57536	1.79	0.42249	D	0.991966	D;D	0.67145	0.996;0.979	P;P	0.58172	0.834;0.687	T	0.71573	-0.4552	10	0.72032	D	0.01	-22.5129	7.826	0.29315	0.1182:0.0:0.8818:0.0	.	171;171	Q2T9J0-2;Q2T9J0	.;TYSD1_HUMAN	W	171	ENSP00000287078:S171W;ENSP00000335673:S171W	ENSP00000287078:S171W	S	-	2	0	TYSND1	71575837	0.979000	0.34478	0.847000	0.33407	0.040000	0.13550	2.413000	0.44618	0.975000	0.38392	-0.657000	0.03884	TCG	.	.		0.706	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
AKIP1	56672	hgsc.bcm.edu	37	11	8940933	8940933	+	Missense_Mutation	SNP	A	A	C	rs148121612		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:8940933A>C	ENST00000309377.4	+	6	629	c.539A>C	c.(538-540)tAt>tCt	p.Y180S	AKIP1_ENST00000534147.1_Missense_Mutation_p.Y180S|AKIP1_ENST00000309357.4_Missense_Mutation_p.Y153S|AKIP1_ENST00000299576.5_Missense_Mutation_p.Y153S|AKIP1_ENST00000396648.2_Missense_Mutation_p.Y153S	NM_020642.3	NP_065693.2	Q9NQ31	AKIP1_HUMAN	A kinase (PRKA) interacting protein 1	180					substrate adhesion-dependent cell spreading (GO:0034446)	nucleus (GO:0005634)				kidney(1)|large_intestine(2)|lung(2)	5						CCAGGGACCTATTCTGTCACT	0.443																																					p.Y180S		Atlas-SNP	.											.	AKIP1	9	.	0			c.A539C						.						176.0	168.0	171.0					11																	8940933		2201	4296	6497	SO:0001583	missense	56672	exon6			GGACCTATTCTGT	AF512007	CCDS7793.1, CCDS55743.1, CCDS55744.1	11p15.3	2011-04-18	2011-04-18	2011-04-18	ENSG00000166452	ENSG00000166452			1170	protein-coding gene	gene with protein product		609191	"""chromosome 11 open reading frame 17"""	C11orf17		20562110, 18178962, 15630084	Standard	NM_020642		Approved	BCA3	uc001mgx.3	Q9NQ31	OTTHUMG00000165653	ENST00000309377.4:c.539A>C	chr11.hg19:g.8940933A>C	ENSP00000310459:p.Tyr180Ser	81.0	0.0		100.0	41.0	NM_020642	Q8NBS2|Q8TAC6|Q8TAD3|Q8TAE0	Missense_Mutation	SNP	ENST00000309377.4	hg19	CCDS7793.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472495	0.84640	.	.	ENSG00000166452	ENST00000299576;ENST00000309377;ENST00000309357;ENST00000530281;ENST00000396648;ENST00000534147;ENST00000529942	T;T;T;T;T;T;T	0.62941	0.1;0.02;1.16;-0.01;0.1;0.02;0.19	6.07	6.07	0.98685	.	0.145914	0.47093	D	0.000242	T	0.79435	0.4445	M	0.78637	2.42	0.45452	D	0.998429	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.81920	-0.0712	10	0.87932	D	0	-13.4518	14.3816	0.66914	1.0:0.0:0.0:0.0	.	153;153;180	Q9NQ31-2;Q9NQ31-3;Q9NQ31	.;.;AKIP1_HUMAN	S	153;180;153;92;153;180;121	ENSP00000299576:Y153S;ENSP00000310459:Y180S;ENSP00000310644:Y153S;ENSP00000436989:Y92S;ENSP00000379885:Y153S;ENSP00000431331:Y180S;ENSP00000431602:Y121S	ENSP00000299576:Y153S	Y	+	2	0	AKIP1	8897509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.888000	0.69758	2.326000	0.78906	0.533000	0.62120	TAT	.	A|1.000;G|0.000		0.443	AKIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385615.1	NM_020642	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33628297	33628297	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:33628297C>T	ENST00000321505.4	+	13	4279	c.4099C>T	c.(4099-4101)Ccc>Tcc	p.P1367S	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.P1373S			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1367						integral component of membrane (GO:0016021)											TGCCATAAAACCCACAGCCCT	0.592																																					p.P1367S		Atlas-SNP	.											.	.	.	.	0			c.C4099T						.						42.0	47.0	45.0					11																	33628297		2045	4212	6257	SO:0001583	missense	25758	exon13			ATAAAACCCACAG	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4099C>T	chr11.hg19:g.33628297C>T	ENSP00000315295:p.Pro1367Ser	135.0	0.0		111.0	43.0	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	hg19	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974170	0.92919	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000536568	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.83543	0.5277	M	0.80746	2.51	0.49130	D	0.999759	D	0.89917	1.0	D	0.97110	1.0	D	0.85544	0.1217	9	0.87932	D	0	-12.262	19.2455	0.93901	0.0:1.0:0.0:0.0	.	1373	E9PAT2	.	S	1367;1373;1206	.	ENSP00000315295:P1367S	P	+	1	0	C11orf41	33584873	1.000000	0.71417	0.995000	0.50966	0.911000	0.54048	7.001000	0.76297	2.553000	0.86117	0.561000	0.74099	CCC	.	.		0.592	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
FNBP4	23360	hgsc.bcm.edu	37	11	47765677	47765677	+	Silent	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:47765677C>T	ENST00000263773.5	-	8	1296	c.1284G>A	c.(1282-1284)gtG>gtA	p.V428V	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	428						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						TAGACCCTGACACACTACCAT	0.413																																					p.V428V		Atlas-SNP	.											.	FNBP4	99	.	0			c.G1284A						.						116.0	106.0	109.0					11																	47765677		2060	4212	6272	SO:0001819	synonymous_variant	23360	exon8			CCCTGACACACTA	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1284G>A	chr11.hg19:g.47765677C>T		81.0	0.0		89.0	50.0	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	hg19	CCDS41644.1																																																																																			.	.		0.413	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
OR5D14	219436	hgsc.bcm.edu	37	11	55563337	55563337	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:55563337G>T	ENST00000335605.1	+	1	306	c.306G>T	c.(304-306)caG>caT	p.Q102H		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				GCATGATGCAGTACTTCCTGT	0.453																																					p.Q102H		Atlas-SNP	.											.	OR5D14	116	.	0			c.G306T						.						146.0	120.0	129.0					11																	55563337		2200	4296	6496	SO:0001583	missense	219436	exon1			GATGCAGTACTTC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.306G>T	chr11.hg19:g.55563337G>T	ENSP00000334456:p.Gln102His	82.0	0.0		81.0	32.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	hg19	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	g	10.81	1.455709	0.26161	.	.	ENSG00000186113	ENST00000335605	T	0.00472	7.19	5.08	-0.673	0.11373	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	D	0.000640	T	0.01905	0.0060	H	0.97564	4.03	0.25512	N	0.987452	D	0.89917	1.0	D	0.85130	0.997	T	0.23868	-1.0176	10	0.87932	D	0	-11.5909	6.5701	0.22533	0.3373:0.1282:0.5345:0.0	.	102	Q8NGL3	OR5DE_HUMAN	H	102	ENSP00000334456:Q102H	ENSP00000334456:Q102H	Q	+	3	2	OR5D14	55319913	0.000000	0.05858	0.113000	0.21522	0.018000	0.09664	-0.121000	0.10643	0.189000	0.20188	-0.149000	0.13747	CAG	.	.		0.453	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
SLC29A2	3177	hgsc.bcm.edu	37	11	66136932	66136932	+	Silent	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:66136932G>A	ENST00000357440.2	-	3	411	c.183C>T	c.(181-183)ccC>ccT	p.P61P	SLC29A2_ENST00000546034.1_Silent_p.P61P|SLC29A2_ENST00000311161.7_Silent_p.P61P|SLC29A2_ENST00000544554.1_Silent_p.P61P	NM_001532.2	NP_001523.2	Q14542	S29A2_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 2	61					cell proliferation (GO:0008283)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10					Didanosine(DB00900)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Zalcitabine(DB00943)|Zidovudine(DB00495)	AGGCATCCTCGGGACCCGTGT	0.627																																					p.P61P		Atlas-SNP	.											SLC29A2,NS,carcinoma,0,1	SLC29A2	24	.	0			c.C183T						.						204.0	194.0	198.0					11																	66136932		2200	4295	6495	SO:0001819	synonymous_variant	3177	exon3			ATCCTCGGGACCC	X86681	CCDS8137.1, CCDS73326.1	11q13	2013-07-17	2013-07-17		ENSG00000174669	ENSG00000174669		"""Solute carriers"""	11004	protein-coding gene	gene with protein product		602110	"""solute carrier family 29 (nucleoside transporters), member 2"""	ENT2, HNP36		9192854, 9478986	Standard	NM_001532		Approved	DER12	uc001oht.3	Q14542	OTTHUMG00000169056	ENST00000357440.2:c.183C>T	chr11.hg19:g.66136932G>A		107.0	0.0		124.0	63.0	NM_001532	B3KPY7|O43530|Q52M84|Q96R00|Q9UPE0	Silent	SNP	ENST00000357440.2	hg19	CCDS8137.1																																																																																			.	.		0.627	SLC29A2-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402093.1	NM_001532	
APOA1	335	hgsc.bcm.edu	37	11	116707867	116707867	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:116707867T>A	ENST00000236850.4	-	3	415	c.50A>T	c.(49-51)cAg>cTg	p.Q17L	APOA1_ENST00000359492.2_Missense_Mutation_p.Q17L|APOA1_ENST00000375329.2_Intron|APOA1_ENST00000375320.1_Missense_Mutation_p.Q17L|APOA1_ENST00000375323.1_Missense_Mutation_p.Q17L|AP006216.12_ENST00000444200.1_RNA	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	17					adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		ATGCCGAGCCTGGCTCCCTGA	0.637																																					p.Q17L		Atlas-SNP	.											.	APOA1	19	.	0			c.A50T	GRCh37	CI082223	APOA1	I		.						46.0	53.0	51.0					11																	116707867		2201	4293	6494	SO:0001583	missense	335	exon3			CGAGCCTGGCTCC	X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.50A>T	chr11.hg19:g.116707867T>A	ENSP00000236850:p.Gln17Leu	42.0	0.0		42.0	19.0	NM_000039	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	ENST00000236850.4	hg19	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.299122	0.81025	.	.	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375323;ENST00000236850	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.76	4.76	0.60689	.	0.000000	0.45867	U	0.000325	D	0.86397	0.5923	M	0.91406	3.205	0.54753	D	0.999988	D	0.89917	1.0	D	0.71414	0.973	D	0.89682	0.3891	10	0.87932	D	0	-28.1483	14.2749	0.66173	0.0:0.0:0.0:1.0	.	17	P02647	APOA1_HUMAN	L	17	ENSP00000364469:Q17L;ENSP00000352471:Q17L;ENSP00000364472:Q17L;ENSP00000236850:Q17L	ENSP00000236850:Q17L	Q	-	2	0	APOA1	116213077	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.597000	0.54031	1.779000	0.52309	0.379000	0.24179	CAG	.	.		0.637	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106281.2	NM_000039	
ROBO3	64221	hgsc.bcm.edu	37	11	124740076	124740076	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:124740076T>A	ENST00000397801.1	+	5	974	c.782T>A	c.(781-783)cTg>cAg	p.L261Q	ROBO3_ENST00000538940.1_Missense_Mutation_p.L239Q	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	261	Ig-like C2-type 3.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CCCTCATTCCTGCGCAGACCA	0.552																																					p.L261Q		Atlas-SNP	.											.	ROBO3	199	.	0			c.T782A						.						126.0	132.0	130.0					11																	124740076		2060	4202	6262	SO:0001583	missense	64221	exon5			CATTCCTGCGCAG	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.782T>A	chr11.hg19:g.124740076T>A	ENSP00000380903:p.Leu261Gln	107.0	0.0		117.0	54.0	NM_022370		Missense_Mutation	SNP	ENST00000397801.1	hg19	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193156	0.58017	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.41065	1.01;1.01	4.92	4.92	0.64577	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.29473	N	0.012046	T	0.55955	0.1953	L	0.52759	1.655	0.28212	N	0.926877	D	0.76494	0.999	D	0.75484	0.986	T	0.51521	-0.8695	10	0.49607	T	0.09	.	11.4352	0.50064	0.0:0.0:0.1505:0.8495	.	261	Q96MS0	ROBO3_HUMAN	Q	261;239	ENSP00000380903:L261Q;ENSP00000441797:L239Q	ENSP00000380903:L261Q	L	+	2	0	ROBO3	124245286	0.021000	0.18746	1.000000	0.80357	0.988000	0.76386	2.086000	0.41643	1.980000	0.57719	0.379000	0.24179	CTG	.	.		0.552	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
SLC37A2	219855	hgsc.bcm.edu	37	11	124949588	124949588	+	Silent	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr11:124949588T>C	ENST00000403796.2	+	6	760	c.459T>C	c.(457-459)aaT>aaC	p.N153N	SLC37A2_ENST00000308074.4_Silent_p.N153N|SLC37A2_ENST00000298280.5_Silent_p.N153N|SLC37A2_ENST00000407458.1_Silent_p.N153N	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	153					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		AGGTCTGTAATGGACTCGTCC	0.602																																					p.N153N	Melanoma(11;373 620 21213 26083 47768)	Atlas-SNP	.											.	SLC37A2	105	.	0			c.T459C						.						65.0	53.0	57.0					11																	124949588		2201	4299	6500	SO:0001819	synonymous_variant	219855	exon6			CTGTAATGGACTC	AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.459T>C	chr11.hg19:g.124949588T>C		111.0	0.0		112.0	43.0	NM_001145290	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Silent	SNP	ENST00000403796.2	hg19	CCDS44757.1																																																																																			.	.		0.602	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386837.1	XM_166184	
CCND2	894	hgsc.bcm.edu	37	12	4387935	4387935	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr12:4387935C>G	ENST00000261254.3	+	3	690	c.421C>G	c.(421-423)Ctg>Gtg	p.L141V	RP11-264F23.3_ENST00000539135.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	141	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GGAGTGGGAACTGGTGGTGCT	0.572			T	IGL@	"""NHL,CLL"""																																p.L141V		Atlas-SNP	.		Dom	yes		12	12p13	894	cyclin D2		L	.	CCND2	50	.	0			c.C421G						.						88.0	93.0	91.0					12																	4387935		2203	4300	6503	SO:0001583	missense	894	exon3			TGGGAACTGGTGG	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.421C>G	chr12.hg19:g.4387935C>G	ENSP00000261254:p.Leu141Val	63.0	0.0		62.0	23.0	NM_001759	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	hg19	CCDS8524.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.71|12.71	2.019541|2.019541	0.35606|0.35606	.|.	.|.	ENSG00000118971|ENSG00000118971	ENST00000261254|ENST00000536537	T|.	0.12361|.	2.69|.	4.79|4.79	3.67|3.67	0.42095|0.42095	Cyclin, N-terminal (1);Cyclin-like (3);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.64204|0.64204	0.2577|0.2577	L|L	0.60845|0.60845	1.875|1.875	0.80722|0.80722	D|D	1|1	B|.	0.26876|.	0.162|.	B|.	0.39904|.	0.313|.	T|T	0.63346|0.63346	-0.6658|-0.6658	10|5	0.30078|.	T|.	0.28|.	.|.	12.9677|12.9677	0.58494|0.58494	0.0:0.9053:0.0:0.0947|0.0:0.9053:0.0:0.0947	.|.	141|.	P30279|.	CCND2_HUMAN|.	V|S	141|56	ENSP00000261254:L141V|.	ENSP00000261254:L141V|.	L|T	+|+	1|2	2|0	CCND2|CCND2	4258196|4258196	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	4.071000|4.071000	0.57556|0.57556	2.198000|2.198000	0.70561|0.70561	0.561000|0.561000	0.74099|0.74099	CTG|ACT	.	.		0.572	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
KCNH3	23416	hgsc.bcm.edu	37	12	49943969	49943969	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr12:49943969G>A	ENST00000257981.6	+	10	2035	c.1775G>A	c.(1774-1776)cGg>cAg	p.R592Q		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	592					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GGCTGCCTGCGGGCACTGTCT	0.677																																					p.R592Q		Atlas-SNP	.											.	KCNH3	88	.	0			c.G1775A						.						28.0	29.0	29.0					12																	49943969		2201	4298	6499	SO:0001583	missense	23416	exon10			GCCTGCGGGCACT	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1775G>A	chr12.hg19:g.49943969G>A	ENSP00000257981:p.Arg592Gln	80.0	0.0		79.0	42.0	NM_012284	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	hg19	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	36	5.915466	0.97099	.	.	ENSG00000135519	ENST00000257981	D	0.96685	-4.09	5.48	5.48	0.80851	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.43919	D	0.000502	D	0.98369	0.9458	M	0.88570	2.965	0.54753	D	0.999986	D	0.89917	1.0	D	0.83275	0.996	D	0.99150	1.0858	10	0.87932	D	0	.	17.2178	0.86949	0.0:0.0:1.0:0.0	.	592	Q9ULD8	KCNH3_HUMAN	Q	592	ENSP00000257981:R592Q	ENSP00000257981:R592Q	R	+	2	0	KCNH3	48230236	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.869000	0.99810	2.755000	0.94549	0.655000	0.94253	CGG	.	.		0.677	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
STAB2	55576	hgsc.bcm.edu	37	12	104100584	104100584	+	Silent	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr12:104100584T>C	ENST00000388887.2	+	38	4215	c.4011T>C	c.(4009-4011)tgT>tgC	p.C1337C		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GAGAATGCTGTGCCGGCTTCT	0.532																																					p.C1337C		Atlas-SNP	.											.	STAB2	370	.	0			c.T4011C						.						123.0	122.0	122.0					12																	104100584		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon38			ATGCTGTGCCGGC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4011T>C	chr12.hg19:g.104100584T>C		107.0	0.0		97.0	34.0	NM_017564		Silent	SNP	ENST00000388887.2	hg19	CCDS31888.1																																																																																			.	.		0.532	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
GOLGA3	2802	hgsc.bcm.edu	37	12	133353241	133353241	+	Silent	SNP	T	T	C	rs541227756	byFrequency	TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr12:133353241T>C	ENST00000450791.2	-	20	4140	c.3957A>G	c.(3955-3957)gaA>gaG	p.E1319E	GOLGA3_ENST00000204726.3_Silent_p.E1319E|GOLGA3_ENST00000456883.2_Silent_p.E1319E			Q08378	GOGA3_HUMAN	golgin A3	1319	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCTGTAGCCCTTCCAGTTCCT	0.587													T|||	45	0.00898562	0.0212	0.0159	5008	,	,		20367	0.0		0.005	False		,,,				2504	0.001				p.E1319E		Atlas-SNP	.											GOLGA3,right_upper_lobe,carcinoma,0,2	GOLGA3	234	.	0			c.A3957G						.						90.0	83.0	85.0					12																	133353241		2203	4300	6503	SO:0001819	synonymous_variant	2802	exon21			TAGCCCTTCCAGT	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3957A>G	chr12.hg19:g.133353241T>C		24.0	0.0		34.0	3.0	NM_005895	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Silent	SNP	ENST00000450791.2	hg19	CCDS9281.1																																																																																			.	.		0.587	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
ZDHHC20	253832	hgsc.bcm.edu	37	13	22033279	22033279	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr13:22033279T>C	ENST00000400590.3	-	1	230	c.32A>G	c.(31-33)cAg>cGg	p.Q11R	ZDHHC20_ENST00000415724.1_Missense_Mutation_p.Q11R|ZDHHC20_ENST00000542645.1_5'UTR|ZDHHC20_ENST00000382466.3_Missense_Mutation_p.Q11R|ZDHHC20_ENST00000422251.1_Missense_Mutation_p.Q11R|ZDHHC20_ENST00000320220.9_Missense_Mutation_p.Q11R			Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20	11					protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		CACGACGCGCTGGCAGCAGCG	0.701																																					p.Q11R		Atlas-SNP	.											.	ZDHHC20	36	.	0			c.A32G						.						24.0	28.0	27.0					13																	22033279		2022	4191	6213	SO:0001583	missense	253832	exon1			ACGCGCTGGCAGC	AK090979	CCDS45017.1, CCDS73551.1	13q12.11	2008-10-21			ENSG00000180776	ENSG00000180776		"""Zinc fingers, DHHC-type"""	20749	protein-coding gene	gene with protein product							Standard	NM_153251		Approved	FLJ25952	uc001uoa.2	Q5W0Z9	OTTHUMG00000017410	ENST00000400590.3:c.32A>G	chr13.hg19:g.22033279T>C	ENSP00000383433:p.Gln11Arg	133.0	0.0		185.0	61.0	NM_153251	A8MTV9|C9JG20|I6L9D4|Q2TB82|Q6NVU8	Missense_Mutation	SNP	ENST00000400590.3	hg19		.	.	.	.	.	.	.	.	.	.	T	15.00	2.703080	0.48412	.	.	ENSG00000180776	ENST00000400590;ENST00000320220;ENST00000382466;ENST00000415724;ENST00000422251	T;T;T;T;T	0.77358	0.95;0.97;0.95;0.95;-1.09	3.88	1.24	0.21308	.	0.190986	0.47093	D	0.000258	T	0.63733	0.2536	L	0.52364	1.645	0.44570	D	0.997535	B	0.02656	0.0	B	0.08055	0.003	T	0.46005	-0.9222	10	0.11182	T	0.66	-7.3251	5.4619	0.16622	0.1532:0.0893:0.0:0.7575	.	11	Q5W0Z9-3	.	R	11	ENSP00000383433:Q11R;ENSP00000313583:Q11R;ENSP00000371905:Q11R;ENSP00000401232:Q11R;ENSP00000396819:Q11R	ENSP00000313583:Q11R	Q	-	2	0	ZDHHC20	20931279	1.000000	0.71417	0.831000	0.32960	0.915000	0.54546	2.911000	0.48774	0.035000	0.15519	0.260000	0.18958	CAG	.	.		0.701	ZDHHC20-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045994.1	NM_153251	
NAA16	79612	hgsc.bcm.edu	37	13	41910840	41910840	+	Missense_Mutation	SNP	G	G	T	rs553717732		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr13:41910840G>T	ENST00000379406.3	+	9	1286	c.962G>T	c.(961-963)gGc>gTc	p.G321V	NAA16_ENST00000379367.3_Missense_Mutation_p.G321V|NAA16_ENST00000403412.3_Missense_Mutation_p.G321V	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	321					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						TTCAGTAAAGGCTGCCCACCC	0.318																																					p.G321V		Atlas-SNP	.											.	NAA16	74	.	0			c.G962T						.						115.0	123.0	120.0					13																	41910840		2203	4299	6502	SO:0001583	missense	79612	exon9			GTAAAGGCTGCCC	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.962G>T	chr13.hg19:g.41910840G>T	ENSP00000368716:p.Gly321Val	135.0	0.0		106.0	39.0	NM_001110798	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	hg19	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482745	0.84747	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.59906	0.23;0.23;0.23	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000001	D	0.82508	0.5052	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.991	D	0.86491	0.1797	10	0.66056	D	0.02	-7.196	19.1432	0.93452	0.0:0.0:1.0:0.0	.	321;321	Q6N069;Q6N069-4	NAA16_HUMAN;.	V	321	ENSP00000368674:G321V;ENSP00000368716:G321V;ENSP00000386103:G321V	ENSP00000368674:G321V	G	+	2	0	NAA16	40808840	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	8.351000	0.90072	2.511000	0.84671	0.650000	0.86243	GGC	.	.		0.318	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
MYCBP2	23077	hgsc.bcm.edu	37	13	77751932	77751932	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr13:77751932T>C	ENST00000544440.2	-	35	5194	c.5177A>G	c.(5176-5178)tAt>tGt	p.Y1726C	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Missense_Mutation_p.Y1764C|MYCBP2_ENST00000357337.6_Missense_Mutation_p.Y1726C					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ACCTCCTCCATAGACAGAGAA	0.423																																					p.Y1764C		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A5291G						.						97.0	84.0	88.0					13																	77751932		2203	4300	6503	SO:0001583	missense	23077	exon35			CCTCCATAGACAG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.5177A>G	chr13.hg19:g.77751932T>C	ENSP00000444596:p.Tyr1726Cys	108.0	0.0		113.0	40.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	T	23.7	4.446785	0.84101	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.56275	0.48;0.47;0.48	5.72	5.72	0.89469	PHR (1);	0.000000	0.64402	D	0.000001	T	0.76772	0.4034	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81300	-0.0995	10	0.87932	D	0	.	16.2962	0.82776	0.0:0.0:0.0:1.0	.	1726	O75592	MYCB2_HUMAN	C	1726;1764;1726	ENSP00000349892:Y1726C;ENSP00000384288:Y1764C;ENSP00000444596:Y1726C	ENSP00000349892:Y1726C	Y	-	2	0	MYCBP2	76649933	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.997000	0.88414	2.304000	0.77564	0.528000	0.53228	TAT	.	.		0.423	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
FRMD6	122786	hgsc.bcm.edu	37	14	52188702	52188702	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr14:52188702G>T	ENST00000344768.5	+	12	1592	c.1396G>T	c.(1396-1398)Gag>Tag	p.E466*	FRMD6_ENST00000554167.1_Nonsense_Mutation_p.E389*|FRMD6_ENST00000553556.1_Nonsense_Mutation_p.E108*|RNU6-301P_ENST00000384277.1_RNA|FRMD6_ENST00000395718.2_Nonsense_Mutation_p.E458*|FRMD6_ENST00000356218.4_Nonsense_Mutation_p.E458*			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	466					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					CCGGGATCTGGAGCAGATGAA	0.453																																					p.E466X		Atlas-SNP	.											.	FRMD6	100	.	0			c.G1396T						.						124.0	119.0	121.0					14																	52188702		2203	4300	6503	SO:0001587	stop_gained	122786	exon12			GATCTGGAGCAGA	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1396G>T	chr14.hg19:g.52188702G>T	ENSP00000343899:p.Glu466*	81.0	0.0		93.0	40.0	NM_001267046	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Nonsense_Mutation	SNP	ENST00000344768.5	hg19	CCDS58318.1	.	.	.	.	.	.	.	.	.	.	G	39	7.527997	0.98339	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555703;ENST00000553556	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	17.8984	0.88896	0.0:0.0:1.0:0.0	.	.	.	.	X	458;458;466;389;106;108	.	ENSP00000343899:E466X	E	+	1	0	FRMD6	51258452	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.140000	0.94607	2.835000	0.97688	0.650000	0.86243	GAG	.	.		0.453	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
EDC3	80153	hgsc.bcm.edu	37	15	74967425	74967425	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr15:74967425C>T	ENST00000315127.4	-	2	222	c.41G>A	c.(40-42)tGt>tAt	p.C14Y	EDC3_ENST00000426797.3_Missense_Mutation_p.C14Y|EDC3_ENST00000568176.1_Missense_Mutation_p.C14Y	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	14	Required for P-body targeting and interaction with DCP1A. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GCTATCTCCACAATTGATGGA	0.478																																					p.C14Y		Atlas-SNP	.											.	EDC3	32	.	0			c.G41A						.						287.0	264.0	272.0					15																	74967425		2197	4296	6493	SO:0001583	missense	80153	exon3			TCTCCACAATTGA	BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.41G>A	chr15.hg19:g.74967425C>T	ENSP00000320503:p.Cys14Tyr	50.0	0.0		70.0	28.0	NM_001142444	B3KPH0|D3DW61|Q9H797	Missense_Mutation	SNP	ENST00000315127.4	hg19	CCDS10267.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048807	0.93740	.	.	ENSG00000179151	ENST00000315127;ENST00000426797	.	.	.	5.72	5.72	0.89469	Enhancer of mRNA-decapping protein 3, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80008	0.4545	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.80953	-0.1152	9	0.66056	D	0.02	-2.1186	18.8652	0.92289	0.0:1.0:0.0:0.0	.	14	Q96F86	EDC3_HUMAN	Y	14	.	ENSP00000320503:C14Y	C	-	2	0	EDC3	72754478	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.361000	0.79497	2.709000	0.92574	0.561000	0.74099	TGT	.	.		0.478	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286399.1	NM_025083	
GRIN2A	2903	hgsc.bcm.edu	37	16	9943750	9943750	+	Silent	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:9943750G>A	ENST00000396573.2	-	6	1500	c.1191C>T	c.(1189-1191)tcC>tcT	p.S397S	GRIN2A_ENST00000562109.1_Silent_p.S397S|GRIN2A_ENST00000396575.2_Silent_p.S397S|GRIN2A_ENST00000535259.1_Silent_p.S240S|GRIN2A_ENST00000404927.2_Silent_p.S397S|GRIN2A_ENST00000330684.3_Silent_p.S397S	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	397					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTCACAGTCGGAGAAGGACT	0.582																																					p.S397S		Atlas-SNP	.											.	GRIN2A	366	.	0			c.C1191T						.						135.0	111.0	119.0					16																	9943750		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon6			ACAGTCGGAGAAG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1191C>T	chr16.hg19:g.9943750G>A		88.0	0.0		90.0	38.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	hg19	CCDS10539.1																																																																																			.	.		0.582	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
CPPED1	55313	hgsc.bcm.edu	37	16	12897629	12897629	+	Nonsense_Mutation	SNP	G	G	T	rs577494472		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:12897629G>T	ENST00000381774.4	-	1	245	c.5C>A	c.(4-6)tCg>tAg	p.S2*	CPPED1_ENST00000261660.4_Nonsense_Mutation_p.S2*|CPPED1_ENST00000433677.2_Nonsense_Mutation_p.S2*	NM_018340.2	NP_060810.2	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain containing 1	2						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|urinary_tract(1)	18						CTCTGCAGCCGACATGGCGAG	0.662																																					p.S2X		Atlas-SNP	.											.	CPPED1	41	.	0			c.C5A						.						15.0	18.0	17.0					16																	12897629		1894	4096	5990	SO:0001587	stop_gained	55313	exon1			GCAGCCGACATGG	AK022710	CCDS42119.1, CCDS42120.1	16p13.12	2014-02-12	2009-03-13		ENSG00000103381	ENSG00000103381			25632	protein-coding gene	gene with protein product	"""complete S transactivated protein 1"""	615603				12477932	Standard	NM_018340		Approved	CSTP1, FLJ11151	uc002dca.4	Q9BRF8	OTTHUMG00000167711	ENST00000381774.4:c.5C>A	chr16.hg19:g.12897629G>T	ENSP00000371193:p.Ser2*	96.0	0.0		94.0	30.0	NM_001099455	B4DQ68|Q6MZY9|Q9H9M9|Q9NUT6	Nonsense_Mutation	SNP	ENST00000381774.4	hg19	CCDS42120.1	.	.	.	.	.	.	.	.	.	.	G	36	5.910995	0.97093	.	.	ENSG00000103381	ENST00000381774;ENST00000433677;ENST00000261660	.	.	.	4.51	3.55	0.40652	.	0.530450	0.16042	N	0.232366	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.592	7.7847	0.29085	0.1105:0.0:0.8895:0.0	.	.	.	.	X	2	.	ENSP00000261660:S2X	S	-	2	0	CPPED1	12805130	0.989000	0.36119	0.805000	0.32314	0.177000	0.22998	2.132000	0.42083	2.497000	0.84241	0.460000	0.39030	TCG	.	.		0.662	CPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395795.2	NM_018340	
DNAH3	55567	hgsc.bcm.edu	37	16	21053420	21053420	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:21053420G>A	ENST00000261383.3	-	32	4566	c.4567C>T	c.(4567-4569)Cca>Tca	p.P1523S	DNAH3_ENST00000415178.1_Missense_Mutation_p.P1523S	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1523	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCGCAGGTTGGGTTCAGAGAG	0.517																																					p.P1523S		Atlas-SNP	.											.	DNAH3	1142	.	0			c.C4567T						.						153.0	123.0	133.0					16																	21053420		2201	4300	6501	SO:0001583	missense	55567	exon32			AGGTTGGGTTCAG	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4567C>T	chr16.hg19:g.21053420G>A	ENSP00000261383:p.Pro1523Ser	84.0	0.0		98.0	49.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289724	0.80914	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.15372	2.43;2.43	4.82	4.82	0.62117	ATPase, AAA+ type, core (1);	0.066892	0.64402	D	0.000013	T	0.40570	0.1122	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.19811	-1.0294	10	0.66056	D	0.02	.	18.4632	0.90747	0.0:0.0:1.0:0.0	.	1523	Q8TD57	DYH3_HUMAN	S	1523	ENSP00000261383:P1523S;ENSP00000394245:P1523S	ENSP00000261383:P1523S	P	-	1	0	DNAH3	20960921	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.561000	0.82288	2.668000	0.90789	0.591000	0.81541	CCA	.	.		0.517	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908302	29908302	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:29908302T>C	ENST00000308713.5	-	3	879	c.352A>G	c.(352-354)Act>Gct	p.T118A	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.T74A|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.T118A|SEZ6L2_ENST00000350527.3_Intron|SEZ6L2_ENST00000562159.1_5'UTR	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	118	Pro-rich.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCTGGCGCAGTGGGGCCTGCC	0.721																																					p.T118A		Atlas-SNP	.											.	SEZ6L2	137	.	0			c.A352G						.						8.0	11.0	10.0					16																	29908302		2183	4251	6434	SO:0001583	missense	26470	exon3			GCGCAGTGGGGCC	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.352A>G	chr16.hg19:g.29908302T>C	ENSP00000312550:p.Thr118Ala	39.0	0.0		44.0	17.0	NM_001243332	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	hg19	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	T	17.16	3.317735	0.60524	.	.	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.42131	0.98;0.98;0.98	5.36	5.36	0.76844	.	0.000000	0.53938	D	0.000050	T	0.26484	0.0647	N	0.19112	0.55	0.26953	N	0.96599	P;P;P;P	0.41929	0.663;0.765;0.533;0.765	B;B;B;B	0.37731	0.257;0.131;0.131;0.209	T	0.13255	-1.0516	9	.	.	.	.	10.9136	0.47122	0.0:0.0:0.1571:0.8428	.	74;118;118;118	F5H293;B7Z5L4;Q9BW82;Q6UXD5	.;.;.;SE6L2_HUMAN	A	118;118;74	ENSP00000312550:T118A;ENSP00000319215:T118A;ENSP00000439412:T74A	.	T	-	1	0	SEZ6L2	29815803	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.536000	0.45693	2.041000	0.60428	0.459000	0.35465	ACT	.	.		0.721	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
PRSS8	5652	hgsc.bcm.edu	37	16	31144008	31144008	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:31144008G>C	ENST00000317508.6	-	4	796	c.533C>G	c.(532-534)cCc>cGc	p.P178R	PRSS8_ENST00000568261.1_Missense_Mutation_p.P124R|RP11-388M20.2_ENST00000563605.1_RNA	NM_002773.3	NP_002764.1	Q16651	PRSS8_HUMAN	protease, serine, 8	178	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				positive regulation of sodium ion transport (GO:0010765)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	8						CTCACCTGAGGGGGCCACATG	0.657																																					p.P178R		Atlas-SNP	.											.	PRSS8	24	.	0			c.C533G						.						59.0	67.0	64.0					16																	31144008		2120	4230	6350	SO:0001583	missense	5652	exon4			CCTGAGGGGGCCA	U33446	CCDS45469.1	16p11.2	2010-05-07	2007-02-21			ENSG00000052344		"""Serine peptidases / Serine peptidases"""	9491	protein-coding gene	gene with protein product	"""prostasin"""	600823				8838796, 7768952	Standard	NM_002773		Approved		uc002ebc.4	Q16651		ENST00000317508.6:c.533C>G	chr16.hg19:g.31144008G>C	ENSP00000319730:p.Pro178Arg	53.0	0.0		77.0	33.0	NM_002773	B4DWP2|Q9UCA3	Missense_Mutation	SNP	ENST00000317508.6	hg19	CCDS45469.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810248	0.50421	.	.	ENSG00000052344	ENST00000317508;ENST00000419768	D	0.88124	-2.34	5.45	3.26	0.37387	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.335769	0.25984	N	0.027050	D	0.84234	0.5427	N	0.21142	0.635	0.80722	D	1	P;D	0.56287	0.918;0.975	P;P	0.59012	0.693;0.85	T	0.80491	-0.1359	10	0.30854	T	0.27	.	8.9982	0.36066	0.0:0.1874:0.5741:0.2385	.	124;178	B4DWP2;Q16651	.;PRSS8_HUMAN	R	178;96	ENSP00000319730:P178R	ENSP00000319730:P178R	P	-	2	0	PRSS8	31051509	0.000000	0.05858	0.987000	0.45799	0.721000	0.41392	0.488000	0.22371	2.554000	0.86153	0.561000	0.74099	CCC	.	.		0.657	PRSS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433536.1	NM_002773	
RBL2	5934	hgsc.bcm.edu	37	16	53498217	53498217	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:53498217C>T	ENST00000262133.6	+	12	1777	c.1640C>T	c.(1639-1641)cCt>cTt	p.P547L	RBL2_ENST00000544545.1_Missense_Mutation_p.P331L|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	547	Domain A.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TATAAGCCTCCTGGGAATTTT	0.338																																					p.P547L		Atlas-SNP	.											RBL2,rectum,NS,0,1	RBL2	115	.	0			c.C1640T						.						90.0	93.0	92.0					16																	53498217		2198	4300	6498	SO:0001583	missense	5934	exon12			AGCCTCCTGGGAA	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1640C>T	chr16.hg19:g.53498217C>T	ENSP00000262133:p.Pro547Leu	126.0	0.0		100.0	46.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	hg19	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156323	0.57259	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000379935;ENST00000544545	D;D;D	0.86956	-2.19;-2.19;-2.19	5.86	5.86	0.93980	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.050790	0.85682	D	0.000000	D	0.92828	0.7719	M	0.79475	2.455	0.58432	D	0.999997	D;D;P;D	0.63880	0.982;0.98;0.741;0.993	P;P;P;P	0.58620	0.767;0.833;0.589;0.842	D	0.92913	0.6349	10	0.72032	D	0.01	-15.6206	20.1996	0.98256	0.0:1.0:0.0:0.0	.	331;547;257;547	B7Z913;Q8NE70;E9PG04;Q08999	.;.;.;RBL2_HUMAN	L	547;473;257;331	ENSP00000262133:P547L;ENSP00000443744:P473L;ENSP00000444685:P331L	ENSP00000262133:P547L	P	+	2	0	RBL2	52055718	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	3.599000	0.54045	2.776000	0.95493	0.650000	0.86243	CCT	.	.		0.338	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
EDC4	23644	hgsc.bcm.edu	37	16	67907167	67907167	+	Start_Codon_SNP	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:67907167G>A	ENST00000358933.5	+	1	242	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CAGGGCCCATGGCCTCCTGCG	0.771																																					p.M1I		Atlas-SNP	.											.	EDC4	101	.	0			c.G3A						.						2.0	2.0	2.0					16																	67907167		1512	3118	4630	SO:0001582	initiator_codon_variant	23644	exon1			GCCCATGGCCTCC	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3G>A	chr16.hg19:g.67907167G>A	ENSP00000351811:p.Met1Ile	80.0	0.0		87.0	33.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	hg19	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	G	37	6.424283	0.97555	.	.	ENSG00000038358	ENST00000358933	.	.	.	5.4	5.4	0.78164	.	0.493023	0.23382	N	0.048782	T	0.76709	0.4025	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.57776	0.827	T	0.79393	-0.1822	8	0.87932	D	0	-22.6807	16.9404	0.86216	0.0:0.0:1.0:0.0	.	1	Q6P2E9	EDC4_HUMAN	I	1	.	ENSP00000351811:M1I	M	+	3	0	EDC4	66464668	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	8.761000	0.91691	2.533000	0.85409	0.561000	0.74099	ATG	.	.		0.771	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	Missense_Mutation
ZNF469	84627	hgsc.bcm.edu	37	16	88496738	88496738	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr16:88496738T>C	ENST00000437464.1	+	1	2860	c.2860T>C	c.(2860-2862)Ttc>Ctc	p.F954L	ZNF469_ENST00000565624.1_Missense_Mutation_p.F954L	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	954					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GTTGAAGCTGTTCCGGAAGGA	0.726																																					p.F954L		Atlas-SNP	.											.	ZNF469	121	.	0			c.T2860C						.						3.0	4.0	4.0					16																	88496738		594	1416	2010	SO:0001583	missense	84627	exon1			AAGCTGTTCCGGA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.2860T>C	chr16.hg19:g.88496738T>C	ENSP00000402343:p.Phe954Leu	622.0	0.0		624.0	256.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759061	0.31137	.	.	ENSG00000225614	ENST00000437464	T	0.06218	3.33	4.46	3.35	0.38373	.	.	.	.	.	T	0.04679	0.0127	N	0.19112	0.55	0.09310	N	1	B	0.17852	0.024	B	0.14023	0.01	T	0.38499	-0.9658	9	0.56958	D	0.05	.	6.2404	0.20787	0.0:0.1316:0.0:0.8684	.	954	Q96JG9	ZN469_HUMAN	L	954	ENSP00000402343:F954L	ENSP00000402343:F954L	F	+	1	0	ZNF469	87024239	0.000000	0.05858	0.013000	0.15412	0.239000	0.25481	0.096000	0.15147	0.606000	0.29965	0.383000	0.25322	TTC	.	.		0.726	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
MYO15A	51168	hgsc.bcm.edu	37	17	18023832	18023832	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:18023832C>T	ENST00000205890.5	+	2	2056	c.1718C>T	c.(1717-1719)gCg>gTg	p.A573V		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	573					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					ACCTCGCTTGCGCGGTTCCTC	0.741																																					p.A573V		Atlas-SNP	.											.	MYO15A	268	.	0			c.C1718T						.						5.0	6.0	6.0					17																	18023832		1766	3906	5672	SO:0001583	missense	51168	exon2			CGCTTGCGCGGTT	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1718C>T	chr17.hg19:g.18023832C>T	ENSP00000205890:p.Ala573Val	330.0	0.0		250.0	179.0	NM_016239	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	hg19	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.662294	0.67700	.	.	ENSG00000091536	ENST00000205890	D	0.89343	-2.5	4.95	3.91	0.45181	.	.	.	.	.	D	0.84920	0.5579	L	0.27053	0.805	0.80722	D	1	D	0.64830	0.994	P	0.49999	0.628	D	0.84661	0.0706	9	0.49607	T	0.09	.	10.4251	0.44373	0.0:0.8017:0.1983:0.0	.	573	Q9UKN7	MYO15_HUMAN	V	573	ENSP00000205890:A573V	ENSP00000205890:A573V	A	+	2	0	MYO15A	17964557	0.793000	0.28825	0.949000	0.38748	0.897000	0.52465	1.203000	0.32284	2.295000	0.77249	0.448000	0.29417	GCG	.	.		0.741	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
SLC47A1	55244	hgsc.bcm.edu	37	17	19454772	19454772	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:19454772G>T	ENST00000270570.4	+	6	620	c.534G>T	c.(532-534)ttG>ttT	p.L178F	SLC47A1_ENST00000542886.1_Missense_Mutation_p.L178F|SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000457293.1_Missense_Mutation_p.L178F|SLC47A1_ENST00000571335.1_Missense_Mutation_p.C30F|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000436810.2_Missense_Mutation_p.L155F|SLC47A1_ENST00000395585.1_Missense_Mutation_p.L178F	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	178					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	TTAAATATTTGCTCAACCAGG	0.438																																					p.L178F		Atlas-SNP	.											.	SLC47A1	55	.	0			c.G534T						.						158.0	147.0	151.0					17																	19454772		2203	4300	6503	SO:0001583	missense	55244	exon6			ATATTTGCTCAAC		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.534G>T	chr17.hg19:g.19454772G>T	ENSP00000270570:p.Leu178Phe	73.0	0.0		35.0	27.0	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	hg19	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059089	0.76074	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.64450	0.2599	M	0.85299	2.745	0.49798	D	0.999827	D;D;D	0.64830	0.987;0.994;0.981	D;D;P	0.66196	0.942;0.942;0.86	T	0.69851	-0.5033	10	0.87932	D	0	-17.2865	10.7957	0.46459	0.088:0.0:0.912:0.0	.	155;178;178	E7EX57;Q96FL8;Q96FL8-3	.;S47A1_HUMAN;.	F	155;178;178;178;178	ENSP00000407155:L155F;ENSP00000270570:L178F;ENSP00000415586:L178F;ENSP00000378951:L178F	ENSP00000270570:L178F	L	+	3	2	SLC47A1	19395364	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.321000	0.43805	2.399000	0.81585	0.561000	0.74099	TTG	.	.		0.438	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
TAOK1	57551	hgsc.bcm.edu	37	17	27835056	27835056	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:27835056T>G	ENST00000261716.3	+	14	2000	c.1481T>G	c.(1480-1482)cTc>cGc	p.L494R	TAOK1_ENST00000536202.1_Missense_Mutation_p.L494R	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	494					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			GAACATCGCCTCAGATTAGAC	0.428																																					p.L494R		Atlas-SNP	.											.	TAOK1	151	.	0			c.T1481G						.						84.0	76.0	79.0					17																	27835056		2203	4300	6503	SO:0001583	missense	57551	exon14			ATCGCCTCAGATT	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1481T>G	chr17.hg19:g.27835056T>G	ENSP00000261716:p.Leu494Arg	194.0	0.0		277.0	55.0	NM_025142	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	hg19	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372845	0.61624	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.46063	0.88;0.88	5.18	5.18	0.71444	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.51500	0.1678	L	0.55834	1.745	0.80722	D	1	D;P;P	0.58970	0.984;0.951;0.737	P;P;B	0.57101	0.661;0.813;0.374	T	0.43956	-0.9359	10	0.15952	T	0.53	.	15.0568	0.71921	0.0:0.0:0.0:1.0	.	494;320;494	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	R	494	ENSP00000261716:L494R;ENSP00000438819:L494R	ENSP00000261716:L494R	L	+	2	0	TAOK1	24859182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.031000	0.88826	1.959000	0.56917	0.533000	0.62120	CTC	.	.		0.428	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
KRT28	162605	hgsc.bcm.edu	37	17	38955938	38955938	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:38955938C>T	ENST00000306658.7	-	1	273	c.208G>A	c.(208-210)Gct>Act	p.A70T		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				CCAATACAAGCAGCATTTCCA	0.532																																					p.A70T	Melanoma(19;789 869 15380 26882 39836)	Atlas-SNP	.											.	KRT28	65	.	0			c.G208A						.						77.0	76.0	76.0					17																	38955938		2203	4300	6503	SO:0001583	missense	162605	exon1			TACAAGCAGCATT	AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.208G>A	chr17.hg19:g.38955938C>T	ENSP00000305263:p.Ala70Thr	98.0	0.0		164.0	52.0	NM_181535		Missense_Mutation	SNP	ENST00000306658.7	hg19	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	C	6.875	0.530807	0.13127	.	.	ENSG00000173908	ENST00000306658	T	0.75477	-0.94	5.02	-0.168	0.13343	.	0.980375	0.08334	N	0.961878	T	0.49150	0.1540	N	0.04959	-0.14	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.30765	-0.9967	10	0.22706	T	0.39	.	6.3853	0.21558	0.3023:0.5398:0.0:0.1578	.	70	Q7Z3Y7	K1C28_HUMAN	T	70	ENSP00000305263:A70T	ENSP00000305263:A70T	A	-	1	0	KRT28	36209464	0.000000	0.05858	0.001000	0.08648	0.701000	0.40568	-0.820000	0.04457	0.226000	0.20979	0.650000	0.86243	GCT	.	.		0.532	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535	
TMEM101	84336	hgsc.bcm.edu	37	17	42089361	42089361	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:42089361T>C	ENST00000589334.1	-	5	1024	c.709A>G	c.(709-711)Atg>Gtg	p.M237V	TMEM101_ENST00000206380.3_Missense_Mutation_p.M237V|TMEM101_ENST00000542039.1_Missense_Mutation_p.M179V			Q96IK0	TM101_HUMAN	transmembrane protein 101	237					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AGGAGCTTCATCTGGTTCCAG	0.552																																					p.M237V		Atlas-SNP	.											.	TMEM101	18	.	0			c.A709G						.						103.0	88.0	93.0					17																	42089361		2203	4300	6503	SO:0001583	missense	84336	exon4			GCTTCATCTGGTT	AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.709A>G	chr17.hg19:g.42089361T>C	ENSP00000468025:p.Met237Val	56.0	0.0		106.0	26.0	NM_032376	B2R9N6	Missense_Mutation	SNP	ENST00000589334.1	hg19	CCDS11474.1	.	.	.	.	.	.	.	.	.	.	T	9.660	1.143996	0.21205	.	.	ENSG00000091947	ENST00000206380;ENST00000542039	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.40932	0.1137	N	0.19112	0.55	0.52099	D	0.999944	B	0.17268	0.021	B	0.16722	0.016	T	0.29243	-1.0018	9	0.12103	T	0.63	-12.6751	13.6738	0.62440	0.0:0.0:0.0:1.0	.	237	Q96IK0	TM101_HUMAN	V	237;179	.	ENSP00000206380:M237V	M	-	1	0	TMEM101	39444887	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.078000	0.71282	2.113000	0.64589	0.397000	0.26171	ATG	.	.		0.552	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457665.1	NM_032376	
STRADA	92335	hgsc.bcm.edu	37	17	61781755	61781755	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:61781755G>A	ENST00000336174.6	-	11	1158	c.1046C>T	c.(1045-1047)tCc>tTc	p.S349F	STRADA_ENST00000582137.1_Intron|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000579340.1_3'UTR|STRADA_ENST00000392950.4_Missense_Mutation_p.S312F|STRADA_ENST00000245865.5_3'UTR|STRADA_ENST00000375840.4_Missense_Mutation_p.S291F|STRADA_ENST00000447001.3_Intron|RP11-51F16.8_ENST00000580553.1_3'UTR	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	349	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						GAAGTGGGGGGAGAAGGTTCG	0.667																																					p.S349F		Atlas-SNP	.											.	STRADA	27	.	0			c.C1046T						.						19.0	20.0	20.0					17																	61781755		2202	4299	6501	SO:0001583	missense	92335	exon11			TGGGGGGAGAAGG	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.1046C>T	chr17.hg19:g.61781755G>A	ENSP00000336655:p.Ser349Phe	50.0	0.0		49.0	29.0	NM_001003787	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	hg19	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222880	0.79464	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000392950;ENST00000245865	T;T;T	0.60299	0.2;0.22;1.43	4.91	4.91	0.64330	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.111386	0.64402	D	0.000006	D	0.84538	0.5494	H	0.96916	3.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.90005	0.4117	10	0.87932	D	0	.	18.2873	0.90118	0.0:0.0:1.0:0.0	.	291;312;312;349	Q5JPI2;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;STRAA_HUMAN	F	349;291;312;311	ENSP00000336655:S349F;ENSP00000365000:S291F;ENSP00000376677:S312F	ENSP00000245865:S311F	S	-	2	0	STRADA	59135487	1.000000	0.71417	0.956000	0.39512	0.929000	0.56500	5.565000	0.67365	2.549000	0.85964	0.491000	0.48974	TCC	.	.		0.667	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
CDK3	1018	hgsc.bcm.edu	37	17	73999349	73999349	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:73999349C>G	ENST00000425876.2	+	6	750	c.662C>G	c.(661-663)aCa>aGa	p.T221R	CDK3_ENST00000448471.1_Missense_Mutation_p.T221R|TEN1-CDK3_ENST00000567351.1_RNA			Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	221	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			central_nervous_system(1)	1						ATGCTGGGGACACCCAGCGAA	0.537																																					p.T221R		Atlas-SNP	.											.	CDK3	31	.	0			c.C662G						.						145.0	157.0	153.0					17																	73999349		2203	4300	6503	SO:0001583	missense	1018	exon7			TGGGGACACCCAG	X66357	CCDS11736.1	17q25.1	2012-09-20			ENSG00000250506	ENSG00000250506		"""Cyclin-dependent kinases"""	1772	protein-coding gene	gene with protein product		123828				1639063	Standard	NM_001258		Approved		uc010dgt.3	Q00526	OTTHUMG00000154861	ENST00000425876.2:c.662C>G	chr17.hg19:g.73999349C>G	ENSP00000410561:p.Thr221Arg	112.0	0.0		119.0	30.0	NM_001258		Missense_Mutation	SNP	ENST00000425876.2	hg19	CCDS11736.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463762	0.84425	.	.	ENSG00000250506	ENST00000448471;ENST00000425876	T;T	0.65178	-0.14;-0.14	4.72	4.72	0.59763	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000027	T	0.70780	0.3263	L	0.28608	0.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.75113	-0.3432	10	0.87932	D	0	-15.8149	17.8863	0.88855	0.0:1.0:0.0:0.0	.	221	Q00526	CDK3_HUMAN	R	221	ENSP00000400088:T221R;ENSP00000410561:T221R	ENSP00000410561:T221R	T	+	2	0	CDK3	71510944	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	7.592000	0.82676	2.455000	0.83008	0.511000	0.50034	ACA	.	.		0.537	CDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337389.2	NM_001258	
OR7A5	26659	hgsc.bcm.edu	37	19	14938490	14938490	+	Silent	SNP	A	A	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:14938490A>C	ENST00000322301.3	-	2	651	c.564T>G	c.(562-564)gcT>gcG	p.A188A	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Silent_p.A188A			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	188					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TATCAGAACAAGCAAGTTGGA	0.423																																					p.A188A		Atlas-SNP	.											.	OR7A5	43	.	0			c.T564G						.						73.0	70.0	71.0					19																	14938490		2203	4300	6503	SO:0001819	synonymous_variant	26659	exon1			AGAACAAGCAAGT	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.564T>G	chr19.hg19:g.14938490A>C		212.0	0.0		239.0	95.0	NM_017506	B2R682|Q6IFP1|Q96R96	Silent	SNP	ENST00000322301.3	hg19	CCDS12318.1																																																																																			.	.		0.423	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
OR7A5	26659	hgsc.bcm.edu	37	19	14938512	14938512	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:14938512A>C	ENST00000322301.3	-	2	629	c.542T>G	c.(541-543)cTt>cGt	p.L181R	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.L181R			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	181					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						GACCTGATTAAGTTCACAGAA	0.453																																					p.L181R		Atlas-SNP	.											.	OR7A5	43	.	0			c.T542G						.						73.0	71.0	72.0					19																	14938512		2203	4300	6503	SO:0001583	missense	26659	exon1			TGATTAAGTTCAC	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.542T>G	chr19.hg19:g.14938512A>C	ENSP00000316955:p.Leu181Arg	230.0	0.0		237.0	95.0	NM_017506	B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	ENST00000322301.3	hg19	CCDS12318.1	.	.	.	.	.	.	.	.	.	.	a	10.95	1.494733	0.26774	.	.	ENSG00000188269	ENST00000322301	T	0.00084	8.75	3.13	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.344301	0.15974	U	0.235614	T	0.00524	0.0017	M	0.90759	3.145	0.09310	N	0.999998	D	0.64830	0.994	D	0.71414	0.973	T	0.29640	-1.0005	10	0.87932	D	0	.	9.762	0.40537	1.0:0.0:0.0:0.0	.	181	Q15622	OR7A5_HUMAN	R	181	ENSP00000316955:L181R	ENSP00000316955:L181R	L	-	2	0	OR7A5	14799512	0.000000	0.05858	0.763000	0.31416	0.494000	0.33585	0.992000	0.29667	1.474000	0.48178	0.113000	0.15668	CTT	.	.		0.453	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
ZNF99	7652	hgsc.bcm.edu	37	19	22942100	22942100	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:22942100T>C	ENST00000596209.1	-	4	701	c.611A>G	c.(610-612)gAa>gGa	p.E204G	ZNF99_ENST00000397104.3_Intron	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GCCACGTTCTTCACATTTGTA	0.303																																					p.E204G		Atlas-SNP	.											.	ZNF99	273	.	0			c.A611G						.																																			SO:0001583	missense	7652	exon4			CGTTCTTCACATT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.611A>G	chr19.hg19:g.22942100T>C	ENSP00000472969:p.Glu204Gly	30.0	0.0		38.0	23.0	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.		0.303	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
PVR	5817	hgsc.bcm.edu	37	19	45153129	45153129	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:45153129A>G	ENST00000425690.3	+	3	775	c.476A>G	c.(475-477)gAg>gGg	p.E159G	PVR_ENST00000406449.4_Missense_Mutation_p.E159G|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000403059.4_Missense_Mutation_p.E159G|PVR_ENST00000344956.4_Missense_Mutation_p.E159G	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	159	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		CTCACTGGAGAGCCAGTGCCC	0.612																																					p.E159G		Atlas-SNP	.											.	PVR	23	.	0			c.A476G						.						101.0	108.0	106.0					19																	45153129		2203	4300	6503	SO:0001583	missense	5817	exon3			CTGGAGAGCCAGT	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.476A>G	chr19.hg19:g.45153129A>G	ENSP00000402060:p.Glu159Gly	79.0	0.0		59.0	29.0	NM_001135769	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	ENST00000425690.3	hg19	CCDS12640.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.119996	0.37436	.	.	ENSG00000073008	ENST00000344956;ENST00000425690;ENST00000406449;ENST00000403059	T;T;T;T	0.08984	3.03;3.03;3.03;3.03	4.54	-0.842	0.10748	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.486060	0.04131	N	0.317900	T	0.10766	0.0263	L	0.39245	1.2	0.09310	N	1	B;B;B;B	0.33883	0.43;0.361;0.201;0.239	B;B;B;P	0.44732	0.228;0.241;0.329;0.459	T	0.43294	-0.9400	10	0.13108	T	0.6	.	5.8806	0.18854	0.4342:0.461:0.1048:0.0	.	159;159;159;159	P15151-2;P15151-3;P15151-4;P15151	.;.;.;PVR_HUMAN	G	159	ENSP00000340870:E159G;ENSP00000402060:E159G;ENSP00000383907:E159G;ENSP00000385344:E159G	ENSP00000340870:E159G	E	+	2	0	PVR	49844969	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	-0.010000	0.12743	0.125000	0.18397	0.402000	0.26972	GAG	.	.		0.612	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	NM_006505	
PVR	5817	hgsc.bcm.edu	37	19	45153140	45153140	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:45153140A>C	ENST00000425690.3	+	3	786	c.487A>C	c.(487-489)Atg>Ctg	p.M163L	PVR_ENST00000406449.4_Missense_Mutation_p.M163L|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000403059.4_Missense_Mutation_p.M163L|PVR_ENST00000344956.4_Missense_Mutation_p.M163L	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	163	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		GCCAGTGCCCATGGCCCGCTG	0.607																																					p.M163L		Atlas-SNP	.											.	PVR	23	.	0			c.A487C						.						89.0	96.0	94.0					19																	45153140		2203	4300	6503	SO:0001583	missense	5817	exon3			GTGCCCATGGCCC	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.487A>C	chr19.hg19:g.45153140A>C	ENSP00000402060:p.Met163Leu	76.0	0.0		62.0	28.0	NM_001135769	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	ENST00000425690.3	hg19	CCDS12640.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999321	0.35226	.	.	ENSG00000073008	ENST00000344956;ENST00000425690;ENST00000406449;ENST00000403059	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	4.54	0.465	0.16711	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.320727	0.22262	N	0.062392	T	0.05593	0.0147	N	0.11427	0.14	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.13407	0.0;0.005;0.009;0.006	T	0.35025	-0.9805	10	0.27785	T	0.31	.	4.5987	0.12343	0.3527:0.1699:0.4774:0.0	.	163;163;163;163	P15151-2;P15151-3;P15151-4;P15151	.;.;.;PVR_HUMAN	L	163	ENSP00000340870:M163L;ENSP00000402060:M163L;ENSP00000383907:M163L;ENSP00000385344:M163L	ENSP00000340870:M163L	M	+	1	0	PVR	49844980	0.019000	0.18553	0.021000	0.16686	0.057000	0.15508	-0.017000	0.12590	0.011000	0.14865	-0.320000	0.08662	ATG	.	.		0.607	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	NM_006505	
SIGLEC6	946	hgsc.bcm.edu	37	19	52031035	52031035	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:52031035T>G	ENST00000425629.3	-	7	1308	c.1154A>C	c.(1153-1155)gAt>gCt	p.D385A	SIGLEC6_ENST00000359982.4_Intron|SIGLEC6_ENST00000343300.4_Intron|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.D333A|SIGLEC6_ENST00000474054.1_5'UTR|SIGLEC6_ENST00000391797.3_Intron|SIGLEC6_ENST00000346477.3_Missense_Mutation_p.D369A	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	385					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GTTCACATCATCCGTGTTTTG	0.502																																					p.D385A		Atlas-SNP	.											.	SIGLEC6	142	.	0			c.A1154C						.						193.0	192.0	192.0					19																	52031035		1954	4153	6107	SO:0001583	missense	946	exon7			ACATCATCCGTGT	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1154A>C	chr19.hg19:g.52031035T>G	ENSP00000401502:p.Asp385Ala	90.0	0.0		77.0	34.0	NM_001245	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	ENST00000425629.3	hg19	CCDS12834.3	.	.	.	.	.	.	.	.	.	.	.	4.770	0.143268	0.09083	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000436458	T;T	0.52754	1.09;0.65	3.02	0.74	0.18330	.	.	.	.	.	T	0.33000	0.0848	L	0.61218	1.895	0.09310	N	1	P;B;P	0.39216	0.495;0.181;0.664	B;B;B	0.30401	0.077;0.054;0.115	T	0.15983	-1.0418	9	0.19590	T	0.45	.	3.2494	0.06808	0.0:0.1378:0.2426:0.6197	.	333;369;385	C9JBE5;O43699-3;O43699	.;.;SIGL6_HUMAN	A	358;369;385;333	ENSP00000401502:D385A;ENSP00000410679:D333A	ENSP00000344064:D358A	D	-	2	0	SIGLEC6	56722847	0.001000	0.12720	0.000000	0.03702	0.028000	0.11728	0.909000	0.28558	0.080000	0.16959	0.338000	0.21704	GAT	.	.		0.502	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245	
FPR2	2358	hgsc.bcm.edu	37	19	52272248	52272248	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:52272248G>A	ENST00000598776.1	+	2	1109	c.337G>A	c.(337-339)Gtc>Atc	p.V113I	FPR2_ENST00000340023.6_Missense_Mutation_p.V113I|FPR2_ENST00000598953.1_Missense_Mutation_p.V113I	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	113					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						CTTTGGAAGTGTCTTCTTGAT	0.493																																					p.V113I		Atlas-SNP	.											.	FPR2	66	.	0			c.G337A						.						179.0	155.0	163.0					19																	52272248		2203	4300	6503	SO:0001583	missense	2358	exon2			GGAAGTGTCTTCT	M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.337G>A	chr19.hg19:g.52272248G>A	ENSP00000468897:p.Val113Ile	91.0	0.0		92.0	38.0	NM_001005738	A8K3E2	Missense_Mutation	SNP	ENST00000598776.1	hg19	CCDS12840.1	.	.	.	.	.	.	.	.	.	.	.	12.64	1.998503	0.35226	.	.	ENSG00000171049	ENST00000340023	T	0.69561	-0.41	3.47	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000005	T	0.51363	0.1670	N	0.21240	0.645	0.35791	D	0.822428	P	0.37083	0.581	B	0.39971	0.315	T	0.58498	-0.7626	10	0.45353	T	0.12	.	8.6931	0.34278	0.119:0.0:0.881:0.0	.	113	P25090	FPR2_HUMAN	I	113	ENSP00000340191:V113I	ENSP00000340191:V113I	V	+	1	0	FPR2	56964060	1.000000	0.71417	0.950000	0.38849	0.388000	0.30384	3.324000	0.52022	0.803000	0.34113	0.491000	0.48974	GTC	.	.		0.493	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	NM_001005738	
ZNF665	79788	hgsc.bcm.edu	37	19	53667735	53667735	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:53667735C>G	ENST00000600412.1	-	2	1928	c.1813G>C	c.(1813-1815)Gca>Cca	p.A605P	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Missense_Mutation_p.A670P			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	605					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		CGATGTTTTGCAAGGTTTGAA	0.478																																					p.A670P		Atlas-SNP	.											.	ZNF665	136	.	0			c.G2008C						.						44.0	46.0	46.0					19																	53667735		2178	4290	6468	SO:0001583	missense	79788	exon4			GTTTTGCAAGGTT		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1813G>C	chr19.hg19:g.53667735C>G	ENSP00000469154:p.Ala605Pro	42.0	0.0		44.0	13.0	NM_024733	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	hg19		.	.	.	.	.	.	.	.	.	.	C	11.16	1.557920	0.27827	.	.	ENSG00000197497	ENST00000396424	T	0.36520	1.25	2.33	-0.0644	0.13772	.	.	.	.	.	T	0.37732	0.1014	L	0.45352	1.415	0.09310	N	1	D	0.55800	0.973	P	0.55871	0.786	T	0.19031	-1.0318	9	0.52906	T	0.07	.	3.3365	0.07103	0.2055:0.5358:0.0:0.2587	.	670	Q9H7R5-2	.	P	670	ENSP00000379702:A670P	ENSP00000379702:A670P	A	-	1	0	ZNF665	58359547	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-2.977000	0.00664	-0.076000	0.12775	-0.399000	0.06403	GCA	.	.		0.478	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
SSC5D	284297	hgsc.bcm.edu	37	19	56000833	56000833	+	Silent	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:56000833C>T	ENST00000389623.6	+	3	188	c.165C>T	c.(163-165)gcC>gcT	p.A55A	SSC5D_ENST00000587166.1_Silent_p.A55A	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	55	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						GCGATGCCGCCGTGGCCTGCC	0.751																																					p.A55A		Atlas-SNP	.											.	SSC5D	65	.	0			c.C165T						.						3.0	5.0	5.0					19																	56000833		557	1408	1965	SO:0001819	synonymous_variant	284297	exon3			TGCCGCCGTGGCC		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.165C>T	chr19.hg19:g.56000833C>T		34.0	0.0		46.0	15.0	NM_001195267	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	hg19	CCDS46196.1																																																																																			.	.		0.751	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF132	7691	hgsc.bcm.edu	37	19	58945805	58945805	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:58945805G>C	ENST00000254166.3	-	3	1406	c.1006C>G	c.(1006-1008)Cat>Gat	p.H336D		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		CTCTGATGATGAACAAATGTG	0.403																																					p.H336D		Atlas-SNP	.											.	ZNF132	56	.	0			c.C1006G						.						74.0	70.0	72.0					19																	58945805		2203	4300	6503	SO:0001583	missense	7691	exon3			GATGATGAACAAA	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1006C>G	chr19.hg19:g.58945805G>C	ENSP00000254166:p.His336Asp	91.0	0.0		94.0	4.0	NM_003433	Q32MI9	Missense_Mutation	SNP	ENST00000254166.3	hg19	CCDS12980.1	.	.	.	.	.	.	.	.	.	.	G	4.060	0.008878	0.07912	.	.	ENSG00000131849	ENST00000254166	T	0.14766	2.48	3.19	0.778	0.18543	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05364	0.0142	N	0.11756	0.17	0.09310	N	1	B	0.29716	0.255	B	0.30251	0.113	T	0.39623	-0.9605	9	0.12103	T	0.63	.	1.4943	0.02463	0.1216:0.1715:0.3803:0.3266	.	336	P52740	ZN132_HUMAN	D	336	ENSP00000254166:H336D	ENSP00000254166:H336D	H	-	1	0	ZNF132	63637617	0.000000	0.05858	0.816000	0.32577	0.962000	0.63368	-0.197000	0.09518	0.672000	0.31204	-0.140000	0.14226	CAT	.	.		0.403	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
TMC2	117532	hgsc.bcm.edu	37	20	2591139	2591139	+	Silent	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:2591139C>T	ENST00000358864.1	+	12	1503	c.1488C>T	c.(1486-1488)taC>taT	p.Y496Y	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	496					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGGAGAATTACCACCCACGCA	0.532																																					p.Y496Y		Atlas-SNP	.											.	TMC2	121	.	0			c.C1488T						.						256.0	212.0	227.0					20																	2591139		2203	4300	6503	SO:0001819	synonymous_variant	117532	exon12			GAATTACCACCCA	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1488C>T	chr20.hg19:g.2591139C>T		110.0	0.0		83.0	65.0	NM_080751	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	ENST00000358864.1	hg19	CCDS13029.2																																																																																			.	.		0.532	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
CRLS1	54675	hgsc.bcm.edu	37	20	6012689	6012689	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:6012689A>G	ENST00000378863.4	+	5	849	c.692A>G	c.(691-693)tAt>tGt	p.Y231C	CRLS1_ENST00000452938.1_Silent_p.L202L|CRLS1_ENST00000464921.1_3'UTR|CRLS1_ENST00000378868.4_Missense_Mutation_p.Y132C	NM_019095.4	NP_061968.1	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1	231					cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			lung(3)|ovary(1)	4						AATCCTTGCTATGCCACTGCT	0.294																																					p.Y231C		Atlas-SNP	.											.	CRLS1	14	.	0			c.A692G						.						111.0	109.0	110.0					20																	6012689		2203	4300	6503	SO:0001583	missense	54675	exon5			CTTGCTATGCCAC	AF241784	CCDS13096.1, CCDS46578.1	20p13-p12.3	2006-04-04	2006-04-04	2006-04-04	ENSG00000088766	ENSG00000088766			16148	protein-coding gene	gene with protein product	"""GCD10 homolog (S. cerevisiae)"""	608188	"""chromosome 20 open reading frame 155"""	C20orf155		16547353	Standard	NM_019095		Approved	dJ967N21.6, CLS1, GCD10	uc002wmn.4	Q9UJA2	OTTHUMG00000031823	ENST00000378863.4:c.692A>G	chr20.hg19:g.6012689A>G	ENSP00000368140:p.Tyr231Cys	496.0	0.0		220.0	174.0	NM_019095	D3DW09|E9PAT4|Q27RP0|Q69YQ5	Missense_Mutation	SNP	ENST00000378863.4	hg19	CCDS13096.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.966316	0.74131	.	.	ENSG00000088766	ENST00000378863;ENST00000378868	.	.	.	5.97	5.97	0.96955	.	0.055339	0.85682	D	0.000000	T	0.77738	0.4175	M	0.73962	2.25	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.70487	0.947;0.969	T	0.78432	-0.2206	9	0.46703	T	0.11	-23.9434	14.4129	0.67128	1.0:0.0:0.0:0.0	.	132;231	Q9UJA2-2;Q9UJA2	.;CRLS1_HUMAN	C	231;132	.	ENSP00000368140:Y231C	Y	+	2	0	CRLS1	5960689	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.354000	0.79424	2.288000	0.76882	0.533000	0.62120	TAT	.	.		0.294	CRLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077902.2	NM_019095	
LRRN4	164312	hgsc.bcm.edu	37	20	6022515	6022515	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:6022515C>A	ENST00000378858.4	-	5	1600	c.1376G>T	c.(1375-1377)gGa>gTa	p.G459V		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	459					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GGCATGTTCTCCTCGGTGCTG	0.652																																					p.G459V		Atlas-SNP	.											.	LRRN4	54	.	0			c.G1376T						.						135.0	128.0	130.0					20																	6022515		2203	4300	6503	SO:0001583	missense	164312	exon5			TGTTCTCCTCGGT	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.1376G>T	chr20.hg19:g.6022515C>A	ENSP00000368135:p.Gly459Val	74.0	0.0		60.0	45.0	NM_152611	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	hg19	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072530	0.36566	.	.	ENSG00000125872	ENST00000378858	T	0.57107	0.42	4.86	-6.66	0.01789	.	1.870380	0.03186	U	0.172668	T	0.26268	0.0641	N	0.14661	0.345	0.09310	N	0.999992	B	0.29432	0.244	B	0.22386	0.039	T	0.07501	-1.0769	10	0.27785	T	0.31	1.1873	2.4386	0.04489	0.1015:0.2082:0.2304:0.4599	.	459	Q8WUT4	LRRN4_HUMAN	V	459	ENSP00000368135:G459V	ENSP00000368135:G459V	G	-	2	0	LRRN4	5970515	0.000000	0.05858	0.000000	0.03702	0.353000	0.29299	-2.039000	0.01418	-0.776000	0.04578	0.561000	0.74099	GGA	.	.		0.652	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
SDC4	6385	hgsc.bcm.edu	37	20	43956037	43956037	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:43956037A>G	ENST00000372733.3	-	5	503	c.464T>C	c.(463-465)aTc>aCc	p.I155T	SDC4_ENST00000537976.1_Missense_Mutation_p.I83T	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	155					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)		SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				GATGCCCACGATGCCACCCAC	0.542			T	ROS1	NSCLC																																p.I155T		Atlas-SNP	.		Dom	yes		20	20q12	6385	syndecan 4		E	.	SDC4	16	.	0			c.T464C						.						77.0	72.0	74.0					20																	43956037		2203	4300	6503	SO:0001583	missense	6385	exon5			CCCACGATGCCAC	X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.464T>C	chr20.hg19:g.43956037A>G	ENSP00000361818:p.Ile155Thr	58.0	0.0		54.0	16.0	NM_002999	O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	ENST00000372733.3	hg19	CCDS13350.1	.	.	.	.	.	.	.	.	.	.	A	8.434	0.849361	0.17034	.	.	ENSG00000124145	ENST00000372733;ENST00000537976	T	0.31510	1.49	5.37	-0.0764	0.13723	.	0.586050	0.17268	N	0.180512	T	0.17109	0.0411	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16482	-1.0401	10	0.72032	D	0.01	-4.6192	5.5791	0.17241	0.5167:0.2839:0.1994:0.0	.	155	P31431	SDC4_HUMAN	T	155;83	ENSP00000361818:I155T	ENSP00000361818:I155T	I	-	2	0	SDC4	43389451	0.000000	0.05858	0.003000	0.11579	0.445000	0.32107	0.498000	0.22530	0.036000	0.15547	0.533000	0.62120	ATC	.	.		0.542	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999	
PMEPA1	56937	hgsc.bcm.edu	37	20	56227494	56227494	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:56227494G>T	ENST00000341744.3	-	4	798	c.479C>A	c.(478-480)cCc>cAc	p.P160H	PMEPA1_ENST00000395814.1_Missense_Mutation_p.P110H|PMEPA1_ENST00000395816.3_Missense_Mutation_p.P110H|PMEPA1_ENST00000265626.4_Missense_Mutation_p.P110H|PMEPA1_ENST00000347215.4_Missense_Mutation_p.P125H	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	160					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						GCCCTGGTAGGGTGGGGGCTC	0.667																																					p.P160H		Atlas-SNP	.											PMEPA1,NS,carcinoma,0,1	PMEPA1	29	.	0			c.C479A						.						31.0	35.0	33.0					20																	56227494		2203	4299	6502	SO:0001583	missense	56937	exon4			TGGTAGGGTGGGG	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.479C>A	chr20.hg19:g.56227494G>T	ENSP00000345826:p.Pro160His	61.0	0.0		89.0	31.0	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	ENST00000341744.3	hg19	CCDS13463.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479742	0.84747	.	.	ENSG00000124225	ENST00000341744;ENST00000347215;ENST00000395816;ENST00000265626;ENST00000395814;ENST00000414037;ENST00000395819	T;T;T;T;T;T;T	0.69806	0.02;0.11;0.06;0.06;0.06;0.2;-0.43	5.42	4.48	0.54585	.	0.055200	0.64402	D	0.000001	T	0.81763	0.4891	M	0.80616	2.505	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.971	D	0.84419	0.0570	10	0.87932	D	0	-31.1453	13.7523	0.62915	0.0739:0.0:0.9261:0.0	.	125;160	Q5JY37;Q969W9	.;PMEPA_HUMAN	H	160;125;110;110;110;132;217	ENSP00000345826:P160H;ENSP00000344014:P125H;ENSP00000379161:P110H;ENSP00000265626:P110H;ENSP00000379159:P110H;ENSP00000401506:P132H;ENSP00000379164:P217H	ENSP00000265626:P110H	P	-	2	0	PMEPA1	55660900	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.622000	0.98378	1.280000	0.44463	0.650000	0.86243	CCC	.	.		0.667	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
OPRL1	4987	hgsc.bcm.edu	37	20	62729870	62729870	+	Silent	SNP	G	G	A	rs144338110		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:62729870G>A	ENST00000349451.3	+	6	1243	c.831G>A	c.(829-831)acG>acA	p.T277T	OPRL1_ENST00000336866.2_Silent_p.T277T|OPRL1_ENST00000355631.4_Silent_p.T277T	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	277					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GCTGCTGGACGCCTGTCCAGG	0.672																																					p.T277T		Atlas-SNP	.											.	OPRL1	47	.	0			c.G831A						.						62.0	55.0	57.0					20																	62729870		2200	4296	6496	SO:0001819	synonymous_variant	4987	exon4			CTGGACGCCTGTC		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.831G>A	chr20.hg19:g.62729870G>A		85.0	0.0		101.0	55.0	NM_000913	Q8TD34|Q8WYH9|Q9H4K4	Silent	SNP	ENST00000349451.3	hg19	CCDS13556.1																																																																																			.	G|1.000;T|0.000		0.672	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647	
POTEH	23784	hgsc.bcm.edu	37	22	16267071	16267071	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr22:16267071C>T	ENST00000343518.6	-	9	1429	c.1378G>A	c.(1378-1380)Gga>Aga	p.G460R		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	460										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TGAGTACTTCCGTGCTTCTTC	0.363																																					p.G460R		Atlas-SNP	.											POTEH,NS,carcinoma,0,1	POTEH	114	.	0			c.G1378A						.						241.0	214.0	222.0					22																	16267071		692	1591	2283	SO:0001583	missense	23784	exon9			TACTTCCGTGCTT	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1378G>A	chr22.hg19:g.16267071C>T	ENSP00000340610:p.Gly460Arg	918.0	0.0		971.0	133.0	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	hg19	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	C	0.306	-0.970906	0.02232	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.24151	1.87	1.4	-2.79	0.05841	.	.	.	.	.	T	0.10380	0.0254	N	0.12746	0.255	0.09310	N	1	B;B	0.27286	0.174;0.041	B;B	0.17979	0.02;0.005	T	0.16867	-1.0388	9	0.36615	T	0.2	.	3.3264	0.07068	0.0:0.2957:0.2166:0.4876	.	460;423	Q6S545;A6NKF6	POTEH_HUMAN;.	R	423;460	ENSP00000340610:G460R	ENSP00000340610:G460R	G	-	1	0	POTEH	14647071	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.911000	0.01583	-1.522000	0.01769	-1.206000	0.01644	GGA	.	.		0.363	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
CABIN1	23523	hgsc.bcm.edu	37	22	24494016	24494016	+	Silent	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr22:24494016A>G	ENST00000398319.2	+	26	4363	c.3978A>G	c.(3976-3978)tcA>tcG	p.S1326S	CABIN1_ENST00000405822.2_Silent_p.S1276S|CABIN1_ENST00000263119.5_Silent_p.S1326S	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1326					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCCACTCTTCAGCTGGGACAC	0.612																																					p.S1326S		Atlas-SNP	.											.	CABIN1	153	.	0			c.A3978G						.						103.0	91.0	95.0					22																	24494016		2203	4300	6503	SO:0001819	synonymous_variant	23523	exon26			CTCTTCAGCTGGG	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3978A>G	chr22.hg19:g.24494016A>G		134.0	0.0		153.0	61.0	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	ENST00000398319.2	hg19	CCDS13823.1																																																																																			.	.		0.612	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
PLA2G6	8398	hgsc.bcm.edu	37	22	38524361	38524361	+	Silent	SNP	G	G	A	rs375896475		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr22:38524361G>A	ENST00000332509.3	-	9	1446	c.1263C>T	c.(1261-1263)gtC>gtT	p.V421V	PLA2G6_ENST00000490473.1_5'Flank|PLA2G6_ENST00000335539.3_Intron|PLA2G6_ENST00000402064.1_Intron	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	421					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	GCTCCGCGGGGACCCCGTGGA	0.612																																					p.V421V		Atlas-SNP	.											.	PLA2G6	54	.	0			c.C1263T						.	G	,,	0,4406		0,0,2203	101.0	93.0	96.0		,,1263	-0.1	0.0	22		96	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,coding-synonymous	PLA2G6	NM_001004426.1,NM_001199562.1,NM_003560.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	,,421/807	38524361	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8398	exon9			CGCGGGGACCCCG	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.1263C>T	chr22.hg19:g.38524361G>A		79.0	0.0		94.0	44.0	NM_003560	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Silent	SNP	ENST00000332509.3	hg19	CCDS13967.1	.	.	.	.	.	.	.	.	.	.	G	0.221	-1.028616	0.02045	0.0	1.16E-4	ENSG00000184381	ENST00000452794;ENST00000427114	.	.	.	4.78	-0.0792	0.13711	.	.	.	.	.	T	0.24314	0.0589	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26780	-1.0093	4	.	.	.	-2.0931	5.0374	0.14441	0.1656:0.0:0.4424:0.392	.	.	.	.	F	78;226	.	.	S	-	2	0	PLA2G6	36854307	0.004000	0.15560	0.012000	0.15200	0.101000	0.19017	0.060000	0.14342	0.514000	0.28300	0.563000	0.77884	TCC	.	.		0.612	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1	NM_001004426	
ADSL	158	hgsc.bcm.edu	37	22	40742624	40742624	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr22:40742624A>G	ENST00000216194.7	+	1	118	c.62A>G	c.(61-63)tAt>tGt	p.Y21C	ADSL_ENST00000342312.6_Missense_Mutation_p.Y21C|ADSL_ENST00000454266.2_Missense_Mutation_p.Y21C	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	21	Substrate binding; shared with neighboring subunit.				'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GCCTCCCGCTATGCCAGCCCG	0.642																																					p.Y21C	Colon(4;65 130 1097 1516)	Atlas-SNP	.											.	ADSL	98	.	0			c.A62G						.						37.0	31.0	33.0					22																	40742624		2203	4300	6503	SO:0001583	missense	158	exon1			CCCGCTATGCCAG	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.62A>G	chr22.hg19:g.40742624A>G	ENSP00000216194:p.Tyr21Cys	46.0	0.0		41.0	17.0	NM_001123378	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	hg19	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.462024	0.84425	.	.	ENSG00000239900	ENST00000216194;ENST00000544206;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.98617	-3.98;-3.98;-5.03	4.8	4.8	0.61643	L-Aspartase-like (1);L-Aspartase-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	M	0.92317	3.295	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.72625	0.954;0.978;0.97;0.97	D	0.98985	1.0806	10	0.87932	D	0	-16.8225	14.5069	0.67758	1.0:0.0:0.0:0.0	.	21;21;21;21	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	C	21	ENSP00000216194:Y21C;ENSP00000390107:Y21C;ENSP00000341429:Y21C	ENSP00000216194:Y21C	Y	+	2	0	ADSL	39072570	1.000000	0.71417	0.995000	0.50966	0.727000	0.41649	7.908000	0.87438	2.148000	0.66965	0.524000	0.50904	TAT	.	.		0.642	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	
EP300	2033	hgsc.bcm.edu	37	22	41574913	41574913	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr22:41574913T>A	ENST00000263253.7	+	31	8417	c.7198T>A	c.(7198-7200)Tca>Aca	p.S2400T	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2400					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CACCGATAACTCAGACTTGAA	0.453			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.S2400T		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.T7198A						.						51.0	52.0	52.0					22																	41574913		2203	4300	6503	SO:0001583	missense	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	GATAACTCAGACT	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.7198T>A	chr22.hg19:g.41574913T>A	ENSP00000263253:p.Ser2400Thr	65.0	0.0		84.0	29.0	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	hg19	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	T	10.50	1.367727	0.24771	.	.	ENSG00000100393	ENST00000263253	D	0.83075	-1.68	5.65	2.21	0.28008	.	0.190634	0.25517	N	0.030134	T	0.71039	0.3293	L	0.36672	1.1	0.22719	N	0.998815	B	0.12630	0.006	B	0.15870	0.014	T	0.49163	-0.8968	10	0.02654	T	1	-0.5412	13.2545	0.60070	0.0:0.0:0.3926:0.6074	.	2400	Q09472	EP300_HUMAN	T	2400	ENSP00000263253:S2400T	ENSP00000263253:S2400T	S	+	1	0	EP300	39904859	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	2.532000	0.45659	0.060000	0.16281	0.533000	0.62120	TCA	.	.		0.453	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ZC3H7B	23264	hgsc.bcm.edu	37	22	41723227	41723227	+	Silent	SNP	G	G	T			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr22:41723227G>T	ENST00000352645.4	+	5	560	c.303G>T	c.(301-303)gcG>gcT	p.A101A	ZC3H7B_ENST00000351589.4_Silent_p.A101A	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	101					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						ATGAGAAGGCGCTGGAGGACA	0.627																																					p.A101A		Atlas-SNP	.											.	ZC3H7B	82	.	0			c.G303T						.						104.0	83.0	90.0					22																	41723227		2203	4300	6503	SO:0001819	synonymous_variant	23264	exon5			GAAGGCGCTGGAG		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.303G>T	chr22.hg19:g.41723227G>T		63.0	0.0		52.0	19.0	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	ENST00000352645.4	hg19	CCDS14013.1																																																																																			.	.		0.627	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
TBC1D25	4943	hgsc.bcm.edu	37	X	48418426	48418426	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chrX:48418426T>C	ENST00000376771.4	+	6	1471	c.1130T>C	c.(1129-1131)tTt>tCt	p.F377S	snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_Missense_Mutation_p.F123S	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	377	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GCCACCAAGTTTGCACACTTG	0.557																																					p.F377S		Atlas-SNP	.											.	TBC1D25	70	.	0			c.T1130C						.						45.0	30.0	35.0					X																	48418426		2202	4300	6502	SO:0001583	missense	4943	exon6			CCAAGTTTGCACA	L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1130T>C	chrX.hg19:g.48418426T>C	ENSP00000365962:p.Phe377Ser	47.0	0.0		50.0	41.0	NM_002536	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	hg19	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.858072	0.51376	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.22945	1.93;1.93	5.65	5.65	0.86999	Rab-GAP/TBC domain (5);	0.000000	0.85682	D	0.000000	T	0.51736	0.1692	M	0.78285	2.405	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.99	T	0.56811	-0.7917	10	0.87932	D	0	-16.9959	12.708	0.57073	0.0:0.0:0.0:1.0	.	381;319;377	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	S	377;123	ENSP00000365962:F377S;ENSP00000444091:F123S	ENSP00000365962:F377S	F	+	2	0	TBC1D25	48303370	1.000000	0.71417	0.998000	0.56505	0.301000	0.27625	7.396000	0.79891	1.908000	0.55244	0.352000	0.21897	TTT	.	.		0.557	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536	
ZNF337	26152	hgsc.bcm.edu	37	20	25655715	25655718	+	Frame_Shift_Del	DEL	GTAA	GTAA	-			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr20:25655715_25655718delGTAA	ENST00000376436.1	-	4	2745_2748	c.2206_2209delTTAC	c.(2206-2211)ttacgtfs	p.LR736fs	ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|ZNF337_ENST00000538750.1_Frame_Shift_Del_p.LR704fs|RP4-694B14.5_ENST00000414393.1_RNA|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000252979.5_Frame_Shift_Del_p.LR736fs|RP4-694B14.5_ENST00000439498.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	736					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CGCTTCTCACGTAAGTGTCTCTTT	0.426																																					p.736_737del		Atlas-INDEL	.											.	ZNF337	65	.	0			c.2207_2210del						.																																			SO:0001589	frameshift_variant	26152	exon5			.		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.2206_2209delTTAC	chr20.hg19:g.25655715_25655718delGTAA	ENSP00000365619:p.Leu736fs	81.0	0.0		83.0	38.0	NM_015655	B4DSM2|Q9Y3Y5	Frame_Shift_Del	DEL	ENST00000376436.1	hg19	CCDS13174.1																																																																																			.	.		0.426	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
KIF4B	285643	hgsc.bcm.edu	37	5	154396709	154396714	+	In_Frame_Del	DEL	AGCAGT	AGCAGT	-	rs370374254		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	AGCAGT	AGCAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr5:154396709_154396714delAGCAGT	ENST00000435029.4	+	1	3450_3455	c.3290_3295delAGCAGT	c.(3289-3297)aagcagtgt>agt	p.1097_1099KQC>S		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1097	Globular. {ECO:0000250}.|Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGTGGGAACAAGCAGTGTGGGTGCAG	0.529																																					p.1097_1098del		Atlas-INDEL	.											.	KIF4B	307	.	0			c.3289_3294del						.																																			SO:0001651	inframe_deletion	285643	exon1			.	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.3290_3295delAGCAGT	chr5.hg19:g.154396709_154396714delAGCAGT	ENSP00000387875:p.Lys1097_Cys1099delinsSer	233.0	0.0		228.0	88.0	NM_001099293		In_Frame_Del	DEL	ENST00000435029.4	hg19	CCDS47324.1																																																																																			.	.		0.529	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
DAAM1	23002	hgsc.bcm.edu	37	14	59834319	59834320	+	Splice_Site	INS	-	-	GA			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr14:59834319_59834320insGA	ENST00000395125.1	+	24	3050		c.e24+2		DAAM1_ENST00000351081.1_Splice_Site|DAAM1_ENST00000360909.3_Splice_Site|DAAM1_ENST00000553966.1_Splice_Site	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1						actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GAAGCTCAGGTGAGAGGATGAT	0.446																																					.		Atlas-INDEL	.											.	DAAM1	95	.	0			c.2997+2->GA						.																																			SO:0001630	splice_region_variant	23002	exon24			.	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.3027+2->GA	chr14.hg19:g.59834322_59834323dupGA		75.0	0.0		36.0	23.0	NM_001270520	Q86U34|Q8N1Z8|Q8TB39	Splice_Site	INS	ENST00000395125.1	hg19	CCDS9737.1																																																																																			.	.		0.446	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	Intron
CFP	5199	hgsc.bcm.edu	37	X	47485892	47485892	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chrX:47485892delC	ENST00000396992.3	-	7	1087	c.967delG	c.(967-969)gagfs	p.E323fs	CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Frame_Shift_Del_p.E323fs|CFP_ENST00000377005.2_Frame_Shift_Del_p.E323fs	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	323	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GGGCTCCACTCCCCCCACGAG	0.602																																					p.E323fs		Atlas-INDEL	.											.	CFP	43	.	0			c.968delA						.						43.0	35.0	38.0					X																	47485892		2203	4300	6503	SO:0001589	frameshift_variant	5199	exon7			.	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.967delG	chrX.hg19:g.47485892delC	ENSP00000380189:p.Glu323fs	67.0	0.0		57.0	47.0	NM_001145252	O15134|O15135|O15136|O75826	Frame_Shift_Del	DEL	ENST00000396992.3	hg19	CCDS14282.1																																																																																			.	.		0.602	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621	
PUM2	23369	hgsc.bcm.edu	37	2	20507799	20507800	+	Frame_Shift_Ins	INS	-	-	TT	rs149498911	byFrequency	TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:20507799_20507800insTT	ENST00000361078.2	-	6	844_845	c.822_823insAA	c.(820-825)caacagfs	p.Q275fs	PUM2_ENST00000338086.5_Frame_Shift_Ins_p.Q275fs|PUM2_ENST00000536417.1_Frame_Shift_Ins_p.Q219fs|PUM2_ENST00000420234.1_5'Flank|PUM2_ENST00000403432.1_Frame_Shift_Ins_p.Q275fs|PUM2_ENST00000319801.5_Frame_Shift_Ins_p.Q275fs			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	275					regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAGTTAACTGTTGAACTGTTA	0.361																																					p.Q275fs		Atlas-INDEL	.											.	PUM2	91	.	0			c.823_824insAA						.																																			SO:0001589	frameshift_variant	23369	exon6			.	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.821_822dupAA	chr2.hg19:g.20507800_20507801dupTT	ENSP00000354370:p.Gln275fs	57.0	0.0		55.0	23.0	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Frame_Shift_Ins	INS	ENST00000361078.2	hg19																																																																																				.	.		0.361	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
FLCN	201163	hgsc.bcm.edu	37	17	17127383	17127385	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr17:17127383_17127385delGAA	ENST00000285071.4	-	6	923_925	c.469_471delTTC	c.(469-471)ttcdel	p.F157del	RP11-45M22.4_ENST00000427497.3_Intron|FLCN_ENST00000389169.5_In_Frame_Del_p.F157del	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	157			Missing (in PSP; impaired protein stability). {ECO:0000269|PubMed:18505456}.		cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						TGTCCTTGATGAAGAAGGTGTGG	0.596									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																												p.157_158del		Atlas-INDEL	.											.	FLCN	87	.	0			c.470_472del	GRCh37	CD083304	FLCN	D		.																																			SO:0001651	inframe_deletion	201163	exon6	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	.	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.469_471delTTC	chr17.hg19:g.17127386_17127388delGAA	ENSP00000285071:p.Phe157del	108.0	0.0		71.0	44.0	NM_144997	A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	In_Frame_Del	DEL	ENST00000285071.4	hg19	CCDS32579.1																																																																																			.	.		0.596	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131577.1	NM_144606	
LAMA1	284217	hgsc.bcm.edu	37	18	6965285	6965307	+	Splice_Site	DEL	TACCTTGCTTCCGGTTTCGCTGG	TACCTTGCTTCCGGTTTCGCTGG	-	rs140792199|rs542213899|rs200776408		TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	TACCTTGCTTCCGGTTTCGCTGG	TACCTTGCTTCCGGTTTCGCTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr18:6965285_6965307delTACCTTGCTTCCGGTTTCGCTGG	ENST00000389658.3	-	50	7268_7289	c.7175_7196delCCAGCGAAACCGGAAGCAAGGTA	c.(7174-7197)tccagcgaaaccggaagcaaggta>ta	p.SSETGSKV2392fs		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2392	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.R2396Q(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTGTGTCCCTACCTTGCTTCCGGTTTCGCTGGAAGGCAATTTT	0.439																																					p.2393_2399del		Atlas-INDEL	.											.	LAMA1	458	.	1	Substitution - Missense(1)	ovary(1)	c.7177_7195del						.																																			SO:0001630	splice_region_variant	284217	exon50			.	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7195+1CCAGCGAAACCGGAAGCAAGGTA>-	chr18.hg19:g.6965285_6965307delTACCTTGCTTCCGGTTTCGCTGG		93.0	0.0		74.0	18.0	NM_005559		Frame_Shift_Del	DEL	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.		0.439	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	Frame_Shift_Del
DLX6	1750	hgsc.bcm.edu	37	7	96635364	96635369	+	In_Frame_Del	DEL	GCAGCA	GCAGCA	-			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	GCAGCA	GCAGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr7:96635364_96635369delGCAGCA	ENST00000518156.2	+	1	505_510	c.75_80delGCAGCA	c.(73-81)gggcagcag>ggg	p.QQ42del	DLX6-AS1_ENST00000430404.2_RNA|DLX6_ENST00000007660.5_In_Frame_Del_p.QQ30del|DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000452769.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	0					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TGGAGTTCGGgcagcagcagcagcag	0.641																																					p.25_27del		Atlas-INDEL	.											.	DLX6	37	.	0			c.74_79del						.																																			SO:0001651	inframe_deletion	1750	exon1			.		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.75_80delGCAGCA	chr7.hg19:g.96635370_96635375delGCAGCA	ENSP00000428480:p.Gln42_Gln43del	34.0	0.0		26.0	12.0	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	In_Frame_Del	DEL	ENST00000518156.2	hg19	CCDS47647.2																																																																																			.	.		0.641	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222	
BRD2	6046	hgsc.bcm.edu	37	6	32947653	32947653	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr6:32947653delT	ENST00000374825.4	+	11	3591	c.1890delT	c.(1888-1890)ggtfs	p.G630fs	BRD2_ENST00000395289.2_Frame_Shift_Del_p.G665fs|BRD2_ENST00000443797.2_Frame_Shift_Del_p.G510fs|BRD2_ENST00000449085.2_Frame_Shift_Del_p.G583fs|BRD2_ENST00000395287.1_Frame_Shift_Del_p.G665fs|BRD2_ENST00000374831.4_Frame_Shift_Del_p.G630fs	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	630					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						TGCCTACAGGTTATGATTCAG	0.522																																					p.G665fs		Atlas-INDEL	.											.	BRD2	70	.	0			c.1994delG						.						45.0	47.0	46.0					6																	32947653		1509	2708	4217	SO:0001589	frameshift_variant	6046	exon11			.	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1890delT	chr6.hg19:g.32947653delT	ENSP00000363958:p.Gly630fs	122.0	0.0		108.0	50.0	NM_001199455	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Frame_Shift_Del	DEL	ENST00000374825.4	hg19	CCDS4762.1																																																																																			.	.		0.522	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
CCDC138	165055	hgsc.bcm.edu	37	2	109411169	109411170	+	Frame_Shift_Ins	INS	-	-	AATTG			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:109411169_109411170insAATTG	ENST00000295124.4	+	5	628_629	c.568_569insAATTG	c.(568-570)aaafs	p.-191fs	CCDC138_ENST00000412964.2_Frame_Shift_Ins_p.-191fs	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138											endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						GATACATCTGAAATTGCAGGTA	0.312																																					p.K190fs		Atlas-INDEL	.											.	CCDC138	49	.	0			c.568_569insAATTG						.																																			SO:0001589	frameshift_variant	165055	exon5			.	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.569_573dupAATTG	chr2.hg19:g.109411170_109411174dupAATTG	ENSP00000295124:p.Leu191fs	81.0	0.0		71.0	26.0	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Frame_Shift_Ins	INS	ENST00000295124.4	hg19	CCDS2080.1																																																																																			.	.		0.312	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	
CEACAM1	634	hgsc.bcm.edu	37	19	43023248	43023249	+	In_Frame_Ins	INS	-	-	AGACTC			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr19:43023248_43023249insAGACTC	ENST00000161559.6	-	5	1231_1232	c.1097_1098insGAGTCT	c.(1096-1098)ctc>ctGAGTCTc	p.366_366L>LSL	LIPE-AS1_ENST00000594688.1_RNA|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000352591.5_Intron|CEACAM1_ENST00000599389.1_Intron|CEACAM1_ENST00000403444.3_In_Frame_Ins_p.366_366L>LSL|CEACAM1_ENST00000351134.3_Intron|CEACAM1_ENST00000403461.1_Intron|CEACAM1_ENST00000358394.3_Intron|CEACAM1_ENST00000308072.4_Intron	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	366	Ig-like C2-type 3.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	CCGAGGACGGGAGACTCTGGTT	0.525																																					p.L366delinsLSL		Atlas-INDEL	.											.	CEACAM1	43	.	0			c.1098_1099insGAGTCT						.																																			SO:0001652	inframe_insertion	634	exon5			.	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.1092_1097dupGAGTCT	chr19.hg19:g.43023249_43023254dupAGACTC	ENSP00000161559:p.SerLeu366dup	185.0	0.0		146.0	49.0	NM_001205344	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	In_Frame_Ins	INS	ENST00000161559.6	hg19	CCDS12609.1																																																																																			.	.		0.525	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
DNAH6	1768	hgsc.bcm.edu	37	2	84960668	84960668	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AACX-01A-11D-A40R-10	TCGA-DD-AACX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a122c38-1433-433c-855c-db0cc9656a78	7645f6cb-664b-4790-b507-7f04d533a3d2	g.chr2:84960668delA	ENST00000237449.6	+	61	10315	c.10307delA	c.(10306-10308)caafs	p.Q3436fs	DNAH6_ENST00000389394.3_Frame_Shift_Del_p.Q3436fs			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3436					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GGACTTACCCAAAATATATTG	0.433																																					p.Q3436fs		Atlas-INDEL	.											.	DNAH6	194	.	0			c.10306delC						.						151.0	123.0	131.0					2																	84960668		692	1591	2283	SO:0001589	frameshift_variant	1768	exon62			.	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.10307delA	chr2.hg19:g.84960668delA	ENSP00000237449:p.Gln3436fs	121.0	0.0		138.0	48.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Frame_Shift_Del	DEL	ENST00000237449.6	hg19	CCDS46348.1																																																																																			.	.		0.433	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
