#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SCMH1	22955	hgsc.bcm.edu	37	1	41608748	41608748	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:41608748T>A	ENST00000326197.7	-	5	483	c.184A>T	c.(184-186)Atg>Ttg	p.M62L	SCMH1_ENST00000361191.5_Start_Codon_SNP_p.M1L|SCMH1_ENST00000402904.2_Missense_Mutation_p.M62L|SCMH1_ENST00000372596.1_Start_Codon_SNP_p.M1L|SCMH1_ENST00000456518.2_Missense_Mutation_p.M15L|SCMH1_ENST00000337495.5_Missense_Mutation_p.M72L|SCMH1_ENST00000361705.3_Missense_Mutation_p.M15L|SCMH1_ENST00000372597.1_Missense_Mutation_p.M15L|SCMH1_ENST00000397171.2_Start_Codon_SNP_p.M1L|SCMH1_ENST00000372595.1_Start_Codon_SNP_p.M1L|SCMH1_ENST00000397174.2_Missense_Mutation_p.M42L					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				TCCAATTTCATACTGATCTTG	0.488																																					p.M72L		Atlas-SNP	.											.	SCMH1	120	.	0			c.A214T						.						205.0	203.0	204.0					1																	41608748		2203	4300	6503	SO:0001583	missense	22955	exon6			ATTTCATACTGAT	AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.184A>T	chr1.hg19:g.41608748T>A	ENSP00000318094:p.Met62Leu	65.0	0.0		56.0	20.0	NM_001172219		Missense_Mutation	SNP	ENST00000326197.7	hg19	CCDS30688.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.790054	0.90367	.	.	ENSG00000010803	ENST00000361705;ENST00000456518;ENST00000402904;ENST00000397174;ENST00000397171;ENST00000361191;ENST00000372597;ENST00000372596;ENST00000337495;ENST00000372595;ENST00000326197	T;T;T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	M	0.87038	2.855	0.80722	D	1	P;D;P;D	0.58620	0.927;0.963;0.912;0.983	D;D;D;P	0.67725	0.945;0.953;0.949;0.891	T	0.73196	-0.4059	10	0.56958	D	0.05	.	15.4647	0.75390	0.0:0.0:0.0:1.0	.	15;72;15;62	B4DRQ8;Q96GD3-2;Q96GD3-4;Q96GD3	.;.;.;SCMH1_HUMAN	L	15;15;62;42;1;1;15;1;72;1;62	ENSP00000354996:M15L;ENSP00000403974:M15L;ENSP00000386079:M62L;ENSP00000380359:M42L;ENSP00000380356:M1L;ENSP00000354656:M1L;ENSP00000361678:M15L;ENSP00000361677:M1L;ENSP00000337352:M72L;ENSP00000361676:M1L;ENSP00000318094:M62L	ENSP00000318094:M62L	M	-	1	0	SCMH1	41381335	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.326000	0.78906	0.533000	0.62120	ATG	.	.		0.488	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
JAK1	3716	hgsc.bcm.edu	37	1	65311203	65311203	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:65311203C>A	ENST00000342505.4	-	15	2356	c.2108G>T	c.(2107-2109)aGc>aTc	p.S703I	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	703	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.S703T(2)|p.S703I(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CACCAAGTAGCTCAGGGCACT	0.542			Mis		ALL																																p.S703I		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	JAK1,colon,carcinoma,-1,6	JAK1	209	.	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.G2108T						.						170.0	175.0	174.0					1																	65311203		1982	4155	6137	SO:0001583	missense	3716	exon15			AAGTAGCTCAGGG	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2108G>T	chr1.hg19:g.65311203C>A	ENSP00000343204:p.Ser703Ile	84.0	0.0		62.0	29.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010965	0.75046	.	.	ENSG00000162434	ENST00000342505	D	0.83335	-1.71	4.72	4.72	0.59763	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.89942	0.6861	M	0.86097	2.795	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.87323	0.2319	9	0.23302	T	0.38	-6.6389	18.2436	0.89977	0.0:1.0:0.0:0.0	.	703	P23458	JAK1_HUMAN	I	703	ENSP00000343204:S703I	ENSP00000343204:S703I	S	-	2	0	JAK1	65083791	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.206000	0.77891	2.594000	0.87642	0.655000	0.94253	AGC	.	.		0.542	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
JAK1	3716	hgsc.bcm.edu	37	1	65311219	65311219	+	Silent	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:65311219G>A	ENST00000342505.4	-	15	2340	c.2092C>T	c.(2092-2094)Ctg>Ttg	p.L698L	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	698	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GCACTGGCCAGCTGTTTGGCA	0.532			Mis		ALL																																p.L698L		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1	209	.	0			c.C2092T						.						168.0	174.0	172.0					1																	65311219		1976	4159	6135	SO:0001819	synonymous_variant	3716	exon15			TGGCCAGCTGTTT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2092C>T	chr1.hg19:g.65311219G>A		92.0	0.0		67.0	31.0	NM_002227	Q59GQ2|Q9UD26	Silent	SNP	ENST00000342505.4	hg19	CCDS41346.1																																																																																			.	.		0.532	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
WDR63	126820	hgsc.bcm.edu	37	1	85537689	85537689	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:85537689G>A	ENST00000294664.6	+	2	244		c.e2+1		WDR63_ENST00000326813.8_Splice_Site|WDR63_ENST00000370596.1_Splice_Site	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63											NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		GTATTAGCTGGTAGGAATATT	0.308																																					.		Atlas-SNP	.											.	WDR63	91	.	0			c.64+1G>A						.						75.0	81.0	79.0					1																	85537689		2203	4300	6503	SO:0001630	splice_region_variant	126820	exon2			TAGCTGGTAGGAA		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.64+1G>A	chr1.hg19:g.85537689G>A		285.0	1.0		210.0	80.0	NM_145172	A8K988|Q96L72|Q96NU4	Splice_Site	SNP	ENST00000294664.6	hg19	CCDS702.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752739	0.31046	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664;ENST00000528899	.	.	.	4.21	3.29	0.37713	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.9752	0.30151	0.1097:0.0:0.8903:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR63	85310277	1.000000	0.71417	0.637000	0.29366	0.160000	0.22226	3.812000	0.55628	1.371000	0.46172	0.655000	0.94253	.	.	.		0.308	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172	Intron
RWDD3	25950	hgsc.bcm.edu	37	1	95710153	95710153	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:95710153A>G	ENST00000370202.4	+	2	548	c.472A>G	c.(472-474)Att>Gtt	p.I158V	RWDD3_ENST00000263893.6_Missense_Mutation_p.I158V|RWDD3_ENST00000495272.1_3'UTR|RWDD3_ENST00000429514.2_Missense_Mutation_p.I143V|RP11-57H12.5_ENST00000444665.1_RNA|RP11-57H12.6_ENST00000604534.1_3'UTR	NM_001199682.1|NM_015485.4	NP_001186611.1|NP_056300	Q9Y3V2	RWDD3_HUMAN	RWD domain containing 3	158					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of hypoxia-inducible factor-1alpha signaling pathway (GO:1902073)|positive regulation of protein sumoylation (GO:0033235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(2)|lung(6)|ovary(1)	10		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		ATATGTCAAAATTGTGGAGAA	0.373																																					p.I158V		Atlas-SNP	.											.	RWDD3	24	.	0			c.A472G						.						119.0	111.0	113.0					1																	95710153		1893	4115	6008	SO:0001583	missense	25950	exon2			GTCAAAATTGTGG	BC010936	CCDS41357.1, CCDS44177.1	1p22.1	2012-12-07			ENSG00000122481	ENSG00000122481			21393	protein-coding gene	gene with protein product		615875				11230166	Standard	NM_015485		Approved	DKFZP566K023	uc009wdu.3	Q9Y3V2	OTTHUMG00000010910	ENST00000370202.4:c.472A>G	chr1.hg19:g.95710153A>G	ENSP00000359221:p.Ile158Val	149.0	0.0		137.0	57.0	NM_001128142	A6NP44|A8K9F0|C9J9L7|C9JI45|Q08AJ7|Q6FID3|Q9BX35	Missense_Mutation	SNP	ENST00000370202.4	hg19	CCDS41357.1	.	.	.	.	.	.	.	.	.	.	A	0.316	-0.965001	0.02249	.	.	ENSG00000122481	ENST00000370202;ENST00000429514;ENST00000263893	T;T;T	0.35605	1.3;1.36;1.31	5.38	4.26	0.50523	.	0.361794	0.32175	N	0.006468	T	0.05823	0.0152	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.32640	-0.9899	10	0.25751	T	0.34	-0.3507	10.6502	0.45645	0.9235:0.0:0.0765:0.0	.	143;158;158;143;158	E7ES73;Q9Y3V2;D3DT49;Q9Y3V2-3;Q9Y3V2-2	.;RWDD3_HUMAN;.;.;.	V	158;143;158	ENSP00000359221:I158V;ENSP00000397398:I143V;ENSP00000263893:I158V	ENSP00000263893:I158V	I	+	1	0	RWDD3	95482741	1.000000	0.71417	0.005000	0.12908	0.979000	0.70002	4.092000	0.57707	1.000000	0.39049	0.528000	0.53228	ATT	.	.		0.373	RWDD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030078.1	NM_015485	
PALMD	54873	hgsc.bcm.edu	37	1	100152744	100152744	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:100152744A>G	ENST00000263174.4	+	6	888	c.513A>G	c.(511-513)aaA>aaG	p.K171K	PALMD_ENST00000605497.1_Splice_Site_p.K171K	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	171					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)		p.K171K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		AAAATAGGAAAGGTATATGAG	0.333																																					p.K171K		Atlas-SNP	.											PALMD,NS,carcinoma,0,1	PALMD	64	.	1	Substitution - coding silent(1)	endometrium(1)	c.A513G						.						72.0	77.0	76.0					1																	100152744		2199	4298	6497	SO:0001630	splice_region_variant	54873	exon6			TAGGAAAGGTATA	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.514+1A>G	chr1.hg19:g.100152744A>G		359.0	0.0		307.0	107.0	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Silent	SNP	ENST00000263174.4	hg19	CCDS758.1																																																																																			.	.		0.333	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	Silent
CELSR2	1952	hgsc.bcm.edu	37	1	109814231	109814231	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:109814231A>T	ENST00000271332.3	+	28	7874	c.7813A>T	c.(7813-7815)Atc>Ttc	p.I2605F	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2605					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGGCCCCTTCATCTTCCTCTC	0.612																																					p.I2605F	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-SNP	.											.	CELSR2	228	.	0			c.A7813T						.						104.0	91.0	96.0					1																	109814231		2203	4300	6503	SO:0001583	missense	1952	exon28			CCCTTCATCTTCC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7813A>T	chr1.hg19:g.109814231A>T	ENSP00000271332:p.Ile2605Phe	104.0	0.0		91.0	43.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	hg19	CCDS796.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.673902	0.67928	.	.	ENSG00000143126	ENST00000271332	T	0.55234	0.53	4.96	4.96	0.65561	GPCR, family 2-like (1);	.	.	.	.	T	0.65396	0.2687	M	0.88979	2.995	0.43814	D	0.996378	D	0.63880	0.993	D	0.68353	0.957	T	0.72669	-0.4223	9	0.72032	D	0.01	.	6.7614	0.23542	0.7684:0.1536:0.078:0.0	.	2605	Q9HCU4	CELR2_HUMAN	F	2605	ENSP00000271332:I2605F	ENSP00000271332:I2605F	I	+	1	0	CELSR2	109615754	0.986000	0.35501	1.000000	0.80357	0.977000	0.68977	1.657000	0.37366	2.089000	0.63090	0.459000	0.35465	ATC	.	.		0.612	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
ETV3	2117	hgsc.bcm.edu	37	1	157103988	157103988	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:157103988T>G	ENST00000368192.4	-	4	380	c.316A>C	c.(316-318)Aca>Cca	p.T106P	ETV3_ENST00000460850.1_5'Flank|ETV3_ENST00000326786.4_Missense_Mutation_p.T106P	NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	106					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				TTCCCTTTTGTTTTATGAAGG	0.368																																					p.T106P		Atlas-SNP	.											.	ETV3	50	.	0			c.A316C						.						153.0	132.0	139.0					1																	157103988		2203	4300	6503	SO:0001583	missense	2117	exon4			CTTTTGTTTTATG	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.316A>C	chr1.hg19:g.157103988T>G	ENSP00000357175:p.Thr106Pro	85.0	0.0		111.0	45.0	NM_005240	B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	ENST00000368192.4	hg19	CCDS44250.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843142	0.91197	.	.	ENSG00000117036	ENST00000368192;ENST00000326786	T;T	0.55588	0.51;0.51	6.06	6.06	0.98353	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.077028	0.53938	D	0.000055	T	0.56891	0.2016	L	0.37850	1.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.991;0.998	T	0.63005	-0.6733	10	0.87932	D	0	.	15.598	0.76602	0.0:0.0:0.0:1.0	.	106;106	P41162-2;P41162	.;ETV3_HUMAN	P	106	ENSP00000357175:T106P;ENSP00000327316:T106P	ENSP00000327316:T106P	T	-	1	0	ETV3	155370612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.987000	0.88182	2.315000	0.78130	0.533000	0.62120	ACA	.	.		0.368	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082843.2	NM_005240	
ETV3	2117	hgsc.bcm.edu	37	1	157104005	157104005	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:157104005T>C	ENST00000368192.4	-	4	363	c.299A>G	c.(298-300)aAg>aGg	p.K100R	ETV3_ENST00000460850.1_5'Flank|ETV3_ENST00000326786.4_Missense_Mutation_p.K100R	NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	100					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				AAGGATCCTCTTGTTGTAATA	0.373																																					p.K100R		Atlas-SNP	.											.	ETV3	50	.	0			c.A299G						.						157.0	131.0	140.0					1																	157104005		2203	4300	6503	SO:0001583	missense	2117	exon4			ATCCTCTTGTTGT	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.299A>G	chr1.hg19:g.157104005T>C	ENSP00000357175:p.Lys100Arg	78.0	0.0		101.0	38.0	NM_005240	B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	ENST00000368192.4	hg19	CCDS44250.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.002970	0.93287	.	.	ENSG00000117036	ENST00000368192;ENST00000326786	T;T	0.57752	0.38;0.38	6.06	6.06	0.98353	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.64402	D	0.000001	T	0.55752	0.1940	L	0.35487	1.065	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.62492	-0.6843	10	0.87932	D	0	.	15.598	0.76602	0.0:0.0:0.0:1.0	.	100;100	P41162-2;P41162	.;ETV3_HUMAN	R	100	ENSP00000357175:K100R;ENSP00000327316:K100R	ENSP00000327316:K100R	K	-	2	0	ETV3	155370629	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.987000	0.88182	2.315000	0.78130	0.533000	0.62120	AAG	.	.		0.373	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082843.2	NM_005240	
C1orf112	55732	hgsc.bcm.edu	37	1	169819420	169819420	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:169819420A>C	ENST00000286031.6	+	22	2878	c.2178A>C	c.(2176-2178)gaA>gaC	p.E726D	C1orf112_ENST00000498289.1_3'UTR|SCYL3_ENST00000367771.6_3'UTR|C1orf112_ENST00000359326.4_Missense_Mutation_p.E726D	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	726										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CAAATCATGAAGAGATAGTTC	0.323																																					p.E726D		Atlas-SNP	.											.	C1orf112	74	.	0			c.A2178C						.						68.0	68.0	68.0					1																	169819420		2203	4300	6503	SO:0001583	missense	55732	exon22			TCATGAAGAGATA	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.2178A>C	chr1.hg19:g.169819420A>C	ENSP00000286031:p.Glu726Asp	64.0	0.0		101.0	42.0	NM_018186	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	hg19	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133743	0.77662	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.47528	0.84;0.84	5.66	3.26	0.37387	.	0.046551	0.85682	N	0.000000	T	0.52837	0.1759	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.56475	-0.7973	10	0.66056	D	0.02	-11.5746	5.7481	0.18132	0.7724:0.0:0.08:0.1476	.	668;726	B4DGF2;Q9NSG2	.;CA112_HUMAN	D	726	ENSP00000352276:E726D;ENSP00000286031:E726D	ENSP00000286031:E726D	E	+	3	2	C1orf112	168086044	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.052000	0.30429	0.378000	0.24764	0.496000	0.49642	GAA	.	.		0.323	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
TOR3A	64222	hgsc.bcm.edu	37	1	179063230	179063230	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:179063230A>T	ENST00000367627.3	+	5	1573	c.821A>T	c.(820-822)aAt>aTt	p.N274I	TOR3A_ENST00000352445.6_Missense_Mutation_p.N274I	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	274					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TCTTTCAGTAATCTCAGGGGC	0.443																																					p.N274I		Atlas-SNP	.											.	TOR3A	28	.	0			c.A821T						.						86.0	86.0	86.0					1																	179063230		2203	4300	6503	SO:0001583	missense	64222	exon5			TCAGTAATCTCAG	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.821A>T	chr1.hg19:g.179063230A>T	ENSP00000356599:p.Asn274Ile	104.0	0.0		133.0	48.0	NM_022371	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	hg19	CCDS1329.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.195323	0.78902	.	.	ENSG00000186283	ENST00000367627;ENST00000352445;ENST00000447595	T;T;T	0.47528	0.84;0.84;0.84	5.55	5.55	0.83447	.	0.043895	0.85682	D	0.000000	T	0.72969	0.3527	M	0.91818	3.245	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.79902	-0.1607	10	0.87932	D	0	-28.8565	13.437	0.61090	1.0:0.0:0.0:0.0	.	274	Q9H497	TOR3A_HUMAN	I	274;274;166	ENSP00000356599:N274I;ENSP00000335351:N274I;ENSP00000410195:N166I	ENSP00000335351:N274I	N	+	2	0	TOR3A	177329853	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	8.530000	0.90606	2.107000	0.64212	0.459000	0.35465	AAT	.	.		0.443	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
DNAH14	127602	hgsc.bcm.edu	37	1	225525877	225525877	+	Intron	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:225525877A>T	ENST00000445597.2	+	46	7716				DNAH14_ENST00000430092.1_Missense_Mutation_p.N3383Y|DNAH14_ENST00000439375.2_Missense_Mutation_p.N3383Y			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATACAATTCAAATTTTAGGTA	0.338																																					p.N3383Y		Atlas-SNP	.											.	DNAH14	300	.	0			c.A10147T						.						169.0	144.0	151.0					1																	225525877		692	1590	2282	SO:0001627	intron_variant	127602	exon66			AATTCAAATTTTA	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7717-84A>T	chr1.hg19:g.225525877A>T		249.0	0.0		401.0	194.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	A	9.454	1.091278	0.20471	.	.	ENSG00000185842	ENST00000430092;ENST00000439375	T;T	0.22945	1.93;1.93	5.54	-1.1	0.09872	.	1.056200	0.07576	N	0.919413	T	0.44540	0.1298	M	0.91090	3.175	0.09310	N	0.999999	D	0.54964	0.969	P	0.51016	0.656	T	0.40059	-0.9583	10	0.87932	D	0	.	5.9362	0.19167	0.4216:0.3752:0.2032:0.0	.	3383	Q0VDD8-4	.	Y	3383	ENSP00000414402:N3383Y;ENSP00000392061:N3383Y	ENSP00000414402:N3383Y	N	+	1	0	DNAH14	223592500	0.003000	0.15002	0.002000	0.10522	0.014000	0.08584	1.199000	0.32235	-0.466000	0.06943	-0.461000	0.05368	AAT	.	.		0.338	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
OSR1	130497	hgsc.bcm.edu	37	2	19553489	19553489	+	Silent	SNP	T	T	G	rs368651434		TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:19553489T>G	ENST00000272223.2	-	2	422	c.78A>C	c.(76-78)gcA>gcC	p.A26A	OSR1_ENST00000536433.1_Silent_p.A26A	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	26					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				GGCCGTTCACTGCCTGAAGGA	0.602																																					p.A26A		Atlas-SNP	.											.	OSR1	29	.	0			c.A78C						.						53.0	50.0	51.0					2																	19553489		2203	4300	6503	SO:0001819	synonymous_variant	130497	exon2			GTTCACTGCCTGA	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.78A>C	chr2.hg19:g.19553489T>G		104.0	0.0		98.0	42.0	NM_145260	B3KV97|D6W521	Silent	SNP	ENST00000272223.2	hg19	CCDS1694.1																																																																																			.	.		0.602	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260	
DHX57	90957	hgsc.bcm.edu	37	2	39033812	39033812	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:39033812A>C	ENST00000295373.6	-	22	3831	c.3705T>G	c.(3703-3705)ttT>ttG	p.F1235L		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1235							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TGGTCTTCTGAAATTTTCCTT	0.363																																					p.F1235L	Melanoma(191;1090 2095 4375 23729 47341)	Atlas-SNP	.											.	DHX57	127	.	0			c.T3705G						.						124.0	114.0	117.0					2																	39033812		2203	4300	6503	SO:0001583	missense	90957	exon22			CTTCTGAAATTTT	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3705T>G	chr2.hg19:g.39033812A>C	ENSP00000295373:p.Phe1235Leu	102.0	0.0		100.0	38.0	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	hg19	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.604269	0.46423	.	.	ENSG00000163214	ENST00000295373	T	0.02656	4.21	5.37	-0.156	0.13391	Domain of unknown function DUF1605 (1);	0.112412	0.40385	N	0.001113	T	0.03390	0.0098	L	0.49640	1.575	0.35861	D	0.827502	B	0.16166	0.016	B	0.16722	0.016	T	0.34428	-0.9829	10	0.42905	T	0.14	.	9.977	0.41791	0.5542:0.0:0.4458:0.0	.	1235	Q6P158	DHX57_HUMAN	L	1235	ENSP00000295373:F1235L	ENSP00000295373:F1235L	F	-	3	2	DHX57	38887316	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	0.801000	0.27055	-0.262000	0.09392	0.379000	0.24179	TTT	.	.		0.363	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
HAAO	23498	hgsc.bcm.edu	37	2	43019665	43019665	+	Silent	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:43019665G>A	ENST00000294973.6	-	1	67	c.12C>T	c.(10-12)cgC>cgT	p.R4R		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						TCACTCCCAGGCGGCGCTCCA	0.692																																					p.R4R		Atlas-SNP	.											.	HAAO	26	.	0			c.C12T						.						28.0	34.0	32.0					2																	43019665		2203	4300	6503	SO:0001819	synonymous_variant	23498	exon1			TCCCAGGCGGCGC	Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.12C>T	chr2.hg19:g.43019665G>A		91.0	0.0		69.0	27.0	NM_012205		Silent	SNP	ENST00000294973.6	hg19	CCDS33187.1																																																																																			.	.		0.692	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325948.2		
EPAS1	2034	hgsc.bcm.edu	37	2	46609728	46609728	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:46609728A>G	ENST00000263734.3	+	15	2962	c.2452A>G	c.(2452-2454)Aag>Gag	p.K818E		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	818					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			GTCAGCCCACAAGGTGTCAGG	0.607																																					p.K818E		Atlas-SNP	.											.	EPAS1	83	.	0			c.A2452G						.						60.0	56.0	57.0					2																	46609728		2203	4300	6503	SO:0001583	missense	2034	exon15			GCCCACAAGGTGT	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.2452A>G	chr2.hg19:g.46609728A>G	ENSP00000263734:p.Lys818Glu	79.0	0.0		90.0	33.0	NM_001430	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	hg19	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.562019	0.45590	.	.	ENSG00000116016	ENST00000263734	T	0.56275	0.47	5.64	5.64	0.86602	.	0.755598	0.13214	N	0.404965	T	0.35998	0.0951	N	0.08118	0	0.40713	D	0.982596	P	0.38992	0.653	B	0.36666	0.23	T	0.43956	-0.9359	10	0.87932	D	0	.	14.0822	0.64932	1.0:0.0:0.0:0.0	.	818	Q99814	EPAS1_HUMAN	E	818	ENSP00000263734:K818E	ENSP00000263734:K818E	K	+	1	0	EPAS1	46463232	1.000000	0.71417	0.997000	0.53966	0.346000	0.29079	4.043000	0.57354	2.143000	0.66587	0.533000	0.62120	AAG	.	.		0.607	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
FOXN2	3344	hgsc.bcm.edu	37	2	48602189	48602189	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:48602189T>G	ENST00000340553.3	+	7	1164	c.903T>G	c.(901-903)gaT>gaG	p.D301E		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	301					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			CAAAAGAAGATCACAATTACA	0.438																																					p.D301E		Atlas-SNP	.											.	FOXN2	39	.	0			c.T903G						.						117.0	96.0	103.0					2																	48602189		2203	4300	6503	SO:0001583	missense	3344	exon7			AGAAGATCACAAT		CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.903T>G	chr2.hg19:g.48602189T>G	ENSP00000343633:p.Asp301Glu	146.0	0.0		104.0	36.0	NM_002158	Q15769|Q6P4Q2	Missense_Mutation	SNP	ENST00000340553.3	hg19	CCDS1838.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.912695	0.72983	.	.	ENSG00000170802	ENST00000304367;ENST00000340553	D	0.98012	-4.66	4.73	-0.115	0.13560	.	0.000000	0.85682	D	0.000000	D	0.97508	0.9184	L	0.58810	1.83	0.41689	D	0.989338	D	0.76494	0.999	D	0.78314	0.991	D	0.95687	0.8737	10	0.66056	D	0.02	.	8.1204	0.30967	0.0:0.3712:0.0:0.6288	.	301	P32314	FOXN2_HUMAN	E	210;301	ENSP00000343633:D301E	ENSP00000305685:D210E	D	+	3	2	FOXN2	48455693	0.998000	0.40836	0.998000	0.56505	0.999000	0.98932	0.372000	0.20467	-0.057000	0.13199	0.533000	0.62120	GAT	.	.		0.438	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251240.3	NM_002158	
NOTO	344022	hgsc.bcm.edu	37	2	73438052	73438052	+	Missense_Mutation	SNP	G	G	A	rs542458363	byFrequency	TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:73438052G>A	ENST00000398468.3	+	3	1160	c.751G>A	c.(751-753)Ggc>Agc	p.G251S		NM_001134462.1	NP_001127934.1	A8MTQ0	NOTO_HUMAN	notochord homeobox	251					cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|notochord development (GO:0030903)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)	2						AGGAGTGGACGGCTGAAGACT	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		19094	0.002		0.0	False		,,,				2504	0.0				p.G251S		Atlas-SNP	.											.	NOTO	20	.	0			c.G751A						.						40.0	39.0	39.0					2																	73438052		692	1591	2283	SO:0001583	missense	344022	exon3			GTGGACGGCTGAA		CCDS46335.1	2p13.2	2011-06-20	2007-02-15		ENSG00000214513	ENSG00000214513		"""Homeoboxes / ANTP class : NKL subclass"""	31839	protein-coding gene	gene with protein product			"""notochord homolog (Xenopus laevis)"""			15231714	Standard	NM_001134462		Approved		uc010yrd.2	A8MTQ0	OTTHUMG00000164128	ENST00000398468.3:c.751G>A	chr2.hg19:g.73438052G>A	ENSP00000381486:p.Gly251Ser	94.0	0.0		63.0	6.0	NM_001134462	B4DJ59|B7ZAU5	Missense_Mutation	SNP	ENST00000398468.3	hg19	CCDS46335.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425160	0.43020	.	.	ENSG00000214513	ENST00000398468	D	0.93247	-3.19	5.03	-0.344	0.12628	.	.	.	.	.	T	0.79805	0.4509	N	0.01352	-0.895	0.21579	N	0.999638	B	0.09022	0.002	B	0.01281	0.0	T	0.70008	-0.4990	9	0.87932	D	0	.	8.7973	0.34887	0.7466:0.0:0.2534:0.0	.	251	A8MTQ0	NOTO_HUMAN	S	251	ENSP00000381486:G251S	ENSP00000381486:G251S	G	+	1	0	NOTO	73291560	0.020000	0.18652	0.558000	0.28319	0.002000	0.02628	-0.151000	0.10175	-0.191000	0.10448	-2.218000	0.00297	GGC	.	.		0.612	NOTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377385.2	XM_292889	
KIF5C	3800	hgsc.bcm.edu	37	2	149868088	149868088	+	Silent	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:149868088G>A	ENST00000435030.1	+	25	3140	c.2772G>A	c.(2770-2772)aaG>aaA	p.K924K	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Silent_p.K829K|KIF5C_ENST00000397413.1_Silent_p.K692K			O60282	KIF5C_HUMAN	kinesin family member 5C	924	Globular.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		ATACAGCCAAGCCCATCCGCC	0.502																																					p.K924K		Atlas-SNP	.											.	KIF5C	166	.	0			c.G2772A						.						51.0	52.0	52.0					2																	149868088		1874	4110	5984	SO:0001819	synonymous_variant	3800	exon25			AGCCAAGCCCATC	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2772G>A	chr2.hg19:g.149868088G>A		66.0	0.0		68.0	23.0	NM_004522	O95079|Q2YDC5	Silent	SNP	ENST00000435030.1	hg19																																																																																				.	.		0.502	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
ITGA6	3655	hgsc.bcm.edu	37	2	173338923	173338923	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:173338923A>G	ENST00000264106.6	+	7	1236	c.1033A>G	c.(1033-1035)Ata>Gta	p.I345V	ITGA6_ENST00000264107.7_Missense_Mutation_p.I306V|ITGA6_ENST00000409080.1_Missense_Mutation_p.I306V|ITGA6_ENST00000409532.1_Missense_Mutation_p.I187V|ITGA6_ENST00000375221.2_Missense_Mutation_p.I345V|ITGA6_ENST00000343713.4_Missense_Mutation_p.I301V			P23229	ITA6_HUMAN	integrin, alpha 6	345					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			CCCTGAGCACATATTCGATGG	0.498																																					p.I306V		Atlas-SNP	.											.	ITGA6	171	.	0			c.A916G						.						140.0	127.0	132.0					2																	173338923		2203	4300	6503	SO:0001583	missense	3655	exon6			GAGCACATATTCG		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1033A>G	chr2.hg19:g.173338923A>G	ENSP00000264106:p.Ile345Val	129.0	0.0		121.0	45.0	NM_000210	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	ENST00000264106.6	hg19		.	.	.	.	.	.	.	.	.	.	A	5.011	0.187758	0.09547	.	.	ENSG00000091409	ENST00000412899;ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T;T	0.71222	-0.55;0.07;-0.29;-0.27;-0.28;-0.3;-0.29;-0.27;-0.3	5.36	0.644	0.17776	.	0.372053	0.33691	N	0.004643	T	0.43433	0.1247	N	0.16602	0.42	0.44104	D	0.996871	B;B;B	0.10296	0.0;0.001;0.003	B;B;B	0.15052	0.001;0.012;0.007	T	0.25847	-1.0120	10	0.06099	T	0.92	.	6.0431	0.19746	0.5862:0.2093:0.2045:0.0	.	301;306;306	P23229-4;G5E9H1;P23229-2	.;.;.	V	192;187;306;345;345;301;306;345;301	ENSP00000413470:I192V;ENSP00000386614:I187V;ENSP00000264107:I306V;ENSP00000264106:I345V;ENSP00000364369:I345V;ENSP00000341078:I301V;ENSP00000386896:I306V;ENSP00000406694:I345V;ENSP00000394169:I301V	ENSP00000264106:I345V	I	+	1	0	ITGA6	173047169	0.939000	0.31865	1.000000	0.80357	0.950000	0.60333	1.251000	0.32862	0.871000	0.35750	-0.264000	0.10439	ATA	.	.		0.498	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
PDK1	5163	hgsc.bcm.edu	37	2	173429803	173429803	+	Splice_Site	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:173429803T>G	ENST00000282077.3	+	5	873		c.e5+2		PDK1_ENST00000392571.2_Splice_Site|PDK1_ENST00000543905.1_Splice_Site|PDK1_ENST00000544863.1_Splice_Site|PDK1_ENST00000410055.1_Splice_Site			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1						cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			TTATTAAAGGTAAATACTGAC	0.289									Autosomal Dominant Polycystic Kidney Disease																												.		Atlas-SNP	.											.	PDK1	39	.	0			c.691+2T>G						.						94.0	88.0	90.0					2																	173429803		2203	4299	6502	SO:0001630	splice_region_variant	5163	exon5	Familial Cancer Database	ADPKD	TAAAGGTAAATAC	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	ENST00000282077.3:c.691+2T>G	chr2.hg19:g.173429803T>G		74.0	0.0		80.0	27.0	NM_002610	B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Splice_Site	SNP	ENST00000282077.3	hg19	CCDS2250.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428600	0.83667	.	.	ENSG00000152256	ENST00000543905;ENST00000544863;ENST00000282077;ENST00000392571;ENST00000410055;ENST00000416991	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3939	0.83550	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDK1	173138049	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.798000	0.85924	2.276000	0.75962	0.455000	0.32223	.	.	.		0.289	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255380.3	NM_002610	Intron
HECW2	57520	hgsc.bcm.edu	37	2	197092916	197092916	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:197092916G>C	ENST00000260983.3	-	22	4009	c.3827C>G	c.(3826-3828)cCa>cGa	p.P1276R	HECW2_ENST00000409111.1_Missense_Mutation_p.P920R	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1276	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GCCATAATATGGGTTAAAGAG	0.353																																					p.P1276R		Atlas-SNP	.											.	HECW2	239	.	0			c.C3827G						.						89.0	91.0	90.0					2																	197092916		2203	4300	6503	SO:0001583	missense	57520	exon22			TAATATGGGTTAA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3827C>G	chr2.hg19:g.197092916G>C	ENSP00000260983:p.Pro1276Arg	282.0	0.0		250.0	110.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	hg19	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634422	0.87660	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.59083	0.29;0.29	5.44	5.44	0.79542	HECT (4);	0.000000	0.85682	D	0.000000	D	0.84074	0.5392	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88221	0.2897	10	0.87932	D	0	.	19.4586	0.94906	0.0:0.0:1.0:0.0	.	1276	Q9P2P5	HECW2_HUMAN	R	920;1276	ENSP00000386775:P920R;ENSP00000260983:P1276R	ENSP00000260983:P1276R	P	-	2	0	HECW2	196801161	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.828000	0.97474	0.655000	0.94253	CCA	.	.		0.353	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
SMARCAL1	50485	hgsc.bcm.edu	37	2	217341834	217341834	+	Silent	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:217341834G>T	ENST00000357276.4	+	16	2760	c.2430G>T	c.(2428-2430)gtG>gtT	p.V810V	AC098820.3_ENST00000453157.1_RNA|SMARCAL1_ENST00000358207.5_Silent_p.V810V	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	810	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		ACACACAGGTGCTGATCCAGG	0.567									Schimke Immuno-Osseous Dysplasia																												p.V810V		Atlas-SNP	.											.	SMARCAL1	93	.	0			c.G2430T						.						70.0	57.0	62.0					2																	217341834		2201	4293	6494	SO:0001819	synonymous_variant	50485	exon16	Familial Cancer Database	SIOD	ACAGGTGCTGATC	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2430G>T	chr2.hg19:g.217341834G>T		46.0	0.0		37.0	15.0	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	hg19	CCDS2403.1																																																																																			.	.		0.567	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
SRGAP3	9901	hgsc.bcm.edu	37	3	9102039	9102039	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:9102039T>G	ENST00000383836.3	-	6	1104	c.677A>C	c.(676-678)cAg>cCg	p.Q226P	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Missense_Mutation_p.Q226P	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	226	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GTACTTGGCCTGCCTCTGGAA	0.428			T	RAF1	pilocytic astrocytoma																																p.Q226P		Atlas-SNP	.		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	SRGAP3	146	.	0			c.A677C						.						138.0	126.0	130.0					3																	9102039		2203	4300	6503	SO:0001583	missense	9901	exon6			TTGGCCTGCCTCT	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.677A>C	chr3.hg19:g.9102039T>G	ENSP00000373347:p.Gln226Pro	86.0	0.0		75.0	29.0	NM_014850	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	hg19	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.350524	0.82132	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.15834	2.39;2.39	5.27	5.27	0.74061	.	0.217293	0.41938	D	0.000784	T	0.46308	0.1386	M	0.86028	2.79	0.80722	D	1	D;B;P;P	0.67145	0.996;0.0;0.952;0.92	D;B;P;B	0.72982	0.979;0.0;0.629;0.425	T	0.53725	-0.8398	10	0.72032	D	0.01	.	14.8468	0.70267	0.0:0.0:0.0:1.0	.	226;95;226;226	C7TPG7;Q9ULR4;O43295-2;O43295	.;.;.;SRGP2_HUMAN	P	226;226;106	ENSP00000373347:Q226P;ENSP00000353587:Q226P	ENSP00000353587:Q226P	Q	-	2	0	SRGAP3	9077039	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	7.873000	0.87193	1.992000	0.58205	0.377000	0.23210	CAG	.	.		0.428	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
PPARG	5468	hgsc.bcm.edu	37	3	12458591	12458591	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:12458591A>T	ENST00000287820.6	+	6	1329	c.1208A>T	c.(1207-1209)aAt>aTt	p.N403I	PPARG_ENST00000539812.1_Intron|PPARG_ENST00000397012.2_Missense_Mutation_p.N375I|PPARG_ENST00000397015.2_Missense_Mutation_p.N375I|PPARG_ENST00000397026.2_Missense_Mutation_p.N381I|PPARG_ENST00000309576.6_Missense_Mutation_p.N375I|PPARG_ENST00000397010.2_Missense_Mutation_p.N375I|PPARG_ENST00000397000.1_Intron	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	403	Ligand-binding.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	GTGAAGTTCAATGCACTGGAA	0.433			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																														p.N403I		Atlas-SNP	.		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	.	PPARG	49	.	0			c.A1208T						.						44.0	43.0	43.0					3																	12458591		2203	4299	6502	SO:0001583	missense	5468	exon6			AGTTCAATGCACT	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.1208A>T	chr3.hg19:g.12458591A>T	ENSP00000287820:p.Asn403Ile	110.0	0.0		70.0	20.0	NM_015869	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	hg19	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.260454	0.80246	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000287820	T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	5.99	4.83	0.62350	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.86347	0.5911	M	0.91459	3.21	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.88229	0.2902	10	0.72032	D	0.01	.	12.1936	0.54284	0.9336:0.0:0.0664:0.0	.	403	P37231	PPARG_HUMAN	I	375;375;375;375;381;403	ENSP00000380205:N375I;ENSP00000312472:N375I;ENSP00000380210:N375I;ENSP00000380207:N375I;ENSP00000380221:N381I;ENSP00000287820:N403I	ENSP00000287820:N403I	N	+	2	0	PPARG	12433591	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.302000	0.96175	1.079000	0.41038	0.533000	0.62120	AAT	.	.		0.433	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037	
PDHB	5162	hgsc.bcm.edu	37	3	58410540	58410540	+	IGR	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:58410540T>G	ENST00000302746.6	-	0	1527				PXK_ENST00000536660.1_Silent_p.P393P|PXK_ENST00000463280.1_3'UTR|PXK_ENST00000383716.3_Silent_p.P497P|PXK_ENST00000479241.1_Missense_Mutation_p.C524G|PXK_ENST00000356151.2_Silent_p.P530P|PXK_ENST00000302779.5_Silent_p.P513P	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta						acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	CCTTGCCTCCTGCGAGCACCG	0.572																																					p.P530P		Atlas-SNP	.											.	PXK	89	.	0			c.T1590G						.						63.0	45.0	51.0					3																	58410540		2203	4300	6503	SO:0001628	intergenic_variant	54899	exon18			GCCTCCTGCGAGC		CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157		chr3.hg19:g.58410540T>G		143.0	0.0		137.0	47.0	NM_017771	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Silent	SNP	ENST00000302746.6	hg19	CCDS2890.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.18|13.18	2.159306|2.159306	0.38119|0.38119	.|.	.|.	ENSG00000168297|ENSG00000168297	ENST00000479241|ENST00000479134	T|.	0.33438|.	1.41|.	6.03|6.03	-12.1|-12.1	0.00011|0.00011	.|.	.|.	.|.	.|.	.|.	T|T	0.30634|0.30634	0.0771|0.0771	.|.	.|.	.|.	0.42227|0.42227	D|D	0.991879|0.991879	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38672|0.38672	-0.9650|-0.9650	6|4	0.10377|.	T|.	0.69|.	-1.5322|-1.5322	1.7683|1.7683	0.03007|0.03007	0.3742:0.3075:0.1516:0.1667|0.3742:0.3075:0.1516:0.1667	.|.	.|.	.|.	.|.	G|R	524|264	ENSP00000419049:C524G|.	ENSP00000419049:C524G|.	C|L	+|+	1|2	0|0	PXK|PXK	58385580|58385580	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.831000|0.831000	0.47069|0.47069	-1.242000|-1.242000	0.02908|0.02908	-2.146000|-2.146000	0.00800|0.00800	-1.140000|-1.140000	0.01884|0.01884	TGC|CTG	.	.		0.572	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353558.1		
SEMA5B	54437	hgsc.bcm.edu	37	3	122631890	122631890	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:122631890A>G	ENST00000357599.3	-	18	2911	c.2525T>C	c.(2524-2526)cTg>cCg	p.L842P	SEMA5B_ENST00000195173.4_Missense_Mutation_p.L841P|SEMA5B_ENST00000451055.2_Missense_Mutation_p.L896P	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	842					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CCCGCTGCGCAGGAGGACCTC	0.796																																					p.L896P		Atlas-SNP	.											.	SEMA5B	303	.	0			c.T2687C						.						4.0	6.0	5.0					3																	122631890		2050	3964	6014	SO:0001583	missense	54437	exon18			CTGCGCAGGAGGA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2525T>C	chr3.hg19:g.122631890A>G	ENSP00000350215:p.Leu842Pro	48.0	0.0		31.0	16.0	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	hg19	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.018592	0.75275	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.37915	1.18;1.17;1.24;1.3	5.01	5.01	0.66863	.	0.254680	0.32719	N	0.005723	T	0.54854	0.1884	L	0.56769	1.78	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.70716	0.97;0.934	T	0.57400	-0.7818	10	0.62326	D	0.03	.	14.0489	0.64722	1.0:0.0:0.0:0.0	.	784;842	D3YTI7;Q9P283	.;SEM5B_HUMAN	P	842;841;784;896;842	ENSP00000350215:L842P;ENSP00000195173:L841P;ENSP00000389588:L896P;ENSP00000377208:L842P	ENSP00000195173:L841P	L	-	2	0	SEMA5B	124114580	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.158000	0.58150	2.114000	0.64651	0.533000	0.62120	CTG	.	.		0.796	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
EPHB1	2047	hgsc.bcm.edu	37	3	134873108	134873108	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:134873108A>G	ENST00000398015.3	+	6	1782	c.1412A>G	c.(1411-1413)tAc>tGc	p.Y471C	EPHB1_ENST00000493838.1_Missense_Mutation_p.Y32C	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	471	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GAGATCCGGTACTATGAGAAG	0.547																																					p.Y471C		Atlas-SNP	.											EPHB1_ENST00000398015,colon,carcinoma,0,2	EPHB1	519	.	0			c.A1412G						.						96.0	99.0	98.0					3																	134873108		2185	4299	6484	SO:0001583	missense	2047	exon6			TCCGGTACTATGA	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1412A>G	chr3.hg19:g.134873108A>G	ENSP00000381097:p.Tyr471Cys	89.0	0.0		70.0	27.0	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	hg19	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.504021	0.85176	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.61274	0.12;0.12	5.21	5.21	0.72293	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.136209	0.51477	D	0.000099	T	0.78515	0.4295	M	0.88979	2.995	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	T	0.82829	-0.0264	10	0.62326	D	0.03	.	14.9025	0.70689	1.0:0.0:0.0:0.0	.	471	P54762	EPHB1_HUMAN	C	471;32	ENSP00000381097:Y471C;ENSP00000419574:Y32C	ENSP00000381097:Y471C	Y	+	2	0	EPHB1	136355798	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.193000	0.77780	2.195000	0.70347	0.533000	0.62120	TAC	.	.		0.547	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
DHX36	170506	hgsc.bcm.edu	37	3	154032979	154032979	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:154032979T>A	ENST00000496811.1	-	3	539	c.459A>T	c.(457-459)aaA>aaT	p.K153N	DHX36_ENST00000329463.5_Missense_Mutation_p.K153N|DHX36_ENST00000544526.1_Missense_Mutation_p.K153N|DHX36_ENST00000308361.6_Missense_Mutation_p.K153N	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	153					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTCTAAACATTTTTTTTTCTT	0.343																																					p.K153N		Atlas-SNP	.											.	DHX36	98	.	0			c.A459T						.						78.0	78.0	78.0					3																	154032979		2202	4299	6501	SO:0001583	missense	170506	exon3			AAACATTTTTTTT	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.459A>T	chr3.hg19:g.154032979T>A	ENSP00000417078:p.Lys153Asn	175.0	0.0		154.0	7.0	NM_020865	B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	hg19	CCDS3171.1	.	.	.	.	.	.	.	.	.	.	T	3.592	-0.083380	0.07141	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.09538	2.97;2.97;2.97;2.97;2.97	5.63	0.0334	0.14179	.	0.941655	0.08967	N	0.867787	T	0.05914	0.0154	L	0.27053	0.805	0.09310	N	1	B;B;B	0.32071	0.302;0.355;0.201	B;B;B	0.24541	0.054;0.047;0.036	T	0.42783	-0.9431	10	0.19590	T	0.45	.	5.1712	0.15110	0.0:0.3743:0.1502:0.4755	.	153;153;153	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	N	153;153;153;153;67	ENSP00000417078:K153N;ENSP00000309296:K153N;ENSP00000444247:K153N;ENSP00000330113:K153N;ENSP00000419862:K67N	ENSP00000309296:K153N	K	-	3	2	DHX36	155515673	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.450000	0.06803	-0.014000	0.14175	-0.350000	0.07774	AAA	.	.		0.343	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	NM_020865	
SI	6476	hgsc.bcm.edu	37	3	164776811	164776811	+	Silent	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:164776811C>T	ENST00000264382.3	-	12	1400	c.1338G>A	c.(1336-1338)agG>agA	p.R446R		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	446	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTGTGTTTCCCCTCTCATAGG	0.353										HNSCC(35;0.089)																											p.R446R		Atlas-SNP	.											.	SI	500	.	0			c.G1338A						.						109.0	96.0	101.0					3																	164776811		2203	4300	6503	SO:0001819	synonymous_variant	6476	exon12			GTTTCCCCTCTCA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1338G>A	chr3.hg19:g.164776811C>T		123.0	0.0		124.0	8.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	hg19	CCDS3196.1																																																																																			.	.		0.353	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
RPL35A	6165	hgsc.bcm.edu	37	3	197678059	197678059	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:197678059A>G	ENST00000464167.1	+	3	308	c.41A>G	c.(40-42)tAt>tGt	p.Y14C	IQCG_ENST00000480302.1_Intron|IQCG_ENST00000455191.1_5'Flank|RPL35A_ENST00000448864.1_Missense_Mutation_p.Y14C|IQCG_ENST00000265239.6_Intron|IQCG_ENST00000453254.1_5'Flank|RPL35A_ENST00000329092.8_3'UTR	NM_000996.2	NP_000987.2	P18077	RL35A_HUMAN	ribosomal protein L35a	14					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)|tRNA binding (GO:0000049)			lung(1)|prostate(1)|urinary_tract(1)	3	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;1.04e-23)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.182)		TTTGCTGGCTATAAGCGGGGT	0.443																																					p.Y14C		Atlas-SNP	.											.	RPL35A	9	.	0			c.A41G						.						73.0	73.0	73.0					3																	197678059		2202	4298	6500	SO:0001583	missense	6165	exon3			CTGGCTATAAGCG	X52966	CCDS33930.1	3q29	2011-04-06			ENSG00000182899	ENSG00000182899		"""L ribosomal proteins"""	10345	protein-coding gene	gene with protein product		180468				1577483, 8786106	Standard	NM_000996		Approved	L35A	uc003fyr.3	P18077	OTTHUMG00000155386	ENST00000464167.1:c.41A>G	chr3.hg19:g.197678059A>G	ENSP00000419117:p.Tyr14Cys	59.0	0.0		59.0	23.0	NM_000996	Q08ES9|Q9BVN7	Missense_Mutation	SNP	ENST00000464167.1	hg19	CCDS33930.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.837717	0.91117	.	.	ENSG00000182899	ENST00000464167;ENST00000448864;ENST00000442341	.	.	.	5.59	5.59	0.84812	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.87716	0.6247	H	0.96518	3.835	0.80722	D	1	P	0.34684	0.463	P	0.51193	0.662	D	0.89768	0.3952	9	0.72032	D	0.01	-18.4759	15.8211	0.78644	1.0:0.0:0.0:0.0	.	14	P18077	RL35A_HUMAN	C	14	.	ENSP00000398058:Y14C	Y	+	2	0	RPL35A	199162456	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.883000	0.92426	2.150000	0.67090	0.529000	0.55759	TAT	.	.		0.443	RPL35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339788.1	NM_000996	
GRSF1	2926	hgsc.bcm.edu	37	4	71705447	71705447	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr4:71705447T>G	ENST00000254799.6	-	1	215	c.98A>C	c.(97-99)tAc>tCc	p.Y33S	GRSF1_ENST00000439371.1_5'Flank|GRSF1_ENST00000508091.1_5'Flank|GRSF1_ENST00000545193.1_5'Flank|GRSF1_ENST00000502323.1_5'Flank	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	33					anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			AGCGGCGGAGTAGAAGGGCAG	0.771																																					p.Y33S		Atlas-SNP	.											.	GRSF1	35	.	0			c.A98C						.						1.0	2.0	2.0					4																	71705447		610	1532	2142	SO:0001583	missense	2926	exon1			GCGGAGTAGAAGG	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.98A>C	chr4.hg19:g.71705447T>G	ENSP00000254799:p.Tyr33Ser	2.0	0.0		6.0	6.0	NM_002092	B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	hg19	CCDS47069.1	.	.	.	.	.	.	.	.	.	.	T	13.04	2.119113	0.37436	.	.	ENSG00000132463	ENST00000254799;ENST00000540657	T	0.23754	1.89	3.41	2.15	0.27550	.	0.000000	0.30704	U	0.009058	T	0.13329	0.0323	N	0.14661	0.345	0.20703	N	0.999861	B	0.18310	0.027	B	0.17433	0.018	T	0.18871	-1.0323	10	0.41790	T	0.15	-0.5051	7.5729	0.27918	0.0:0.0:0.2184:0.7816	.	33	Q12849	GRSF1_HUMAN	S	33	ENSP00000254799:Y33S	ENSP00000254799:Y33S	Y	-	2	0	GRSF1	71924311	0.001000	0.12720	0.015000	0.15790	0.001000	0.01503	0.124000	0.15728	0.455000	0.26910	0.477000	0.44152	TAC	.	.		0.771	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092	
KIAA1109	84162	hgsc.bcm.edu	37	4	123179993	123179993	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr4:123179993A>G	ENST00000264501.4	+	42	7130	c.6757A>G	c.(6757-6759)Ata>Gta	p.I2253V	KIAA1109_ENST00000388738.3_Missense_Mutation_p.I2253V|KIAA1109_ENST00000455637.1_Missense_Mutation_p.I2253V			Q2LD37	K1109_HUMAN	KIAA1109	2253					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGCATTAAAAATAAAGGTATA	0.368																																					p.I2253V		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A6757G						.						64.0	60.0	61.0					4																	123179993		1816	4078	5894	SO:0001583	missense	84162	exon40			TTAAAAATAAAGG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.6757A>G	chr4.hg19:g.123179993A>G	ENSP00000264501:p.Ile2253Val	80.0	0.0		70.0	28.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.17|19.17	3.776138|3.776138	0.70107|0.70107	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000419325	T;T;T|.	0.26067|.	2.39;2.39;1.76|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.000000|.	0.56097|.	U|.	0.000031|.	T|T	0.53948|0.53948	0.1828|0.1828	N|N	0.24115|0.24115	0.695|0.695	0.46725|0.46725	D|D	0.999173|0.999173	P;P;P|.	0.48640|.	0.65;0.876;0.913|.	P;D;P|.	0.64595|.	0.743;0.927;0.891|.	T|T	0.50668|0.50668	-0.8801|-0.8801	10|5	0.02654|.	T|.	1|.	.|.	16.4221|16.4221	0.83766|0.83766	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2253;2252;2253|.	Q2LD37-6;Q2LD37-2;Q2LD37|.	.;.;K1109_HUMAN|.	V|S	2253|210	ENSP00000264501:I2253V;ENSP00000373390:I2253V;ENSP00000389925:I2253V|.	ENSP00000264501:I2253V|.	I|N	+|+	1|2	0|0	KIAA1109|KIAA1109	123399443|123399443	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.885000|8.885000	0.92439|0.92439	2.283000|2.283000	0.76528|0.76528	0.477000|0.477000	0.44152|0.44152	ATA|AAT	.	.		0.368	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
RASA1	5921	hgsc.bcm.edu	37	5	86633866	86633867	+	Missense_Mutation	DNP	AG	AG	GA			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr5:86633866_86633867AG>GA	ENST00000274376.6	+	5	1539_1540	c.975_976AG>GA	c.(973-978)acAGat>acGAat	p.D326N	RASA1_ENST00000506290.1_Missense_Mutation_p.D160N|RASA1_ENST00000456692.2_Missense_Mutation_p.D149N|RASA1_ENST00000512763.1_Missense_Mutation_p.D159N	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	326	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ATTTAAGAACAGATGAACAAGG	0.287																																					p.T325T|p.D326N		Atlas-SNP	.											.|RASA1_ENST00000456692,NS,carcinoma,0,2	RASA1	213	.	0			c.A975G|c.G976A						.																																			SO:0001583	missense	5921	exon5			AAGAACAGATGAA|AGAACAGATGAAC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	Exception_encountered	chr5.hg19:g.86633866_86633867delinsGA	ENSP00000274376:p.Asp326Asn	394.0|391.0	0.0		314.0|316.0	108.0|107.0	NM_002890	B2R6W3|Q9UDI1	Silent|Missense_Mutation	SNP	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.		0.287	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
CHD1	1105	hgsc.bcm.edu	37	5	98262046	98262046	+	Silent	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr5:98262046T>G	ENST00000284049.3	-	1	194	c.45A>C	c.(43-45)ggA>ggC	p.G15G	CTD-2007H13.3_ENST00000513175.1_lincRNA	NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	15	Ser-rich.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	ACCTTGATTCTCCACTACTGT	0.274																																					p.G15G		Atlas-SNP	.											.	CHD1	137	.	0			c.A45C						.						117.0	113.0	114.0					5																	98262046		2201	4294	6495	SO:0001819	synonymous_variant	1105	exon1			TGATTCTCCACTA	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.45A>C	chr5.hg19:g.98262046T>G		75.0	0.0		61.0	21.0	NM_001270	Q17RZ3	Silent	SNP	ENST00000284049.3	hg19	CCDS34204.1																																																																																			.	.		0.274	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
CDC25C	995	hgsc.bcm.edu	37	5	137665271	137665271	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr5:137665271A>T	ENST00000323760.6	-	3	538	c.260T>A	c.(259-261)cTt>cAt	p.L87H	CDC25C_ENST00000514555.1_Missense_Mutation_p.L87H|CDC25C_ENST00000415130.2_Intron|CDC25C_ENST00000356505.3_Missense_Mutation_p.L87H|CDC25C_ENST00000513970.1_Missense_Mutation_p.L87H|CDC25C_ENST00000357274.3_Intron|CDC25C_ENST00000348983.3_Intron	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	87					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AGAAGTGGTAAGCTGAGTGGC	0.443																																					p.L87H		Atlas-SNP	.											.	CDC25C	37	.	0			c.T260A						.						170.0	167.0	168.0					5																	137665271		2203	4300	6503	SO:0001583	missense	995	exon3			GTGGTAAGCTGAG	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.260T>A	chr5.hg19:g.137665271A>T	ENSP00000321656:p.Leu87His	70.0	0.0		89.0	23.0	NM_001790	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	hg19	CCDS4202.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.321697	0.60634	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000513970;ENST00000534892;ENST00000514555;ENST00000503022;ENST00000510119	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	4.4	3.2	0.36748	.	0.764676	0.11327	N	0.575452	T	0.52240	0.1722	L	0.56769	1.78	0.09310	N	0.999997	D;D;D;D	0.71674	0.998;0.997;0.995;0.996	P;P;P;P	0.61592	0.891;0.781;0.847;0.754	T	0.32903	-0.9889	10	0.38643	T	0.18	-0.2367	6.6695	0.23060	0.8893:0.0:0.1107:0.0	.	104;104;87;87	G3V1P6;B4DX61;P30307-2;P30307	.;.;.;MPIP3_HUMAN	H	87;87;87;104;87;87;104	ENSP00000321656:L87H;ENSP00000348898:L87H;ENSP00000424795:L87H;ENSP00000425470:L87H;ENSP00000427251:L87H;ENSP00000427105:L104H	ENSP00000321656:L87H	L	-	2	0	CDC25C	137693170	0.157000	0.22836	0.115000	0.21578	0.950000	0.60333	2.386000	0.44380	1.855000	0.53841	0.460000	0.39030	CTT	.	.		0.443	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1		
NMUR2	56923	hgsc.bcm.edu	37	5	151784554	151784554	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr5:151784554G>A	ENST00000255262.3	-	1	286	c.121C>T	c.(121-123)Cgc>Tgc	p.R41C	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	41					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AAGTGGCTGCGCCGAGGTCCG	0.537																																					p.R41C		Atlas-SNP	.											NMUR2,NS,haematopoietic_neoplasm,0,1	NMUR2	111	.	0			c.C121T						.						97.0	93.0	94.0					5																	151784554		2203	4300	6503	SO:0001583	missense	56923	exon1			GGCTGCGCCGAGG	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.121C>T	chr5.hg19:g.151784554G>A	ENSP00000255262:p.Arg41Cys	157.0	0.0		161.0	71.0	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	hg19	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.348860	0.61183	.	.	ENSG00000132911	ENST00000255262	T	0.38077	1.16	5.54	3.5	0.40072	.	0.000000	0.64402	D	0.000007	T	0.61311	0.2337	M	0.80746	2.51	0.54753	D	0.999988	D	0.89917	1.0	D	0.76575	0.988	T	0.69101	-0.5234	10	0.72032	D	0.01	-24.3232	14.9967	0.71436	0.0:0.0:0.7298:0.2702	.	41	Q9GZQ4	NMUR2_HUMAN	C	41	ENSP00000255262:R41C	ENSP00000255262:R41C	R	-	1	0	NMUR2	151764747	1.000000	0.71417	0.854000	0.33618	0.790000	0.44656	3.934000	0.56553	1.285000	0.44548	0.655000	0.94253	CGC	.	.		0.537	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
ATXN1	6310	hgsc.bcm.edu	37	6	16327864	16327864	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr6:16327864G>C	ENST00000244769.4	-	8	1614	c.678C>G	c.(676-678)caC>caG	p.H226Q	ATXN1_ENST00000436367.1_Missense_Mutation_p.H226Q	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	226					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CCCTGCTGAGGtgctgctgct	0.652																																					p.H226Q		Atlas-SNP	.											.,1	ATXN1	117	.	0			c.C678G						.						11.0	15.0	13.0					6																	16327864		2150	4194	6344	SO:0001583	missense	6310	exon7			GCTGAGGTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.678C>G	chr6.hg19:g.16327864G>C	ENSP00000244769:p.His226Gln	63.0	0.0		48.0	4.0	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	hg19	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	1.926	-0.447046	0.04572	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.27256	1.68;1.68	4.74	0.503	0.16940	.	0.308295	0.34291	N	0.004091	T	0.05686	0.0149	L	0.39397	1.21	0.09310	N	0.999995	B	0.32245	0.361	B	0.28638	0.092	T	0.23976	-1.0173	10	0.48119	T	0.1	-16.8942	3.2876	0.06937	0.3032:0.0:0.385:0.3119	.	226	P54253	ATX1_HUMAN	Q	226	ENSP00000244769:H226Q;ENSP00000416360:H226Q	ENSP00000244769:H226Q	H	-	3	2	ATXN1	16435843	0.437000	0.25593	0.006000	0.13384	0.009000	0.06853	0.925000	0.28791	0.191000	0.20236	0.563000	0.77884	CAC	.	.		0.652	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
PPP1R18	170954	hgsc.bcm.edu	37	6	30652197	30652197	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr6:30652197T>A	ENST00000274853.3	-	1	3475	c.1599A>T	c.(1597-1599)agA>agT	p.R533S	PPP1R18_ENST00000488324.1_5'UTR|PPP1R18_ENST00000399199.3_Missense_Mutation_p.R533S	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	533						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GTTTGTGGTGTCTTTCGGGGG	0.542																																					p.R533S		Atlas-SNP	.											.	.	.	.	0			c.A1599T						.						56.0	60.0	58.0					6																	30652197		1206	2529	3735	SO:0001583	missense	170954	exon2			GTGGTGTCTTTCG	AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.1599A>T	chr6.hg19:g.30652197T>A	ENSP00000274853:p.Arg533Ser	115.0	0.0		93.0	52.0	NM_001134870	A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Missense_Mutation	SNP	ENST00000274853.3	hg19	CCDS43444.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.371805	0.61624	.	.	ENSG00000146112	ENST00000274853;ENST00000399199	T;T	0.37235	1.21;1.21	4.52	1.53	0.23141	.	0.256528	0.29544	N	0.011848	T	0.23094	0.0558	N	0.16478	0.41	0.32141	N	0.585526	D	0.76494	0.999	D	0.85130	0.997	T	0.10683	-1.0619	10	0.62326	D	0.03	-13.0709	6.7082	0.23262	0.0:0.1857:0.0:0.8143	.	533	Q6NYC8	PPR18_HUMAN	S	533	ENSP00000274853:R533S;ENSP00000382150:R533S	ENSP00000274853:R533S	R	-	3	2	KIAA1949	30760176	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	0.744000	0.26245	0.366000	0.24427	0.533000	0.62120	AGA	.	.		0.542	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076498.2	NM_133471	
VEGFA	7422	hgsc.bcm.edu	37	6	43746274	43746274	+	Splice_Site	SNP	G	G	C	rs113966402		TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr6:43746274G>C	ENST00000523873.1	+	4	430		c.e4+1		VEGFA_ENST00000372055.4_Splice_Site|VEGFA_ENST00000372077.4_Splice_Site|VEGFA_ENST00000425836.2_Splice_Site|VEGFA_ENST00000482630.2_Splice_Site|VEGFA_ENST00000520948.1_Splice_Site|VEGFA_ENST00000417285.2_Splice_Site|VEGFA_ENST00000518824.1_Splice_Site|VEGFA_ENST00000523950.1_Splice_Site|VEGFA_ENST00000372064.4_Splice_Site|VEGFA_ENST00000413642.3_Splice_Site|VEGFA_ENST00000324450.6_Splice_Site|VEGFA_ENST00000518689.1_Splice_Site|VEGFA_ENST00000372067.3_Splice_Site|VEGFA_ENST00000457104.2_Splice_Site|VEGFA_ENST00000523125.1_Splice_Site|VEGFA_ENST00000230480.6_Splice_Site			P15692	VEGFA_HUMAN	vascular endothelial growth factor A						activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	GTGAATGCAGGTGAGGATGTA	0.502																																					.		Atlas-SNP	.											.	VEGFA	21	.	0			c.392+1G>C						.						117.0	92.0	101.0					6																	43746274		2203	4300	6503	SO:0001630	splice_region_variant	7422	exon4			ATGCAGGTGAGGA	AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745	ENST00000523873.1:c.392+1G>C	chr6.hg19:g.43746274G>C		99.0	0.0		77.0	5.0	NM_001171625	B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	Splice_Site	SNP	ENST00000523873.1	hg19	CCDS55010.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282106	0.80692	.	.	ENSG00000112715	ENST00000372067;ENST00000324450;ENST00000417285;ENST00000413642;ENST00000372055;ENST00000482630;ENST00000425836;ENST00000372064;ENST00000372077;ENST00000519767;ENST00000520948;ENST00000523873;ENST00000523950;ENST00000457104;ENST00000518689;ENST00000523125;ENST00000518824;ENST00000230480	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8433	0.92194	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	VEGFA	43854252	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.125000	0.94402	2.707000	0.92482	0.561000	0.74099	.	.	.		0.502	VEGFA-021	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374460.1	NM_001025366	Intron
MAP3K7	6885	hgsc.bcm.edu	37	6	91229026	91229026	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr6:91229026G>A	ENST00000369329.3	-	15	1636	c.1475C>T	c.(1474-1476)tCa>tTa	p.S492L	MAP3K7_ENST00000369320.1_Missense_Mutation_p.S146L|MAP3K7_ENST00000479630.1_5'UTR|MAP3K7_ENST00000369332.3_Missense_Mutation_p.S465L|MAP3K7_ENST00000369327.3_Missense_Mutation_p.S465L|MAP3K7_ENST00000369325.3_Missense_Mutation_p.S492L	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	492					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GGAGTTATCTGATCCATTGGT	0.328																																					p.S492L		Atlas-SNP	.											.	MAP3K7	100	.	0			c.C1475T						.						136.0	126.0	130.0					6																	91229026		2203	4299	6502	SO:0001583	missense	6885	exon15			TTATCTGATCCAT	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.1475C>T	chr6.hg19:g.91229026G>A	ENSP00000358335:p.Ser492Leu	103.0	0.0		90.0	44.0	NM_145331	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	hg19	CCDS5028.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469004	0.84533	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000369320;ENST00000450832	T;T;T;D	0.81579	-1.07;-1.06;-1.3;-1.51	6.06	6.06	0.98353	.	0.122293	0.64402	D	0.000019	D	0.85500	0.5711	L	0.46157	1.445	0.80722	D	1	P;B;D;P	0.76494	0.939;0.005;0.999;0.956	P;B;D;P	0.68192	0.703;0.011;0.956;0.549	D	0.85140	0.0980	10	0.66056	D	0.02	.	20.6314	0.99525	0.0:0.0:1.0:0.0	.	465;465;492;492	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	L	465;492;492;465;146;392	ENSP00000358338:S465L;ENSP00000358335:S492L;ENSP00000358331:S492L;ENSP00000358333:S465L	ENSP00000358326:S146L	S	-	2	0	MAP3K7	91285747	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.650000	0.67944	2.885000	0.99019	0.579000	0.79373	TCA	.	.		0.328	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	
TRRAP	8295	hgsc.bcm.edu	37	7	98586442	98586442	+	Silent	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr7:98586442G>T	ENST00000359863.4	+	62	9665	c.9456G>T	c.(9454-9456)ctG>ctT	p.L3152L	TRRAP_ENST00000446306.3_Silent_p.L3123L|TRRAP_ENST00000355540.3_Silent_p.L3123L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3152	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ACGATGTGCTGGTGAAAGCCT	0.547																																					p.L3152L		Atlas-SNP	.											.	TRRAP	863	.	0			c.G9456T						.						98.0	97.0	97.0					7																	98586442		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon62			TGTGCTGGTGAAA	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.9456G>T	chr7.hg19:g.98586442G>T		55.0	0.0		50.0	16.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	hg19	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	9.565	1.119624	0.20877	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.53	4.65	0.58169	.	.	.	.	.	T	0.63885	0.2549	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62450	-0.6852	4	.	.	.	.	12.5982	0.56483	0.1394:0.0:0.8606:0.0	.	.	.	.	L	2863	.	.	W	+	2	0	TRRAP	98424378	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.313000	0.43735	1.326000	0.45319	0.655000	0.94253	TGG	.	.		0.547	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
ACHE	43	hgsc.bcm.edu	37	7	100491024	100491024	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr7:100491024C>A	ENST00000412389.1	-	1	985	c.830G>T	c.(829-831)cGc>cTc	p.R277L	ACHE_ENST00000428317.1_Missense_Mutation_p.R277L|ACHE_ENST00000411582.1_Missense_Mutation_p.R277L|ACHE_ENST00000241069.5_Missense_Mutation_p.R277L|ACHE_ENST00000497647.1_5'Flank|ACHE_ENST00000302913.4_Missense_Mutation_p.R277L|ACHE_ENST00000419336.2_Missense_Mutation_p.R277L			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	277					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CGTGGCCCTGCGACGGGCCTC	0.706																																					p.R277L		Atlas-SNP	.											.	ACHE	80	.	0			c.G830T						.						29.0	30.0	30.0					7																	100491024		2202	4299	6501	SO:0001583	missense	43	exon2			GCCCTGCGACGGG		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.830G>T	chr7.hg19:g.100491024C>A	ENSP00000394976:p.Arg277Leu	45.0	0.0		41.0	17.0	NM_000665	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	ENST00000412389.1	hg19	CCDS5709.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717703	0.48622	.	.	ENSG00000087085	ENST00000419336;ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000426415;ENST00000430554;ENST00000411582;ENST00000422451	T;T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	4.95	4.95	0.65309	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	L	0.60845	1.875	0.80722	D	1	D;D;D;D	0.76494	0.997;0.998;0.999;0.997	D;P;P;D	0.63283	0.913;0.809;0.847;0.913	T	0.71547	-0.4560	10	0.20519	T	0.43	.	15.6562	0.77136	0.0:1.0:0.0:0.0	.	277;277;277;277	B7WPI6;P22303-3;P22303-2;P22303	.;.;.;ACES_HUMAN	L	277	ENSP00000403474:R277L;ENSP00000241069:R277L;ENSP00000414858:R277L;ENSP00000303211:R277L;ENSP00000394976:R277L;ENSP00000397143:R277L;ENSP00000399725:R277L;ENSP00000404865:R277L	ENSP00000241069:R277L	R	-	2	0	ACHE	100328960	0.068000	0.21057	1.000000	0.80357	0.833000	0.47200	1.142000	0.31540	2.281000	0.76405	0.484000	0.47621	CGC	.	.		0.706	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000401970.2_5'UTR|LHFPL3_ENST00000424859.1_5'UTR|LHFPL3_ENST00000543266.1_Silent_p.A8A			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A		Atlas-SNP	.											LHFPL3,NS,carcinoma,0,1	LHFPL3	24	.	1	Substitution - coding silent(1)	kidney(1)	c.C24T						.						11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	chr7.hg19:g.103969251C>T		43.0	0.0		46.0	3.0	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	hg19																																																																																				.	.		0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding		NM_199000	
KMT2C	58508	hgsc.bcm.edu	37	7	151874011	151874011	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr7:151874011C>T	ENST00000262189.6	-	38	8745	c.8527G>A	c.(8527-8529)Gat>Aat	p.D2843N	KMT2C_ENST00000355193.2_Missense_Mutation_p.D2843N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2843					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTATTCTCATCATTTTTTTCA	0.383																																					p.D2843N		Atlas-SNP	.											.	MLL3	1564	.	0			c.G8527A						.						134.0	132.0	133.0					7																	151874011		2203	4300	6503	SO:0001583	missense	58508	exon38			TCTCATCATTTTT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8527G>A	chr7.hg19:g.151874011C>T	ENSP00000262189:p.Asp2843Asn	75.0	0.0		74.0	36.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	3.956	-0.011247	0.07727	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.85484	-1.97;-1.99	5.58	4.7	0.59300	.	0.608750	0.14192	N	0.335271	T	0.76300	0.3968	N	0.24115	0.695	0.80722	D	1	B;B;B	0.21520	0.057;0.0;0.0	B;B;B	0.15870	0.014;0.002;0.002	T	0.69068	-0.5243	10	0.33141	T	0.24	.	12.9312	0.58288	0.0:0.9248:0.0:0.0752	.	2843;1904;2843	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	N	2843	ENSP00000262189:D2843N;ENSP00000347325:D2843N	ENSP00000262189:D2843N	D	-	1	0	MLL3	151504944	0.100000	0.21855	0.007000	0.13788	0.083000	0.17756	1.502000	0.35704	1.355000	0.45865	0.650000	0.86243	GAT	.	.		0.383	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PABPC1	26986	hgsc.bcm.edu	37	8	101721828	101721828	+	Silent	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr8:101721828A>C	ENST00000318607.5	-	8	2232	c.1104T>G	c.(1102-1104)gcT>gcG	p.A368A	AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000522387.1_Silent_p.A336A|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Silent_p.A323A	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	368	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CTTTGCGCTGAGCTAAAGCTA	0.473																																					p.A368A		Atlas-SNP	.											.	PABPC1	76	.	0			c.T1104G						.						127.0	110.0	116.0					8																	101721828		2203	4300	6503	SO:0001819	synonymous_variant	26986	exon8			GCGCTGAGCTAAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1104T>G	chr8.hg19:g.101721828A>C		87.0	0.0		222.0	158.0	NM_002568	Q15097|Q93004	Silent	SNP	ENST00000318607.5	hg19	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.64|10.64	1.407262|1.407262	0.25378|0.25378	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000519596	.|.	.|.	.|.	5.05|5.05	2.32|2.32	0.28847|0.28847	.|.	.|.	.|.	.|.	.|.	T|T	0.43831|0.43831	0.1265|0.1265	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.31308|0.31308	-0.9948|-0.9948	4|4	.|.	.|.	.|.	.|.	2.1503|2.1503	0.03798|0.03798	0.3536:0.0:0.1648:0.4816|0.3536:0.0:0.1648:0.4816	.|.	.|.	.|.	.|.	R|A	237|201	.|.	.|.	L|S	-|-	2|1	0|0	PABPC1|PABPC1	101791004|101791004	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.794000|0.794000	0.26958|0.26958	0.849000|0.849000	0.35215|0.35215	-0.496000|-0.496000	0.04628|0.04628	CTC|TCA	.	.		0.473	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
KLF10	7071	hgsc.bcm.edu	37	8	103663642	103663642	+	Silent	SNP	C	C	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr8:103663642C>A	ENST00000285407.6	-	3	1218	c.918G>T	c.(916-918)gtG>gtT	p.V306V	KLF10_ENST00000395884.3_Silent_p.V295V	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	306					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			TGCCCATGAACACAACAGGGG	0.592																																					p.V306V	Esophageal Squamous(16;495 519 2144 16528 44005)	Atlas-SNP	.											.	KLF10	44	.	0			c.G918T						.						79.0	80.0	80.0					8																	103663642		2203	4300	6503	SO:0001819	synonymous_variant	7071	exon3			CATGAACACAACA	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.918G>T	chr8.hg19:g.103663642C>A		123.0	0.0		284.0	86.0	NM_005655	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Silent	SNP	ENST00000285407.6	hg19	CCDS6294.1																																																																																			.	.		0.592	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1		
BNC2	54796	hgsc.bcm.edu	37	9	16436154	16436154	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr9:16436154C>T	ENST00000380672.4	-	6	2095	c.2038G>A	c.(2038-2040)Gag>Aag	p.E680K	BNC2_ENST00000380666.2_Missense_Mutation_p.E680K|BNC2_ENST00000380667.2_Missense_Mutation_p.E613K|BNC2_ENST00000545497.1_Missense_Mutation_p.E585K	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CTCATCTCCTCTTGGGAGTGA	0.478																																					p.E680K		Atlas-SNP	.											.	BNC2	166	.	0			c.G2038A						.						123.0	110.0	114.0					9																	16436154		2203	4300	6503	SO:0001583	missense	54796	exon6			TCTCCTCTTGGGA	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2038G>A	chr9.hg19:g.16436154C>T	ENSP00000370047:p.Glu680Lys	103.0	0.0		51.0	21.0	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	hg19	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854931	0.51376	.	.	ENSG00000173068	ENST00000380672;ENST00000411752;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T;T	0.44482	1.49;0.92;1.51;1.5;1.5;1.5	5.79	5.79	0.91817	.	0.283148	0.40144	N	0.001164	T	0.32645	0.0836	N	0.24115	0.695	0.58432	D	0.999994	B;B;B;B;B;B;B;B;B	0.34290	0.081;0.048;0.447;0.447;0.039;0.048;0.155;0.155;0.023	B;B;B;B;B;B;B;B;B	0.30572	0.031;0.007;0.075;0.117;0.023;0.014;0.023;0.051;0.01	T	0.05533	-1.0879	10	0.33141	T	0.24	-11.814	20.0411	0.97590	0.0:1.0:0.0:0.0	.	585;613;680;506;680;637;680;585;445	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	K	680;73;637;613;585;506;680;680	ENSP00000370047:E680K;ENSP00000392212:E73K;ENSP00000408370:E637K;ENSP00000370042:E613K;ENSP00000444640:E585K;ENSP00000370041:E680K	ENSP00000370041:E680K	E	-	1	0	BNC2	16426154	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.759000	0.85235	2.739000	0.93911	0.655000	0.94253	GAG	.	.		0.478	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
PRUNE2	158471	hgsc.bcm.edu	37	9	79252403	79252403	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr9:79252403C>T	ENST00000376718.3	-	14	9017	c.8894G>A	c.(8893-8895)gGt>gAt	p.G2965D	PRUNE2_ENST00000466266.2_Intron|PRUNE2_ENST00000428286.1_Missense_Mutation_p.G2607D|PRUNE2_ENST00000443509.2_Missense_Mutation_p.G214D|PRUNE2_ENST00000223609.6_Missense_Mutation_p.G230D	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2965	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGGGGTTGCACCATTCAAGTA	0.408																																					p.G2965D		Atlas-SNP	.											.	PRUNE2	331	.	0			c.G8894A						.						224.0	199.0	207.0					9																	79252403		1568	3582	5150	SO:0001583	missense	158471	exon14			GTTGCACCATTCA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8894G>A	chr9.hg19:g.79252403C>T	ENSP00000365908:p.Gly2965Asp	69.0	0.0		70.0	20.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.659131|4.659131	0.88154|0.88154	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376717;ENST00000376718;ENST00000428286;ENST00000441554;ENST00000443509;ENST00000424866;ENST00000223609;ENST00000422033|ENST00000426088	T;T;T;T;T;T|.	0.36878|.	1.23;1.23;1.23;1.23;1.23;1.23|.	5.29|5.29	5.29|5.29	0.74685|0.74685	Cellular retinaldehyde-binding/triple function, C-terminal (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86674|.	0.5989|.	M|M	0.92555|0.92555	3.32|3.32	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.991;1.0;1.0|.	D|.	0.89579|.	0.3819|.	10|.	0.44086|.	T|.	0.13|.	-24.028|-24.028	19.2996|19.2996	0.94138|0.94138	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	230;229;214;2965|.	B4DSQ3;Q8WUY3-5;B4DJW7;Q8WUY3|.	.;.;.;PRUN2_HUMAN|.	D|X	230;2965;2607;186;214;138;230;2968|2289	ENSP00000365907:G230D;ENSP00000365908:G2965D;ENSP00000397425:G2607D;ENSP00000393843:G214D;ENSP00000393657:G138D;ENSP00000223609:G230D|.	ENSP00000223609:G230D|.	G|W	-|-	2|3	0|0	PRUNE2|PRUNE2	78442223|78442223	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.445000|7.445000	0.80570|0.80570	2.648000|2.648000	0.89879|0.89879	0.561000|0.561000	0.74099|0.74099	GGT|TGG	.	.		0.408	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PRUNE2	158471	hgsc.bcm.edu	37	9	79322011	79322011	+	Silent	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr9:79322011A>G	ENST00000376718.3	-	8	5302	c.5179T>C	c.(5179-5181)Ttg>Ctg	p.L1727L	PRUNE2_ENST00000428286.1_Silent_p.L1368L	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1727					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GCTGTGACCAAGAACTTATTA	0.428																																					p.L1727L		Atlas-SNP	.											.	PRUNE2	331	.	0			c.T5179C						.						140.0	116.0	123.0					9																	79322011		1568	3582	5150	SO:0001819	synonymous_variant	158471	exon8			TGACCAAGAACTT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.5179T>C	chr9.hg19:g.79322011A>G		75.0	0.0		111.0	7.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	A	2.831	-0.242542	0.05906	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.91	3.52	0.40303	.	0.168917	0.28414	N	0.015431	T	0.25195	0.0612	.	.	.	0.20196	N	0.999925	.	.	.	.	.	.	T	0.13845	-1.0494	5	.	.	.	-4.1287	3.5456	0.07827	0.6556:0.1387:0.0728:0.1329	.	.	.	.	P	1048	.	.	L	-	2	0	PRUNE2	78511831	0.265000	0.24102	0.667000	0.29798	0.682000	0.39822	1.173000	0.31920	0.463000	0.27118	0.533000	0.62120	CTT	.	.		0.428	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
VIM	7431	hgsc.bcm.edu	37	10	17271486	17271486	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:17271486G>T	ENST00000224237.5	+	1	210	c.65G>T	c.(64-66)aGc>aTc	p.S22I	VIM_ENST00000485947.1_3'UTR|VIM-AS1_ENST00000605833.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.S22I|VIM-AS1_ENST00000437232.1_RNA			P08670	VIME_HUMAN	vimentin	22	Head.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGCACCGCGAGCCGGCCGAGC	0.736																																					p.S22I		Atlas-SNP	.											.	VIM	71	.	0			c.G65T						.						10.0	10.0	10.0					10																	17271486		2112	4153	6265	SO:0001583	missense	7431	exon2			CCGCGAGCCGGCC	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.65G>T	chr10.hg19:g.17271486G>T	ENSP00000224237:p.Ser22Ile	105.0	0.0		85.0	35.0	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	hg19	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209228	0.58343	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533	D;D	0.84800	-1.9;-1.9	4.49	3.58	0.41010	Intermediate filament head, DNA-binding domain (1);	0.132342	0.35124	N	0.003440	T	0.81216	0.4776	M	0.65498	2.005	0.46222	D	0.998931	B;B;P;B;B	0.40970	0.011;0.218;0.734;0.001;0.011	B;B;B;B;B	0.34536	0.009;0.116;0.185;0.003;0.009	T	0.81044	-0.1111	10	0.49607	T	0.09	.	12.2249	0.54455	0.0:0.0:0.8296:0.1704	.	22;9;9;22;22	Q53HU8;F5H288;B3KRK8;B0YJC4;P08670	.;.;.;.;VIME_HUMAN	I	22;22;9	ENSP00000446007:S22I;ENSP00000224237:S22I	ENSP00000224237:S22I	S	+	2	0	VIM	17311492	.	.	0.916000	0.36221	0.896000	0.52359	.	.	1.089000	0.41292	0.448000	0.29417	AGC	.	.		0.736	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
THNSL1	79896	hgsc.bcm.edu	37	10	25312254	25312254	+	Silent	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:25312254A>C	ENST00000524413.1	+	3	449	c.102A>C	c.(100-102)tcA>tcC	p.S34S	THNSL1_ENST00000376356.4_Silent_p.S34S			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	34						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	GATTTCTTTCAAGAACCTTTG	0.398																																					p.S34S		Atlas-SNP	.											.	THNSL1	70	.	0			c.A102C						.						104.0	106.0	106.0					10																	25312254		2203	4300	6503	SO:0001819	synonymous_variant	79896	exon3			TCTTTCAAGAACC	AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.102A>C	chr10.hg19:g.25312254A>C		153.0	0.0		143.0	63.0	NM_024838	B3KWL1|D3DRV3|Q5VV21	Silent	SNP	ENST00000524413.1	hg19	CCDS7147.1																																																																																			.	.		0.398	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394913.1	NM_024838	
TBC1D12	23232	hgsc.bcm.edu	37	10	96269915	96269915	+	Silent	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:96269915A>T	ENST00000225235.4	+	8	1778	c.1668A>T	c.(1666-1668)ccA>ccT	p.P556P	TBC1D12_ENST00000485048.1_3'UTR	NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	556	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GTACATTTCCATCTCTCTACA	0.353																																					p.P556P		Atlas-SNP	.											.	TBC1D12	51	.	0			c.A1668T						.						170.0	154.0	159.0					10																	96269915		1835	4097	5932	SO:0001819	synonymous_variant	23232	exon8			ATTTCCATCTCTC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1668A>T	chr10.hg19:g.96269915A>T		105.0	0.0		98.0	47.0	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	hg19	CCDS41553.1																																																																																			.	.		0.353	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
BTRC	8945	hgsc.bcm.edu	37	10	103285923	103285923	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:103285923C>A	ENST00000370187.3	+	6	828	c.710C>A	c.(709-711)tCt>tAt	p.S237Y	BTRC_ENST00000393441.4_Missense_Mutation_p.S196Y|BTRC_ENST00000408038.2_Missense_Mutation_p.S201Y	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	237					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		AGGACAGATTCTCTGTGGAGA	0.483																																					p.S237Y		Atlas-SNP	.											BTRC,colon,carcinoma,0,2	BTRC	64	.	0			c.C710A						.						166.0	151.0	156.0					10																	103285923		2203	4300	6503	SO:0001583	missense	8945	exon6			CAGATTCTCTGTG	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.710C>A	chr10.hg19:g.103285923C>A	ENSP00000359206:p.Ser237Tyr	124.0	0.0		122.0	7.0	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	hg19	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278781	0.59758	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.22134	1.97;1.97;1.97	5.54	5.54	0.83059	F-box domain, Skp2-like (1);	0.000000	0.64402	D	0.000001	T	0.35913	0.0948	M	0.80616	2.505	0.80722	D	1	B;B;B	0.25955	0.039;0.138;0.068	B;B;B	0.32724	0.031;0.151;0.009	T	0.21177	-1.0253	10	0.56958	D	0.05	-11.948	19.4875	0.95035	0.0:1.0:0.0:0.0	.	211;201;237	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	Y	237;196;201	ENSP00000359206:S237Y;ENSP00000377088:S196Y;ENSP00000385339:S201Y	ENSP00000359206:S237Y	S	+	2	0	BTRC	103275913	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.051000	0.71072	2.615000	0.88500	0.655000	0.94253	TCT	.	.		0.483	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115536900	115536900	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:115536900G>A	ENST00000369310.3	+	11	1611	c.1049G>A	c.(1048-1050)gGc>gAc	p.G350D	PLEKHS1_ENST00000354462.3_Missense_Mutation_p.G100D|PLEKHS1_ENST00000361048.1_Intron|PLEKHS1_ENST00000369309.1_Missense_Mutation_p.G184D|PLEKHS1_ENST00000369312.4_Missense_Mutation_p.G268D	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	364																	CAGTGGGAAGGCCCCCCACGT	0.557																																					p.G350D		Atlas-SNP	.											.	PLEKHS1	19	.	0			c.G1049A						.						44.0	40.0	42.0					10																	115536900		876	1991	2867	SO:0001583	missense	79949	exon11			GGGAAGGCCCCCC	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.1049G>A	chr10.hg19:g.115536900G>A	ENSP00000358316:p.Gly350Asp	74.0	0.0		59.0	10.0	NM_182601	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	hg19	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.937212	0.52972	.	.	ENSG00000148735	ENST00000369312;ENST00000369310;ENST00000369309;ENST00000354462	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.96	5.05	0.67936	.	0.106321	0.64402	D	0.000005	T	0.51839	0.1698	M	0.63843	1.955	0.35179	D	0.772286	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.77557	0.99;0.981;0.986	T	0.66126	-0.6001	10	0.72032	D	0.01	-17.3972	13.2257	0.59912	0.0:0.1592:0.8408:0.0	.	364;350;350	Q5SXH7;Q5SXH7-5;Q5SXH7-2	CJ081_HUMAN;.;.	D	268;350;184;100	ENSP00000358318:G268D;ENSP00000358316:G350D;ENSP00000358315:G184D;ENSP00000346451:G100D	ENSP00000346451:G100D	G	+	2	0	C10orf81	115526890	0.994000	0.37717	0.984000	0.44739	0.237000	0.25408	2.818000	0.48041	1.519000	0.48950	0.655000	0.94253	GGC	.	.		0.557	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
CACUL1	143384	hgsc.bcm.edu	37	10	120450798	120450798	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:120450798A>C	ENST00000369151.3	-	7	1487	c.1004T>G	c.(1003-1005)cTt>cGt	p.L335R	CACUL1_ENST00000544392.1_5'UTR	NM_153810.4	NP_722517.3	Q86Y37	CACL1_HUMAN	CDK2-associated, cullin domain 1	335					G1/S transition of mitotic cell cycle (GO:0000082)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase activity (GO:0045860)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)	protein kinase binding (GO:0019901)										ATTCTGTATAAGTTCTCTTTG	0.383																																					p.L335R		Atlas-SNP	.											.	.	.	.	0			c.T1004G						.						134.0	138.0	137.0					10																	120450798		1818	4085	5903	SO:0001583	missense	143384	exon7			TGTATAAGTTCTC	AK097728	CCDS41570.1	10q26.13	2012-06-12	2012-06-12	2012-06-12	ENSG00000151893	ENSG00000151893			23727	protein-coding gene	gene with protein product	"""Cdk-Associated Cullin1"""		"""chromosome 10 open reading frame 46"""	C10orf46		19829063	Standard	NM_153810		Approved	FLJ40409, MGC33215, CAC1	uc001lds.1	Q86Y37	OTTHUMG00000019138	ENST00000369151.3:c.1004T>G	chr10.hg19:g.120450798A>C	ENSP00000358147:p.Leu335Arg	72.0	0.0		75.0	21.0	NM_153810	Q5XPL7|Q8IY11|Q8N7S4	Missense_Mutation	SNP	ENST00000369151.3	hg19	CCDS41570.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.701899	0.88924	.	.	ENSG00000151893	ENST00000544392;ENST00000369156;ENST00000369151	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.68007	0.2954	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.70586	-0.4831	9	0.66056	D	0.02	-4.4185	16.4696	0.84102	1.0:0.0:0.0:0.0	.	335	Q86Y37	CJ046_HUMAN	R	146;212;335	.	ENSP00000358147:L335R	L	-	2	0	C10orf46	120440788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.064000	0.89483	2.289000	0.77006	0.482000	0.46254	CTT	.	.		0.383	CACUL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050612.2	NM_153810	
PLEKHA1	59338	hgsc.bcm.edu	37	10	124172538	124172538	+	Missense_Mutation	SNP	G	G	A	rs573666181		TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:124172538G>A	ENST00000368990.3	+	6	576	c.445G>A	c.(445-447)Gta>Ata	p.V149I	PLEKHA1_ENST00000433307.1_Missense_Mutation_p.V149I|PLEKHA1_ENST00000494222.1_3'UTR|PLEKHA1_ENST00000368988.1_Missense_Mutation_p.V149I|PLEKHA1_ENST00000538022.1_Missense_Mutation_p.V149I|PLEKHA1_ENST00000368989.2_Missense_Mutation_p.V149I	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1	149					androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGTTGGTGGCGTACCCATCAT	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		13721	0.0		0.0	False		,,,				2504	0.001				p.V149I		Atlas-SNP	.											.	PLEKHA1	33	.	0			c.G445A						.						130.0	120.0	123.0					10																	124172538		2203	4300	6503	SO:0001583	missense	59338	exon6			GGTGGCGTACCCA	AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.445G>A	chr10.hg19:g.124172538G>A	ENSP00000357986:p.Val149Ile	140.0	0.0		111.0	5.0	NM_021622	B3KQ55|D3DRE2|Q9BVK0	Missense_Mutation	SNP	ENST00000368990.3	hg19	CCDS7629.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123233	0.94429	.	.	ENSG00000107679	ENST00000368990;ENST00000368989;ENST00000409427;ENST00000368988;ENST00000538022;ENST00000433307	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	M	0.80982	2.52	0.80722	D	1	P;D	0.65815	0.68;0.995	B;D	0.64776	0.166;0.929	T	0.05500	-1.0881	10	0.39692	T	0.17	-16.352	20.2314	0.98350	0.0:0.0:1.0:0.0	.	149;149	B3KQ55;Q9HB21	.;PKHA1_HUMAN	I	149	ENSP00000357986:V149I;ENSP00000357985:V149I;ENSP00000357984:V149I;ENSP00000438608:V149I;ENSP00000394416:V149I	ENSP00000357984:V149I	V	+	1	0	PLEKHA1	124162528	1.000000	0.71417	0.870000	0.34147	0.946000	0.59487	9.011000	0.93618	2.789000	0.95967	0.591000	0.81541	GTA	.	.		0.363	PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050783.1	NM_001001974	
DHX32	55760	hgsc.bcm.edu	37	10	127529548	127529549	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr10:127529548_127529549GT>TG	ENST00000284690.3	-	8	2050_2051	c.1560_1561AC>CA	c.(1558-1563)tcACat>tcCAat	p.H521N	AL360176.1_ENST00000401153.1_RNA|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000368721.1_Missense_Mutation_p.H145N|BCCIP_ENST00000299130.3_Intron|BCCIP_ENST00000429863.2_Intron|DHX32_ENST00000284688.6_Missense_Mutation_p.H440N	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	521						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGTGGCACATGTGAAAAGCAAT	0.426																																					p.H521N|p.S520S		Atlas-SNP	.											.	DHX32	67	.	0			c.C1561A|c.A1560C						.																																			SO:0001583	missense	55760	exon8			GCACATGTGAAAA|CACATGTGAAAAG		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1560_1561delinsTG	chr10.hg19:g.127529548_127529549delinsTG	ENSP00000284690:p.His521Asn	86.0|87.0	0.0		73.0	27.0|28.0	NM_018180	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation|Silent	SNP	ENST00000284690.3	hg19	CCDS7652.1																																																																																			.	.		0.426	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	NM_018180	
MUC2	4583	hgsc.bcm.edu	37	11	1094728	1094728	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr11:1094728C>T	ENST00000441003.2	+	31	5843	c.5816C>T	c.(5815-5817)aCg>aTg	p.T1939M	MUC2_ENST00000333592.6_Missense_Mutation_p.T227M|MUC2_ENST00000361558.6_Missense_Mutation_p.T77M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4301					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACTGTGCAGACGACCACCACC	0.637																																					p.T1935M		Atlas-SNP	.											.	MUC2	614	.	0			c.C5804T						.						110.0	131.0	124.0					11																	1094728		2100	4228	6328	SO:0001583	missense	4583	exon32			TGCAGACGACCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5816C>T	chr11.hg19:g.1094728C>T	ENSP00000415183:p.Thr1939Met	91.0	0.0		78.0	30.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	c	11.73	1.727216	0.30593	.	.	ENSG00000198788	ENST00000441003;ENST00000361558;ENST00000333592	T;T;T	0.50548	2.62;0.74;2.98	1.74	1.74	0.24563	.	.	.	.	.	T	0.39759	0.1090	L	0.58101	1.795	0.09310	N	1	D	0.60575	0.988	B	0.39339	0.297	T	0.32348	-0.9910	9	0.59425	D	0.04	.	8.3718	0.32419	0.0:1.0:0.0:0.0	.	1939	E7EUV1	.	M	1939;77;227	ENSP00000415183:T1939M;ENSP00000354885:T77M;ENSP00000331373:T227M	ENSP00000331373:T227M	T	+	2	0	MUC2	1084728	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.326000	0.07965	0.965000	0.38133	0.479000	0.44913	ACG	.	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR52N5	390075	hgsc.bcm.edu	37	11	5799571	5799571	+	Silent	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr11:5799571G>A	ENST00000317093.2	-	1	326	c.294C>T	c.(292-294)ctC>ctT	p.L98L	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		TAATTTCTTTGAGACTGAACC	0.478																																					p.L98L		Atlas-SNP	.											.	OR52N5	58	.	0			c.C294T						.						93.0	89.0	90.0					11																	5799571		2121	4087	6208	SO:0001819	synonymous_variant	390075	exon1			TTCTTTGAGACTG	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.294C>T	chr11.hg19:g.5799571G>A		189.0	0.0		183.0	14.0	NM_001001922	B9EH12|Q6IFG2	Silent	SNP	ENST00000317093.2	hg19	CCDS31397.1																																																																																			.	.		0.478	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922	
PPP1R32	220004	hgsc.bcm.edu	37	11	61252246	61252246	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr11:61252246G>C	ENST00000338608.2	+	5	593	c.468G>C	c.(466-468)caG>caC	p.Q156H	RP11-286N22.8_ENST00000544880.1_3'UTR|PPP1R32_ENST00000432063.2_Missense_Mutation_p.Q156H	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	156							phosphatase binding (GO:0019902)										TGCTCCACCAGCAGCAGGGCC	0.672																																					p.Q156H		Atlas-SNP	.											.	.	.	.	0			c.G468C						.						23.0	24.0	24.0					11																	61252246		2202	4299	6501	SO:0001583	missense	220004	exon5			CCACCAGCAGCAG	AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.468G>C	chr11.hg19:g.61252246G>C	ENSP00000344140:p.Gln156His	117.0	0.0		97.0	35.0	NM_001170753	Q4G0P4|Q96M77	Missense_Mutation	SNP	ENST00000338608.2	hg19	CCDS8008.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227940	0.58777	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.46451	0.87;1.46	5.33	2.39	0.29439	.	0.221526	0.30565	N	0.009355	T	0.52980	0.1768	M	0.68317	2.08	0.80722	D	1	D;D	0.64830	0.987;0.994	P;P	0.62740	0.838;0.906	T	0.51795	-0.8660	9	.	.	.	-15.9934	6.9325	0.24449	0.3199:0.0:0.6801:0.0	.	156;156	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	H	156	ENSP00000391560:Q156H;ENSP00000344140:Q156H	.	Q	+	3	2	C11orf66	61008822	0.985000	0.35326	1.000000	0.80357	0.680000	0.39746	1.482000	0.35486	1.249000	0.43950	0.462000	0.41574	CAG	.	.		0.672	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398621.1	NM_145017	
CCND1	595	hgsc.bcm.edu	37	11	69466001	69466001	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr11:69466001A>T	ENST00000227507.2	+	5	1066	c.839A>T	c.(838-840)gAg>gTg	p.E280V	ORAOV1_ENST00000542515.1_5'Flank	NM_053056.2	NP_444284.1	P24385	CCND1_HUMAN	cyclin D1	280	Poly-Glu.				canonical Wnt signaling pathway (GO:0060070)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|lactation (GO:0007595)|Leydig cell differentiation (GO:0033327)|liver development (GO:0001889)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ regeneration (GO:0031100)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|positive regulation of protein phosphorylation (GO:0001934)|re-entry into mitotic cell cycle (GO:0000320)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to organonitrogen compound (GO:0010243)|response to UV-A (GO:0070141)|response to vitamin E (GO:0033197)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)|transcriptional repressor complex (GO:0017053)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|proline-rich region binding (GO:0070064)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			NS(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|ovary(1)|urinary_tract(1)	23	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	gaggaggaggaggtggaCCTG	0.706			T	"""IGH@, FSTL3"""	"""CLL, B-ALL, breast"""					Multiple Myeloma(6;0.086)																											p.E280V	Pancreas(65;393 884 2788 21700 24360 27795 36895)	Atlas-SNP	.		Dom	yes		11	11q13	595	cyclin D1		"""L, E"""	.	CCND1	107	.	0			c.A839T						.						28.0	23.0	25.0					11																	69466001		2200	4294	6494	SO:0001583	missense	595	exon5			AGGAGGAGGTGGA	Z23022	CCDS8191.1	11q13	2008-07-18	2005-09-12		ENSG00000110092	ENSG00000110092			1582	protein-coding gene	gene with protein product	"""parathyroid adenomatosis 1"", ""B-cell CLL/lymphoma 1"", ""G1/S-specific cyclin D1"""	168461	"""cyclin D1 (PRAD1: parathyroid adenomatosis 1)"""	BCL1, D11S287E, PRAD1		1826542, 1833066	Standard	XM_006718653		Approved	U21B31	uc001opa.3	P24385	OTTHUMG00000167877	ENST00000227507.2:c.839A>T	chr11.hg19:g.69466001A>T	ENSP00000227507:p.Glu280Val	186.0	0.0		144.0	6.0	NM_053056	Q6LEF0	Missense_Mutation	SNP	ENST00000227507.2	hg19	CCDS8191.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214161	0.79352	.	.	ENSG00000110092	ENST00000227507;ENST00000542897	T	0.10192	2.9	5.18	4.05	0.47172	.	0.220157	0.46442	D	0.000298	T	0.10637	0.0260	L	0.36672	1.1	0.80722	D	1	B	0.32382	0.368	B	0.35114	0.196	T	0.09207	-1.0685	10	0.54805	T	0.06	.	10.7647	0.46286	0.9251:0.0:0.0749:0.0	.	280	P24385	CCND1_HUMAN	V	280;146	ENSP00000227507:E280V	ENSP00000227507:E280V	E	+	2	0	CCND1	69175182	1.000000	0.71417	0.349000	0.25694	0.990000	0.78478	5.551000	0.67274	0.822000	0.34565	0.459000	0.35465	GAG	.	.		0.706	CCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396775.2	NM_053056	
C2CD3	26005	hgsc.bcm.edu	37	11	73817446	73817446	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr11:73817446T>G	ENST00000334126.7	-	13	2281	c.2055A>C	c.(2053-2055)gaA>gaC	p.E685D	C2CD3_ENST00000313663.7_Missense_Mutation_p.E685D			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	685					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					ACTGACCATTTTCTTGTTGCA	0.433																																					p.E685D		Atlas-SNP	.											.	C2CD3	288	.	0			c.A2055C						.						98.0	91.0	94.0					11																	73817446		2200	4293	6493	SO:0001583	missense	26005	exon13			ACCATTTTCTTGT	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.2055A>C	chr11.hg19:g.73817446T>G	ENSP00000334379:p.Glu685Asp	189.0	0.0		169.0	68.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	hg19		.	.	.	.	.	.	.	.	.	.	T	16.04	3.009282	0.54361	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.11169	2.8;2.81	5.47	3.16	0.36331	.	0.276343	0.39759	N	0.001265	T	0.21307	0.0513	M	0.68952	2.095	0.23113	N	0.998278	D	0.65815	0.995	P	0.57371	0.819	T	0.04579	-1.0941	10	0.54805	T	0.06	-9.629	7.1741	0.25734	0.0:0.3036:0.0:0.6964	.	685	Q4AC94-1	.	D	685	ENSP00000334379:E685D;ENSP00000323339:E685D	ENSP00000323339:E685D	E	-	3	2	C2CD3	73495094	0.995000	0.38212	0.900000	0.35374	0.310000	0.27922	1.054000	0.30455	0.467000	0.27218	0.482000	0.46254	GAA	.	.		0.433	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
GUCY2C	2984	hgsc.bcm.edu	37	12	14778727	14778727	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr12:14778727T>G	ENST00000261170.3	-	21	2508	c.2372A>C	c.(2371-2373)gAc>gCc	p.D791A		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	791					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GTCAGCCCTGTCCCTCTCTGC	0.453																																					p.D791A		Atlas-SNP	.											.	GUCY2C	126	.	0			c.A2372C						.						235.0	201.0	212.0					12																	14778727		2203	4300	6503	SO:0001583	missense	2984	exon21			GCCCTGTCCCTCT		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2372A>C	chr12.hg19:g.14778727T>G	ENSP00000261170:p.Asp791Ala	119.0	0.0		85.0	4.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	hg19	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.436009	0.83885	.	.	ENSG00000070019	ENST00000261170	T	0.80909	-1.43	5.35	5.35	0.76521	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.85682	D	0.000000	D	0.85164	0.5634	L	0.49256	1.55	0.80722	D	1	P	0.50443	0.935	P	0.59825	0.864	D	0.85178	0.1002	10	0.45353	T	0.12	.	15.633	0.76926	0.0:0.0:0.0:1.0	.	791	P25092	GUC2C_HUMAN	A	791	ENSP00000261170:D791A	ENSP00000261170:D791A	D	-	2	0	GUCY2C	14669994	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.943000	0.87716	2.155000	0.67459	0.482000	0.46254	GAC	.	.		0.453	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
ITGA7	3679	hgsc.bcm.edu	37	12	56081819	56081819	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr12:56081819A>G	ENST00000555728.1	-	25	3279	c.3251T>C	c.(3250-3252)gTc>gCc	p.V1084A	ITGA7_ENST00000452168.2_Missense_Mutation_p.V947A|ITGA7_ENST00000394229.2_Missense_Mutation_p.V1040A|ITGA7_ENST00000394230.2_Missense_Mutation_p.V1044A|ITGA7_ENST00000257880.7_Missense_Mutation_p.V1084A|ITGA7_ENST00000257879.6_Missense_Mutation_p.V1040A|ITGA7_ENST00000553804.1_Missense_Mutation_p.V1044A|ITGA7_ENST00000347027.6_Missense_Mutation_p.V1034A			Q13683	ITA7_HUMAN	integrin, alpha 7	1084					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CAGGAGGATGACCCACCAGGG	0.602																																					p.V1044A		Atlas-SNP	.											.	ITGA7	194	.	0			c.T3131C						.						121.0	120.0	120.0					12																	56081819		2203	4300	6503	SO:0001583	missense	3679	exon24			AGGATGACCCACC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3251T>C	chr12.hg19:g.56081819A>G	ENSP00000452387:p.Val1084Ala	146.0	0.0		134.0	39.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.70	3.196816	0.58126	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728;ENST00000557555	T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	4.92	3.76	0.43208	.	0.147970	0.45361	D	0.000379	T	0.52964	0.1767	M	0.75264	2.295	0.31329	N	0.685098	B;B;B;P	0.37141	0.118;0.241;0.427;0.584	B;B;B;B	0.38985	0.139;0.103;0.287;0.207	T	0.62431	-0.6856	10	0.87932	D	0	.	8.9659	0.35877	0.9096:0.0:0.0903:0.0	.	947;1084;1044;1103	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	A	1044;1040;1034;947;1084;1044;1040;913;1084;70	ENSP00000452120:V1044A;ENSP00000257879:V1040A;ENSP00000343009:V1034A;ENSP00000393844:V947A;ENSP00000257880:V1084A;ENSP00000377777:V1044A;ENSP00000377776:V1040A;ENSP00000452387:V1084A	ENSP00000257879:V1040A	V	-	2	0	ITGA7	54368086	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.712000	0.74681	0.726000	0.32339	0.386000	0.25728	GTC	.	.		0.602	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
ITGA7	3679	hgsc.bcm.edu	37	12	56081826	56081826	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr12:56081826A>G	ENST00000555728.1	-	25	3272	c.3244T>C	c.(3244-3246)Tgg>Cgg	p.W1082R	ITGA7_ENST00000452168.2_Missense_Mutation_p.W945R|ITGA7_ENST00000394229.2_Missense_Mutation_p.W1038R|ITGA7_ENST00000394230.2_Missense_Mutation_p.W1042R|ITGA7_ENST00000257880.7_Missense_Mutation_p.W1082R|ITGA7_ENST00000257879.6_Missense_Mutation_p.W1038R|ITGA7_ENST00000553804.1_Missense_Mutation_p.W1042R|ITGA7_ENST00000347027.6_Missense_Mutation_p.W1032R			Q13683	ITA7_HUMAN	integrin, alpha 7	1082					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ATGACCCACCAGGGCACTCCT	0.597																																					p.W1042R		Atlas-SNP	.											.	ITGA7	194	.	0			c.T3124C						.						120.0	118.0	119.0					12																	56081826		2203	4300	6503	SO:0001583	missense	3679	exon24			CCCACCAGGGCAC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3244T>C	chr12.hg19:g.56081826A>G	ENSP00000452387:p.Trp1082Arg	143.0	0.0		142.0	43.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	hg19		.	.	.	.	.	.	.	.	.	.	A	21.0	4.083848	0.76642	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728;ENST00000557555	T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	4.92	4.92	0.64577	.	0.160277	0.45606	D	0.000354	T	0.68357	0.2992	M	0.81341	2.54	0.58432	D	0.999996	D;D;D;D	0.76494	0.995;0.995;0.999;0.998	D;D;D;D	0.74023	0.935;0.933;0.982;0.933	T	0.73257	-0.4040	10	0.72032	D	0.01	.	12.5563	0.56254	1.0:0.0:0.0:0.0	.	945;1082;1042;1101	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	R	1042;1038;1032;945;1082;1042;1038;911;1082;68	ENSP00000452120:W1042R;ENSP00000257879:W1038R;ENSP00000343009:W1032R;ENSP00000393844:W945R;ENSP00000257880:W1082R;ENSP00000377777:W1042R;ENSP00000377776:W1038R;ENSP00000452387:W1082R	ENSP00000257879:W1038R	W	-	1	0	ITGA7	54368093	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.490000	0.90464	1.854000	0.53819	0.386000	0.25728	TGG	.	.		0.597	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
CCT2	10576	hgsc.bcm.edu	37	12	69992133	69992133	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr12:69992133A>G	ENST00000299300.6	+	14	1555	c.1367A>G	c.(1366-1368)tAt>tGt	p.Y456C	CCT2_ENST00000544368.2_Missense_Mutation_p.Y456C|CCT2_ENST00000543146.2_Missense_Mutation_p.Y409C	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	456					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			AATGCAGGCTATGACAGTGCA	0.468																																					p.Y456C		Atlas-SNP	.											.	CCT2	49	.	0			c.A1367G						.						97.0	91.0	93.0					12																	69992133		2203	4300	6503	SO:0001583	missense	10576	exon14			CAGGCTATGACAG	AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.1367A>G	chr12.hg19:g.69992133A>G	ENSP00000299300:p.Tyr456Cys	322.0	0.0		371.0	111.0	NM_006431	A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Missense_Mutation	SNP	ENST00000299300.6	hg19	CCDS8991.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450764	0.84101	.	.	ENSG00000166226	ENST00000299300;ENST00000544368;ENST00000543146	T;T;T	0.78816	-1.21;-1.21;-1.21	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.88366	0.6417	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72982	0.965;0.979	D	0.88780	0.3270	9	.	.	.	-8.0319	16.5582	0.84512	1.0:0.0:0.0:0.0	.	456;456	F5GWF6;P78371	.;TCPB_HUMAN	C	456;456;409	ENSP00000299300:Y456C;ENSP00000441847:Y456C;ENSP00000445471:Y409C	.	Y	+	2	0	CCT2	68278400	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.778000	0.91785	2.308000	0.77769	0.533000	0.62120	TAT	.	.		0.468	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403818.1	NM_006431	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85441230	85441230	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr12:85441230A>C	ENST00000393217.2	+	6	721	c.660A>C	c.(658-660)aaA>aaC	p.K220N		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	220	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAAAGAAGAAATTAGAGAACA	0.308																																					p.K220N		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.A660C						.						58.0	66.0	64.0					12																	85441230		2200	4297	6497	SO:0001583	missense	84125	exon6			GAAGAAATTAGAG	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.660A>C	chr12.hg19:g.85441230A>C	ENSP00000376910:p.Lys220Asn	486.0	1.0		633.0	159.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	hg19	CCDS41816.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.28|16.28	3.077533|3.077533	0.55753|0.55753	.|.	.|.	ENSG00000133640|ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217|ENST00000533414	T|.	0.59224|.	0.28|.	5.23|5.23	-0.237|-0.237	0.13061|0.13061	.|.	0.839209|.	0.10519|.	N|.	0.665218|.	T|T	0.33904|0.33904	0.0879|0.0879	L|L	0.42245|0.42245	1.32|1.32	0.21604|0.21604	N|N	0.999627|0.999627	D;D;D|.	0.61697|.	0.989;0.965;0.99|.	P;P;P|.	0.57960|.	0.827;0.583;0.83|.	T|T	0.29731|0.29731	-1.0002|-1.0002	10|5	0.66056|.	D|.	0.02|.	.|.	5.4584|5.4584	0.16604|0.16604	0.4563:0.1542:0.3895:0.0|0.4563:0.1542:0.3895:0.0	.|.	220;220;220|.	Q96JM4-2;Q96JM4;C9JI57|.	.;LRIQ1_HUMAN;.|.	N|T	220|118	ENSP00000376910:K220N|.	ENSP00000256007:K220N|.	K|N	+|+	3|2	2|0	LRRIQ1|LRRIQ1	83965361|83965361	0.996000|0.996000	0.38824|0.38824	0.996000|0.996000	0.52242|0.52242	0.914000|0.914000	0.54420|0.54420	0.372000|0.372000	0.20467|0.20467	-0.052000|-0.052000	0.13311|0.13311	0.477000|0.477000	0.44152|0.44152	AAA|AAT	.	.		0.308	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
SPATA13	221178	hgsc.bcm.edu	37	13	24864943	24864943	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr13:24864943C>G	ENST00000382095.4	+	8	1533	c.1126C>G	c.(1126-1128)Ctg>Gtg	p.L376V	SPATA13_ENST00000409126.1_Missense_Mutation_p.L236V|SPATA13_ENST00000424834.2_Missense_Mutation_p.L1001V|SPATA13_ENST00000382108.3_Missense_Mutation_p.L1001V|SPATA13_ENST00000343003.6_Missense_Mutation_p.L320V|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.L879V|SPATA13_ENST00000399949.2_Missense_Mutation_p.L298V	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	376	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CGACGGGTTCCTGCTCACACC	0.572																																					p.L1001V		Atlas-SNP	.											.	SPATA13	92	.	0			c.C3001G						.						58.0	59.0	59.0					13																	24864943		2203	4300	6503	SO:0001583	missense	221178	exon9			GGGTTCCTGCTCA	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.1126C>G	chr13.hg19:g.24864943C>G	ENSP00000371527:p.Leu376Val	192.0	0.0		140.0	60.0	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	hg19	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.49|18.49	3.635538|3.635538	0.67130|0.67130	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694;ENST00000399949;ENST00000409126;ENST00000343003|ENST00000424834	D;D;D;D;D;D|.	0.83755|.	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76|.	5.44|5.44	4.6|4.6	0.57074|0.57074	Dbl homology (DH) domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85261|0.85261	0.5656|0.5656	H|H	0.94582|0.94582	3.555|3.555	0.51012|0.51012	D|D	0.999902|0.999902	D;D;D;D;D;D|.	0.89917|.	0.999;1.0;0.998;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	0.999;1.0;0.998;1.0;1.0;1.0|.	D|D	0.89017|0.89017	0.3432|0.3432	10|5	0.87932|.	D|.	0|.	.|.	13.3238|13.3238	0.60449|0.60449	0.0:0.9241:0.0:0.0759|0.0:0.9241:0.0:0.0759	.|.	236;320;260;322;298;376|.	E9PFR9;Q96N96-3;Q96N96-5;Q96N96-4;Q96N96-2;Q96N96|.	.;.;.;.;.;SPT13_HUMAN|.	V|R	1001;376;274;322;298;236;320|1038	ENSP00000371542:L1001V;ENSP00000371527:L376V;ENSP00000401605:L274V;ENSP00000382830:L298V;ENSP00000386471:L236V;ENSP00000343631:L320V|.	ENSP00000343631:L320V|.	L|P	+|+	1|2	2|0	SPATA13|SPATA13	23762943|23762943	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.977000|0.977000	0.68977|0.68977	3.671000|3.671000	0.54576|0.54576	1.314000|1.314000	0.45095|0.45095	-0.266000|-0.266000	0.10368|0.10368	CTG|CCT	.	.		0.572	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
DHRS4L1	728635	hgsc.bcm.edu	37	14	24517969	24517969	+	RNA	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr14:24517969T>A	ENST00000558293.1	+	0	617					NR_102693.1																						CAAGGAACATTAGGGTGAACT	0.522																																					p.I208I		Atlas-SNP	.											.	.	.	.	0			c.T624A						.						154.0	152.0	153.0					14																	24517969		2203	4300	6503			728635	exon8			GAACATTAGGGTG																													chr14.hg19:g.24517969T>A		622.0	0.0		523.0	187.0	NM_001082488		Silent	SNP	ENST00000558293.1	hg19																																																																																				.	.		0.522	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105407215	105407215	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr14:105407215C>A	ENST00000333244.5	-	7	14692	c.14573G>T	c.(14572-14574)gGt>gTt	p.G4858V	AHNAK2_ENST00000557457.1_5'UTR	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4858						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGATACCTGACCAAGAGAAAC	0.493																																					p.G4858V		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G14573T						.						28.0	30.0	30.0					14																	105407215		1920	4143	6063	SO:0001583	missense	113146	exon7			ACCTGACCAAGAG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14573G>T	chr14.hg19:g.105407215C>A	ENSP00000353114:p.Gly4858Val	132.0	0.0		96.0	28.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326148	0.41197	.	.	ENSG00000185567	ENST00000333244	T	0.05717	3.4	4.67	-1.39	0.08997	.	.	.	.	.	T	0.04227	0.0117	N	0.24115	0.695	0.09310	N	1	P	0.41673	0.759	B	0.41860	0.368	T	0.40683	-0.9550	9	0.27785	T	0.31	.	4.2791	0.10824	0.2811:0.3168:0.3289:0.0731	.	4858	Q8IVF2	AHNK2_HUMAN	V	4858	ENSP00000353114:G4858V	ENSP00000353114:G4858V	G	-	2	0	AHNAK2	104478260	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.215000	0.02985	-0.152000	0.11156	-0.311000	0.09066	GGT	.	.		0.493	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NOP10	55505	hgsc.bcm.edu	37	15	34634207	34634207	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr15:34634207T>C	ENST00000328848.4	-	2	260	c.157A>G	c.(157-159)Aag>Gag	p.K53E	NUTM1_ENST00000438749.3_5'Flank|NUTM1_ENST00000537011.1_5'Flank|NOP10_ENST00000557912.1_Silent_p.S33S	NM_018648.3	NP_061118.1	Q9NPE3	NOP10_HUMAN	NOP10 ribonucleoprotein	53					pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA RNP complex (GO:0072588)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	snoRNA binding (GO:0030515)			lung(1)|ovary(1)	2						ATGAGCACCTTGAAGCGTTTC	0.537																																					p.K53E		Atlas-SNP	.											NOP10,colon,carcinoma,0,1	NOP10	8	.	0			c.A157G						.						167.0	126.0	140.0					15																	34634207		2201	4298	6499	SO:0001583	missense	55505	exon2			GCACCTTGAAGCG	AB043103	CCDS10037.1	15q14-q15	2014-09-17	2012-12-10	2008-10-13	ENSG00000182117	ENSG00000182117			14378	protein-coding gene	gene with protein product	"""homolog of yeast Nop10p"""	606471	"""nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs)"", ""NOP10 ribonucleoprotein homolog (yeast)"""	NOLA3		11074001, 9843512	Standard	NM_018648		Approved	NOP10P, MGC70651	uc001zie.1	Q9NPE3	OTTHUMG00000129440	ENST00000328848.4:c.157A>G	chr15.hg19:g.34634207T>C	ENSP00000332198:p.Lys53Glu	113.0	0.0		91.0	40.0	NM_018648		Missense_Mutation	SNP	ENST00000328848.4	hg19	CCDS10037.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.991105	0.74703	.	.	ENSG00000182117	ENST00000328848	T	0.76448	-1.02	5.39	4.27	0.50696	.	0.178992	0.51477	D	0.000083	T	0.67655	0.2916	.	.	.	0.80722	D	1	B	0.23128	0.08	B	0.26202	0.067	T	0.67635	-0.5620	9	0.66056	D	0.02	.	5.3576	0.16069	0.0:0.245:0.0:0.755	.	53	Q9NPE3	NOP10_HUMAN	E	53	ENSP00000332198:K53E	ENSP00000332198:K53E	K	-	1	0	NOP10	32421499	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.774000	0.55341	2.043000	0.60533	0.533000	0.62120	AAG	.	.		0.537	NOP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251602.2	NM_018648	
SH3GL3	6457	hgsc.bcm.edu	37	15	84237305	84237305	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr15:84237305T>C	ENST00000427482.2	+	4	518	c.212T>C	c.(211-213)cTg>cCg	p.L71P	SH3GL3_ENST00000434347.1_Missense_Mutation_p.L79P|SH3GL3_ENST00000324537.5_Missense_Mutation_p.L79P|SH3GL3_ENST00000535412.1_Missense_Mutation_p.L71P	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	71	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Required for dimerization upon membrane association. {ECO:0000250}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						CTAGGAATGCTGAACACTGTG	0.453																																					p.L71P		Atlas-SNP	.											.	SH3GL3	91	.	0			c.T212C						.						81.0	79.0	79.0					15																	84237305		2203	4300	6503	SO:0001583	missense	6457	exon4			GAATGCTGAACAC	AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.212T>C	chr15.hg19:g.84237305T>C	ENSP00000391372:p.Leu71Pro	81.0	0.0		68.0	29.0	NM_003027	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	hg19	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	T	22.3	4.270980	0.80469	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	4.86	4.86	0.63082	BAR (3);	0.076128	0.53938	D	0.000046	T	0.81833	0.4906	M	0.82323	2.585	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.991	D;D;D	0.72075	0.976;0.967;0.962	D	0.84011	0.0348	10	0.52906	T	0.07	-38.6117	13.9656	0.64207	0.0:0.0:0.0:1.0	.	71;71;79	Q8IVP1;Q99963;Q99963-3	.;SH3G3_HUMAN;.	P	71;71;79;79	ENSP00000391372:L71P;ENSP00000439239:L71P;ENSP00000320092:L79P;ENSP00000397871:L79P	ENSP00000320092:L79P	L	+	2	0	SH3GL3	82028309	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.781000	0.62389	1.947000	0.56498	0.445000	0.29226	CTG	.	.		0.453	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027	
AKAP13	11214	hgsc.bcm.edu	37	15	86198736	86198736	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr15:86198736G>T	ENST00000394518.2	+	11	4558	c.4463G>T	c.(4462-4464)gGc>gTc	p.G1488V	RP11-815J21.4_ENST00000558980.1_RNA|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.G1488V	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1488					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TCTTCTCATGGCAGTGATGTG	0.507																																					p.G1488V	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.G4463T						.						100.0	86.0	91.0					15																	86198736		2202	4299	6501	SO:0001583	missense	11214	exon11			CTCATGGCAGTGA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.4463G>T	chr15.hg19:g.86198736G>T	ENSP00000378026:p.Gly1488Val	84.0	0.0		93.0	4.0	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187682	0.78789	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000452008	T;T	0.51071	0.72;0.72	5.37	5.37	0.77165	.	.	.	.	.	T	0.68531	0.3011	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.70270	-0.4918	9	0.87932	D	0	.	18.2884	0.90121	0.0:0.0:1.0:0.0	.	1488;1488;1488	Q12802-4;Q12802;Q12802-2	.;AKP13_HUMAN;.	V	1488;1488;1487;1487;128	ENSP00000354718:G1488V;ENSP00000378026:G1488V	ENSP00000354718:G1488V	G	+	2	0	AKAP13	83999740	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.834000	0.62774	2.808000	0.96608	0.650000	0.86243	GGC	.	.		0.507	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
NTRK3	4916	hgsc.bcm.edu	37	15	88670420	88670420	+	Silent	SNP	G	G	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr15:88670420G>C	ENST00000360948.2	-	11	1427	c.1266C>G	c.(1264-1266)acC>acG	p.T422T	NTRK3_ENST00000558676.1_Silent_p.T414T|NTRK3_ENST00000355254.2_Silent_p.T422T|NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000540489.2_Silent_p.T422T|NTRK3_ENST00000394480.2_Silent_p.T422T|NTRK3_ENST00000557856.1_Silent_p.T414T|NTRK3_ENST00000317501.3_Silent_p.T422T|NTRK3_ENST00000542733.2_Silent_p.T324T|NTRK3_ENST00000357724.2_Silent_p.T414T	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	422					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTGGTTTGTGGGTCACAGTGA	0.483			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.T422T		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	NTRK3_ENST00000360948,NS,haematopoietic_neoplasm,0,3	NTRK3	587	.	0			c.C1266G						.						127.0	108.0	114.0					15																	88670420		2201	4299	6500	SO:0001819	synonymous_variant	4916	exon12			TTTGTGGGTCACA	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1266C>G	chr15.hg19:g.88670420G>C		225.0	0.0		171.0	79.0	NM_001012338	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	hg19	CCDS32322.1																																																																																			.	.		0.483	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
CLDN9	9080	hgsc.bcm.edu	37	16	3063428	3063428	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr16:3063428T>C	ENST00000445369.2	+	1	972	c.65T>C	c.(64-66)cTg>cCg	p.L22P		NM_020982.3	NP_066192.1	O95484	CLD9_HUMAN	claudin 9	22					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.L22P(1)		endometrium(2)|large_intestine(1)|lung(5)|prostate(2)	10						CTGGGGACCCTGGTGTCCTGC	0.667																																					p.L22P		Atlas-SNP	.											CLDN9,NS,carcinoma,0,1	CLDN9	33	.	1	Substitution - Missense(1)	lung(1)	c.T65C						.						95.0	80.0	85.0					16																	3063428		2198	4300	6498	SO:0001583	missense	9080	exon1			GGACCCTGGTGTC	AJ130941	CCDS10487.1	16p13.3	2008-08-01			ENSG00000213937	ENSG00000213937		"""Claudins"""	2051	protein-coding gene	gene with protein product		615799				9441748, 18234789	Standard	NM_020982		Approved		uc010uwo.1	O95484	OTTHUMG00000129000	ENST00000445369.2:c.65T>C	chr16.hg19:g.3063428T>C	ENSP00000398017:p.Leu22Pro	78.0	0.0		55.0	3.0	NM_020982		Missense_Mutation	SNP	ENST00000445369.2	hg19	CCDS10487.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.101022	0.76983	.	.	ENSG00000213937	ENST00000445369	D	0.93488	-3.23	4.79	4.79	0.61399	.	0.172969	0.38605	N	0.001639	D	0.96346	0.8808	M	0.86178	2.8	0.80722	D	1	D	0.64830	0.994	D	0.66196	0.942	D	0.96773	0.9570	10	0.87932	D	0	.	12.3183	0.54971	0.0:0.0:0.0:1.0	.	22	O95484	CLD9_HUMAN	P	22	ENSP00000398017:L22P	ENSP00000398017:L22P	L	+	2	0	CLDN9	3003429	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	7.833000	0.86765	2.011000	0.59026	0.482000	0.46254	CTG	.	.		0.667	CLDN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250989.1	NM_020982	
LOC81691	81691	hgsc.bcm.edu	37	16	20857589	20857589	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr16:20857589G>T	ENST00000261377.6	+	19	2380	c.2171G>T	c.(2170-2172)cGg>cTg	p.R724L	AC004381.6_ENST00000348433.6_Missense_Mutation_p.R693L|AC004381.6_ENST00000564274.1_Missense_Mutation_p.R724L|ERI2_ENST00000564349.1_Intron	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					CGCTGGAGCCGGAAGATTGGA	0.537																																					p.R724L		Atlas-SNP	.											.	LOC81691	41	.	0			c.G2171T						.						154.0	153.0	153.0					16																	20857589		2201	4300	6501	SO:0001583	missense	0	exon19			GGAGCCGGAAGAT																												ENST00000261377.6:c.2171G>T	chr16.hg19:g.20857589G>T	ENSP00000261377:p.Arg724Leu	125.0	0.0		100.0	4.0	NM_030941		Missense_Mutation	SNP	ENST00000261377.6	hg19	CCDS10591.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858002	0.51376	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.34859	1.34;1.83	5.63	2.19	0.27852	.	0.514477	0.19584	N	0.110790	T	0.34048	0.0884	L	0.60455	1.87	0.28485	N	0.914781	B;B	0.30973	0.302;0.242	B;B	0.31946	0.138;0.089	T	0.34875	-0.9811	10	0.72032	D	0.01	-10.7206	10.123	0.42632	0.2606:0.0:0.7394:0.0	.	693;724	Q96IC2-2;Q96IC2	.;REXON_HUMAN	L	693;724	ENSP00000261378:R693L;ENSP00000261377:R724L	ENSP00000261377:R724L	R	+	2	0	AC004381.6	20765090	0.994000	0.37717	1.000000	0.80357	0.969000	0.65631	0.836000	0.27545	0.738000	0.32606	-0.254000	0.11334	CGG	.	.		0.537	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
ANKRD11	29123	hgsc.bcm.edu	37	16	89337284	89337284	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr16:89337284T>A	ENST00000301030.4	-	12	8207	c.7747A>T	c.(7747-7749)Aac>Tac	p.N2583Y	ANKRD11_ENST00000378330.2_Missense_Mutation_p.N2583Y|AC137932.1_ENST00000602042.1_3'UTR	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2583					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGGCGGGCGTTGAAACGGTCG	0.602																																					p.N2583Y		Atlas-SNP	.											.	ANKRD11	195	.	0			c.A7747T						.						82.0	66.0	71.0					16																	89337284		2198	4300	6498	SO:0001583	missense	29123	exon12			GGGCGTTGAAACG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7747A>T	chr16.hg19:g.89337284T>A	ENSP00000301030:p.Asn2583Tyr	85.0	0.0		68.0	33.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.777247	0.90195	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.53857	0.6;0.6	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000002	T	0.73621	0.3610	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78775	-0.2072	10	0.87932	D	0	.	13.8323	0.63389	0.0:0.0:0.0:1.0	.	2583	Q6UB99	ANR11_HUMAN	Y	2583	ENSP00000301030:N2583Y;ENSP00000367581:N2583Y	ENSP00000301030:N2583Y	N	-	1	0	ANKRD11	87864785	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.858000	0.86971	1.806000	0.52798	0.397000	0.26171	AAC	.	.		0.602	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
NCOR1	9611	hgsc.bcm.edu	37	17	15965046	15965046	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr17:15965046T>A	ENST00000268712.3	-	37	5807	c.5550A>T	c.(5548-5550)gaA>gaT	p.E1850D	NCOR1_ENST00000395851.1_Intron|NCOR1_ENST00000395857.3_Missense_Mutation_p.E434D	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1850	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCAAATTTTCTTCTAACCTGG	0.488																																					p.E1850D		Atlas-SNP	.											.	NCOR1	240	.	0			c.A5550T						.						84.0	83.0	84.0					17																	15965046		2203	4300	6503	SO:0001583	missense	9611	exon37			ATTTTCTTCTAAC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5550A>T	chr17.hg19:g.15965046T>A	ENSP00000268712:p.Glu1850Asp	107.0	0.0		112.0	40.0	NM_006311	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.264824	0.59431	.	.	ENSG00000141027	ENST00000268712;ENST00000395849;ENST00000395857	T;T	0.46451	0.87;0.87	5.87	4.76	0.60689	.	0.092272	0.85682	D	0.000000	T	0.46908	0.1417	L	0.36672	1.1	0.39982	D	0.974938	D;D;B;B	0.69078	0.997;0.978;0.051;0.067	D;P;B;B	0.77557	0.99;0.76;0.015;0.084	T	0.38457	-0.9660	10	0.13108	T	0.6	-11.38	8.4628	0.32938	0.0:0.1486:0.0:0.8514	.	660;1754;1850;370	B4DZ48;E7EVK1;O75376;Q86YY1	.;.;NCOR1_HUMAN;.	D	1850;1754;434	ENSP00000268712:E1850D;ENSP00000379198:E434D	ENSP00000268712:E1850D	E	-	3	2	NCOR1	15905771	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.346000	0.19997	2.247000	0.74100	0.528000	0.53228	GAA	.	.		0.488	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
SUPT6H	6830	hgsc.bcm.edu	37	17	27027983	27027983	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr17:27027983C>T	ENST00000314616.6	+	36	5114	c.4831C>T	c.(4831-4833)Cca>Tca	p.P1611S	SUPT6H_ENST00000347486.4_Missense_Mutation_p.P1611S	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1611					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AGCCCAGCAGCCAGTGGCCAC	0.587																																					p.P1611S		Atlas-SNP	.											.	SUPT6H	165	.	0			c.C4831T						.						204.0	208.0	207.0					17																	27027983		2203	4300	6503	SO:0001583	missense	6830	exon36			CAGCAGCCAGTGG	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4831C>T	chr17.hg19:g.27027983C>T	ENSP00000319104:p.Pro1611Ser	106.0	0.0		135.0	43.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	hg19	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.426930	0.62733	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.35885	0.0947	N	0.05441	-0.05	0.80722	D	1	B	0.18741	0.03	B	0.11329	0.006	T	0.35549	-0.9784	9	0.02654	T	1	-7.0448	18.8074	0.92043	0.0:1.0:0.0:0.0	.	1611	Q7KZ85	SPT6H_HUMAN	S	1611	.	ENSP00000319104:P1611S	P	+	1	0	SUPT6H	24052110	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.973000	0.76116	2.465000	0.83290	0.650000	0.86243	CCA	.	.		0.587	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
COL1A1	1277	hgsc.bcm.edu	37	17	48266329	48266329	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr17:48266329G>T	ENST00000225964.5	-	41	3098	c.2980C>A	c.(2980-2982)Cgt>Agt	p.R994S		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	994	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GGGGGACCACGTTCACCACTT	0.617			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.R994S		Atlas-SNP	.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1	158	.	0			c.C2980A						.						72.0	71.0	71.0					17																	48266329		2203	4300	6503	SO:0001583	missense	1277	exon41			GACCACGTTCACC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2980C>A	chr17.hg19:g.48266329G>T	ENSP00000225964:p.Arg994Ser	155.0	0.0		112.0	38.0	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	hg19	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437806	0.62955	.	.	ENSG00000108821	ENST00000225964	D	0.92965	-3.14	3.83	3.83	0.44106	.	0.066944	0.64402	D	0.000018	D	0.94361	0.8187	L	0.54965	1.715	0.58432	D	0.999999	D	0.57571	0.98	D	0.72982	0.979	D	0.94590	0.7787	10	0.56958	D	0.05	.	14.7416	0.69461	0.0:0.0:1.0:0.0	.	994	P02452	CO1A1_HUMAN	S	994	ENSP00000225964:R994S	ENSP00000225964:R994S	R	-	1	0	COL1A1	45621328	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.705000	0.84606	1.998000	0.58463	0.298000	0.19748	CGT	.	.		0.617	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
CARD14	79092	hgsc.bcm.edu	37	17	78164640	78164640	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr17:78164640G>A	ENST00000573882.1	+	9	1567	c.1031G>A	c.(1030-1032)aGg>aAg	p.R344K	CARD14_ENST00000570421.1_Missense_Mutation_p.R344K|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000344227.2_Missense_Mutation_p.R344K|CARD14_ENST00000392434.2_Missense_Mutation_p.R107K			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	344					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CAACTCTACAGGGAGAAGGTG	0.602																																					p.R344K		Atlas-SNP	.											.	CARD14	98	.	0			c.G1031A						.						84.0	80.0	81.0					17																	78164640		2203	4300	6503	SO:0001583	missense	79092	exon7			TCTACAGGGAGAA	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1031G>A	chr17.hg19:g.78164640G>A	ENSP00000458715:p.Arg344Lys	87.0	0.0		66.0	17.0	NM_024110	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	hg19	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	g	4.604	0.112208	0.08831	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.30714	1.52;1.52	4.26	-2.37	0.06643	.	0.243825	0.40640	N	0.001060	T	0.06962	0.0177	N	0.00793	-1.18	0.21020	N	0.999803	B;B;B	0.12630	0.001;0.006;0.0	B;B;B	0.10450	0.001;0.005;0.001	T	0.33059	-0.9883	10	0.02654	T	1	-15.8856	10.8681	0.46866	0.4696:0.0:0.5304:0.0	.	344;107;344	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	K	344;107;107	ENSP00000344549:R344K;ENSP00000376229:R107K	ENSP00000308507:R107K	R	+	2	0	CARD14	75779235	1.000000	0.71417	0.668000	0.29813	0.296000	0.27459	0.804000	0.27098	-0.970000	0.03569	-0.310000	0.09108	AGG	.	.		0.602	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
OSBPL1A	114876	hgsc.bcm.edu	37	18	21758132	21758132	+	Silent	SNP	G	G	T	rs539256061	byFrequency	TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr18:21758132G>T	ENST00000319481.3	-	21	2144	c.1938C>A	c.(1936-1938)tcC>tcA	p.S646S	OSBPL1A_ENST00000357041.4_Silent_p.S264S|OSBPL1A_ENST00000399443.3_Silent_p.S133S	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	646					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TGACCTGTTCGGAGATGAGTC	0.323																																					p.S646S		Atlas-SNP	.											.	OSBPL1A	94	.	0			c.C1938A						.						125.0	117.0	119.0					18																	21758132		2203	4300	6503	SO:0001819	synonymous_variant	114876	exon21			CTGTTCGGAGATG	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1938C>A	chr18.hg19:g.21758132G>T		107.0	0.0		94.0	36.0	NM_080597	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	hg19	CCDS11884.1																																																																																			.	.		0.323	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
CCDC102B	79839	hgsc.bcm.edu	37	18	66678323	66678323	+	Silent	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr18:66678323C>T	ENST00000360242.5	+	7	1533	c.1416C>T	c.(1414-1416)ctC>ctT	p.L472L	CCDC102B_ENST00000584156.1_Silent_p.L472L|CCDC102B_ENST00000319445.6_Silent_p.L472L	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	472										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AGCAGGGACTCAATCAAAAAG	0.363																																					p.L472L		Atlas-SNP	.											.	CCDC102B	92	.	0			c.C1416T						.						97.0	94.0	95.0					18																	66678323		2203	4300	6503	SO:0001819	synonymous_variant	79839	exon9			GGGACTCAATCAA	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1416C>T	chr18.hg19:g.66678323C>T		263.0	0.0		329.0	22.0	NM_001093729	Q7Z467|Q8NDK7|Q9H5C1	Silent	SNP	ENST00000360242.5	hg19	CCDS11996.2																																																																																			.	.		0.363	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781	
MYO1F	4542	hgsc.bcm.edu	37	19	8587279	8587279	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr19:8587279T>C	ENST00000338257.8	-	27	3469	c.3202A>G	c.(3202-3204)Att>Gtt	p.I1068V		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	1068	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						AGGATCTCAATGACCTCGTTC	0.612																																					p.I1068V		Atlas-SNP	.											.	MYO1F	128	.	0			c.A3202G						.						69.0	71.0	71.0					19																	8587279		2124	4232	6356	SO:0001583	missense	4542	exon27			TCTCAATGACCTC	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.3202A>G	chr19.hg19:g.8587279T>C	ENSP00000344871:p.Ile1068Val	45.0	0.0		43.0	23.0	NM_012335	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	hg19	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	T	12.20	1.866854	0.32977	.	.	ENSG00000142347	ENST00000338257	T	0.56444	0.46	5.5	5.5	0.81552	Src homology-3 domain (5);	.	.	.	.	T	0.40570	0.1122	L	0.27944	0.81	0.48040	D	0.999574	B	0.17268	0.021	B	0.24541	0.054	T	0.24048	-1.0171	9	0.15499	T	0.54	.	14.7786	0.69749	0.0:0.0:0.0:1.0	.	1068	O00160	MYO1F_HUMAN	V	1068	ENSP00000344871:I1068V	ENSP00000344871:I1068V	I	-	1	0	MYO1F	8493279	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	2.515000	0.45512	2.078000	0.62432	0.528000	0.53228	ATT	.	.		0.612	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
HSPB6	126393	hgsc.bcm.edu	37	19	36247733	36247733	+	Silent	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr19:36247733G>A	ENST00000592984.1	-	2	373	c.177C>T	c.(175-177)agC>agT	p.S59S	C19orf55_ENST00000421853.2_5'Flank|C19orf55_ENST00000544099.1_5'Flank|HSPB6_ENST00000587965.1_Silent_p.S59S|AC002398.12_ENST00000587767.1_RNA|C19orf55_ENST00000396908.4_5'Flank|HSPB6_ENST00000004982.3_Silent_p.S59S|C19orf55_ENST00000537459.1_5'Flank|C19orf55_ENST00000536950.1_5'Flank			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6	59					regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCAGCGCCACGCTGGGTGCGC	0.706																																					p.S59S		Atlas-SNP	.											.	HSPB6	1	.	0			c.C177T						.						2.0	3.0	3.0					19																	36247733		1456	2735	4191	SO:0001819	synonymous_variant	126393	exon1			CGCCACGCTGGGT	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122	ENST00000592984.1:c.177C>T	chr19.hg19:g.36247733G>A		73.0	0.0		79.0	5.0	NM_144617	O14551|Q6NVI3|Q96MG9	Silent	SNP	ENST00000592984.1	hg19	CCDS12475.1																																																																																			.	.		0.706	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109498.3	NM_144617	
PSMD8	5714	hgsc.bcm.edu	37	19	38867017	38867017	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr19:38867017A>T	ENST00000215071.4	+	3	525	c.459A>T	c.(457-459)caA>caT	p.Q153H	PSMD8_ENST00000592035.1_De_novo_Start_OutOfFrame|PSMD8_ENST00000602911.1_Missense_Mutation_p.Q90H	NM_002812.4	NP_002803.2	P48556	PSMD8_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	153					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(1)	6	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCGGGGCCCAATGGAGCATCC	0.557																																					p.Q153H		Atlas-SNP	.											.	PSMD8	31	.	0			c.A459T						.						55.0	46.0	49.0					19																	38867017		2162	4217	6379	SO:0001583	missense	5714	exon3			GGCCCAATGGAGC	D38047	CCDS12515.2	19q13.2	2009-05-07			ENSG00000099341	ENSG00000099341		"""Proteasome (prosome, macropain) subunits"""	9566	protein-coding gene	gene with protein product						7621825	Standard	NM_002812		Approved	S14, Nin1p, p31, HIP6, HYPF, Rpn12	uc002oii.4	P48556	OTTHUMG00000150691	ENST00000215071.4:c.459A>T	chr19.hg19:g.38867017A>T	ENSP00000215071:p.Gln153His	125.0	0.0		93.0	43.0	NM_002812	B4DX18|Q6P1L7	Missense_Mutation	SNP	ENST00000215071.4	hg19	CCDS12515.2	.	.	.	.	.	.	.	.	.	.	A	14.73	2.624068	0.46840	.	.	ENSG00000099341	ENST00000215071	.	.	.	4.44	-0.413	0.12363	.	0.200805	0.43260	D	0.000593	T	0.47248	0.1435	M	0.70595	2.14	0.80722	D	1	B	0.31318	0.319	B	0.27608	0.081	T	0.29305	-1.0016	9	0.21014	T	0.42	-22.6106	8.1873	0.31346	0.3854:0.0:0.6146:0.0	.	153	P48556	PSMD8_HUMAN	H	153	.	ENSP00000215071:Q153H	Q	+	3	2	PSMD8	43558857	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.346000	0.44027	0.180000	0.19960	-0.546000	0.04227	CAA	.	.		0.557	PSMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319627.1	NM_002812	
PRKD2	25865	hgsc.bcm.edu	37	19	47200429	47200429	+	Silent	SNP	G	G	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr19:47200429G>A	ENST00000291281.4	-	9	1527	c.1302C>T	c.(1300-1302)acC>acT	p.T434T	PRKD2_ENST00000601806.1_Silent_p.T277T|PRKD2_ENST00000600194.1_Silent_p.T277T|PRKD2_ENST00000433867.1_Silent_p.T434T|PRKD2_ENST00000595515.1_Silent_p.T434T			Q9BZL6	KPCD2_HUMAN	protein kinase D2	434	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		AGTATCTGTTGGTCGTGTTGT	0.542																																					p.T434T		Atlas-SNP	.											.	PRKD2	94	.	0			c.C1302T						.						147.0	119.0	129.0					19																	47200429		2203	4300	6503	SO:0001819	synonymous_variant	25865	exon9			TCTGTTGGTCGTG	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1302C>T	chr19.hg19:g.47200429G>A		83.0	0.0		60.0	29.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	hg19	CCDS12689.1																																																																																			.	.		0.542	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
ZNF808	388558	hgsc.bcm.edu	37	19	53056997	53056997	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr19:53056997C>G	ENST00000359798.4	+	5	1008	c.828C>G	c.(826-828)tgC>tgG	p.C276W		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		ACCTTGCATGCCATCGTAGAT	0.403																																					p.C276W		Atlas-SNP	.											.	ZNF808	81	.	0			c.C828G						.						173.0	170.0	171.0					19																	53056997		2203	4300	6503	SO:0001583	missense	388558	exon5			TGCATGCCATCGT	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.828C>G	chr19.hg19:g.53056997C>G	ENSP00000352846:p.Cys276Trp	149.0	0.0		121.0	40.0	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	hg19	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	2.830	-0.242815	0.05906	.	.	ENSG00000198482	ENST00000359798	T	0.07444	3.19	1.53	-3.06	0.05379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03263	0.0095	N	0.04880	-0.145	0.21473	N	0.999674	B	0.19200	0.034	B	0.21546	0.035	T	0.40515	-0.9559	9	0.62326	D	0.03	.	0.5512	0.00662	0.3021:0.3162:0.1406:0.2411	.	276	Q8N4W9	ZN808_HUMAN	W	276	ENSP00000352846:C276W	ENSP00000352846:C276W	C	+	3	2	ZNF808	57748809	0.848000	0.29623	0.000000	0.03702	0.005000	0.04900	0.516000	0.22817	-1.723000	0.01375	0.298000	0.19748	TGC	.	.		0.403	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF83	55769	hgsc.bcm.edu	37	19	53117612	53117612	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr19:53117612T>G	ENST00000597597.1	-	2	2459	c.206A>C	c.(205-207)cAt>cCt	p.H69P	ZNF83_ENST00000301096.3_Missense_Mutation_p.H69P|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000536937.1_Missense_Mutation_p.H69P|ZNF83_ENST00000541777.2_Missense_Mutation_p.H69P|ZNF83_ENST00000545872.1_Missense_Mutation_p.H69P|ZNF83_ENST00000391789.4_Missense_Mutation_p.H69P|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000544146.1_Missense_Mutation_p.H69P			P51522	ZNF83_HUMAN	zinc finger protein 83	69					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TTCATATGTATGAGAAATGTG	0.348																																					p.H69P		Atlas-SNP	.											.	ZNF83	73	.	0			c.A206C						.						74.0	76.0	76.0					19																	53117612		2203	4300	6503	SO:0001583	missense	55769	exon3			TATGTATGAGAAA	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.206A>C	chr19.hg19:g.53117612T>G	ENSP00000472619:p.His69Pro	137.0	0.0		137.0	54.0	NM_018300	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	hg19	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	t	8.428	0.847877	0.17034	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.08720	3.07;3.07;3.07;3.07;3.07;3.06	1.87	1.87	0.25490	.	.	.	.	.	T	0.07234	0.0183	L	0.41079	1.255	0.09310	N	1	P;D	0.54601	0.908;0.967	B;B	0.40329	0.211;0.326	T	0.31696	-0.9934	9	0.52906	T	0.07	.	7.4344	0.27148	0.0:0.0:0.0:1.0	.	69;69	P51522-2;P51522	.;ZNF83_HUMAN	P	69	ENSP00000445993:H69P;ENSP00000301096:H69P;ENSP00000445470:H69P;ENSP00000440713:H69P;ENSP00000439681:H69P;ENSP00000375666:H69P	ENSP00000301096:H69P	H	-	2	0	ZNF83	57809424	0.011000	0.17503	0.011000	0.14972	0.049000	0.14656	2.251000	0.43187	1.099000	0.41499	0.482000	0.46254	CAT	.	.		0.348	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
CENPB	1059	hgsc.bcm.edu	37	20	3765921	3765921	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr20:3765921C>G	ENST00000379751.4	-	1	1416	c.1210G>C	c.(1210-1212)Gag>Cag	p.E404Q	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	404	Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						tcctctccctcACTCTTGAGG	0.617																																					p.E404Q		Atlas-SNP	.											.	CENPB	24	.	0			c.G1210C						.						35.0	30.0	32.0					20																	3765921		2203	4299	6502	SO:0001583	missense	1059	exon1			CTCCCTCACTCTT	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1210G>C	chr20.hg19:g.3765921C>G	ENSP00000369075:p.Glu404Gln	47.0	0.0		34.0	12.0	NM_001810	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	hg19	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	c	12.59	1.983988	0.35036	.	.	ENSG00000125817	ENST00000379751	T	0.07444	3.19	4.47	4.47	0.54385	.	.	.	.	.	T	0.07234	0.0183	N	0.14661	0.345	0.27748	N	0.944252	P	0.51057	0.941	P	0.46389	0.515	T	0.27468	-1.0073	9	0.19590	T	0.45	-3.4795	12.6378	0.56692	0.0:1.0:0.0:0.0	.	404	P07199	CENPB_HUMAN	Q	404	ENSP00000369075:E404Q	ENSP00000369075:E404Q	E	-	1	0	CENPB	3713921	0.923000	0.31300	0.998000	0.56505	0.883000	0.51084	1.661000	0.37408	2.019000	0.59389	0.550000	0.68814	GAG	.	.		0.617	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
MKKS	8195	hgsc.bcm.edu	37	20	10393869	10393869	+	Silent	SNP	A	A	C			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr20:10393869A>C	ENST00000347364.3	-	3	1056	c.294T>G	c.(292-294)ctT>ctG	p.L98L	MKKS_ENST00000399054.2_Silent_p.L98L	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	98					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						GGTTGCAGCAAAGAATAGCTG	0.393																																					p.L98L	Melanoma(79;1979 2212 6640)	Atlas-SNP	.											.	MKKS	35	.	0			c.T294G						.						123.0	113.0	116.0					20																	10393869		2203	4300	6503	SO:0001819	synonymous_variant	8195	exon3			GCAGCAAAGAATA	AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.294T>G	chr20.hg19:g.10393869A>C		113.0	0.0		84.0	30.0	NM_170784	A8K7B0|D3DW18	Silent	SNP	ENST00000347364.3	hg19	CCDS13111.1																																																																																			.	.		0.393	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3		
NCOA6	23054	hgsc.bcm.edu	37	20	33345769	33345769	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr20:33345769T>A	ENST00000374796.2	-	8	3352	c.782A>T	c.(781-783)cAg>cTg	p.Q261L	NCOA6_ENST00000359003.2_Missense_Mutation_p.Q261L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	261	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ctgctgctgctgcagctgGGG	0.527																																					p.Q261L		Atlas-SNP	.											.	NCOA6	219	.	0			c.A782T						.						56.0	51.0	53.0					20																	33345769		2203	4300	6503	SO:0001583	missense	23054	exon7			TGCTGCTGCAGCT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.782A>T	chr20.hg19:g.33345769T>A	ENSP00000363929:p.Gln261Leu	71.0	0.0		78.0	4.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.153279	0.38021	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	T;T	0.33654	1.4;1.4	5.11	3.94	0.45596	.	.	.	.	.	T	0.26412	0.0645	L	0.27053	0.805	0.47659	D	0.999484	B;B	0.18741	0.003;0.03	B;B	0.17722	0.005;0.019	T	0.08207	-1.0733	9	0.49607	T	0.09	-2.628	11.6071	0.51039	0.0:0.0:0.1488:0.8512	.	261;261	F6M2K2;Q14686	.;NCOA6_HUMAN	L	261;261;218	ENSP00000363929:Q261L;ENSP00000351894:Q261L	ENSP00000351894:Q261L	Q	-	2	0	NCOA6	32809430	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.842000	0.48230	1.930000	0.55929	0.383000	0.25322	CAG	.	.		0.527	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
TBC1D10A	83874	hgsc.bcm.edu	37	22	30690978	30690978	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr22:30690978C>A	ENST00000215790.7	-	5	755	c.591G>T	c.(589-591)caG>caT	p.Q197H	TBC1D10A_ENST00000403477.3_Missense_Mutation_p.Q204H|RP1-130H16.18_ENST00000447976.1_Missense_Mutation_p.Q71H|TBC1D10A_ENST00000403362.1_Missense_Mutation_p.Q109H	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	197	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.	Glutamine finger. {ECO:0000250}.			activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						GCGCCTGGGCCTGGCAGTAGC	0.677																																					p.Q204H		Atlas-SNP	.											.	TBC1D10A	49	.	0			c.G612T						.						66.0	68.0	67.0					22																	30690978		2203	4300	6503	SO:0001583	missense	83874	exon5			CTGGGCCTGGCAG	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.591G>T	chr22.hg19:g.30690978C>A	ENSP00000215790:p.Gln197His	102.0	0.0		103.0	24.0	NM_001204240	B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	hg19	CCDS13874.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844758	0.71603	.	.	ENSG00000248751;ENSG00000099992;ENSG00000099992;ENSG00000099992;ENSG00000099992	ENST00000434291;ENST00000215790;ENST00000403477;ENST00000403362;ENST00000393906	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	4.33	2.25	0.28309	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.56804	0.2010	H	0.98256	4.185	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.998;0.999	T	0.61667	-0.7016	10	0.87932	D	0	.	7.2311	0.26043	0.0:0.7203:0.0:0.2797	.	197;204;197;197	Q20WK7;B3KXT8;Q9BXI6;A7E244	.;.;TB10A_HUMAN;.	H	71;197;204;109;109	ENSP00000401535:Q71H;ENSP00000215790:Q197H;ENSP00000384996:Q204H;ENSP00000385050:Q109H;ENSP00000377484:Q109H	ENSP00000331267:Q58H	Q	-	3	2	TBC1D10A;RP1-130H16.18	29020978	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.188000	0.50958	0.588000	0.29660	0.561000	0.74099	CAG	.	.		0.677	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937	
HMOX1	3162	hgsc.bcm.edu	37	22	35782898	35782898	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr22:35782898G>T	ENST00000216117.8	+	3	704	c.365G>T	c.(364-366)gGg>gTg	p.G122V		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	122					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	CACGAGGTGGGGCGCACAGAG	0.657																																					p.G122V		Atlas-SNP	.											.	HMOX1	32	.	0			c.G365T						.						40.0	45.0	43.0					22																	35782898		2203	4300	6503	SO:0001583	missense	3162	exon3			AGGTGGGGCGCAC		CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.365G>T	chr22.hg19:g.35782898G>T	ENSP00000216117:p.Gly122Val	95.0	0.0		77.0	7.0	NM_002133		Missense_Mutation	SNP	ENST00000216117.8	hg19	CCDS13914.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368475	0.61513	.	.	ENSG00000100292	ENST00000412893;ENST00000216117	T;T	0.22134	1.97;1.97	5.8	4.78	0.61160	Haem oxygenase-like, multi-helical (2);	0.000000	0.85682	D	0.000000	T	0.47116	0.1428	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52049	-0.8627	10	0.87932	D	0	-59.5041	16.231	0.82343	0.0:0.0:0.8659:0.1341	.	122	P09601	HMOX1_HUMAN	V	122	ENSP00000413316:G122V;ENSP00000216117:G122V	ENSP00000216117:G122V	G	+	2	0	HMOX1	34112898	1.000000	0.71417	0.991000	0.47740	0.138000	0.21146	9.746000	0.98859	1.448000	0.47680	-0.181000	0.13052	GGG	.	.		0.657	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320657.1		
TOB2	10766	hgsc.bcm.edu	37	22	41833266	41833266	+	Silent	SNP	A	A	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr22:41833266A>G	ENST00000327492.3	-	2	790	c.84T>C	c.(82-84)ttT>ttC	p.F28F		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	28					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						GCTCCTCCCCAAACAGGTCTG	0.537																																					p.F28F		Atlas-SNP	.											.	TOB2	30	.	0			c.T84C						.						35.0	39.0	38.0					22																	41833266		2203	4300	6503	SO:0001819	synonymous_variant	10766	exon2			CTCCCCAAACAGG	D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.84T>C	chr22.hg19:g.41833266A>G		110.0	0.0		51.0	20.0	NM_016272	Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Silent	SNP	ENST00000327492.3	hg19	CCDS14015.1																																																																																			.	.		0.537	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320699.1	NM_016272	
MXRA5	25878	hgsc.bcm.edu	37	X	3240425	3240425	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chrX:3240425C>T	ENST00000217939.6	-	5	3455	c.3301G>A	c.(3301-3303)Ggt>Agt	p.G1101S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1101						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTCATTATACCCAGTGTGGAG	0.498																																					p.G1101S		Atlas-SNP	.											.	MXRA5	815	.	0			c.G3301A						.						122.0	96.0	105.0					X																	3240425		2203	4300	6503	SO:0001583	missense	25878	exon5			TTATACCCAGTGT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3301G>A	chrX.hg19:g.3240425C>T	ENSP00000217939:p.Gly1101Ser	82.0	0.0		60.0	4.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	hg19	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	c	1.681	-0.506384	0.04231	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.61627	0.09	2.85	0.366	0.16136	.	1.602580	0.04155	N	0.322097	T	0.37892	0.1020	N	0.19112	0.55	0.09310	N	1	B	0.28026	0.198	B	0.22386	0.039	T	0.14811	-1.0459	10	0.15499	T	0.54	.	5.5411	0.17038	0.0:0.4703:0.0:0.5297	.	1101	Q9NR99	MXRA5_HUMAN	S	1101	ENSP00000217939:G1101S	ENSP00000217939:G1101S	G	-	1	0	MXRA5	3250425	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.788000	0.04614	0.242000	0.21303	0.519000	0.50382	GGT	.	.		0.498	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
THOC2	57187	hgsc.bcm.edu	37	X	122772802	122772802	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chrX:122772802T>G	ENST00000245838.8	-	17	1854	c.1823A>C	c.(1822-1824)aAt>aCt	p.N608T	THOC2_ENST00000355725.4_Missense_Mutation_p.N608T|THOC2_ENST00000491737.1_Missense_Mutation_p.N493T	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	608					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GACATCATAATTCAGTGAAGT	0.299																																					p.N608T		Atlas-SNP	.											.	THOC2	310	.	0			c.A1823C						.						205.0	190.0	195.0					X																	122772802		1839	4079	5918	SO:0001583	missense	57187	exon17			TCATAATTCAGTG	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.1823A>C	chrX.hg19:g.122772802T>G	ENSP00000245838:p.Asn608Thr	192.0	0.0		147.0	113.0	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	hg19	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.947656	0.34377	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.74	5.74	0.90152	THO complex, subunitTHOC2, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.26122	0.0637	N	0.01048	-1.04	0.54753	D	0.99998	B;B	0.21452	0.03;0.056	B;B	0.23275	0.045;0.038	T	0.16837	-1.0389	9	0.31617	T	0.26	-20.6516	15.049	0.71850	0.0:0.0:0.0:1.0	.	533;608	B4DKZ6;Q8NI27	.;THOC2_HUMAN	T	608;608;493;533	.	ENSP00000245838:N608T	N	-	2	0	THOC2	122600483	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.033000	0.64146	1.936000	0.56123	0.439000	0.28862	AAT	.	.		0.299	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
SAR1B	51128	hgsc.bcm.edu	37	5	133942642	133942642	+	Stop_Codon_Del	DEL	A	A	-			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr5:133942642delA	ENST00000402673.2	-	0	873				SAR1B_ENST00000507419.1_Stop_Codon_Del|SAR1B_ENST00000509937.1_Stop_Codon_Del|SAR1B_ENST00000439578.1_Stop_Codon_Del|SAR1B_ENST00000502539.1_Stop_Codon_Del	NM_016103.3	NP_057187.1	Q9Y6B6	SAR1B_HUMAN	secretion associated, Ras related GTPase 1B						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|GTP catabolic process (GO:0006184)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			kidney(2)|lung(2)|urinary_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGTTTGTGTTAATCAATGTAC	0.423																																					p.X199Y		Atlas-INDEL	.											.	SAR1B	19	.	0			c.596delA						.						165.0	153.0	157.0					5																	133942642		2203	4300	6503	SO:0001567	stop_retained_variant	51128	exon8			.	AF092130	CCDS4177.1	5q31.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000152700	ENSG00000152700			10535	protein-coding gene	gene with protein product		607690	"""SAR1a gene homolog (S. cerevisiae) 2"", ""SAR1a gene homolog 2 (S. cerevisiae)"", ""SAR1 homolog B (S. cerevisiae)"""	SARA2			Standard	NM_001033503		Approved		uc003kzr.3	Q9Y6B6	OTTHUMG00000129114	Exception_encountered	chr5.hg19:g.133942642delA	Exception_encountered	114.0	0.0		96.0	45.0	NM_001033503	D3DQA4|Q567T4	Frame_Shift_Del	DEL	ENST00000402673.2	hg19	CCDS4177.1																																																																																			.	.		0.423	SAR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251158.2	NM_016103	
EGFR	1956	hgsc.bcm.edu	37	7	55248998	55248999	+	In_Frame_Ins	INS	-	-	TGGCCAGCG			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr7:55248998_55248999insTGGCCAGCG	ENST00000275493.2	+	20	2473_2474	c.2296_2297insTGGCCAGCG	c.(2296-2298)atg>aTGGCCAGCGtg	p.769_770insASV	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_In_Frame_Ins_p.716_717insASV|EGFR_ENST00000455089.1_In_Frame_Ins_p.724_725insASV	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> M (found in a lung cancer sample; dbSNP:rs147149347). {ECO:0000269|PubMed:15623594}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.M766T(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AGCCTACGTGATGGCCAGCGTG	0.644		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.M766delinsMASV		Atlas-INDEL	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,caecum,carcinoma,0,1	EGFR	20426	.	1	Substitution - Missense(1)	lung(1)	c.2296_2297insTGGCCAGCG						.																																			SO:0001652	inframe_insertion	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	.		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2297_2305dupTGGCCAGCG	chr7.hg19:g.55248999_55249007dupTGGCCAGCG	ENSP00000275493:p.Ala767_Val769dup	105.0	0.0		81.0	14.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	In_Frame_Ins	INS	ENST00000275493.2	hg19	CCDS5514.1																																																																																			.	.		0.644	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
FOXN2	3344	hgsc.bcm.edu	37	2	48602157	48602167	+	Frame_Shift_Del	DEL	TCTTTAGCCAC	TCTTTAGCCAC	-	rs368599437		TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	TCTTTAGCCAC	TCTTTAGCCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr2:48602157_48602167delTCTTTAGCCAC	ENST00000340553.3	+	7	1132_1142	c.871_881delTCTTTAGCCAC	c.(871-882)tctttagccaccfs	p.SLAT291fs		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	291					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			AGAGAGTGATTCTTTAGCCACCAGCATTGAT	0.45																																					p.290_294del		Atlas-INDEL	.											.	FOXN2	39	.	0			c.870_880del						.																																			SO:0001589	frameshift_variant	3344	exon7			.		CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.871_881delTCTTTAGCCAC	chr2.hg19:g.48602157_48602167delTCTTTAGCCAC	ENSP00000343633:p.Ser291fs	154.0	0.0		116.0	39.0	NM_002158	Q15769|Q6P4Q2	Frame_Shift_Del	DEL	ENST00000340553.3	hg19	CCDS1838.1																																																																																			.	.		0.450	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251240.3	NM_002158	
CABIN1	23523	hgsc.bcm.edu	37	22	24515513	24515539	+	In_Frame_Del	DEL	CCCCAGGGGCTGCCGGCTGGTGCTGAG	CCCCAGGGGCTGCCGGCTGGTGCTGAG	-	rs200130091|rs200593206	byFrequency	TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	CCCCAGGGGCTGCCGGCTGGTGCTGAG	CCCCAGGGGCTGCCGGCTGGTGCTGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr22:24515513_24515539delCCCCAGGGGCTGCCGGCTGGTGCTGAG	ENST00000398319.2	+	28	4865_4891	c.4480_4506delCCCCAGGGGCTGCCGGCTGGTGCTGAG	c.(4480-4506)ccccaggggctgccggctggtgctgagdel	p.PQGLPAGAE1494del	CABIN1_ENST00000405822.2_In_Frame_Del_p.PQGLPAGAE1415del|CABIN1_ENST00000263119.5_In_Frame_Del_p.PQGLPAGAE1494del	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1494					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.P1498Q(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AGTGGCCTTCCCCCAGGGGCTGCCGGCTGGTGCTGAGGAGCAGCGGC	0.648																																					p.1493_1502del		Atlas-INDEL	.											.	CABIN1	153	.	1	Substitution - Missense(1)	lung(1)	c.4479_4505del						.																																			SO:0001651	inframe_deletion	23523	exon28			.	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4480_4506delCCCCAGGGGCTGCCGGCTGGTGCTGAG	chr22.hg19:g.24515513_24515539delCCCCAGGGGCTGCCGGCTGGTGCTGAG	ENSP00000381364:p.Pro1494_Glu1502del	91.0	0.0		62.0	12.0	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	In_Frame_Del	DEL	ENST00000398319.2	hg19	CCDS13823.1																																																																																			.	.		0.648	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
SOCS3	9021	hgsc.bcm.edu	37	17	76354878	76354878	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr17:76354878delC	ENST00000330871.2	-	2	714	c.299delG	c.(298-300)ggcfs	p.G100fs	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	100	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			AGAGAAGCTGCCCCCCTCACA	0.647																																					p.G100fs		Atlas-INDEL	.											.	SOCS3	16	.	0			c.300delC						.						37.0	36.0	36.0					17																	76354878		2202	4300	6502	SO:0001589	frameshift_variant	9021	exon2			.	AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.299delG	chr17.hg19:g.76354878delC	ENSP00000330341:p.Gly100fs	118.0	0.0		109.0	37.0	NM_003955	O14509	Frame_Shift_Del	DEL	ENST00000330871.2	hg19	CCDS11756.1																																																																																			.	.		0.647	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437300.1		
MACF1	23499	hgsc.bcm.edu	37	1	39824861	39824862	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr1:39824861_39824862insA	ENST00000372915.3	+	46	12271_12272	c.12184_12185insA	c.(12184-12186)caafs	p.Q4062fs	MACF1_ENST00000317713.7_Frame_Shift_Ins_p.Q1995fs|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Frame_Shift_Ins_p.Q1995fs|MACF1_ENST00000539005.1_Frame_Shift_Ins_p.Q1995fs|MACF1_ENST00000567887.1_Frame_Shift_Ins_p.Q4094fs|MACF1_ENST00000361689.2_Frame_Shift_Ins_p.Q1995fs|MACF1_ENST00000289893.4_Frame_Shift_Ins_p.Q2497fs|MACF1_ENST00000564288.1_Frame_Shift_Ins_p.Q4057fs			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4062					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGAAAAACTCCAAAAAGTAGCT	0.411																																					p.Q1995fs		Atlas-INDEL	.											.	MACF1	909	.	0			c.5983_5984insA						.																																			SO:0001589	frameshift_variant	23499	exon43			.	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12189dupA	chr1.hg19:g.39824866_39824866dupA	ENSP00000362006:p.Gln4062fs	484.0	0.0		399.0	51.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Ins	INS	ENST00000372915.3	hg19																																																																																				.	.		0.411	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
RFTN1	23180	hgsc.bcm.edu	37	3	16368341	16368341	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACY-01A-11D-A40R-10	TCGA-DD-AACY-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b7cb238c-7b7f-41e9-acc4-2173a66c4f20	96563036-f486-49db-9442-d334ebc044a9	g.chr3:16368341delG	ENST00000334133.4	-	8	1461	c.1189delC	c.(1189-1191)ctgfs	p.L397fs	OXNAD1_ENST00000605932.1_Intron|OXNAD1_ENST00000544043.1_Intron|RFTN1_ENST00000483671.1_5'UTR|RFTN1_ENST00000432519.1_Frame_Shift_Del_p.L361fs|OXNAD1_ENST00000435829.2_Intron|OXNAD1_ENST00000606098.1_Intron	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	397					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						TAGGCCGCCAGCGAGTTCAGC	0.542																																					p.L397fs		Atlas-INDEL	.											.	RFTN1	79	.	0			c.1190delT						.						54.0	46.0	49.0					3																	16368341		2203	4300	6503	SO:0001589	frameshift_variant	23180	exon8			.	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.1189delC	chr3.hg19:g.16368341delG	ENSP00000334153:p.Leu397fs	47.0	0.0		28.0	17.0	NM_015150	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Frame_Shift_Del	DEL	ENST00000334133.4	hg19	CCDS33712.1																																																																																			.	.		0.542	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
