#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MST1L	11223	hgsc.bcm.edu	37	1	17085380	17085380	+	RNA	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:17085380G>T	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCCCATCTGGGTCTGGCAGAA	0.587																																					p.D437E		Atlas-SNP	.											.	.	.	.	0			c.C1311A						.																																					11223	exon10			ATCTGGGTCTGGC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		chr1.hg19:g.17085380G>T		235.0	0.0		315.0	26.0	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.969|8.969	0.972437|0.972437	0.18736|0.18736	.|.	.|.	ENSG00000186715|ENSG00000186715	ENST00000389184|ENST00000334998;ENST00000442552	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.000000	.|0.45867	.|D	.|0.000339	.|T	.|0.25827	.|0.0629	.|.	.|.	.|.	.|.	.|.	.|.	.|B	.|0.14805	.|0.011	.|B	.|0.08055	.|0.003	.|T	.|0.14839	.|-1.0458	.|5	.|.	.|.	.|.	.|.	5.8178|5.8178	0.18506|0.18506	0.001:0.0:0.999:0.0|0.001:0.0:0.999:0.0	.|.	.|437	.|Q2TV78-2	.|.	.|E	-1|437	.|.	.|.	.|D	-|-	.|3	.|2	MST1P9|MST1P9	16957967|16957967	1.000000|1.000000	0.71417|0.71417	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	3.161000|3.161000	0.50747|0.50747	-0.000000|-0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	.|GAC	.	.		0.587	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
MFAP2	4237	hgsc.bcm.edu	37	1	17303683	17303683	+	Silent	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:17303683C>A	ENST00000375535.3	-	3	337	c.48G>T	c.(46-48)ctG>ctT	p.L16L	MFAP2_ENST00000375534.3_Silent_p.L15L|MFAP2_ENST00000490075.1_5'UTR|RP1-37C10.3_ENST00000446261.1_RNA|MFAP2_ENST00000438542.1_Silent_p.L15L			P55001	MFAP2_HUMAN	microfibrillar-associated protein 2	16					extracellular matrix organization (GO:0030198)|platelet formation (GO:0030220)	extracellular region (GO:0005576)|microfibril (GO:0001527)				kidney(1)|lung(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGCCCTGAGCCAGCAAGCCTG	0.657																																					p.L16L		Atlas-SNP	.											.	MFAP2	8	.	0			c.G48T						.						29.0	26.0	27.0					1																	17303683		2202	4299	6501	SO:0001819	synonymous_variant	4237	exon3			CTGAGCCAGCAAG	BC015039	CCDS174.1, CCDS44071.1	1p36.1-p35	2008-02-05			ENSG00000117122	ENSG00000117122			7033	protein-coding gene	gene with protein product		156790				7759096	Standard	NM_017459		Approved	MAGP, MAGP-1	uc001azw.3	P55001	OTTHUMG00000002290	ENST00000375535.3:c.48G>T	chr1.hg19:g.17303683C>A		100.0	0.0		129.0	55.0	NM_017459	Q53X60|Q5JXY0	Silent	SNP	ENST00000375535.3	hg19	CCDS174.1																																																																																			.	.		0.657	MFAP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006609.1	NM_002403	
MINOS1	440574	hgsc.bcm.edu	37	1	19950009	19950009	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:19950009G>T	ENST00000322753.6	+	3	210	c.154G>T	c.(154-156)Gga>Tga	p.G52*	MINOS1-NBL1_ENST00000602662.1_Intron|MINOS1_ENST00000486890.1_3'UTR	NM_001032363.3|NM_001204082.1|NM_001204083.1	NP_001027535.1|NP_001191011.1|NP_001191012.1	Q5TGZ0	MIC10_HUMAN	mitochondrial inner membrane organizing system 1	52						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)											CATGGGATTAGGAATGGCTTA	0.388																																					p.G52X		Atlas-SNP	.											.	.	.	.	0			c.G154T						.						173.0	171.0	172.0					1																	19950009		2203	4300	6503	SO:0001587	stop_gained	440574	exon3			GGATTAGGAATGG	AK094318	CCDS30620.1, CCDS72719.1	1p36.13	2013-10-11	2011-10-04	2011-10-04	ENSG00000173436	ENSG00000173436			32068	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 151"""	C1orf151		21944719	Standard	NM_001032363		Approved	RP5-1056L3.2, FLJ36999, MIO10	uc021ohu.1	Q5TGZ0	OTTHUMG00000002712	ENST00000322753.6:c.154G>T	chr1.hg19:g.19950009G>T	ENSP00000325562:p.Gly52*	52.0	0.0		46.0	11.0	NM_001032363	Q96G68	Nonsense_Mutation	SNP	ENST00000322753.6	hg19	CCDS30620.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693479	0.68386	.	.	ENSG00000173436	ENST00000322753	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.6774	16.655	0.85226	0.0:0.0:1.0:0.0	.	.	.	.	X	52	.	ENSP00000325562:G52X	G	+	1	0	C1orf151	19822596	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	7.593000	0.82686	2.715000	0.92844	0.655000	0.94253	GGA	.	.		0.388	MINOS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007697.2	NM_001032363	
ZBTB40	9923	hgsc.bcm.edu	37	1	22837792	22837792	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:22837792A>T	ENST00000375647.4	+	10	2161	c.1954A>T	c.(1954-1956)Aaa>Taa	p.K652*	ZBTB40_ENST00000404138.1_Nonsense_Mutation_p.K652*|ZBTB40_ENST00000374651.4_Nonsense_Mutation_p.K540*	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	652					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CAGTGTCCACAAATCTTTTCC	0.547																																					p.K652X		Atlas-SNP	.											.	ZBTB40	87	.	0			c.A1954T						.						62.0	64.0	63.0					1																	22837792		2203	4300	6503	SO:0001587	stop_gained	9923	exon11			GTCCACAAATCTT	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.1954A>T	chr1.hg19:g.22837792A>T	ENSP00000364798:p.Lys652*	107.0	0.0		116.0	23.0	NM_001083621	O75066|Q5TFU5|Q8N1R1	Nonsense_Mutation	SNP	ENST00000375647.4	hg19	CCDS224.1	.	.	.	.	.	.	.	.	.	.	A	42	9.641536	0.99227	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	.	.	.	5.97	-0.807	0.10872	.	1.064270	0.07352	N	0.882639	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9724	4.5689	0.12200	0.3072:0.355:0.3378:0.0	.	.	.	.	X	652;652;540	.	ENSP00000363782:K540X	K	+	1	0	ZBTB40	22710379	0.000000	0.05858	0.031000	0.17742	0.930000	0.56654	0.330000	0.19715	-0.091000	0.12440	0.533000	0.62120	AAA	.	.		0.547	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
RUNX3	864	hgsc.bcm.edu	37	1	25229122	25229123	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:25229122_25229123GG>TT	ENST00000308873.6	-	5	746_747	c.738_739CC>AA	c.(736-741)cgCCag>cgAAag	p.Q247K	RUNX3_ENST00000540420.1_Missense_Mutation_p.Q154K|RUNX3_ENST00000496967.1_5'UTR|RUNX3_ENST00000338888.3_Missense_Mutation_p.Q261K|RUNX3_ENST00000399916.1_Missense_Mutation_p.Q261K	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	247	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		CGGTCAAACTGGCGGGGGTCGG	0.619																																					p.Q261K|p.R260R		Atlas-SNP	.											.	RUNX3	72	.	0			c.C781A|c.C780A						.																																			SO:0001583	missense	864	exon6			CAAACTGGCGGGG|AAACTGGCGGGGG	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.738_739delinsTT	chr1.hg19:g.25229122_25229123delinsTT	ENSP00000308051:p.Gln247Lys	131.0	0.0		154.0|153.0	58.0	NM_001031680	B1AJV5|Q12969|Q13760	Missense_Mutation|Silent	SNP	ENST00000308873.6	hg19	CCDS257.1																																																																																			.	.		0.619	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
USP24	23358	hgsc.bcm.edu	37	1	55609866	55609866	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:55609866T>A	ENST00000294383.6	-	21	2372	c.2373A>T	c.(2371-2373)ttA>ttT	p.L791F	USP24_ENST00000407756.1_Missense_Mutation_p.L631F	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	791					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AAGTTTTAAATAAGTTAAAAC	0.303																																					p.L791F		Atlas-SNP	.											.	USP24	323	.	0			c.A2373T						.						48.0	41.0	43.0					1																	55609866		1800	4061	5861	SO:0001583	missense	23358	exon21			TTTAAATAAGTTA	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2373A>T	chr1.hg19:g.55609866T>A	ENSP00000294383:p.Leu791Phe	262.0	0.0		326.0	117.0	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	hg19	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	T	19.08	3.757440	0.69648	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.03524	3.9;3.9	5.25	4.12	0.48240	.	0.138749	0.48767	D	0.000169	T	0.06050	0.0157	L	0.29908	0.895	0.45354	D	0.998349	D	0.61080	0.989	P	0.53912	0.737	T	0.49031	-0.8981	10	0.38643	T	0.18	.	9.4055	0.38460	0.0:0.1443:0.0:0.8557	.	631	B7WPF4	.	F	791;631	ENSP00000294383:L791F;ENSP00000385700:L631F	ENSP00000294383:L791F	L	-	3	2	USP24	55382454	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.678000	0.25277	1.115000	0.41800	0.482000	0.46254	TTA	.	.		0.303	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
KANK4	163782	hgsc.bcm.edu	37	1	62734068	62734068	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:62734068T>A	ENST00000371153.4	-	5	2500	c.2122A>T	c.(2122-2124)Aaa>Taa	p.K708*	KANK4_ENST00000354381.3_Nonsense_Mutation_p.K80*|KANK4_ENST00000371150.1_Nonsense_Mutation_p.K64*	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	708						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TGGGCATCTTTGACATGCTTG	0.607																																					p.K708X		Atlas-SNP	.											.	KANK4	135	.	0			c.A2122T						.						98.0	78.0	85.0					1																	62734068		2203	4300	6503	SO:0001587	stop_gained	163782	exon5			CATCTTTGACATG	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2122A>T	chr1.hg19:g.62734068T>A	ENSP00000360195:p.Lys708*	45.0	0.0		50.0	18.0	NM_181712	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Nonsense_Mutation	SNP	ENST00000371153.4	hg19	CCDS620.1	.	.	.	.	.	.	.	.	.	.	T	46	12.717165	0.99690	.	.	ENSG00000132854	ENST00000371153;ENST00000354381;ENST00000371150	.	.	.	6.17	3.77	0.43336	.	0.355289	0.20622	N	0.088754	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-9.5482	4.9508	0.14013	0.0:0.1572:0.2486:0.5942	.	.	.	.	X	708;80;64	.	ENSP00000346352:K80X	K	-	1	0	KANK4	62506656	0.002000	0.14202	0.018000	0.16275	0.004000	0.04260	0.484000	0.22308	1.166000	0.42689	0.533000	0.62120	AAA	.	.		0.607	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
HFM1	164045	hgsc.bcm.edu	37	1	91784922	91784922	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:91784922T>C	ENST00000370425.3	-	24	2706	c.2608A>G	c.(2608-2610)Att>Gtt	p.I870V	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Missense_Mutation_p.I549V|HFM1_ENST00000294696.5_Missense_Mutation_p.I102V	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	870	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TGTATGGGAATGCATCCTAGT	0.368																																					p.I870V		Atlas-SNP	.											.	HFM1	188	.	0			c.A2608G						.						103.0	99.0	100.0					1																	91784922		2203	4300	6503	SO:0001583	missense	164045	exon24			TGGGAATGCATCC	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2608A>G	chr1.hg19:g.91784922T>C	ENSP00000359454:p.Ile870Val	178.0	0.0		228.0	56.0	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	hg19	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	T	6.455	0.452153	0.12283	.	.	ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	T;T;T	0.60672	0.17;0.17;0.17	5.0	3.79	0.43588	Sec63 domain (2);	0.112576	0.64402	D	0.000016	T	0.40448	0.1117	L	0.35854	1.095	0.34524	D	0.70844	B;P;B	0.46987	0.102;0.888;0.412	B;P;B	0.50934	0.03;0.654;0.179	T	0.39440	-0.9614	10	0.39692	T	0.17	.	8.2439	0.31675	0.13:0.0:0.1348:0.7352	.	549;125;870	A6NGI5;B1B0B5;A2PYH4	.;.;HFM1_HUMAN	V	870;102;549;554	ENSP00000359454:I870V;ENSP00000294696:I102V;ENSP00000359453:I549V	ENSP00000294696:I102V	I	-	1	0	HFM1	91557510	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.165000	0.42396	1.996000	0.58369	0.528000	0.53228	ATT	.	.		0.368	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
SYCP1	6847	hgsc.bcm.edu	37	1	115527442	115527442	+	Missense_Mutation	SNP	T	T	A	rs200809568		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:115527442T>A	ENST00000369522.3	+	30	2896	c.2656T>A	c.(2656-2658)Ttt>Att	p.F886I	SYCP1_ENST00000369518.1_Missense_Mutation_p.F886I|SYCP1_ENST00000477590.1_Intron	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	886					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAAATGGCCTTTGAATTTGA	0.249																																					p.F886I		Atlas-SNP	.											.	SYCP1	149	.	0			c.T2656A						.						51.0	59.0	56.0					1																	115527442		2198	4274	6472	SO:0001583	missense	6847	exon30			ATGGCCTTTGAAT	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2656T>A	chr1.hg19:g.115527442T>A	ENSP00000358535:p.Phe886Ile	375.0	0.0		425.0	78.0	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461868	0.43736	.	.	ENSG00000198765	ENST00000369522;ENST00000369518	T;T	0.29917	1.55;1.55	5.55	5.55	0.83447	.	0.246616	0.43110	D	0.000617	T	0.13200	0.0320	L	0.50333	1.59	0.26949	N	0.966068	P;P	0.37525	0.598;0.598	B;B	0.37346	0.247;0.247	T	0.08764	-1.0706	10	0.30854	T	0.27	-6.9628	8.6033	0.33758	0.0:0.0862:0.0:0.9138	.	886;886	B7ZLS9;Q15431	.;SYCP1_HUMAN	I	886	ENSP00000358535:F886I;ENSP00000358531:F886I	ENSP00000358531:F886I	F	+	1	0	SYCP1	115328965	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	2.585000	0.46111	2.238000	0.73509	0.533000	0.62120	TTT	.	T|1.000;G|0.000		0.249	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
NHLH2	4808	hgsc.bcm.edu	37	1	116380919	116380919	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:116380919G>A	ENST00000369506.1	-	1	5619	c.75C>T	c.(73-75)ggC>ggT	p.G25G	NHLH2_ENST00000320238.3_Silent_p.G25G			Q02577	HEN2_HUMAN	nescient helix loop helix 2	25					cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|mating behavior (GO:0007617)|ovulation cycle (GO:0042698)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)			prostate(1)	1	Lung SC(450;0.184)	all_cancers(81;1.75e-06)|all_epithelial(167;1.16e-06)|all_lung(203;9.55e-06)|Lung NSC(69;5.83e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TGTCCGTGCCGCCCAGGGACT	0.687																																					p.G25G		Atlas-SNP	.											.	NHLH2	8	.	0			c.C75T						.						12.0	14.0	13.0					1																	116380919		2178	4269	6447	SO:0001819	synonymous_variant	4808	exon2			CGTGCCGCCCAGG		CCDS885.1	1p12-p11	2013-05-21			ENSG00000177551	ENSG00000177551		"""Basic helix-loop-helix proteins"""	7818	protein-coding gene	gene with protein product		162361		HEN2		1528853	Standard	NM_005599		Approved	NSCL2, bHLHa34	uc001efy.3	Q02577	OTTHUMG00000011969	ENST00000369506.1:c.75C>T	chr1.hg19:g.116380919G>A		78.0	0.0		121.0	39.0	NM_001111061	Q5T1P6	Silent	SNP	ENST00000369506.1	hg19	CCDS885.1																																																																																			.	.		0.687	NHLH2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033090.1	NM_005599	
OR10K1	391109	hgsc.bcm.edu	37	1	158435707	158435707	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:158435707G>T	ENST00000289451.2	+	1	436	c.356G>T	c.(355-357)gGc>gTc	p.G119V		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					GCAGCCATGGGCTATGATCGC	0.537																																					p.G119V		Atlas-SNP	.											.	OR10K1	80	.	0			c.G356T						.						180.0	176.0	178.0					1																	158435707		2203	4300	6503	SO:0001583	missense	391109	exon1			CCATGGGCTATGA	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.356G>T	chr1.hg19:g.158435707G>T	ENSP00000289451:p.Gly119Val	112.0	0.0		149.0	27.0	NM_001004473	Q6IFS2	Missense_Mutation	SNP	ENST00000289451.2	hg19	CCDS30897.1	.	.	.	.	.	.	.	.	.	.	g	14.65	2.598649	0.46318	.	.	ENSG00000173285	ENST00000289451	T	0.37411	1.2	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	D	0.000511	T	0.46367	0.1389	M	0.64404	1.975	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.48456	-0.9034	10	0.72032	D	0.01	.	11.1684	0.48556	0.0:0.3117:0.6883:0.0	.	119	Q8NGX5	O10K1_HUMAN	V	119	ENSP00000289451:G119V	ENSP00000289451:G119V	G	+	2	0	OR10K1	156702331	1.000000	0.71417	0.989000	0.46669	0.285000	0.27093	4.930000	0.63462	2.311000	0.77944	0.557000	0.71058	GGC	.	.		0.537	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1		
PTPN14	5784	hgsc.bcm.edu	37	1	214557127	214557127	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:214557127G>T	ENST00000366956.5	-	13	2265	c.2071C>A	c.(2071-2073)Cag>Aag	p.Q691K	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	691					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.Q691E(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TGGTGATACTGAGGGAGCTGG	0.632																																					p.Q691K	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											PTPN14,NS,carcinoma,0,1	PTPN14	168	.	1	Substitution - Missense(1)	lung(1)	c.C2071A						.						60.0	60.0	60.0					1																	214557127		2203	4300	6503	SO:0001583	missense	5784	exon13			GATACTGAGGGAG	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2071C>A	chr1.hg19:g.214557127G>T	ENSP00000355923:p.Gln691Lys	51.0	1.0		80.0	18.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	3.999	-0.002920	0.07773	.	.	ENSG00000152104	ENST00000366956	T	0.66460	-0.21	5.0	2.98	0.34508	.	0.712333	0.13864	N	0.357462	T	0.42787	0.1218	N	0.08118	0	0.09310	N	0.999998	B	0.13145	0.007	B	0.06405	0.002	T	0.21861	-1.0233	10	0.22109	T	0.4	.	9.4153	0.38517	0.0:0.1386:0.5784:0.283	.	691	Q15678	PTN14_HUMAN	K	691	ENSP00000355923:Q691K	ENSP00000355923:Q691K	Q	-	1	0	PTPN14	212623750	0.153000	0.22777	0.406000	0.26421	0.387000	0.30353	1.742000	0.38248	1.104000	0.41587	0.563000	0.77884	CAG	.	.		0.632	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
ESRRG	2104	hgsc.bcm.edu	37	1	216741353	216741353	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:216741353A>T	ENST00000408911.3	-	4	830	c.677T>A	c.(676-678)cTg>cAg	p.L226Q	ESRRG_ENST00000493603.1_Missense_Mutation_p.L203Q|ESRRG_ENST00000493748.1_Missense_Mutation_p.L203Q|ESRRG_ENST00000463665.1_Missense_Mutation_p.L164Q|ESRRG_ENST00000487276.1_Missense_Mutation_p.L203Q|ESRRG_ENST00000360012.3_Missense_Mutation_p.L203Q|ESRRG_ENST00000359162.2_Missense_Mutation_p.L203Q|ESRRG_ENST00000361395.2_Missense_Mutation_p.L203Q|ESRRG_ENST00000366937.1_Missense_Mutation_p.L231Q|ESRRG_ENST00000366940.2_Missense_Mutation_p.L203Q|ESRRG_ENST00000391890.3_Missense_Mutation_p.L203Q|ESRRG_ENST00000361525.3_Missense_Mutation_p.L203Q|ESRRG_ENST00000366938.2_Missense_Mutation_p.L203Q	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	226					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TGGCTGAACCAGCTGAGGGTT	0.522																																					p.L231Q		Atlas-SNP	.											.	ESRRG	111	.	0			c.T692A						.						155.0	127.0	136.0					1																	216741353		2203	4300	6503	SO:0001583	missense	2104	exon5			TGAACCAGCTGAG	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.677T>A	chr1.hg19:g.216741353A>T	ENSP00000386171:p.Leu226Gln	48.0	0.0		105.0	8.0	NM_001243518	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	hg19	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	A	13.42	2.231887	0.39399	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;T;D;D;D	0.94537	-3.44;-3.44;-3.31;-3.45;-3.44;-3.44;-3.44;-3.44;-3.44;-3.34;0.37;-3.44;-3.44;-3.27	5.76	5.76	0.90799	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.92685	0.7675	L	0.51422	1.61	0.80722	D	1	B;P;P	0.47677	0.027;0.899;0.838	B;P;B	0.44990	0.007;0.466;0.154	D	0.91012	0.4850	10	0.14656	T	0.56	.	16.0728	0.80946	1.0:0.0:0.0:0.0	.	164;231;226	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	Q	203;203;231;226;203;203;203;203;203;203;164;203;203;203;203	ENSP00000355225:L203Q;ENSP00000355907:L203Q;ENSP00000355904:L231Q;ENSP00000386171:L226Q;ENSP00000352077:L203Q;ENSP00000354584:L203Q;ENSP00000355905:L203Q;ENSP00000353108:L203Q;ENSP00000419594:L203Q;ENSP00000375761:L203Q;ENSP00000418629:L164Q;ENSP00000419155:L203Q;ENSP00000417374:L203Q;ENSP00000419514:L203Q	ENSP00000346386:L203Q	L	-	2	0	ESRRG	214807976	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.201000	0.70794	0.528000	0.53228	CTG	.	.		0.522	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
AHCTF1	25909	hgsc.bcm.edu	37	1	247016483	247016483	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:247016483T>A	ENST00000391829.2	-	32	4596	c.4473A>T	c.(4471-4473)gaA>gaT	p.E1491D	AHCTF1_ENST00000326225.3_Missense_Mutation_p.E1500D|AHCTF1_ENST00000366508.1_Missense_Mutation_p.E1526D|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1491	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CAACTTCTACTTCATGATCTT	0.408																																					p.E1500D	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.A4500T						.						35.0	33.0	34.0					1																	247016483		2202	4280	6482	SO:0001583	missense	25909	exon32			TTCTACTTCATGA		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4473A>T	chr1.hg19:g.247016483T>A	ENSP00000375705:p.Glu1491Asp	438.0	0.0		624.0	71.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	hg19		.	.	.	.	.	.	.	.	.	.	T	12.48	1.950028	0.34377	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.33216	1.42;1.43;1.43	5.76	4.64	0.57946	.	0.283135	0.30528	N	0.009439	T	0.28732	0.0712	L	0.40543	1.245	0.21445	N	0.999689	D;B;B	0.55385	0.971;0.241;0.156	P;B;B	0.49597	0.616;0.153;0.073	T	0.10019	-1.0648	10	0.28530	T	0.3	-15.661	6.0434	0.19746	0.0:0.0836:0.1644:0.752	.	352;1526;1491	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	D	1526;1500;1491	ENSP00000355464:E1526D;ENSP00000355465:E1500D;ENSP00000375705:E1491D	ENSP00000355465:E1500D	E	-	3	2	AHCTF1	245083106	0.153000	0.22777	0.614000	0.29051	0.556000	0.35491	1.088000	0.30877	1.017000	0.39495	0.528000	0.53228	GAA	.	.		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2T4	127074	hgsc.bcm.edu	37	1	248525837	248525837	+	Missense_Mutation	SNP	C	C	A	rs375159583		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr1:248525837C>A	ENST00000366475.1	+	1	955	c.955C>A	c.(955-957)Cct>Act	p.P319T		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGTGGTGAACCCTTTAATCTA	0.458																																					p.P319T		Atlas-SNP	.											.	OR2T4	126	.	0			c.C955A						.						140.0	139.0	139.0					1																	248525837		2203	4300	6503	SO:0001583	missense	127074	exon1			GTGAACCCTTTAA	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.955C>A	chr1.hg19:g.248525837C>A	ENSP00000355431:p.Pro319Thr	480.0	0.0		639.0	57.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675482	0.29783	.	.	ENSG00000196944	ENST00000366475	T	0.63913	-0.07	2.87	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000279	T	0.79131	0.4394	M	0.91038	3.17	0.36512	D	0.869679	D	0.60160	0.987	P	0.62813	0.907	D	0.83903	0.0291	10	0.87932	D	0	.	10.5129	0.44872	0.196:0.804:0.0:0.0	.	319	Q8NH00	OR2T4_HUMAN	T	319	ENSP00000355431:P319T	ENSP00000355431:P319T	P	+	1	0	OR2T4	246592460	0.916000	0.31088	0.875000	0.34327	0.057000	0.15508	3.115000	0.50391	0.381000	0.24851	0.485000	0.47835	CCT	.	.		0.458	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
ADCY3	109	hgsc.bcm.edu	37	2	25059804	25059804	+	Silent	SNP	G	G	C	rs372998415		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:25059804G>C	ENST00000260600.5	-	8	2495	c.1644C>G	c.(1642-1644)ccC>ccG	p.P548P	ADCY3_ENST00000405392.1_Silent_p.P181P	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	548					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CCTGCTCCTCGGGCTTCTCCG	0.632																																					p.P548P		Atlas-SNP	.											.	ADCY3	114	.	0			c.C1644G						.						54.0	49.0	51.0					2																	25059804		2203	4300	6503	SO:0001819	synonymous_variant	109	exon8			CTCCTCGGGCTTC	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1644C>G	chr2.hg19:g.25059804G>C		53.0	0.0		99.0	7.0	NM_004036	B3KT86|Q53T54|Q9UDB1	Silent	SNP	ENST00000260600.5	hg19	CCDS1715.1																																																																																			.	.		0.632	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
DNMT3A	1788	hgsc.bcm.edu	37	2	25505281	25505281	+	Intron	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:25505281A>G	ENST00000264709.3	-	4	786				DNMT3A_ENST00000321117.5_Intron|DNMT3A_ENST00000406659.3_Silent_p.S159S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha						C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGCCCAGAAGAGGCTGCCC	0.627			"""Mis, F, N, S"""		AML																																p.S159S		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A	1807	.	0			c.T477C						.						10.0	12.0	11.0					2																	25505281		2196	4282	6478	SO:0001627	intron_variant	1788	exon4			CCCAGAAGAGGCT		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.448+28T>C	chr2.hg19:g.25505281A>G		105.0	0.0		79.0	8.0	NM_175630	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	hg19	CCDS33157.1																																																																																			.	.		0.627	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43924355	43924355	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:43924355C>T	ENST00000282406.4	+	7	658	c.548C>T	c.(547-549)tCg>tTg	p.S183L		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	183					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTAAAGCTTTCGGAAGGCCAG	0.378																																					p.S183L		Atlas-SNP	.											PLEKHH2,colon,carcinoma,0,1	PLEKHH2	156	.	0			c.C548T						.						132.0	135.0	134.0					2																	43924355		2203	4300	6503	SO:0001583	missense	130271	exon7			AGCTTTCGGAAGG	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.548C>T	chr2.hg19:g.43924355C>T	ENSP00000282406:p.Ser183Leu	103.0	0.0		102.0	8.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	hg19	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463759	0.26335	.	.	ENSG00000152527	ENST00000282406	T	0.50813	0.73	5.25	3.44	0.39384	.	0.690693	0.14177	N	0.336299	T	0.25382	0.0617	N	0.22421	0.69	0.09310	N	1	B;P	0.43287	0.019;0.802	B;B	0.31337	0.003;0.128	T	0.04454	-1.0950	10	0.21540	T	0.41	-0.3171	8.0407	0.30519	0.0:0.7042:0.1425:0.1533	.	183;183	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	L	183	ENSP00000282406:S183L	ENSP00000282406:S183L	S	+	2	0	PLEKHH2	43777859	0.000000	0.05858	0.006000	0.13384	0.797000	0.45037	-0.205000	0.09411	1.202000	0.43218	0.557000	0.71058	TCG	.	.		0.378	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
ADD2	119	hgsc.bcm.edu	37	2	70910836	70910836	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:70910836G>A	ENST00000264436.4	-	10	1456	c.1012C>T	c.(1012-1014)Cgg>Tgg	p.R338W	ADD2_ENST00000413157.2_Missense_Mutation_p.R338W|ADD2_ENST00000407644.2_Missense_Mutation_p.R338W|ADD2_ENST00000430656.1_Missense_Mutation_p.R354W|ADD2_ENST00000355733.3_Missense_Mutation_p.R338W	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	338					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						TCATGGGGCCGGTGCTTCTCC	0.627																																					p.R354W		Atlas-SNP	.											.	ADD2	261	.	0			c.C1060T						.						38.0	37.0	37.0					2																	70910836		2203	4300	6503	SO:0001583	missense	119	exon9			GGGGCCGGTGCTT	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1012C>T	chr2.hg19:g.70910836G>A	ENSP00000264436:p.Arg338Trp	227.0	0.0		249.0	63.0	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	hg19	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548924	0.86127	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.09630	3.25;3.25;3.09;2.96;2.96	4.87	4.87	0.63330	Class II aldolase/adducin, N-terminal (2);	0.137242	0.47093	D	0.000250	T	0.26557	0.0649	L	0.48642	1.525	0.48571	D	0.999674	D;D;D;D	0.89917	0.986;1.0;1.0;1.0	P;D;D;D	0.74674	0.677;0.968;0.937;0.984	T	0.00523	-1.1690	10	0.87932	D	0	-14.5366	15.5561	0.76196	0.0:0.0:1.0:0.0	.	354;338;338;338	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	W	338;338;338;338;338;354	ENSP00000264436:R338W;ENSP00000384677:R338W;ENSP00000347972:R338W;ENSP00000388072:R338W;ENSP00000398112:R354W	ENSP00000264436:R338W	R	-	1	2	ADD2	70764344	0.987000	0.35691	0.996000	0.52242	0.991000	0.79684	1.574000	0.36482	2.541000	0.85698	0.655000	0.94253	CGG	.	.		0.627	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
DYSF	8291	hgsc.bcm.edu	37	2	71795093	71795093	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:71795093A>T	ENST00000258104.3	+	25	2801	c.2524A>T	c.(2524-2526)Aag>Tag	p.K842*	DYSF_ENST00000409762.1_Nonsense_Mutation_p.K859*|DYSF_ENST00000413539.2_Nonsense_Mutation_p.K873*|DYSF_ENST00000394120.2_Nonsense_Mutation_p.K843*|DYSF_ENST00000409744.1_Nonsense_Mutation_p.K829*|DYSF_ENST00000409651.1_Nonsense_Mutation_p.K874*|DYSF_ENST00000410020.3_Nonsense_Mutation_p.K860*|DYSF_ENST00000409582.3_Nonsense_Mutation_p.K859*|DYSF_ENST00000429174.2_Nonsense_Mutation_p.K842*|DYSF_ENST00000410041.1_Nonsense_Mutation_p.K860*|DYSF_ENST00000409366.1_Nonsense_Mutation_p.K843*	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	842					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TCCGATGGAGAAGGTGCCTGG	0.582																																					p.K874X		Atlas-SNP	.											.	DYSF	536	.	0			c.A2620T						.						120.0	116.0	117.0					2																	71795093		2203	4300	6503	SO:0001587	stop_gained	8291	exon26			ATGGAGAAGGTGC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2524A>T	chr2.hg19:g.71795093A>T	ENSP00000258104:p.Lys842*	125.0	0.0		167.0	35.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Nonsense_Mutation	SNP	ENST00000258104.3	hg19	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	A	43	10.297977	0.99378	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	4.81	0.892	0.19230	.	1.180440	0.05904	N	0.630456	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0051	9.2953	0.37811	0.259:0.0:0.741:0.0	.	.	.	.	X	873;859;859;842;842;874;843;829;843;860;860	.	ENSP00000258104:K842X	K	+	1	0	DYSF	71648601	0.891000	0.30450	0.008000	0.14137	0.974000	0.67602	2.255000	0.43222	-0.146000	0.11274	0.448000	0.29417	AAG	.	.		0.582	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
CYP26B1	56603	hgsc.bcm.edu	37	2	72371128	72371128	+	Missense_Mutation	SNP	T	T	C	rs200324765		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:72371128T>C	ENST00000001146.2	-	2	622	c.419A>G	c.(418-420)aAc>aGc	p.N140S	CYP26B1_ENST00000412253.1_5'Flank|CYP26B1_ENST00000546307.1_Intron	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	140					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CTTGCGCTTGTTGCGGTGGAT	0.622																																					p.N140S		Atlas-SNP	.											.	CYP26B1	73	.	0			c.A419G						.						53.0	53.0	53.0					2																	72371128		2203	4300	6503	SO:0001583	missense	56603	exon2			CGCTTGTTGCGGT		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.419A>G	chr2.hg19:g.72371128T>C	ENSP00000001146:p.Asn140Ser	74.0	0.0		98.0	4.0	NM_019885	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	hg19	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.112779	0.37242	.	.	ENSG00000003137	ENST00000001146;ENST00000461519	T;T	0.66638	-0.22;-0.22	4.78	4.78	0.61160	.	0.384245	0.30428	N	0.009642	T	0.42245	0.1194	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.001;0.004	T	0.33803	-0.9854	10	0.29301	T	0.29	-44.6661	12.641	0.56709	0.0:0.0:0.0:1.0	.	123;140	B7Z2P4;Q9NR63	.;CP26B_HUMAN	S	140;123	ENSP00000001146:N140S;ENSP00000430871:N123S	ENSP00000001146:N140S	N	-	2	0	CYP26B1	72224636	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.646000	0.61411	2.166000	0.68216	0.454000	0.30748	AAC	.	T|1.000;A|0.000		0.622	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613037	+	Missense_Mutation	DNP	GA	GA	CT	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:73613036_73613037GA>CT	ENST00000264448.6	+	1	151_152	c.40_41GA>CT	c.(40-42)GAg>CTg	p.E14L	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14L|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggaggag	0.693																																					p.E14Q|p.E14V		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C|c.A41T						.																																			SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG|TGGAGGAGGAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	Exception_encountered	chr2.hg19:g.73613036_73613037delinsCT	ENSP00000264448:p.Glu14Leu	150.0|149.0	0.0		289.0|292.0	27.0|30.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.693	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SNRNP200	23020	hgsc.bcm.edu	37	2	96949333	96949333	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:96949333T>G	ENST00000323853.5	-	33	4780	c.4703A>C	c.(4702-4704)cAg>cCg	p.Q1568P	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1568	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GAGGCGGGTCTGCTTGCGAGA	0.582																																					p.Q1568P		Atlas-SNP	.											.	SNRNP200	195	.	0			c.A4703C						.						140.0	134.0	136.0					2																	96949333		2203	4300	6503	SO:0001583	missense	23020	exon33			CGGGTCTGCTTGC	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.4703A>C	chr2.hg19:g.96949333T>G	ENSP00000317123:p.Gln1568Pro	71.0	0.0		84.0	27.0	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	hg19	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339422	0.81911	.	.	ENSG00000144028	ENST00000323853;ENST00000536601;ENST00000543553	D	0.85258	-1.96	5.0	5.0	0.66597	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93858	0.8035	H	0.97077	3.935	0.80722	D	1	D;D	0.59357	0.985;0.969	P;P	0.58780	0.845;0.845	D	0.95648	0.8704	10	0.87932	D	0	-21.5037	14.0005	0.64431	0.0:0.0:0.0:1.0	.	1319;1568	A4FU77;O75643	.;U520_HUMAN	P	1568;27;151	ENSP00000317123:Q1568P	ENSP00000317123:Q1568P	Q	-	2	0	SNRNP200	96313060	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.606000	0.82863	2.014000	0.59158	0.460000	0.39030	CAG	.	.		0.582	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
FER1L5	90342	hgsc.bcm.edu	37	2	97368053	97368053	+	RNA	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:97368053C>T	ENST00000457909.1	+	0	4673							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GTATGAGCTGCGATGCATCAT	0.552																																					p.R1760X		Atlas-SNP	.											.	FER1L5	113	.	0			c.C5278T						.						42.0	41.0	41.0					2																	97368053		2044	4196	6240			90342	exon46			GAGCTGCGATGCA	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		chr2.hg19:g.97368053C>T		199.0	0.0		335.0	84.0	NM_001113382	Q17RH2|Q6ZU24	Nonsense_Mutation	SNP	ENST00000457909.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.76	2.035740	0.35893	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	5.19	5.19	0.71726	.	0.000000	0.45867	U	0.000331	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.9525	17.5041	0.87740	0.0:1.0:0.0:0.0	.	.	.	.	X	1760;1764;469	.	ENSP00000442027:R469X	R	+	1	2	FER1L5	96731780	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	4.762000	0.62250	2.431000	0.82371	0.655000	0.94253	CGA	.	.		0.552	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
MARCO	8685	hgsc.bcm.edu	37	2	119739022	119739022	+	Silent	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:119739022G>T	ENST00000327097.4	+	9	939	c.804G>T	c.(802-804)ggG>ggT	p.G268G	MARCO_ENST00000541757.1_Silent_p.G190G	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	268	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GAGATGCAGGGGTCATGGGGC	0.567																																					p.G268G	GBM(8;18 374 7467 11269 32796)	Atlas-SNP	.											.	MARCO	120	.	0			c.G804T						.						38.0	37.0	38.0					2																	119739022		2203	4300	6503	SO:0001819	synonymous_variant	8685	exon9			TGCAGGGGTCATG	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.804G>T	chr2.hg19:g.119739022G>T		133.0	0.0		184.0	38.0	NM_006770	B4DW79|Q9Y5S3	Silent	SNP	ENST00000327097.4	hg19	CCDS2124.1																																																																																			.	.		0.567	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
TTN	7273	hgsc.bcm.edu	37	2	179438250	179438250	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:179438250A>T	ENST00000591111.1	-	276	67910	c.67686T>A	c.(67684-67686)taT>taA	p.Y22562*	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y24203*|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y21635*|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y15263*|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y15138*|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y15330*|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22562	Fibronectin type-III 63. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCCACTCCATATTTATTTA	0.438																																					p.Y24203X		Atlas-SNP	.											.	TTN	18412	.	0			c.T72609A						.						152.0	154.0	153.0					2																	179438250		1928	4122	6050	SO:0001587	stop_gained	7273	exon326			CACTCCATATTTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67686T>A	chr2.hg19:g.179438250A>T	ENSP00000465570:p.Tyr22562*	115.0	0.0		148.0	32.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	62	69.390303	0.99992	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	6.08	-3.37	0.04898	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.3725	0.38264	0.4875:0.1019:0.4106:0.0	.	.	.	.	X	21635;15138;15330;15263;15136	.	ENSP00000340554:Y15330X	Y	-	3	2	TTN	179146496	0.979000	0.34478	0.973000	0.42090	0.995000	0.86356	0.484000	0.22308	-0.577000	0.05967	-0.290000	0.09829	TAT	.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179502130	179502130	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:179502130C>A	ENST00000591111.1	-	174	36194	c.35970G>T	c.(35968-35970)aaG>aaT	p.K11990N	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K13631N|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K11063N|TTN_ENST00000359218.5_Missense_Mutation_p.K4691N|TTN_ENST00000460472.2_Missense_Mutation_p.K4566N|TTN_ENST00000342175.6_Missense_Mutation_p.K4758N|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11990	Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCCTCTTCCTTAGGTGCTT	0.363																																					p.K13631N		Atlas-SNP	.											.	TTN	18412	.	0			c.G40893T						.						46.0	46.0	46.0					2																	179502130		1808	4075	5883	SO:0001583	missense	7273	exon224			CTCTTCCTTAGGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35970G>T	chr2.hg19:g.179502130C>A	ENSP00000465570:p.Lys11990Asn	59.0	0.0		78.0	11.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.87	2.066744	0.36470	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68025	-0.3;0.03;0.01;-0.0	5.52	2.23	0.28157	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.74854	0.3771	L	0.58101	1.795	0.35438	D	0.794596	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.76071	0.987;0.987;0.987;0.987	T	0.77210	-0.2671	9	0.87932	D	0	.	7.8107	0.29230	0.0:0.3389:0.0:0.6611	.	4566;4691;4758;11990	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	11063;4566;4758;4691;4566	ENSP00000343764:K11063N;ENSP00000434586:K4566N;ENSP00000340554:K4758N;ENSP00000352154:K4691N	ENSP00000340554:K4758N	K	-	3	2	TTN	179210375	0.998000	0.40836	0.999000	0.59377	0.971000	0.66376	0.208000	0.17415	0.172000	0.19760	0.491000	0.48974	AAG	.	.		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NIF3L1	60491	hgsc.bcm.edu	37	2	201761875	201761875	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:201761875G>C	ENST00000409020.1	+	5	1097	c.803G>C	c.(802-804)cGa>cCa	p.R268P	RNU6-762P_ENST00000517107.1_RNA|NIF3L1_ENST00000416651.1_Missense_Mutation_p.R268P|NIF3L1_ENST00000359683.4_Missense_Mutation_p.R241P|NIF3L1_ENST00000409357.1_Missense_Mutation_p.R268P|NIF3L1_ENST00000409588.1_Intron			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	268					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						ATGATTGATCGAATAAAAAGA	0.433																																					p.R268P		Atlas-SNP	.											NIF3L1_ENST00000409020,colon,carcinoma,0,2	NIF3L1	51	.	0			c.G803C						.						131.0	121.0	124.0					2																	201761875		1922	4120	6042	SO:0001583	missense	60491	exon5			TTGATCGAATAAA	AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.803G>C	chr2.hg19:g.201761875G>C	ENSP00000386394:p.Arg268Pro	113.0	0.0		165.0	46.0	NM_001136039	Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	ENST00000409020.1	hg19	CCDS46485.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.6|21.6	4.179961|4.179961	0.78564|0.78564	.|.	.|.	ENSG00000196290|ENSG00000196290	ENST00000436412|ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357	.|T;T;T;T	.|0.46819	.|0.86;0.86;0.86;0.86	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	.|0.263821	.|0.38272	.|N	.|0.001752	T|T	0.75932|0.75932	0.3917|0.3917	M|M	0.90425|0.90425	3.115|3.115	0.49389|0.49389	D|D	0.999782|0.999782	.|D	.|0.76494	.|0.999	.|D	.|0.75484	.|0.986	T|T	0.75816|0.75816	-0.3184|-0.3184	5|10	.|0.39692	.|T	.|0.17	-10.4432|-10.4432	20.5141|20.5141	0.99211|0.99211	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|268	.|Q9GZT8	.|NIF3L_HUMAN	Q|P	27|268;268;241;268	.|ENSP00000400787:R268P;ENSP00000386394:R268P;ENSP00000352711:R241P;ENSP00000387315:R268P	.|ENSP00000352711:R241P	E|R	+|+	1|2	0|0	NIF3L1|NIF3L1	201470120|201470120	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.905000|0.905000	0.53344|0.53344	4.266000|4.266000	0.58871|0.58871	2.850000|2.850000	0.98022|0.98022	0.655000|0.655000	0.94253|0.94253	GAA|CGA	.	.		0.433	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1	NM_021824	
LANCL1	10314	hgsc.bcm.edu	37	2	211300146	211300146	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr2:211300146C>T	ENST00000443314.1	-	8	1430	c.1088G>A	c.(1087-1089)tGc>tAc	p.C363Y	LANCL1_ENST00000441020.3_Missense_Mutation_p.C363Y|LANCL1_ENST00000431941.2_Missense_Mutation_p.C363Y|LANCL1_ENST00000450366.2_Missense_Mutation_p.C363Y|AC007970.1_ENST00000433296.1_RNA|LANCL1_ENST00000233714.4_Missense_Mutation_p.C363Y|AC007970.1_ENST00000420418.1_RNA			O43813	LANC1_HUMAN	LanC lantibiotic synthetase component C-like 1 (bacterial)	363					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|G-protein coupled receptor activity (GO:0004930)|glutathione binding (GO:0043295)|low-density lipoprotein particle receptor binding (GO:0050750)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		TGGTGTTCTGCATCCATGTTC	0.363																																					p.C363Y		Atlas-SNP	.											.	LANCL1	23	.	0			c.G1088A						.						136.0	131.0	133.0					2																	211300146		2203	4300	6503	SO:0001583	missense	10314	exon9			GTTCTGCATCCAT	Y11395	CCDS2392.1	2q33-q35	2008-05-23	2001-12-04		ENSG00000115365	ENSG00000115365			6508	protein-coding gene	gene with protein product		604155	"""LanC (bacterial lantibiotic synthetase component C)-like 1"""	GPR69A		9512664	Standard	NM_001136574		Approved	p40	uc010zjh.2	O43813	OTTHUMG00000132991	ENST00000443314.1:c.1088G>A	chr2.hg19:g.211300146C>T	ENSP00000388713:p.Cys363Tyr	119.0	0.0		159.0	42.0	NM_001136574		Missense_Mutation	SNP	ENST00000443314.1	hg19	CCDS2392.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.066770|5.066770	0.93898|0.93898	.|.	.|.	ENSG00000115365|ENSG00000115365	ENST00000443314;ENST00000441020;ENST00000450366;ENST00000233714;ENST00000431941|ENST00000412863	T;T;T;T;T|.	0.40756|.	1.02;1.02;1.02;1.02;1.02|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75488|0.75488	0.3856|0.3856	M|M	0.64676|0.64676	1.99|1.99	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.70443|0.70443	-0.4870|-0.4870	10|5	0.30854|.	T|.	0.27|.	.|.	20.8598|20.8598	0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	363|.	O43813|.	LANC1_HUMAN|.	Y|I	363|121	ENSP00000388713:C363Y;ENSP00000393323:C363Y;ENSP00000393597:C363Y;ENSP00000233714:C363Y;ENSP00000397646:C363Y|.	ENSP00000233714:C363Y|.	C|M	-|-	2|3	0|0	LANCL1|LANCL1	211008391|211008391	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.487000|7.487000	0.81328|0.81328	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	TGC|ATG	.	.		0.363	LANCL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336817.1	NM_006055	
TRANK1	9881	hgsc.bcm.edu	37	3	36898772	36898772	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr3:36898772T>A	ENST00000429976.2	-	12	2556	c.2309A>T	c.(2308-2310)cAg>cTg	p.Q770L	TRANK1_ENST00000428977.2_Missense_Mutation_p.Q220L|TRANK1_ENST00000301807.6_Missense_Mutation_p.Q220L	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	770							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCAGTCATCCTGATCATCATT	0.552																																					p.Q770L		Atlas-SNP	.											.	TRANK1	398	.	0			c.A2309T						.						214.0	208.0	210.0					3																	36898772		2051	4217	6268	SO:0001583	missense	9881	exon12			TCATCCTGATCAT	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2309A>T	chr3.hg19:g.36898772T>A	ENSP00000416168:p.Gln770Leu	77.0	0.0		97.0	15.0	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	hg19	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	T	13.23	2.175994	0.38413	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.32515	1.45;1.82;1.45	5.75	-4.15	0.03881	.	0.650629	0.13438	N	0.387894	T	0.13713	0.0332	L	0.27053	0.805	0.09310	N	1	B	0.23937	0.094	B	0.18871	0.023	T	0.15350	-1.0440	10	0.44086	T	0.13	.	0.983	0.01440	0.4366:0.2137:0.1147:0.235	.	770	O15050	TRNK1_HUMAN	L	220;770;220	ENSP00000416826:Q220L;ENSP00000416168:Q770L;ENSP00000301807:Q220L	ENSP00000301807:Q220L	Q	-	2	0	TRANK1	36873776	0.407000	0.25352	0.002000	0.10522	0.178000	0.23041	0.476000	0.22180	-0.293000	0.08986	0.533000	0.62120	CAG	.	.		0.552	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
SLC9C1	285335	hgsc.bcm.edu	37	3	111962868	111962868	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr3:111962868A>C	ENST00000305815.5	-	11	1505	c.1253T>G	c.(1252-1254)aTt>aGt	p.I418S	SLC9C1_ENST00000487372.1_Missense_Mutation_p.I370S	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	418					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										CACTGGCAAAATAAATCTATT	0.308																																					p.I418S		Atlas-SNP	.											.	.	.	.	0			c.T1253G						.						76.0	81.0	79.0					3																	111962868		2203	4300	6503	SO:0001583	missense	285335	exon11			GGCAAAATAAATC	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1253T>G	chr3.hg19:g.111962868A>C	ENSP00000306627:p.Ile418Ser	274.0	0.0		346.0	100.0	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	hg19	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	A	8.501	0.864294	0.17250	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.77229	-1.04;-1.08	5.11	3.79	0.43588	Cation/H+ exchanger (1);	0.216928	0.32258	N	0.006352	T	0.65770	0.2723	L	0.47716	1.5	0.27233	N	0.959345	B;B	0.32653	0.27;0.379	B;B	0.31390	0.096;0.129	T	0.57929	-0.7726	10	0.36615	T	0.2	-22.2886	5.2148	0.15336	0.838:0.0:0.162:0.0	.	370;418	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	S	418;370	ENSP00000306627:I418S;ENSP00000420688:I370S	ENSP00000306627:I418S	I	-	2	0	SLC9A10	113445558	0.996000	0.38824	0.985000	0.45067	0.034000	0.12701	2.849000	0.48286	2.044000	0.60594	0.352000	0.21897	ATT	.	.		0.308	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
PIK3R4	30849	hgsc.bcm.edu	37	3	130424491	130424491	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr3:130424491T>A	ENST00000356763.3	-	12	3403	c.2846A>T	c.(2845-2847)cAg>cTg	p.Q949L		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	949					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						CCGCTTTTGCTGGATGAGTTG	0.403																																					p.Q949L		Atlas-SNP	.											.	PIK3R4	145	.	0			c.A2846T						.						193.0	180.0	184.0					3																	130424491		2203	4300	6503	SO:0001583	missense	30849	exon12			TTTTGCTGGATGA	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2846A>T	chr3.hg19:g.130424491T>A	ENSP00000349205:p.Gln949Leu	140.0	0.0		171.0	67.0	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	hg19	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.873598	0.33069	.	.	ENSG00000196455	ENST00000356763	T	0.05786	3.39	5.72	5.72	0.89469	WD40 repeat-like-containing domain (1);	0.160586	0.56097	D	0.000026	T	0.06050	0.0157	L	0.27053	0.805	0.80722	D	1	B	0.20164	0.042	B	0.15484	0.013	T	0.42832	-0.9428	10	0.20046	T	0.44	-12.4214	15.9899	0.80197	0.0:0.0:0.0:1.0	.	949	Q99570	PI3R4_HUMAN	L	949	ENSP00000349205:Q949L	ENSP00000349205:Q949L	Q	-	2	0	PIK3R4	131907181	1.000000	0.71417	0.253000	0.24343	0.421000	0.31385	8.000000	0.88501	2.168000	0.68352	0.533000	0.62120	CAG	.	.		0.403	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
MBNL1	4154	hgsc.bcm.edu	37	3	152132806	152132806	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr3:152132806G>A	ENST00000463374.1	+	2	762	c.251G>A	c.(250-252)cGc>cAc	p.R84H	MBNL1_ENST00000498502.1_Missense_Mutation_p.R84H|MBNL1_ENST00000357472.3_Missense_Mutation_p.R84H|MBNL1_ENST00000324196.5_Missense_Mutation_p.R84H|MBNL1_ENST00000485910.1_Missense_Mutation_p.R84H|MBNL1_ENST00000324210.5_Missense_Mutation_p.R84H|MBNL1_ENST00000485509.1_Missense_Mutation_p.R84H|MBNL1_ENST00000545754.1_Missense_Mutation_p.R84H|MBNL1_ENST00000493459.1_Missense_Mutation_p.R27H|MBNL1_ENST00000355460.2_Missense_Mutation_p.R84H|MBNL1_ENST00000282488.7_Missense_Mutation_p.R84H|MBNL1_ENST00000282486.6_Missense_Mutation_p.R84H|MBNL1_ENST00000492948.1_Missense_Mutation_p.R84H	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	84					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R84H(2)		endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATAAATGGACGCAATAACTTG	0.478																																					p.R84H		Atlas-SNP	.											MBNL1_ENST00000282488,colon,carcinoma,0,2	MBNL1	100	.	2	Substitution - Missense(2)	large_intestine(2)	c.G251A						.						137.0	125.0	129.0					3																	152132806		2203	4300	6503	SO:0001583	missense	4154	exon3			ATGGACGCAATAA	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.251G>A	chr3.hg19:g.152132806G>A	ENSP00000418108:p.Arg84His	142.0	0.0		195.0	70.0	NM_207292	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	ENST00000463374.1	hg19	CCDS3165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	5.989217|5.989217	0.97179|0.97179	.|.	.|.	ENSG00000152601|ENSG00000152601	ENST00000464596|ENST00000282486;ENST00000282488;ENST00000355460;ENST00000493459;ENST00000324210;ENST00000459747;ENST00000498502;ENST00000324196;ENST00000545754;ENST00000357472;ENST00000485910;ENST00000463374;ENST00000465907;ENST00000492948;ENST00000485509	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.51574	.|0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70902|0.70902	0.3277|0.3277	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D	.|0.97110	.|0.993;0.999;0.999;0.998;0.993;0.993;0.997;1.0	T|T	0.71108|0.71108	-0.4688|-0.4688	5|10	.|0.87932	.|D	.|0	.|.	20.5948|20.5948	0.99439|0.99439	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|84;84;84;84;84;27;84;84	.|E9PBW7;Q9NR56-3;Q96RE3;Q9NR56;Q86UV8;Q86VM6;Q9NR56-2;Q96P92	.|.;.;.;MBNL1_HUMAN;.;.;.;.	T|H	83|84;84;84;27;84;28;84;84;84;84;84;84;84;84;84	.|ENSP00000282486:R84H;ENSP00000282488:R84H;ENSP00000347637:R84H;ENSP00000419347:R27H;ENSP00000319429:R84H;ENSP00000417169:R28H;ENSP00000420327:R84H;ENSP00000319374:R84H;ENSP00000437491:R84H;ENSP00000350064:R84H;ENSP00000418427:R84H;ENSP00000418108:R84H;ENSP00000417630:R84H;ENSP00000420103:R84H;ENSP00000418876:R84H	.|ENSP00000282486:R84H	A|R	+|+	1|2	0|0	MBNL1|MBNL1	153615496|153615496	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.731000|9.731000	0.98807|0.98807	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GCA|CGC	.	.		0.478	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	
ATP13A5	344905	hgsc.bcm.edu	37	3	193081052	193081052	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr3:193081052G>C	ENST00000342358.4	-	3	474	c.357C>G	c.(355-357)aaC>aaG	p.N119K		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	119						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TTAAGGCTTGGTTTATGACAG	0.383																																					p.N119K		Atlas-SNP	.											.	ATP13A5	171	.	0			c.C357G						.						98.0	97.0	97.0					3																	193081052		2203	4300	6503	SO:0001583	missense	344905	exon3			GGCTTGGTTTATG	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.357C>G	chr3.hg19:g.193081052G>C	ENSP00000341942:p.Asn119Lys	117.0	0.0		146.0	43.0	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	hg19	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.505942	0.26949	.	.	ENSG00000187527	ENST00000342358;ENST00000446087	T;T	0.33865	1.39;1.39	5.12	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	L	0.54323	1.7	0.32700	N	0.513014	P	0.47106	0.89	P	0.45232	0.474	T	0.35699	-0.9778	10	0.12430	T	0.62	-18.9578	7.7121	0.28684	0.2653:0.0:0.7346:0.0	.	119	Q4VNC0	AT135_HUMAN	K	119;141	ENSP00000341942:N119K;ENSP00000389416:N141K	ENSP00000341942:N119K	N	-	3	2	ATP13A5	194563746	1.000000	0.71417	0.993000	0.49108	0.053000	0.15095	2.232000	0.43018	0.816000	0.34421	0.650000	0.86243	AAC	.	.		0.383	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
FAM157A	728262	hgsc.bcm.edu	37	3	197880167	197880167	+	lincRNA	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr3:197880167G>A	ENST00000437428.2	+	0	47							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcaACTGG	0.527																																					p.Q82Q		Atlas-SNP	.											.	FAM157A	4	.	0			c.G246A						.						2.0	6.0	5.0					3																	197880167		369	1057	1426			728262	exon2			GCAGCAGCAGCAA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			chr3.hg19:g.197880167G>A		467.0	0.0		592.0	29.0	NM_001145248		Silent	SNP	ENST00000437428.2	hg19																																																																																				.	.		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
PROM1	8842	hgsc.bcm.edu	37	4	16025980	16025980	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:16025980T>A	ENST00000510224.1	-	7	880	c.632A>T	c.(631-633)cAa>cTa	p.Q211L	PROM1_ENST00000505450.1_Splice_Site_p.Q202L|PROM1_ENST00000447510.2_Splice_Site_p.Q211L|PROM1_ENST00000540805.1_Splice_Site_p.Q211L|PROM1_ENST00000539194.1_Splice_Site_p.Q211L|PROM1_ENST00000543373.1_Splice_Site_p.Q202L|PROM1_ENST00000502943.1_5'UTR|PROM1_ENST00000508167.1_Splice_Site_p.Q202L			O43490	PROM1_HUMAN	prominin 1	211					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						ATATTTGATTTGCTGAAAAAA	0.353																																					p.Q211L		Atlas-SNP	.											.	PROM1	91	.	0			c.A632T						.						112.0	104.0	107.0					4																	16025980		1833	4095	5928	SO:0001630	splice_region_variant	8842	exon6			TTGATTTGCTGAA	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.631-1A>T	chr4.hg19:g.16025980T>A		124.0	0.0		158.0	62.0	NM_006017	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	ENST00000510224.1	hg19	CCDS47029.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.496446	0.64186	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.56963	0.2021	M	0.80746	2.51	0.80722	D	1	P;P;P;P;B;P	0.41848	0.72;0.72;0.72;0.72;0.058;0.763	P;P;B;P;B;P	0.44921	0.447;0.447;0.333;0.447;0.046;0.464	T	0.65471	-0.6160	10	0.72032	D	0.01	-19.8061	13.9438	0.64071	0.0:0.0:0.0:1.0	.	202;211;202;211;202;211	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	L	211;211;211;202;202;211;202	ENSP00000415481:Q211L;ENSP00000438045:Q211L;ENSP00000443620:Q211L;ENSP00000426090:Q202L;ENSP00000427346:Q202L;ENSP00000426809:Q211L;ENSP00000445526:Q202L	ENSP00000415481:Q211L	Q	-	2	0	PROM1	15635078	1.000000	0.71417	0.997000	0.53966	0.511000	0.34104	6.143000	0.71756	1.833000	0.53350	0.459000	0.35465	CAA	.	.		0.353	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	Missense_Mutation
SLC34A2	10568	hgsc.bcm.edu	37	4	25667799	25667799	+	Silent	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:25667799T>A	ENST00000382051.3	+	5	479	c.429T>A	c.(427-429)ccT>ccA	p.P143P	SLC34A2_ENST00000510033.2_3'UTR|SLC34A2_ENST00000504570.1_Silent_p.P142P|SLC34A2_ENST00000503434.1_Silent_p.P142P	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	143					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				TGTCCAACCCTTTGTTGGGGC	0.498			T	ROS1	NSCLC																																p.P143P		Atlas-SNP	.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2	93	.	0			c.T429A						.						143.0	146.0	145.0					4																	25667799		2203	4300	6503	SO:0001819	synonymous_variant	10568	exon5			CAACCCTTTGTTG	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.429T>A	chr4.hg19:g.25667799T>A		51.0	0.0		73.0	14.0	NM_006424	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	ENST00000382051.3	hg19	CCDS3435.1																																																																																			.	.		0.498	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
SEL1L3	23231	hgsc.bcm.edu	37	4	25819867	25819867	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:25819867C>T	ENST00000399878.3	-	9	1579	c.1457G>A	c.(1456-1458)cGc>cAc	p.R486H	SEL1L3_ENST00000264868.5_Missense_Mutation_p.R451H|SEL1L3_ENST00000502949.1_Missense_Mutation_p.R333H	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	486						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						CCCATACCTGCGCTGGAGGTC	0.542																																					p.R486H		Atlas-SNP	.											.	SEL1L3	62	.	0			c.G1457A						.						53.0	55.0	55.0					4																	25819867		1958	4163	6121	SO:0001583	missense	23231	exon9			TACCTGCGCTGGA	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1457G>A	chr4.hg19:g.25819867C>T	ENSP00000382767:p.Arg486His	128.0	0.0		154.0	37.0	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	hg19	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	C	4.392	0.072331	0.08436	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.14516	2.72;2.72;2.5	5.75	-1.97	0.07503	.	1.198870	0.05443	N	0.547975	T	0.07548	0.0190	N	0.24115	0.695	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	10	0.33940	T	0.23	-2.4685	0.2933	0.00261	0.257:0.2612:0.1445:0.3372	.	486	Q68CR1	SE1L3_HUMAN	H	486;451;333	ENSP00000382767:R486H;ENSP00000264868:R451H;ENSP00000425438:R333H	ENSP00000264868:R451H	R	-	2	0	SEL1L3	25428965	0.000000	0.05858	0.039000	0.18376	0.001000	0.01503	-1.235000	0.02928	-0.399000	0.07668	-0.794000	0.03295	CGC	.	.		0.542	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
CWH43	80157	hgsc.bcm.edu	37	4	48996766	48996766	+	Silent	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:48996766A>G	ENST00000226432.4	+	5	825	c.642A>G	c.(640-642)ggA>ggG	p.G214G	CWH43_ENST00000513409.1_Silent_p.G187G	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	214					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GGGTTTTTGGAGAAGTCTCTC	0.542																																					p.G214G		Atlas-SNP	.											.	CWH43	101	.	0			c.A642G						.						115.0	109.0	111.0					4																	48996766		2203	4300	6503	SO:0001819	synonymous_variant	80157	exon5			TTTTGGAGAAGTC		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.642A>G	chr4.hg19:g.48996766A>G		150.0	0.0		222.0	50.0	NM_025087	B2RPD7	Silent	SNP	ENST00000226432.4	hg19	CCDS3486.1																																																																																			.	.		0.542	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
RUFY3	22902	hgsc.bcm.edu	37	4	71655272	71655272	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:71655272A>T	ENST00000226328.4	+	12	1863	c.1300A>T	c.(1300-1302)Aat>Tat	p.N434Y	RUFY3_ENST00000502653.1_Missense_Mutation_p.N381Y|RUFY3_ENST00000536664.1_Missense_Mutation_p.N418Y|RUFY3_ENST00000381006.3_Missense_Mutation_p.N434Y|RUFY3_ENST00000417478.2_Missense_Mutation_p.N494Y	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	434					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			AGAGAAGACTAATCAGATGGC	0.348																																					p.N494Y		Atlas-SNP	.											.	RUFY3	61	.	0			c.A1480T						.						125.0	128.0	127.0					4																	71655272		2203	4300	6503	SO:0001583	missense	22902	exon12			AAGACTAATCAGA	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.1300A>T	chr4.hg19:g.71655272A>T	ENSP00000226328:p.Asn434Tyr	216.0	0.0		253.0	51.0	NM_001130709	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	hg19	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.427456	0.83667	.	.	ENSG00000018189	ENST00000417478;ENST00000381006;ENST00000226328;ENST00000536664;ENST00000502653	T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54	5.47	5.47	0.80525	.	0.039429	0.85682	D	0.000000	T	0.37598	0.1009	M	0.73217	2.22	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;0.997	D;D;D;D	0.77557	0.984;0.983;0.99;0.964	T	0.17349	-1.0372	10	0.87932	D	0	-27.772	15.5336	0.75983	1.0:0.0:0.0:0.0	.	418;434;434;494	B4DKC2;Q7L099-3;Q7L099;Q7L099-2	.;.;RUFY3_HUMAN;.	Y	494;434;434;418;381	ENSP00000399771:N494Y;ENSP00000370394:N434Y;ENSP00000226328:N434Y;ENSP00000443652:N418Y;ENSP00000425400:N381Y	ENSP00000226328:N434Y	N	+	1	0	RUFY3	71874136	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.626000	0.90969	2.073000	0.62155	0.533000	0.62120	AAT	.	.		0.348	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
COL25A1	84570	hgsc.bcm.edu	37	4	109765684	109765684	+	Silent	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:109765684A>T	ENST00000399132.1	-	30	2150	c.1620T>A	c.(1618-1620)ccT>ccA	p.P540P	COL25A1_ENST00000399126.1_Silent_p.P540P|COL25A1_ENST00000399127.1_Silent_p.P513P	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CCATGgggccaggtgggccat	0.438																																					p.P540P		Atlas-SNP	.											.	COL25A1	178	.	0			c.T1620A						.						91.0	95.0	94.0					4																	109765684		1849	4096	5945	SO:0001819	synonymous_variant	84570	exon29			GGGGCCAGGTGGG	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1620T>A	chr4.hg19:g.109765684A>T		134.0	0.0		154.0	27.0	NM_198721		Silent	SNP	ENST00000399132.1	hg19	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.431786	0.43122	.	.	ENSG00000188517	ENST00000443653	.	.	.	5.47	-2.13	0.07144	.	.	.	.	.	T	0.38453	0.1041	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30387	-0.9980	4	.	.	.	-4.3426	0.9855	0.01445	0.3115:0.094:0.1886:0.4059	.	.	.	.	R	456	.	.	W	-	1	0	COL25A1	109985133	0.977000	0.34250	0.997000	0.53966	0.985000	0.73830	-0.225000	0.09151	-0.252000	0.09528	-0.177000	0.13119	TGG	.	.		0.438	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
ANK2	287	hgsc.bcm.edu	37	4	114158756	114158756	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:114158756T>C	ENST00000357077.4	+	7	724	c.671T>C	c.(670-672)aTg>aCg	p.M224T	ANK2_ENST00000394537.3_Splice_Site_p.M224T|ANK2_ENST00000264366.6_Splice_Site_p.M224T|ANK2_ENST00000506722.1_Splice_Site_p.M203T	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	224					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGCTTCAGATGATGGTGAAT	0.358																																					p.M224T		Atlas-SNP	.											.	ANK2	576	.	0			c.T671C						.						226.0	206.0	213.0					4																	114158756		2203	4300	6503	SO:0001630	splice_region_variant	287	exon7			TTCAGATGATGGT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.670-1T>C	chr4.hg19:g.114158756T>C		99.0	0.0		98.0	22.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	T	16.72	3.201840	0.58234	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.66280	-0.05;0.08;-0.16;-0.06;-0.13;-0.18;-0.2	5.65	5.65	0.86999	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000002	T	0.68320	0.2988	N	0.25647	0.755	0.80722	D	1	D;D;D;D;P	0.65815	0.985;0.995;0.991;0.981;0.935	D;D;D;D;D	0.78314	0.979;0.991;0.991;0.98;0.914	T	0.66602	-0.5882	10	0.31617	T	0.26	.	16.1657	0.81754	0.0:0.0:0.0:1.0	.	224;224;224;203;203	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	T	203;203;203;239;224;224;224;203	ENSP00000423799:M203T;ENSP00000421011:M203T;ENSP00000421067:M203T;ENSP00000424722:M239T;ENSP00000378044:M224T;ENSP00000349588:M224T;ENSP00000264366:M224T	ENSP00000264366:M224T	M	+	2	0	ANK2	114378205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.276000	0.75962	0.528000	0.53228	ATG	.	.		0.358	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	Missense_Mutation
FSTL5	56884	hgsc.bcm.edu	37	4	162680644	162680644	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:162680644A>G	ENST00000306100.5	-	6	1082	c.646T>C	c.(646-648)Tgt>Cgt	p.C216R	FSTL5_ENST00000536695.1_Missense_Mutation_p.C215R|FSTL5_ENST00000379164.4_Missense_Mutation_p.C215R|FSTL5_ENST00000427802.2_Missense_Mutation_p.C215R	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	216	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TACAAAGTACAATCAAAGAGA	0.303																																					p.C216R		Atlas-SNP	.											.	FSTL5	207	.	0			c.T646C						.						90.0	98.0	96.0					4																	162680644		2203	4300	6503	SO:0001583	missense	56884	exon6			AAGTACAATCAAA	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.646T>C	chr4.hg19:g.162680644A>G	ENSP00000305334:p.Cys216Arg	493.0	0.0		493.0	104.0	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	hg19	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.107376	0.37145	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	5.37	5.37	0.77165	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	L	0.47016	1.485	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.997	T	0.22730	-1.0208	10	0.87932	D	0	.	14.5345	0.67950	1.0:0.0:0.0:0.0	.	215;215;216	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	R	216;215;215;215	ENSP00000305334:C216R;ENSP00000368462:C215R;ENSP00000389270:C215R;ENSP00000440409:C215R	ENSP00000305334:C216R	C	-	1	0	FSTL5	162900094	1.000000	0.71417	0.908000	0.35775	0.028000	0.11728	6.778000	0.75043	2.030000	0.59900	0.472000	0.43445	TGT	.	.		0.303	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
CLCN3	1182	hgsc.bcm.edu	37	4	170613454	170613454	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr4:170613454G>A	ENST00000513761.1	+	7	1478	c.919G>A	c.(919-921)Gaa>Aaa	p.E307K	CLCN3_ENST00000347613.4_Missense_Mutation_p.E307K|CLCN3_ENST00000504131.2_Missense_Mutation_p.E290K|CLCN3_ENST00000360642.3_Missense_Mutation_p.E307K	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	307					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TAGCACAAACGAAGCTAAAAA	0.328																																					p.E307K		Atlas-SNP	.											.	CLCN3	85	.	0			c.G919A						.						108.0	109.0	109.0					4																	170613454		2203	4300	6503	SO:0001583	missense	1182	exon7			ACAAACGAAGCTA	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.919G>A	chr4.hg19:g.170613454G>A	ENSP00000424603:p.Glu307Lys	236.0	0.0		188.0	46.0	NM_001243372	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	hg19	CCDS34101.1	.	.	.	.	.	.	.	.	.	.	G	35	5.461222	0.96240	.	.	ENSG00000109572	ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131;ENST00000507875	D;D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45;-3.45	5.94	5.94	0.96194	Chloride channel, core (2);	0.044023	0.85682	D	0.000000	D	0.97185	0.9080	M	0.76433	2.335	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.999;0.999;0.995;0.994	D;D;D;D;P	0.71870	0.957;0.975;0.962;0.975;0.863	D	0.97134	0.9820	10	0.87932	D	0	-5.2076	20.419	0.99029	0.0:0.0:1.0:0.0	.	307;290;280;307;307	B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.;.;.;CLCN3_HUMAN;.	K	307;307;307;290;280	ENSP00000424603:E307K;ENSP00000261514:E307K;ENSP00000353857:E307K;ENSP00000424540:E290K;ENSP00000425323:E280K	ENSP00000261514:E307K	E	+	1	0	CLCN3	170850029	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.832000	0.97577	0.650000	0.86243	GAA	.	.		0.328	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
ADCY2	108	hgsc.bcm.edu	37	5	7520950	7520950	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:7520950A>G	ENST00000338316.4	+	3	597	c.508A>G	c.(508-510)Acc>Gcc	p.T170A		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	170					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CTCCTCCCACACCATCGTGCT	0.567																																					p.T170A		Atlas-SNP	.											.	ADCY2	337	.	0			c.A508G						.						199.0	129.0	152.0					5																	7520950		2203	4300	6503	SO:0001583	missense	108	exon3			TCCCACACCATCG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.508A>G	chr5.hg19:g.7520950A>G	ENSP00000342952:p.Thr170Ala	75.0	0.0		113.0	11.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	hg19	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	A	17.30	3.353584	0.61293	.	.	ENSG00000078295	ENST00000338316;ENST00000541993	T	0.76578	-1.03	5.65	5.65	0.86999	.	0.054653	0.64402	D	0.000001	T	0.74604	0.3738	L	0.59436	1.845	0.80722	D	1	B	0.25312	0.123	B	0.22753	0.041	T	0.73610	-0.3928	10	0.66056	D	0.02	.	13.6275	0.62173	1.0:0.0:0.0:0.0	.	170	Q08462	ADCY2_HUMAN	A	170;21	ENSP00000342952:T170A	ENSP00000342952:T170A	T	+	1	0	ADCY2	7573950	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.506000	0.73712	2.143000	0.66587	0.528000	0.53228	ACC	.	.		0.567	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
FAM134B	54463	hgsc.bcm.edu	37	5	16617067	16617067	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:16617067G>T	ENST00000306320.9	-	1	100	c.14C>A	c.(13-15)gCg>gAg	p.A5E	CTC-461F20.1_ENST00000504935.1_lincRNA|FAM134B_ENST00000509048.1_5'UTR|RP11-260E18.1_ENST00000499131.1_RNA	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	5					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						CTCCGGAGGCGCCGGGCTCGC	0.801																																					p.A5E		Atlas-SNP	.											.	FAM134B	72	.	0			c.C14A						.						1.0	1.0	1.0					5																	16617067		575	1410	1985	SO:0001583	missense	54463	exon1			GGAGGCGCCGGGC	BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.14C>A	chr5.hg19:g.16617067G>T	ENSP00000304642:p.Ala5Glu	176.0	0.0		295.0	77.0	NM_001034850	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	hg19	CCDS43304.1	.	.	.	.	.	.	.	.	.	.	G	9.810	1.183003	0.21870	.	.	ENSG00000154153	ENST00000306320	T	0.48836	0.8	2.96	-0.694	0.11294	.	.	.	.	.	T	0.29458	0.0734	N	0.19112	0.55	0.19775	N	0.99996	B	0.06786	0.001	B	0.04013	0.001	T	0.25152	-1.0140	9	0.72032	D	0.01	-20.5905	6.875	0.24141	0.0:0.3495:0.4723:0.1782	.	5	Q9H6L5	F134B_HUMAN	E	5	ENSP00000304642:A5E	ENSP00000304642:A5E	A	-	2	0	FAM134B	16670067	0.814000	0.29104	0.906000	0.35671	0.002000	0.02628	2.250000	0.43178	-0.049000	0.13379	-1.133000	0.01973	GCG	.	.		0.801	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1	NM_001034850	
ITGA2	3673	hgsc.bcm.edu	37	5	52371063	52371063	+	Silent	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:52371063A>G	ENST00000296585.5	+	23	2897	c.2754A>G	c.(2752-2754)gaA>gaG	p.E918E		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	918					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				AAAGCCAAGAAGAAAACAAGG	0.348																																					p.E918E		Atlas-SNP	.											.	ITGA2	211	.	0			c.A2754G						.						69.0	71.0	71.0					5																	52371063		2203	4300	6503	SO:0001819	synonymous_variant	3673	exon23			CCAAGAAGAAAAC		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2754A>G	chr5.hg19:g.52371063A>G		150.0	0.0		204.0	43.0	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	hg19	CCDS3957.1																																																																																			.	.		0.348	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
MAST4	375449	hgsc.bcm.edu	37	5	66391425	66391425	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:66391425G>T	ENST00000404260.3	+	7	1151	c.843G>T	c.(841-843)agG>agT	p.R281S	MAST4_ENST00000261569.7_Splice_Site_p.R84S|MAST4_ENST00000490016.2_Splice_Site_p.R89S|MAST4_ENST00000405643.1_Splice_Site_p.R99S|MAST4_ENST00000403666.1_Splice_Site_p.R89S|MAST4_ENST00000403625.2_Splice_Site_p.R278S			O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	281						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTCTCAATAGGACTGATGGAC	0.468																																					p.R278S		Atlas-SNP	.											.	MAST4	218	.	0			c.G834T						.						82.0	87.0	85.0					5																	66391425		1972	4164	6136	SO:0001583	missense	375449	exon7			CAATAGGACTGAT	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000404260.3:c.843G>T	chr5.hg19:g.66391425G>T	ENSP00000385048:p.Arg281Ser	93.0	0.0		124.0	37.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000404260.3	hg19		.	.	.	.	.	.	.	.	.	.	G	19.07	3.756108	0.69648	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	6.04	4.26	0.50523	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.349077	0.10870	U	0.624992	T	0.53498	0.1800	M	0.71920	2.185	0.32711	N	0.511522	P;D;D;P;P	0.67145	0.866;0.996;0.995;0.917;0.949	P;D;P;P;P	0.65773	0.61;0.938;0.844;0.637;0.733	T	0.59731	-0.7399	10	0.62326	D	0.03	.	12.1009	0.53783	0.1395:0.0:0.8605:0.0	.	99;281;84;89;89	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	S	281;278;89;89;99;99;84;84;84	ENSP00000385048:R281S;ENSP00000385727:R278S;ENSP00000421739:R89S;ENSP00000384313:R89S;ENSP00000384099:R99S;ENSP00000261569:R84S;ENSP00000392478:R84S	ENSP00000261569:R84S	R	+	3	2	MAST4	66427181	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	2.945000	0.49043	0.871000	0.35750	0.563000	0.77884	AGG	.	.		0.468	MAST4-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
NAIP	4671	hgsc.bcm.edu	37	5	70308629	70308629	+	Silent	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:70308629T>A	ENST00000517649.1	-	4	404	c.114A>T	c.(112-114)ctA>ctT	p.L38L	NAIP_ENST00000194097.4_Silent_p.L38L|NAIP_ENST00000523981.1_Intron|NAIP_ENST00000503719.2_Intron|NAIP_ENST00000508426.2_Silent_p.L38L	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	38					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		CCTCTTCTTCTAGTTCCTTTG	0.463																																					p.L38L		Atlas-SNP	.											.	NAIP	38	.	0			c.A114T						.						150.0	136.0	141.0					5																	70308629		2202	4296	6498	SO:0001819	synonymous_variant	4671	exon4			TTCTTCTAGTTCC	U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.114A>T	chr5.hg19:g.70308629T>A		148.0	0.0		173.0	29.0	NM_004536	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Silent	SNP	ENST00000517649.1	hg19	CCDS4009.1																																																																																			.	.		0.463	NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
SPATA9	83890	hgsc.bcm.edu	37	5	94994511	94994511	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:94994511G>A	ENST00000274432.8	-	5	722	c.581C>T	c.(580-582)tCt>tTt	p.S194F	RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_5'UTR	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	194					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		CACAGGCTCAGAAAAGGCTTT	0.423																																					p.S194F		Atlas-SNP	.											.	SPATA9	17	.	0			c.C581T						.						119.0	110.0	113.0					5																	94994511		2203	4299	6502	SO:0001583	missense	83890	exon5			GGCTCAGAAAAGG	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.581C>T	chr5.hg19:g.94994511G>A	ENSP00000274432:p.Ser194Phe	63.0	0.0		112.0	37.0	NM_031952	A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	ENST00000274432.8	hg19	CCDS4076.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598019	0.46318	.	.	ENSG00000145757	ENST00000274432	T	0.33438	1.41	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000031	T	0.42877	0.1222	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.33059	-0.9883	10	0.87932	D	0	-21.0328	14.4496	0.67376	0.0:0.0:1.0:0.0	.	194	Q9BWV2	SPAT9_HUMAN	F	194	ENSP00000274432:S194F	ENSP00000274432:S194F	S	-	2	0	SPATA9	95020267	1.000000	0.71417	0.991000	0.47740	0.086000	0.17979	4.225000	0.58600	2.799000	0.96334	0.637000	0.83480	TCT	.	.		0.423	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	NM_031952	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128887588	128887588	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:128887588T>C	ENST00000274487.4	+	7	1487	c.1342T>C	c.(1342-1344)Tgt>Cgt	p.C448R	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	448	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGATGAACCATGTGATACTGT	0.313																																					p.C448R		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.T1342C						.						59.0	60.0	60.0					5																	128887588		2202	4291	6493	SO:0001583	missense	171019	exon7			GAACCATGTGATA	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1342T>C	chr5.hg19:g.128887588T>C	ENSP00000274487:p.Cys448Arg	114.0	0.0		97.0	48.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.174304	0.57692	.	.	ENSG00000145808	ENST00000274487	D	0.86562	-2.14	3.83	3.83	0.44106	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	D	0.90940	0.7152	L	0.58583	1.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90283	0.4316	9	.	.	.	.	12.5284	0.56100	0.0:0.0:0.0:1.0	.	448	Q8TE59	ATS19_HUMAN	R	448	ENSP00000274487:C448R	.	C	+	1	0	ADAMTS19	128915487	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.127000	0.64727	1.968000	0.57251	0.482000	0.46254	TGT	.	.		0.313	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
CDC23	8697	hgsc.bcm.edu	37	5	137527198	137527198	+	Silent	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:137527198T>C	ENST00000394886.2	-	13	1419	c.1389A>G	c.(1387-1389)ggA>ggG	p.G463G		NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	463					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCTCCACATCTCCCACGGCGT	0.428																																					p.G463G		Atlas-SNP	.											.	CDC23	46	.	0			c.A1389G						.						187.0	185.0	186.0					5																	137527198		2203	4300	6503	SO:0001819	synonymous_variant	8697	exon13			CACATCTCCCACG	AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.1389A>G	chr5.hg19:g.137527198T>C		116.0	0.0		137.0	67.0	NM_004661	A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Silent	SNP	ENST00000394886.2	hg19	CCDS4200.2																																																																																			.	.		0.428	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2		
PCDHB8	56128	hgsc.bcm.edu	37	5	140559603	140559603	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:140559603T>A	ENST00000239444.2	+	1	2233	c.1988T>A	c.(1987-1989)cTg>cAg	p.L663Q	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	663	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACTTGCTCCTGGTGGACGGC	0.697																																					p.L663Q		Atlas-SNP	.											.	PCDHB8	199	.	0			c.T1988A						.						33.0	35.0	35.0					5																	140559603		2157	4218	6375	SO:0001583	missense	56128	exon1			TGCTCCTGGTGGA	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1988T>A	chr5.hg19:g.140559603T>A	ENSP00000239444:p.Leu663Gln	72.0	0.0		77.0	39.0	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	hg19	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.829244	0.50845	.	.	ENSG00000120322	ENST00000239444	T	0.70282	-0.47	4.22	4.22	0.49857	Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.88610	0.6483	H	0.96662	3.86	0.33998	D	0.649901	D	0.58268	0.982	D	0.73708	0.981	D	0.94239	0.7483	9	0.87932	D	0	.	13.0554	0.58977	0.0:0.0:0.0:1.0	.	663	Q9UN66	PCDB8_HUMAN	Q	663	ENSP00000239444:L663Q	ENSP00000239444:L663Q	L	+	2	0	PCDHB8	140539787	0.005000	0.15991	1.000000	0.80357	0.530000	0.34684	1.622000	0.36997	1.561000	0.49584	0.248000	0.18094	CTG	.	.		0.697	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140810730	140810730	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:140810730A>T	ENST00000252085.3	+	1	546	c.404A>T	c.(403-405)gAa>gTa	p.E135V	PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	135	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTTTCGTGAAAGTGAATTA	0.413																																					p.E135V		Atlas-SNP	.											.	PCDHGA12	271	.	0			c.A404T						.						79.0	93.0	88.0					5																	140810730		2203	4300	6503	SO:0001583	missense	26025	exon1			TTCGTGAAAGTGA	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.404A>T	chr5.hg19:g.140810730A>T	ENSP00000252085:p.Glu135Val	148.0	0.0		220.0	121.0	NM_032094	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	hg19	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	a	5.240	0.229717	0.09916	.	.	ENSG00000253159	ENST00000252085	T	0.19938	2.11	5.79	5.79	0.91817	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.17066	0.0410	N	0.22421	0.69	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.11329	0.006;0.002	T	0.15723	-1.0427	9	0.25751	T	0.34	.	15.8034	0.78473	1.0:0.0:0.0:0.0	.	135;135	O60330-2;O60330	.;PCDGC_HUMAN	V	135	ENSP00000252085:E135V	ENSP00000252085:E135V	E	+	2	0	PCDHGA12	140790914	0.000000	0.05858	0.236000	0.24074	0.721000	0.41392	0.592000	0.23984	2.215000	0.71742	0.528000	0.53228	GAA	.	.		0.413	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
SLC26A2	1836	hgsc.bcm.edu	37	5	149360924	149360924	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:149360924A>T	ENST00000286298.4	+	3	2036	c.1768A>T	c.(1768-1770)Ata>Tta	p.I590L		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	590	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCTCTACTACATAAACAAAGA	0.398																																					p.I590L		Atlas-SNP	.											.	SLC26A2	48	.	0			c.A1768T						.						75.0	81.0	79.0					5																	149360924		2203	4300	6503	SO:0001583	missense	1836	exon3			TACTACATAAACA	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.1768A>T	chr5.hg19:g.149360924A>T	ENSP00000286298:p.Ile590Leu	64.0	0.0		91.0	48.0	NM_000112	A8K2U3|B2R6J1|Q6N051	Missense_Mutation	SNP	ENST00000286298.4	hg19	CCDS4300.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425079	0.43020	.	.	ENSG00000155850	ENST00000286298	D	0.87729	-2.29	6.07	1.15	0.20763	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.202691	0.53938	D	0.000051	T	0.81749	0.4888	L	0.44542	1.39	0.26728	N	0.970651	B	0.22414	0.069	B	0.29176	0.099	T	0.74124	-0.3766	10	0.87932	D	0	.	9.8135	0.40838	0.5896:0.0:0.4104:0.0	.	590	P50443	S26A2_HUMAN	L	590	ENSP00000286298:I590L	ENSP00000286298:I590L	I	+	1	0	SLC26A2	149341117	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	3.237000	0.51344	0.184000	0.20083	-0.250000	0.11733	ATA	.	.		0.398	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252333.2	NM_000112	
CNOT8	9337	hgsc.bcm.edu	37	5	154242880	154242880	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:154242880A>C	ENST00000517876.1	+	3	518	c.42A>C	c.(40-42)gaA>gaC	p.E14D	CNOT8_ENST00000524105.1_Intron|CNOT8_ENST00000521402.1_3'UTR|CNOT8_ENST00000403027.2_Missense_Mutation_p.E14D|CNOT8_ENST00000521583.1_Intron|CNOT8_ENST00000521450.1_Intron|CNOT8_ENST00000519404.1_Missense_Mutation_p.E14D|CNOT8_ENST00000520671.1_Intron|CNOT8_ENST00000523698.1_Intron|CNOT8_ENST00000285896.6_Missense_Mutation_p.E14D			Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8	14					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTATCTGTGAAGTGTGGGCCA	0.458																																					p.E14D	NSCLC(140;1804 1895 27149 29895 35312)	Atlas-SNP	.											.	CNOT8	20	.	0			c.A42C						.						206.0	191.0	196.0					5																	154242880		2203	4300	6503	SO:0001583	missense	9337	exon2			CTGTGAAGTGTGG	AF053318	CCDS4329.1, CCDS75361.1	5q31-q33	2008-07-18			ENSG00000155508	ENSG00000155508			9207	protein-coding gene	gene with protein product	"""PGK promoter directed over production"""	603731		POP2		10036195, 10637334	Standard	XM_005268527		Approved	CAF1, hCAF1, CALIF	uc003lvw.3	Q9UFF9	OTTHUMG00000130192	ENST00000517876.1:c.42A>C	chr5.hg19:g.154242880A>C	ENSP00000430493:p.Glu14Asp	137.0	0.0		189.0	10.0	NM_004779	B0AZS3|B2RAR8|B7Z8R1|D3DQI8|O95709|Q7Z521|Q9H6Y1	Missense_Mutation	SNP	ENST00000517876.1	hg19	CCDS4329.1	.	.	.	.	.	.	.	.	.	.	A	9.621	1.133845	0.21123	.	.	ENSG00000155508	ENST00000517876;ENST00000520472;ENST00000519211;ENST00000522458;ENST00000403027;ENST00000517568;ENST00000285896;ENST00000519430;ENST00000518028;ENST00000519404;ENST00000519394;ENST00000518775	T;T;T;T;T;T;T;T;T;T;T;T	0.42131	0.98;1.85;0.98;0.98;0.98;0.98;0.98;1.85;1.85;0.98;1.85;0.98	5.2	2.84	0.33178	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.18130	0.0435	N	0.04705	-0.18	0.52501	D	0.999956	B;B	0.14805	0.011;0.0	B;B	0.24155	0.051;0.003	T	0.09707	-1.0662	10	0.06757	T	0.87	-14.2761	8.241	0.31660	0.6843:0.0:0.3157:0.0	.	14;14	B7Z8R1;Q9UFF9	.;CNOT8_HUMAN	D	14	ENSP00000430493:E14D;ENSP00000430215:E14D;ENSP00000429108:E14D;ENSP00000428550:E14D;ENSP00000384747:E14D;ENSP00000428090:E14D;ENSP00000285896:E14D;ENSP00000429310:E14D;ENSP00000429810:E14D;ENSP00000430833:E14D;ENSP00000428842:E14D;ENSP00000429394:E14D	ENSP00000285896:E14D	E	+	3	2	CNOT8	154223073	1.000000	0.71417	0.998000	0.56505	0.867000	0.49689	1.580000	0.36547	0.326000	0.23384	-0.256000	0.11100	GAA	.	.		0.458	CNOT8-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377449.1	NM_004779	
SGCD	6444	hgsc.bcm.edu	37	5	156184773	156184773	+	Intron	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:156184773C>A	ENST00000435422.3	+	7	1183				SGCD_ENST00000517913.1_Missense_Mutation_p.P253T|SGCD_ENST00000447401.1_Missense_Mutation_p.P253T|SGCD_ENST00000337851.4_Intron	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)						muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCCAACCCTTCCCATAACTGG	0.453																																					p.P253T		Atlas-SNP	.											.	SGCD	52	.	0			c.C757A						.						67.0	68.0	67.0					5																	156184773		1940	4152	6092	SO:0001627	intron_variant	6444	exon8			ACCCTTCCCATAA	BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.696+58C>A	chr5.hg19:g.156184773C>A		366.0	0.0		442.0	44.0	NM_172244	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	ENST00000435422.3	hg19	CCDS47327.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512846	0.27123	.	.	ENSG00000170624	ENST00000517913;ENST00000447401	T;T	0.32515	1.45;1.45	3.97	2.13	0.27403	.	.	.	.	.	T	0.23492	0.0568	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.24512	-1.0158	8	0.87932	D	0	.	7.0782	0.25217	0.0:0.6924:0.1446:0.1629	.	253	Q92629-3	.	T	253	ENSP00000429378:P253T;ENSP00000408324:P253T	ENSP00000408324:P253T	P	+	1	0	SGCD	156117351	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	-0.320000	0.08028	0.615000	0.30124	0.655000	0.94253	CCC	.	.		0.453	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3		
SOX30	11063	hgsc.bcm.edu	37	5	157065283	157065283	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr5:157065283A>G	ENST00000265007.6	-	4	2176	c.1835T>C	c.(1834-1836)tTt>tCt	p.F612S	SOX30_ENST00000311371.5_Intron|SOX30_ENST00000519442.1_Missense_Mutation_p.F307S	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	612	Pro-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGGTGATGAAAAGAGAATCT	0.478																																					p.F612S	Esophageal Squamous(31;525 799 19355 21125 41744)	Atlas-SNP	.											.	SOX30	67	.	0			c.T1835C						.						80.0	79.0	79.0					5																	157065283		2203	4300	6503	SO:0001583	missense	11063	exon4			TGATGAAAAGAGA	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1835T>C	chr5.hg19:g.157065283A>G	ENSP00000265007:p.Phe612Ser	209.0	0.0		331.0	42.0	NM_178424	O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	hg19	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619753	0.66787	.	.	ENSG00000039600	ENST00000265007;ENST00000519442	D;D	0.98264	-4.7;-4.83	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000010	D	0.97430	0.9159	L	0.27053	0.805	0.38540	D	0.949194	D;D	0.89917	0.979;1.0	P;D	0.64144	0.702;0.922	D	0.98737	1.0715	10	0.87932	D	0	.	11.6296	0.51166	0.8523:0.1477:0.0:0.0	.	307;612	B4DXW7;O94993	.;SOX30_HUMAN	S	612;307	ENSP00000265007:F612S;ENSP00000427984:F307S	ENSP00000265007:F612S	F	-	2	0	SOX30	156997861	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.417000	0.59822	2.135000	0.66039	0.528000	0.53228	TTT	.	.		0.478	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
ZNF391	346157	hgsc.bcm.edu	37	6	27368626	27368626	+	Silent	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:27368626C>T	ENST00000244576.4	+	3	1022	c.477C>T	c.(475-477)caC>caT	p.H159H		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						AAAGAACTCACACTGGAGAGA	0.393																																					p.H159H		Atlas-SNP	.											.	ZNF391	90	.	0			c.C477T						.						88.0	95.0	92.0					6																	27368626		2199	4298	6497	SO:0001819	synonymous_variant	346157	exon3			AACTCACACTGGA	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.477C>T	chr6.hg19:g.27368626C>T		164.0	0.0		206.0	82.0	NM_001076781	B4DH77	Silent	SNP	ENST00000244576.4	hg19	CCDS43429.1																																																																																			.	.		0.393	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781	
RPP21	79897	hgsc.bcm.edu	37	6	30314488	30314488	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:30314488A>T	ENST00000442966.2	+	5	380		c.e5-1		RPP21_ENST00000428040.2_Splice_Site|RPP21_ENST00000433076.2_Splice_Site|RPP21_ENST00000436442.2_Splice_Site|TRIM39-RPP21_ENST00000513556.1_Splice_Site			Q9H633	RPP21_HUMAN	ribonuclease P/MRP 21kDa subunit						response to drug (GO:0042493)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonuclease P activity (GO:0004526)			endometrium(2)|ovary(1)|prostate(1)	4						TCATTTACTCAGATTCCAAAC	0.463																																					.		Atlas-SNP	.											.	RPP21	11	.	0			c.375-2A>T						.						192.0	200.0	197.0					6																	30314488		1511	2709	4220	SO:0001630	splice_region_variant	79897	exon5			TTACTCAGATTCC	AK026291	CCDS4679.1, CCDS56409.1, CCDS56410.1	6p21.32	2012-05-21	2007-06-26	2004-03-19	ENSG00000241370	ENSG00000241370			21300	protein-coding gene	gene with protein product		612524	"""chromosome 6 open reading frame 135"", ""ribonuclease P 21kDa subunit"""	C6orf135			Standard	NM_001199120		Approved	FLJ22638, Em:AB014085.3		Q9H633	OTTHUMG00000031220	ENST00000442966.2:c.368-1A>T	chr6.hg19:g.30314488A>T		106.0	0.0		131.0	51.0	NM_001199121	A2AAZ8|B0S834|B0S835|Q5JPL9|Q5JPM1|Q5STF8|Q5STF9|Q5STG2|Q5SU41|Q5SU42|Q86Y49|Q86Y50|Q86Y51|Q96F16	Splice_Site	SNP	ENST00000442966.2	hg19	CCDS4679.1	.	.	.	.	.	.	.	.	.	.	A	11.12	1.545539	0.27652	.	.	ENSG00000204599;ENSG00000248167;ENSG00000241370;ENSG00000241370;ENSG00000241370;ENSG00000241370	ENST00000412529;ENST00000513556;ENST00000433076;ENST00000442966;ENST00000428040;ENST00000436442	.	.	.	4.94	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999989	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1552	0.31165	0.8221:0.0:0.0:0.1779	.	.	.	.	.	-1	.	.	.	+	.	.	RPP21;TRIM39-RPP21;TRIM39	30422467	0.962000	0.33011	0.137000	0.22149	0.096000	0.18686	2.370000	0.44240	0.994000	0.38892	0.533000	0.62120	.	.	.		0.463	RPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076451.2	NM_024839	Intron
NOTCH4	4855	hgsc.bcm.edu	37	6	32180406	32180406	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:32180406T>A	ENST00000375023.3	-	17	2665		c.e17-2		NOTCH4_ENST00000465528.1_Splice_Site	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4						cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CATCAGAGTCTGAGGGGTGGG	0.582																																					.		Atlas-SNP	.											.	NOTCH4	201	.	0			c.2527-2A>T						.						103.0	86.0	92.0					6																	32180406		1510	2707	4217	SO:0001630	splice_region_variant	4855	exon18			AGAGTCTGAGGGG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2527-2A>T	chr6.hg19:g.32180406T>A		112.0	0.0		128.0	20.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Splice_Site	SNP	ENST00000375023.3	hg19	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.628123	0.46944	.	.	ENSG00000204301	ENST00000375023	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7824	0.52021	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH4	32288384	1.000000	0.71417	0.963000	0.40424	0.569000	0.35902	5.704000	0.68347	1.959000	0.56917	0.459000	0.35465	.	.	.		0.582	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		Intron
HLA-DQB1	3119	hgsc.bcm.edu	37	6	32632742	32632742	+	Missense_Mutation	SNP	C	C	T	rs281862072		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:32632742C>T	ENST00000399084.1	-	3	390	c.212G>A	c.(211-213)cGc>cAc	p.R71H	HLA-DQB1_ENST00000399082.3_Intron|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.R71H|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.R71H|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.R71H			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	71	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	GCTGTCGAAGCGCGCGTACTC	0.612									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.R71H	Esophageal Squamous(151;720 1825 15000 40336 43415)	Atlas-SNP	.											.	HLA-DQB1	15	.	0			c.G212A						.						38.0	38.0	38.0					6																	32632742		2138	4235	6373	SO:0001583	missense	3119	exon2	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	TCGAAGCGCGCGT		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399084.1:c.212G>A	chr6.hg19:g.32632742C>T	ENSP00000382034:p.Arg71His	61.0	0.0		69.0	30.0	NM_002123	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399084.1	hg19	CCDS43451.1	.	.	.	.	.	.	.	.	.	.	.	10.84	1.463525	0.26248	.	.	ENSG00000179344	ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084	T;T;T;T	0.00367	7.78;7.78;7.78;7.78	4.06	3.19	0.36642	.	0.413935	0.22513	U	0.059068	T	0.00109	0.0003	M	0.73430	2.235	0.32384	N	0.554176	P;B;B;P;B	0.44429	0.835;0.251;0.407;0.55;0.136	B;B;B;B;B	0.33042	0.139;0.09;0.09;0.157;0.067	T	0.46610	-0.9179	10	0.72032	D	0.01	.	6.2113	0.20631	0.0:0.7732:0.0:0.2267	.	81;71;36;71;71	Q59F80;A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.;.	H	71	ENSP00000382029:R71H;ENSP00000364080:R71H;ENSP00000407332:R71H;ENSP00000382034:R71H	ENSP00000364080:R71H	R	-	2	0	HLA-DQB1	32740720	0.914000	0.31030	0.997000	0.53966	0.041000	0.13682	1.127000	0.31357	0.935000	0.37341	0.305000	0.20034	CGC	.	.		0.612	HLA-DQB1-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276127.1	NM_002123	
C6orf141	135398	hgsc.bcm.edu	37	6	49518524	49518524	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:49518524A>T	ENST00000529246.2	+	1	412	c.19A>T	c.(19-21)Agg>Tgg	p.R7W		NM_001145652.1	NP_001139124	Q5SZD1	CF141_HUMAN	chromosome 6 open reading frame 141	7										breast(1)|prostate(1)	2						CCCTTTTGCCAGGATGGAGAC	0.662																																					p.R7W		Atlas-SNP	.											.	C6orf141	7	.	0			c.A19T						.						18.0	21.0	20.0					6																	49518524		692	1591	2283	SO:0001583	missense	135398	exon1			TTTGCCAGGATGG	AK054918	CCDS55018.1	6p12.3	2012-02-06			ENSG00000197261	ENSG00000197261			21351	protein-coding gene	gene with protein product							Standard	NM_001145652		Approved	MGC46457	uc011dwo.2	Q5SZD1	OTTHUMG00000014820	ENST00000529246.2:c.19A>T	chr6.hg19:g.49518524A>T	ENSP00000434602:p.Arg7Trp	196.0	0.0		275.0	64.0	NM_001145652	A8K1H4|Q8N400|Q96NQ1	Missense_Mutation	SNP	ENST00000529246.2	hg19	CCDS55018.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.624179	0.66901	.	.	ENSG00000197261	ENST00000529246	T	0.35605	1.3	4.13	-8.26	0.01021	.	.	.	.	.	T	0.05410	0.0143	N	0.14661	0.345	0.09310	N	1	B	0.28208	0.203	B	0.26864	0.074	T	0.32455	-0.9906	9	0.59425	D	0.04	.	4.6409	0.12548	0.2244:0.1113:0.5539:0.1104	.	7	Q5SZD1	CF141_HUMAN	W	7	ENSP00000434602:R7W	ENSP00000431184:R7W	R	+	1	2	C6orf141	49626483	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.538000	0.06120	-1.949000	0.01031	0.374000	0.22700	AGG	.	.		0.662	C6orf141-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390228.1	NM_153344	
GJB7	375519	hgsc.bcm.edu	37	6	87994409	87994409	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:87994409G>A	ENST00000525899.1	-	3	567	c.222C>T	c.(220-222)gtC>gtT	p.V74V	GJB7_ENST00000296882.3_Silent_p.V74V	NM_198568.2	NP_940970.1	Q6PEY0	CXB7_HUMAN	gap junction protein, beta 7, 25kDa	74					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)	5		all_cancers(76;1.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;7.38e-10)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00323)		BRCA - Breast invasive adenocarcinoma(108;0.0167)		CCCAAAGTCTGACTTGGGAAA	0.448																																					p.V74V		Atlas-SNP	.											.	GJB7	28	.	0			c.C222T						.						118.0	111.0	114.0					6																	87994409		2203	4300	6503	SO:0001819	synonymous_variant	375519	exon3			AAGTCTGACTTGG	AJ414563	CCDS5008.1	6q15	2008-02-05	2007-11-06			ENSG00000164411		"""Ion channels / Gap junction proteins (connexins)"""	16690	protein-coding gene	gene with protein product	"""connexin 25"""	611921	"""gap junction protein, beta 7"""				Standard	NM_198568		Approved	CX25, bA136M9.1	uc003plo.2	Q6PEY0		ENST00000525899.1:c.222C>T	chr6.hg19:g.87994409G>A		144.0	0.0		204.0	56.0	NM_198568	B3KXL0|Q96KP0	Silent	SNP	ENST00000525899.1	hg19	CCDS5008.1																																																																																			.	.		0.448	GJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394780.1		
ROS1	6098	hgsc.bcm.edu	37	6	117609803	117609803	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:117609803G>C	ENST00000368508.3	-	43	7094	c.6896C>G	c.(6895-6897)tCt>tGt	p.S2299C	ROS1_ENST00000368507.3_Missense_Mutation_p.S2293C	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2299					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAGACCACAAGATTCAGATTC	0.473			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.S2299C		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.C6896G						.						104.0	105.0	105.0					6																	117609803		2203	4300	6503	SO:0001583	missense	6098	exon43			CCACAAGATTCAG	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6896C>G	chr6.hg19:g.117609803G>C	ENSP00000357494:p.Ser2299Cys	110.0	0.0		174.0	70.0	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	hg19	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426786	0.43020	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.72167	-0.62;-0.63	4.5	3.62	0.41486	.	0.129523	0.34986	N	0.003528	T	0.44767	0.1309	L	0.29908	0.895	0.09310	N	1	D	0.55172	0.97	P	0.47206	0.541	T	0.35943	-0.9768	10	0.54805	T	0.06	.	7.23	0.26036	0.0909:0.0:0.7427:0.1663	.	2299	P08922	ROS1_HUMAN	C	2299;2293	ENSP00000357494:S2299C;ENSP00000357493:S2293C	ENSP00000357493:S2293C	S	-	2	0	ROS1	117716496	0.269000	0.24143	0.248000	0.24265	0.979000	0.70002	1.170000	0.31883	1.082000	0.41137	0.563000	0.77884	TCT	.	.		0.473	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
ARID1B	57492	hgsc.bcm.edu	37	6	157505501	157505501	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:157505501A>T	ENST00000350026.5	+	12	3444	c.3443A>T	c.(3442-3444)gAg>gTg	p.E1148V	ARID1B_ENST00000367148.1_Missense_Mutation_p.E1201V|ARID1B_ENST00000346085.5_Missense_Mutation_p.E1161V|ARID1B_ENST00000275248.4_Missense_Mutation_p.E1143V	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1148					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CGTGGGGAGGAGCCCCCGCCG	0.582																																					p.E1161V		Atlas-SNP	.											.	ARID1B	320	.	0			c.A3482T						.						58.0	59.0	58.0					6																	157505501		2203	4296	6499	SO:0001583	missense	57492	exon13			GGGAGGAGCCCCC	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3443A>T	chr6.hg19:g.157505501A>T	ENSP00000055163:p.Glu1148Val	187.0	0.0		252.0	48.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	hg19	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	A	16.84	3.234045	0.58886	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000414678;ENST00000319584;ENST00000400790	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.91	5.91	0.95273	ARID/BRIGHT DNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.44767	0.1309	L	0.43152	1.355	0.80722	D	1	D;D;D;D	0.69078	0.997;0.988;0.993;0.993	P;P;P;P	0.59056	0.851;0.606;0.779;0.779	T	0.47086	-0.9144	10	0.72032	D	0.01	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	398;1148;1161;1143	Q8NFD5-4;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	V	1161;1148;1201;1143;618;670;623;215	ENSP00000344546:E1161V;ENSP00000055163:E1148V;ENSP00000356116:E1201V;ENSP00000275248:E1143V;ENSP00000412835:E670V;ENSP00000313006:E623V;ENSP00000383596:E215V	ENSP00000275248:E1143V	E	+	2	0	ARID1B	157547193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.329000	0.96413	2.254000	0.74563	0.533000	0.62120	GAG	.	.		0.582	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
FRMD1	79981	hgsc.bcm.edu	37	6	168465694	168465694	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:168465694G>A	ENST00000283309.6	-	5	569	c.505C>T	c.(505-507)Cgc>Tgc	p.R169C	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_5'UTR|FRMD1_ENST00000440994.2_Missense_Mutation_p.R101C	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	169	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTCAGCACGCGCTCCTTCAAG	0.672																																					p.R169C	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	Atlas-SNP	.											.	FRMD1	52	.	0			c.C505T						.						60.0	51.0	54.0					6																	168465694		2203	4300	6503	SO:0001583	missense	79981	exon5			GCACGCGCTCCTT		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.505C>T	chr6.hg19:g.168465694G>A	ENSP00000283309:p.Arg169Cys	30.0	0.0		54.0	7.0	NM_024919	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	hg19	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307886	0.40895	.	.	ENSG00000153303	ENST00000283309;ENST00000440994	T;T	0.78246	-1.16;-1.16	2.75	1.83	0.25207	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.374549	0.22213	U	0.063074	T	0.78304	0.4262	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.959;0.985;0.954	T	0.78473	-0.2190	10	0.62326	D	0.03	.	10.3608	0.43991	0.0:0.0:0.7875:0.2125	.	81;169;101	B7Z8G9;Q8N878;Q8N878-2	.;FRMD1_HUMAN;.	C	169;101	ENSP00000283309:R169C;ENSP00000414115:R101C	ENSP00000283309:R169C	R	-	1	0	FRMD1	168208543	1.000000	0.71417	0.530000	0.27963	0.051000	0.14879	6.047000	0.71038	0.307000	0.22880	0.313000	0.20887	CGC	.	.		0.672	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		66.0	0.0		93.0	7.0	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
AMZ1	155185	hgsc.bcm.edu	37	7	2748314	2748314	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:2748314T>A	ENST00000312371.4	+	4	933	c.565T>A	c.(565-567)Tgg>Agg	p.W189R	AMZ1_ENST00000407112.1_Missense_Mutation_p.W189R|AMZ1_ENST00000489665.1_3'UTR	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	189							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CCATGAGGCCTGGAGCTTCAC	0.652																																					p.W189R		Atlas-SNP	.											.	AMZ1	41	.	0			c.T565A						.						95.0	80.0	85.0					7																	2748314		2203	4300	6503	SO:0001583	missense	155185	exon4			GAGGCCTGGAGCT	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.565T>A	chr7.hg19:g.2748314T>A	ENSP00000308149:p.Trp189Arg	37.0	0.0		43.0	16.0	NM_133463	B3KRS0|Q8TF51	Missense_Mutation	SNP	ENST00000312371.4	hg19	CCDS34589.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.281509	0.59758	.	.	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.77489	-1.1;-1.1	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	D	0.87696	0.6242	M	0.80183	2.485	0.49389	D	0.99978	D;P	0.89917	1.0;0.952	D;P	0.91635	0.999;0.694	D	0.89529	0.3784	10	0.87932	D	0	-24.9435	13.7325	0.62797	0.0:0.0:0.0:1.0	.	189;189	B3KRS0;Q400G9	.;AMZ1_HUMAN	R	189	ENSP00000308149:W189R;ENSP00000386020:W189R	ENSP00000308149:W189R	W	+	1	0	AMZ1	2714840	1.000000	0.71417	0.993000	0.49108	0.363000	0.29612	4.528000	0.60580	1.689000	0.51079	0.379000	0.24179	TGG	.	.		0.652	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
GNA12	2768	hgsc.bcm.edu	37	7	2834735	2834735	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:2834735G>C	ENST00000275364.3	-	2	514	c.352C>G	c.(352-354)Cct>Gct	p.P118A	GNA12_ENST00000407904.3_Missense_Mutation_p.P59A|GNA12_ENST00000544127.1_Missense_Mutation_p.P42A	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	118					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		TACTGCCAAGGAATGCCAAGC	0.478																																					p.P118A		Atlas-SNP	.											.	GNA12	35	.	0			c.C352G						.						157.0	152.0	154.0					7																	2834735		2203	4300	6503	SO:0001583	missense	2768	exon2			GCCAAGGAATGCC	L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.352C>G	chr7.hg19:g.2834735G>C	ENSP00000275364:p.Pro118Ala	85.0	0.0		164.0	63.0	NM_007353	A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Missense_Mutation	SNP	ENST00000275364.3	hg19	CCDS5335.1	.	.	.	.	.	.	.	.	.	.	G	8.657	0.899656	0.17686	.	.	ENSG00000146535	ENST00000275364;ENST00000407904;ENST00000544127;ENST00000447791	D;D;D	0.88124	-2.34;-2.34;-2.34	5.58	5.58	0.84498	G protein alpha subunit, helical insertion (2);	0.300803	0.37393	N	0.002119	D	0.86306	0.5901	M	0.64404	1.975	0.54753	D	0.999987	B;B;B	0.18310	0.006;0.001;0.027	B;B;B	0.16289	0.006;0.006;0.015	T	0.82452	-0.0450	10	0.49607	T	0.09	.	17.7636	0.88470	0.0:0.0:1.0:0.0	.	118;118;59	Q5PPR5;Q03113;B3KXS2	.;GNA12_HUMAN;.	A	118;59;42;33	ENSP00000275364:P118A;ENSP00000385935:P59A;ENSP00000437469:P42A	ENSP00000275364:P118A	P	-	1	0	GNA12	2801261	1.000000	0.71417	0.173000	0.22940	0.700000	0.40528	2.881000	0.48538	2.641000	0.89580	0.563000	0.77884	CCT	.	.		0.478	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241608.1	NM_007353	
CARD11	84433	hgsc.bcm.edu	37	7	2946324	2946324	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:2946324T>A	ENST00000396946.4	-	25	3816	c.3413A>T	c.(3412-3414)aAg>aTg	p.K1138M		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1138	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CTCGCCGATCTTGTCCTTGAC	0.647			Mis		DLBCL																																p.K1138M		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.A3413T						.						93.0	76.0	82.0					7																	2946324		2203	4300	6503	SO:0001583	missense	84433	exon25			CCGATCTTGTCCT	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3413A>T	chr7.hg19:g.2946324T>A	ENSP00000380150:p.Lys1138Met	98.0	0.0		188.0	63.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	hg19	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	T	14.92	2.680010	0.47886	.	.	ENSG00000198286	ENST00000396946	T	0.17054	2.3	3.68	2.52	0.30459	.	0.092076	0.44902	D	0.000419	T	0.12092	0.0294	L	0.44542	1.39	0.42253	D	0.99198	P	0.42078	0.77	B	0.35899	0.213	T	0.08827	-1.0703	10	0.39692	T	0.17	-25.6192	7.7319	0.28791	0.0:0.1867:0.0:0.8133	.	1138	Q9BXL7	CAR11_HUMAN	M	1138	ENSP00000380150:K1138M	ENSP00000380150:K1138M	K	-	2	0	CARD11	2912850	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	1.465000	0.35299	0.328000	0.23435	0.418000	0.28097	AAG	.	.		0.647	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
TWIST1	7291	hgsc.bcm.edu	37	7	19156809	19156809	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:19156809C>T	ENST00000242261.5	-	1	486	c.136G>A	c.(136-138)Gcg>Acg	p.A46T	AC003986.7_ENST00000417460.1_RNA|AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	46					aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)			lung(2)|upper_aerodigestive_tract(1)	3						ccgccgcccgcgctgcgcctg	0.791																																					p.A46T		Atlas-SNP	.											.	TWIST1	18	.	0			c.G136A						.						1.0	1.0	1.0					7																	19156809		497	928	1425	SO:0001583	missense	7291	exon1			CGCCCGCGCTGCG	U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.136G>A	chr7.hg19:g.19156809C>T	ENSP00000242261:p.Ala46Thr	121.0	0.0		234.0	38.0	NM_000474	A4D128|Q92487|Q99804	Missense_Mutation	SNP	ENST00000242261.5	hg19	CCDS5367.1	.	.	.	.	.	.	.	.	.	.	N	11.31	1.599865	0.28534	.	.	ENSG00000122691	ENST00000242261	D	0.91686	-2.89	3.73	3.73	0.42828	.	0.459579	0.15411	U	0.263751	T	0.80989	0.4730	N	0.08118	0	0.25194	N	0.990101	B	0.27286	0.174	B	0.17722	0.019	T	0.68191	-0.5474	9	.	.	.	-1.7774	11.256	0.49054	0.0:0.6574:0.3426:0.0	.	46	Q15672	TWST1_HUMAN	T	46	ENSP00000242261:A46T	.	A	-	1	0	TWIST1	19123334	.	.	0.538000	0.28064	0.307000	0.27823	.	.	1.682000	0.51000	0.175000	0.17021	GCG	.	.		0.791	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207625.1	NM_000474	
BMPER	168667	hgsc.bcm.edu	37	7	34118743	34118743	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:34118743G>A	ENST00000297161.2	+	13	1727	c.1353G>A	c.(1351-1353)gcG>gcA	p.A451A	BMPER_ENST00000426693.1_Silent_p.A451A	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	451	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.A451A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCTGCCGCGCGCCACACTTCC	0.657																																					p.A451A		Atlas-SNP	.											BMPER,NS,carcinoma,0,1	BMPER	131	.	1	Substitution - coding silent(1)	endometrium(1)	c.G1353A						.						49.0	51.0	50.0					7																	34118743		2203	4300	6503	SO:0001819	synonymous_variant	168667	exon13			CCGCGCGCCACAC		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1353G>A	chr7.hg19:g.34118743G>A		139.0	1.0		221.0	87.0	NM_133468	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	hg19	CCDS5442.1																																																																																			.	.		0.657	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
POU6F2	11281	hgsc.bcm.edu	37	7	39379608	39379608	+	Silent	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:39379608T>A	ENST00000403058.1	+	6	1033	c.879T>A	c.(877-879)ccT>ccA	p.P293P	POU6F2_ENST00000559001.1_Silent_p.P285P|POU6F2_ENST00000518318.2_Silent_p.P293P|POU6F2_ENST00000517348.1_3'UTR	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	293	Gln-rich.|Pro-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CACCCAATCCTCTACAGGTAT	0.602																																					p.P293P		Atlas-SNP	.											.	POU6F2	117	.	0			c.T879A						.						93.0	105.0	101.0					7																	39379608		2203	4300	6503	SO:0001819	synonymous_variant	11281	exon6			CAATCCTCTACAG	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.879T>A	chr7.hg19:g.39379608T>A		35.0	0.0		61.0	25.0	NM_007252	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	ENST00000403058.1	hg19	CCDS34620.2																																																																																			.	.		0.602	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
ELN	2006	hgsc.bcm.edu	37	7	73442595	73442595	+	Silent	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:73442595T>A	ENST00000252034.7	+	1	477	c.78T>A	c.(76-78)ccT>ccA	p.P26P	ELN_ENST00000445912.1_Silent_p.P26P|ELN_ENST00000380575.4_Silent_p.P26P|ELN_ENST00000320492.7_Silent_p.P26P|ELN_ENST00000380562.4_Silent_p.P26P|ELN_ENST00000380576.5_Silent_p.P26P|ELN_ENST00000358929.4_Silent_p.P26P|ELN_ENST00000429192.1_Silent_p.P26P|ELN_ENST00000414324.1_Silent_p.P26P|ELN_ENST00000458204.1_Silent_p.P26P|ELN_ENST00000320399.6_Silent_p.P26P|ELN_ENST00000357036.5_Silent_p.P26P|ELN_ENST00000380553.4_Silent_p.P26P|ELN_ENST00000380584.4_Silent_p.P26P	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	26					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CCTCTCGGCCTGGAGGTAAGG	0.711			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P26P		Atlas-SNP	.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	81	.	0			c.T78A						.						19.0	20.0	20.0					7																	73442595		2197	4297	6494	SO:0001819	synonymous_variant	2006	exon1			TCGGCCTGGAGGT		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.78T>A	chr7.hg19:g.73442595T>A		34.0	0.0		25.0	8.0	NM_001081753	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	hg19	CCDS5562.2																																																																																			.	.		0.711	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
HGF	3082	hgsc.bcm.edu	37	7	81355282	81355282	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:81355282C>G	ENST00000222390.5	-	9	1318	c.1092G>C	c.(1090-1092)tgG>tgC	p.W364C	HGF_ENST00000457544.2_Missense_Mutation_p.W359C	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	364	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						TGGTAAAACACCAGGGTGATT	0.438																																					p.W364C		Atlas-SNP	.											.	HGF	171	.	0			c.G1092C						.						148.0	140.0	142.0					7																	81355282		2203	4300	6503	SO:0001583	missense	3082	exon9			AAAACACCAGGGT		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1092G>C	chr7.hg19:g.81355282C>G	ENSP00000222390:p.Trp364Cys	163.0	0.0		167.0	16.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	hg19	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100680	0.76983	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	D;D	0.81579	-1.51;-1.51	5.51	5.51	0.81932	Kringle (4);Kringle-like fold (1);Kringle, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94928	0.8360	H	0.99565	4.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97174	0.9846	10	0.87932	D	0	.	19.4111	0.94673	0.0:1.0:0.0:0.0	.	359;364	P14210-3;P14210	.;HGF_HUMAN	C	364;359	ENSP00000222390:W364C;ENSP00000391238:W359C	ENSP00000222390:W364C	W	-	3	0	HGF	81193218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.935000	0.75886	2.580000	0.87095	0.591000	0.81541	TGG	.	.		0.438	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
PCLO	27445	hgsc.bcm.edu	37	7	82580060	82580060	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:82580060T>A	ENST00000333891.9	-	6	10181	c.9844A>T	c.(9844-9846)Agg>Tgg	p.R3282W	PCLO_ENST00000423517.2_Missense_Mutation_p.R3282W|PCLO_ENST00000437081.1_Missense_Mutation_p.R2W	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTCTCCTGCCTCATCATGAAC	0.483																																					p.R3282W		Atlas-SNP	.											.	PCLO	1506	.	0			c.A9844T						.						145.0	135.0	138.0					7																	82580060		1998	4192	6190	SO:0001583	missense	27445	exon6			CCTGCCTCATCAT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9844A>T	chr7.hg19:g.82580060T>A	ENSP00000334319:p.Arg3282Trp	62.0	0.0		65.0	10.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	13.58	2.280802	0.40294	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.18810	2.19;2.19	5.29	5.29	0.74685	.	.	.	.	.	T	0.44030	0.1274	M	0.61703	1.905	0.42720	D	0.993671	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.74348	0.926;0.983;0.983	T	0.42189	-0.9466	9	0.87932	D	0	.	15.1715	0.72878	0.0:0.0:0.0:1.0	.	3213;3282;3282	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	W	3213;3282;3282;2	ENSP00000334319:R3282W;ENSP00000388393:R3282W	ENSP00000334319:R3282W	R	-	1	2	PCLO	82417996	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.560000	0.53763	2.128000	0.65567	0.460000	0.39030	AGG	.	.		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
SEMA3E	9723	hgsc.bcm.edu	37	7	82997259	82997259	+	Silent	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:82997259T>C	ENST00000307792.3	-	17	2438	c.1971A>G	c.(1969-1971)gtA>gtG	p.V657V	SEMA3E_ENST00000427262.1_Silent_p.V597V	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	657	Ig-like C2-type.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				AGCTATGCTCTACTGTCTGGC	0.458																																					p.V657V		Atlas-SNP	.											.	SEMA3E	125	.	0			c.A1971G						.						131.0	119.0	123.0					7																	82997259		2203	4300	6503	SO:0001819	synonymous_variant	9723	exon17			ATGCTCTACTGTC	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1971A>G	chr7.hg19:g.82997259T>C		101.0	0.0		94.0	20.0	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	hg19	CCDS34674.1																																																																																			.	.		0.458	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
ZNF394	84124	hgsc.bcm.edu	37	7	99096398	99096398	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:99096398G>A	ENST00000337673.6	-	2	727	c.524C>T	c.(523-525)gCa>gTa	p.A175V	ZNF394_ENST00000394177.3_5'UTR|ZNF789_ENST00000494186.1_Intron|ZNF394_ENST00000426306.2_Intron|ZNF789_ENST00000493485.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	175	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GTCCCTCCGTGCTGGGTCCAG	0.582																																					p.A175V	Ovarian(24;589 697 9939 12704 40742)	Atlas-SNP	.											.	ZNF394	48	.	0			c.C524T						.						116.0	89.0	98.0					7																	99096398		2203	4300	6503	SO:0001583	missense	84124	exon2			CTCCGTGCTGGGT	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.524C>T	chr7.hg19:g.99096398G>A	ENSP00000337363:p.Ala175Val	66.0	0.0		63.0	16.0	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	ENST00000337673.6	hg19	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.525650	0.44969	.	.	ENSG00000160908	ENST00000337673	T	0.02498	4.27	4.31	3.36	0.38483	Krueppel-associated box (4);	0.000000	0.43110	D	0.000615	T	0.02767	0.0083	L	0.49455	1.56	0.19300	N	0.999977	B	0.31910	0.346	B	0.30105	0.111	T	0.41963	-0.9479	10	0.19147	T	0.46	.	5.3024	0.15785	0.1218:0.2004:0.6778:0.0	.	175	Q53GI3	ZN394_HUMAN	V	175	ENSP00000337363:A175V	ENSP00000337363:A175V	A	-	2	0	ZNF394	98934334	0.009000	0.17119	0.028000	0.17463	0.115000	0.19883	0.508000	0.22692	1.286000	0.44565	0.563000	0.77884	GCA	.	.		0.582	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
PODXL	5420	hgsc.bcm.edu	37	7	131241035	131241035	+	Silent	SNP	C	C	G	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:131241035C>G	ENST00000378555.3	-	1	331	c.84G>C	c.(82-84)ccG>ccC	p.P28P	PODXL_ENST00000537928.1_Silent_p.P28P|PODXL_ENST00000541194.1_Silent_p.P28P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000322985.9_Silent_p.P28P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					GGGAGggcgacggcgacggcg	0.741																																					p.P28P		Atlas-SNP	.											.	PODXL	53	.	2	Deletion - In frame(2)	prostate(2)	c.G84C						.																																			SO:0001819	synonymous_variant	5420	exon1			GGGCGACGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84G>C	chr7.hg19:g.131241035C>G		52.0	0.0		74.0	6.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
PLXNA4	91584	hgsc.bcm.edu	37	7	131872243	131872243	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:131872243A>T	ENST00000359827.3	-	15	3942	c.2980T>A	c.(2980-2982)Tgt>Agt	p.C994S	PLXNA4_ENST00000321063.4_Missense_Mutation_p.C994S			Q9HCM2	PLXA4_HUMAN	plexin A4	994	IPT/TIG 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGGAAGAGACAGGGCTGCTTT	0.552																																					p.C994S		Atlas-SNP	.											.	PLXNA4	873	.	0			c.T2980A						.						221.0	239.0	233.0					7																	131872243		2078	4221	6299	SO:0001583	missense	91584	exon15			AGAGACAGGGCTG	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2980T>A	chr7.hg19:g.131872243A>T	ENSP00000352882:p.Cys994Ser	63.0	0.0		69.0	14.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653721	0.88056	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.62941	-0.01;-0.01	5.54	5.54	0.83059	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83492	0.5266	M	0.92555	3.32	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.87696	0.2557	10	0.72032	D	0.01	.	15.6748	0.77307	1.0:0.0:0.0:0.0	.	994	Q9HCM2	PLXA4_HUMAN	S	994	ENSP00000323194:C994S;ENSP00000352882:C994S	ENSP00000323194:C994S	C	-	1	0	PLXNA4	131522783	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.930000	0.92872	2.114000	0.64651	0.454000	0.30748	TGT	.	.		0.552	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
PDIA4	9601	hgsc.bcm.edu	37	7	148709035	148709035	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:148709035C>A	ENST00000286091.4	-	6	1114	c.882G>T	c.(880-882)aaG>aaT	p.K294N		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	294	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CCTGGACCTGCTTCAGGGTCA	0.567																																					p.K294N		Atlas-SNP	.											.	PDIA4	57	.	0			c.G882T						.						94.0	86.0	89.0					7																	148709035		2203	4300	6503	SO:0001583	missense	9601	exon6			GACCTGCTTCAGG	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.882G>T	chr7.hg19:g.148709035C>A	ENSP00000286091:p.Lys294Asn	63.0	0.0		73.0	5.0	NM_004911	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	hg19	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	c	17.89	3.498563	0.64298	.	.	ENSG00000155660	ENST00000286091	T	0.78003	-1.14	5.14	4.05	0.47172	Thioredoxin-like fold (3);	0.042698	0.85682	D	0.000000	T	0.81950	0.4931	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.80228	-0.1469	10	0.37606	T	0.19	.	12.4775	0.55823	0.0:0.858:0.0:0.142	.	294	P13667	PDIA4_HUMAN	N	294	ENSP00000286091:K294N	ENSP00000286091:K294N	K	-	3	2	PDIA4	148339968	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	0.808000	0.27154	2.423000	0.82170	0.639000	0.83563	AAG	.	.		0.567	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
NOS3	4846	hgsc.bcm.edu	37	7	150698381	150698381	+	Missense_Mutation	SNP	G	G	T	rs145811781		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:150698381G>T	ENST00000484524.1	+	10	1296	c.1296G>T	c.(1294-1296)gaG>gaT	p.E432D	NOS3_ENST00000467517.1_Missense_Mutation_p.E432D|NOS3_ENST00000461406.1_Missense_Mutation_p.E226D|NOS3_ENST00000297494.3_Missense_Mutation_p.E432D	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCACCTGGAGAATGAGCAGA	0.617																																					p.E432D		Atlas-SNP	.											.	NOS3	131	.	0			c.G1296T						.	G	ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU	0,4406		0,0,2203	66.0	69.0	68.0		1296,1296,1296,1296	1.2	1.0	7	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	NOS3	NM_000603.4,NM_001160109.1,NM_001160110.1,NM_001160111.1	45,45,45,45	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	432/1204,432/597,432/615,432/630	150698381	1,13005	2203	4300	6503	SO:0001583	missense	4846	exon10			CCTGGAGAATGAG		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1296G>T	chr7.hg19:g.150698381G>T	ENSP00000420215:p.Glu432Asp	46.0	0.0		49.0	12.0	NM_001160111	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	hg19	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416681	0.42918	0.0	1.16E-4	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.13	1.22	0.21188	Nitric oxide synthase, oxygenase domain (2);	0.094778	0.42964	N	0.000631	T	0.25865	0.0630	L	0.48218	1.51	0.40758	D	0.982975	B;B;B;P;B	0.49862	0.001;0.001;0.03;0.929;0.377	B;B;B;P;B	0.56278	0.008;0.008;0.116;0.795;0.147	T	0.03795	-1.1003	10	0.42905	T	0.14	-13.1128	4.5865	0.12285	0.3514:0.1529:0.4957:0.0	.	432;432;432;226;432	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	D	432;226;432;432	ENSP00000297494:E432D;ENSP00000417143:E226D;ENSP00000420215:E432D;ENSP00000420551:E432D	ENSP00000297494:E432D	E	+	3	2	NOS3	150329314	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	2.560000	0.45896	-0.056000	0.13221	-0.215000	0.12644	GAG	.	G|1.000;T|0.000		0.617	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
INSIG1	3638	hgsc.bcm.edu	37	7	155094075	155094075	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr7:155094075G>A	ENST00000340368.4	+	4	863	c.652G>A	c.(652-654)Gct>Act	p.A218T	INSIG1_ENST00000342407.5_Intron|INSIG1_ENST00000344756.4_Missense_Mutation_p.A66T	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	218					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GATCACCATAGCTTTTCTAGC	0.438																																					p.A218T		Atlas-SNP	.											.	INSIG1	20	.	0			c.G652A						.						126.0	114.0	118.0					7																	155094075		2203	4300	6503	SO:0001583	missense	3638	exon4			ACCATAGCTTTTC		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.652G>A	chr7.hg19:g.155094075G>A	ENSP00000344741:p.Ala218Thr	106.0	0.0		104.0	37.0	NM_005542	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	hg19	CCDS5938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.474863|5.474863	0.96291|0.96291	.|.	.|.	ENSG00000186480|ENSG00000186480	ENST00000340368;ENST00000344756|ENST00000476756	T;T|.	0.57107|.	0.42;0.43|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77818|0.77818	0.4187|0.4187	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.994;1.0|.	D;D|.	0.91635|.	0.946;0.999|.	T|T	0.76353|0.76353	-0.2990|-0.2990	10|5	0.54805|.	T|.	0.06|.	.|.	19.8944|19.8944	0.96949|0.96949	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	66;218|.	F5H6P3;O15503|.	.;INSI1_HUMAN|.	T|N	218;66|126	ENSP00000344741:A218T;ENSP00000340010:A66T|.	ENSP00000344741:A218T|.	A|S	+|+	1|2	0|0	INSIG1|INSIG1	154725010|154725010	1.000000|1.000000	0.71417|0.71417	0.884000|0.884000	0.34674|0.34674	0.844000|0.844000	0.47949|0.47949	9.113000|9.113000	0.94321|0.94321	2.695000|2.695000	0.91970|0.91970	0.650000|0.650000	0.86243|0.86243	GCT|AGC	.	.		0.438	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
PIWIL2	55124	hgsc.bcm.edu	37	8	22137035	22137035	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:22137035G>A	ENST00000454009.2	+	2	645	c.136G>A	c.(136-138)Ggc>Agc	p.G46S	PIWIL2_ENST00000521356.1_Missense_Mutation_p.G46S|PIWIL2_ENST00000356766.6_Missense_Mutation_p.G46S	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	46					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		AGCACCTGCAGGCAGAGGCCA	0.577																																					p.G46S		Atlas-SNP	.											.	PIWIL2	100	.	0			c.G136A						.						93.0	93.0	93.0					8																	22137035		2203	4300	6503	SO:0001583	missense	55124	exon2			CCTGCAGGCAGAG	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.136G>A	chr8.hg19:g.22137035G>A	ENSP00000406956:p.Gly46Ser	99.0	0.0		97.0	19.0	NM_001135721	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	ENST00000454009.2	hg19	CCDS6029.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399050	0.42512	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.05025	3.55;3.51;3.55	5.93	4.12	0.48240	.	0.072152	0.52532	D	0.000075	T	0.05044	0.0135	L	0.27053	0.805	0.29043	N	0.884999	B;B	0.18013	0.025;0.025	B;B	0.12837	0.008;0.008	T	0.09509	-1.0671	10	0.49607	T	0.09	-20.8528	9.0002	0.36077	0.1429:0.0:0.8571:0.0	.	46;46	E7ECA4;Q8TC59	.;PIWL2_HUMAN	S	46	ENSP00000349208:G46S;ENSP00000428267:G46S;ENSP00000406956:G46S	ENSP00000349208:G46S	G	+	1	0	PIWIL2	22192980	0.976000	0.34144	0.983000	0.44433	0.612000	0.37316	1.476000	0.35420	2.808000	0.96608	0.655000	0.94253	GGC	.	.		0.577	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1		
KCNB2	9312	hgsc.bcm.edu	37	8	73849796	73849796	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:73849796C>T	ENST00000523207.1	+	3	2794	c.2206C>T	c.(2206-2208)Cca>Tca	p.P736S		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	736					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CACAGCCAGGCCACTGCCAGT	0.542																																					p.P736S		Atlas-SNP	.											.	KCNB2	228	.	0			c.C2206T						.						100.0	106.0	104.0					8																	73849796		2203	4300	6503	SO:0001583	missense	9312	exon3			GCCAGGCCACTGC	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2206C>T	chr8.hg19:g.73849796C>T	ENSP00000430846:p.Pro736Ser	106.0	0.0		225.0	17.0	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	hg19	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.022416	0.35701	.	.	ENSG00000182674	ENST00000523207	T	0.23147	1.92	5.04	5.04	0.67666	.	0.960065	0.08478	N	0.939986	T	0.21145	0.0509	N	0.16368	0.405	0.42207	D	0.99179	B	0.12013	0.005	B	0.18263	0.021	T	0.04103	-1.0977	10	0.62326	D	0.03	.	14.2015	0.65707	0.0:0.8506:0.1494:0.0	.	736	Q92953	KCNB2_HUMAN	S	736	ENSP00000430846:P736S	ENSP00000430846:P736S	P	+	1	0	KCNB2	74012350	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	3.846000	0.55888	2.602000	0.87976	0.591000	0.81541	CCA	.	.		0.542	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
SLC10A5	347051	hgsc.bcm.edu	37	8	82606852	82606852	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:82606852T>A	ENST00000518568.1	-	1	1557	c.356A>T	c.(355-357)aAg>aTg	p.K119M		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	119						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						TTTCACATTCTTGATTTCTTC	0.353																																					p.K119M		Atlas-SNP	.											.	SLC10A5	35	.	0			c.A356T						.						142.0	132.0	135.0					8																	82606852		2203	4300	6503	SO:0001583	missense	347051	exon1			ACATTCTTGATTT		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.356A>T	chr8.hg19:g.82606852T>A	ENSP00000428612:p.Lys119Met	103.0	0.0		234.0	32.0	NM_001010893	B2RN26	Missense_Mutation	SNP	ENST00000518568.1	hg19	CCDS34915.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.105680	0.56291	.	.	ENSG00000253598	ENST00000518568	T	0.09445	2.98	5.7	3.29	0.37713	.	0.274240	0.26146	N	0.026076	T	0.11665	0.0284	L	0.27053	0.805	0.26302	N	0.97796	D	0.58620	0.983	P	0.52710	0.707	T	0.08493	-1.0719	10	0.56958	D	0.05	-2.3846	6.1091	0.20090	0.0:0.0838:0.1623:0.7539	.	119	Q5PT55	NTCP5_HUMAN	M	119	ENSP00000428612:K119M	ENSP00000428612:K119M	K	-	2	0	SLC10A5	82769407	0.956000	0.32656	1.000000	0.80357	0.957000	0.61999	0.545000	0.23268	0.412000	0.25729	0.533000	0.62120	AAG	.	.		0.353	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493	
GRHL2	79977	hgsc.bcm.edu	37	8	102570707	102570707	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:102570707A>T	ENST00000251808.3	+	4	683	c.345A>T	c.(343-345)caA>caT	p.Q115H	GRHL2_ENST00000395927.1_Missense_Mutation_p.Q99H	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	115					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			ACCGAGTGCAAGTCCTAAAGA	0.483																																					p.Q115H		Atlas-SNP	.											.	GRHL2	68	.	0			c.A345T						.						125.0	126.0	126.0					8																	102570707		2203	4300	6503	SO:0001583	missense	79977	exon4			AGTGCAAGTCCTA	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.345A>T	chr8.hg19:g.102570707A>T	ENSP00000251808:p.Gln115His	146.0	0.0		352.0	41.0	NM_024915	A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	ENST00000251808.3	hg19	CCDS34931.1	.	.	.	.	.	.	.	.	.	.	A	9.039	0.989202	0.18966	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.13196	2.61;2.62	5.26	3.33	0.38152	.	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	L	0.44542	1.39	0.52501	D	0.999959	D;B	0.67145	0.996;0.054	D;B	0.75484	0.986;0.028	T	0.06006	-1.0851	10	0.20046	T	0.44	-23.8905	7.1112	0.25390	0.4104:0.0:0.5896:0.0	.	115;115	B4DL28;Q6ISB3	.;GRHL2_HUMAN	H	115;99;115	ENSP00000251808:Q115H;ENSP00000379260:Q99H	ENSP00000251808:Q115H	Q	+	3	2	GRHL2	102639883	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	2.227000	0.42972	0.493000	0.27837	-0.312000	0.09012	CAA	.	.		0.483	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1	NM_024915	
ZFPM2	23414	hgsc.bcm.edu	37	8	106331209	106331209	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:106331209C>T	ENST00000407775.2	+	1	290	c.40C>T	c.(40-42)Cgg>Tgg	p.R14W	ZFPM2_ENST00000520492.1_5'Flank	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	14					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GCAGATCAAACGTAAGTTTGC	0.711																																					p.R14W		Atlas-SNP	.											.	ZFPM2	219	.	0			c.C40T						.						5.0	7.0	6.0					8																	106331209		1557	3525	5082	SO:0001630	splice_region_variant	23414	exon1			ATCAAACGTAAGT	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.40+1C>T	chr8.hg19:g.106331209C>T		291.0	0.0		673.0	148.0	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	hg19	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	31	5.097507	0.94197	.	.	ENSG00000169946	ENST00000407775	T	0.22134	1.97	3.66	3.66	0.41972	.	.	.	.	.	T	0.30039	0.0752	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	P	0.57679	0.825	T	0.05370	-1.0889	9	0.54805	T	0.06	.	13.9515	0.64121	0.0:1.0:0.0:0.0	.	14	Q8WW38	FOG2_HUMAN	W	14	ENSP00000384179:R14W	ENSP00000384179:R14W	R	+	1	2	ZFPM2	106400385	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.319000	0.72871	1.582000	0.49881	0.585000	0.79938	CGG	.	.		0.711	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		Missense_Mutation
TRPS1	7227	hgsc.bcm.edu	37	8	116616720	116616720	+	Silent	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:116616720A>G	ENST00000220888.5	-	3	1596	c.1437T>C	c.(1435-1437)tcT>tcC	p.S479S	TRPS1_ENST00000395715.3_Silent_p.S492S|TRPS1_ENST00000520276.1_Silent_p.S483S|TRPS1_ENST00000519674.1_Silent_p.S479S|TRPS1_ENST00000519076.1_Intron			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	479					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GATTAATGACAGAGCCCCTGG	0.463									Langer-Giedion syndrome																												p.S492S		Atlas-SNP	.											.	TRPS1	516	.	0			c.T1476C						.						73.0	70.0	71.0					8																	116616720		1902	4116	6018	SO:0001819	synonymous_variant	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AATGACAGAGCCC	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1437T>C	chr8.hg19:g.116616720A>G		89.0	0.0		180.0	17.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	hg19																																																																																				.	.		0.463	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
TRPS1	7227	hgsc.bcm.edu	37	8	116631492	116631492	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:116631492A>T	ENST00000220888.5	-	2	953	c.794T>A	c.(793-795)tTg>tAg	p.L265*	TRPS1_ENST00000395715.3_Nonsense_Mutation_p.L278*|TRPS1_ENST00000520276.1_Nonsense_Mutation_p.L269*|TRPS1_ENST00000519674.1_Nonsense_Mutation_p.L265*|TRPS1_ENST00000519076.1_Nonsense_Mutation_p.L219*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	265					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATGAAGGGCCAAGATTTTGCT	0.483									Langer-Giedion syndrome																												p.L278X		Atlas-SNP	.											.	TRPS1	516	.	0			c.T833A						.						101.0	98.0	99.0					8																	116631492		1937	4156	6093	SO:0001587	stop_gained	7227	exon3	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AGGGCCAAGATTT	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.794T>A	chr8.hg19:g.116631492A>T	ENSP00000220888:p.Leu265*	191.0	0.0		299.0	27.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	A	37	6.139141	0.97315	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	.	.	.	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4401	0.75176	1.0:0.0:0.0:0.0	.	.	.	.	X	278;265;219;269;265	.	ENSP00000220888:L265X	L	-	2	0	TRPS1	116700667	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.339000	0.96797	2.056000	0.61249	0.377000	0.23210	TTG	.	.		0.483	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
KIFC2	90990	hgsc.bcm.edu	37	8	145698549	145698549	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr8:145698549T>C	ENST00000301332.2	+	17	2610	c.2233T>C	c.(2233-2235)Tct>Cct	p.S745P	KIFC2_ENST00000301331.5_3'UTR|FOXH1_ENST00000525197.1_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	745	Pro-rich.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGGGAGACAGTCTGCTCCCTC	0.741																																					p.S745P		Atlas-SNP	.											.	KIFC2	53	.	0			c.T2233C						.						8.0	10.0	9.0					8																	145698549		2148	4235	6383	SO:0001583	missense	90990	exon17			AGACAGTCTGCTC	AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.2233T>C	chr8.hg19:g.145698549T>C	ENSP00000301332:p.Ser745Pro	85.0	0.0		193.0	15.0	NM_145754	E9PHB2|Q96NN6	Missense_Mutation	SNP	ENST00000301332.2	hg19	CCDS6427.1	.	.	.	.	.	.	.	.	.	.	T	13.32	2.201064	0.38905	.	.	ENSG00000167702	ENST00000301332	T	0.71341	-0.56	4.45	4.45	0.53987	.	.	.	.	.	T	0.59224	0.2178	N	0.14661	0.345	0.80722	D	1	P;P	0.50943	0.94;0.79	P;B	0.48030	0.564;0.276	T	0.62435	-0.6855	9	0.45353	T	0.12	-1.3599	11.692	0.51521	0.0:0.0:0.0:1.0	.	133;745	Q96BU4;Q96AC6	.;KIFC2_HUMAN	P	745	ENSP00000301332:S745P	ENSP00000301332:S745P	S	+	1	0	KIFC2	145669357	0.994000	0.37717	0.986000	0.45419	0.377000	0.30045	5.212000	0.65225	1.882000	0.54519	0.397000	0.26171	TCT	.	.		0.741	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754	
PSIP1	11168	hgsc.bcm.edu	37	9	15472658	15472658	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:15472658T>G	ENST00000380733.4	-	10	1292	c.949A>C	c.(949-951)Aag>Cag	p.K317Q	PSIP1_ENST00000380738.4_Missense_Mutation_p.K317Q|PSIP1_ENST00000380715.1_Missense_Mutation_p.K317Q|PSIP1_ENST00000397519.2_Missense_Mutation_p.K317Q|PSIP1_ENST00000380716.4_Missense_Mutation_p.K317Q			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	317					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		TCCTCTTGCTTGCGTTTTCGA	0.363																																					p.K317Q		Atlas-SNP	.											.	PSIP1	93	.	0			c.A949C						.						192.0	168.0	176.0					9																	15472658		2202	4299	6501	SO:0001583	missense	11168	exon9			CTTGCTTGCGTTT	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.949A>C	chr9.hg19:g.15472658T>G	ENSP00000370109:p.Lys317Gln	87.0	0.0		84.0	46.0	NM_021144	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Missense_Mutation	SNP	ENST00000380733.4	hg19	CCDS6479.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.910404	0.72983	.	.	ENSG00000164985	ENST00000380733;ENST00000380738;ENST00000380715;ENST00000380716;ENST00000397519	T;T;T;T;T	0.54675	0.71;0.71;0.59;0.56;0.56	6.07	6.07	0.98685	.	0.260464	0.41194	D	0.000923	T	0.60869	0.2302	L	0.59436	1.845	0.36716	D	0.880892	P;P	0.51351	0.944;0.839	P;B	0.50617	0.646;0.276	T	0.70687	-0.4803	10	0.87932	D	0	.	15.2061	0.73180	0.0:0.0:0.0:1.0	.	317;317	O75475-2;O75475	.;PSIP1_HUMAN	Q	317	ENSP00000370109:K317Q;ENSP00000370114:K317Q;ENSP00000370091:K317Q;ENSP00000370092:K317Q;ENSP00000380653:K317Q	ENSP00000370091:K317Q	K	-	1	0	PSIP1	15462658	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.157000	0.64911	2.330000	0.79161	0.477000	0.44152	AAG	.	.		0.363	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222	
PRUNE2	158471	hgsc.bcm.edu	37	9	79320430	79320430	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:79320430T>A	ENST00000376718.3	-	8	6883	c.6760A>T	c.(6760-6762)Agc>Tgc	p.S2254C	PRUNE2_ENST00000428286.1_Missense_Mutation_p.S1895C	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2254					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GGAGAAAAGCTGTCTGATATC	0.448																																					p.S2254C		Atlas-SNP	.											.	PRUNE2	331	.	0			c.A6760T						.						53.0	50.0	51.0					9																	79320430		1568	3582	5150	SO:0001583	missense	158471	exon8			AAAAGCTGTCTGA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6760A>T	chr9.hg19:g.79320430T>A	ENSP00000365908:p.Ser2254Cys	152.0	0.0		141.0	35.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.83|15.83	2.948782|2.948782	0.53186|0.53186	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000426088|ENST00000376718;ENST00000428286;ENST00000422033	.|T;T	.|0.47869	.|0.83;0.84	5.92|5.92	2.0|2.0	0.26442|0.26442	.|.	.|1.181910	.|0.06099	.|N	.|0.665088	T|T	0.38904|0.38904	0.1058|0.1058	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|P	.|0.48640	.|0.913	.|B	.|0.43103	.|0.408	T|T	0.37337|0.37337	-0.9710|-0.9710	5|10	.|0.87932	.|D	.|0	0.3904|0.3904	9.9257|9.9257	0.41492|0.41492	0.0:0.6552:0.0:0.3448|0.0:0.6552:0.0:0.3448	.|.	.|2254	.|Q8WUY3	.|PRUN2_HUMAN	L|C	1575|2254;1895;2253	.|ENSP00000365908:S2254C;ENSP00000397425:S1895C	.|ENSP00000365908:S2254C	Q|S	-|-	2|1	0|0	PRUNE2|PRUNE2	78510250|78510250	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.119000|0.119000	0.20118|0.20118	-0.423000|-0.423000	0.07034|0.07034	0.396000|0.396000	0.25283|0.25283	-0.242000|-0.242000	0.12053|0.12053	CAG|AGC	.	.		0.448	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TLE4	7091	hgsc.bcm.edu	37	9	82324551	82324551	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:82324551C>G	ENST00000376552.2	+	14	2295	c.1277C>G	c.(1276-1278)cCa>cGa	p.P426R	TLE4_ENST00000376520.4_Missense_Mutation_p.P458R|TLE4_ENST00000376534.4_Missense_Mutation_p.P63R|TLE4_ENST00000376544.3_Missense_Mutation_p.P357R|TLE4_ENST00000265284.6_Missense_Mutation_p.P401R|TLE4_ENST00000376537.4_Missense_Mutation_p.P458R	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	426					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						GGATTTGATCCACACCATCAC	0.423																																					p.P426R		Atlas-SNP	.											.	TLE4	187	.	0			c.C1277G						.						97.0	98.0	97.0					9																	82324551		1914	4134	6048	SO:0001583	missense	7091	exon14			TTGATCCACACCA	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1277C>G	chr9.hg19:g.82324551C>G	ENSP00000365735:p.Pro426Arg	75.0	0.0		78.0	21.0	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	hg19	CCDS43837.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.067392|5.067392	0.93898|0.93898	.|.	.|.	ENSG00000106829|ENSG00000106829	ENST00000417836|ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000376534;ENST00000265284;ENST00000467142	.|T;T;T;T;T;T;T	.|0.53857	.|0.63;0.79;0.83;0.84;0.6;0.73;0.92	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78207|0.78207	0.4247|0.4247	M|M	0.87758|0.87758	2.905|2.905	0.80722|0.80722	D|D	1|1	.|P;D;P;P	.|0.76494	.|0.919;0.999;0.823;0.869	.|P;D;P;P	.|0.80764	.|0.807;0.994;0.751;0.646	T|T	0.80410|0.80410	-0.1394|-0.1394	5|10	.|0.72032	.|D	.|0.01	-11.3478|-11.3478	20.2963|20.2963	0.98556|0.98556	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|401;357;458;426	.|F8W6T6;Q04727-2;Q04727-3;Q04727	.|.;.;.;TLE4_HUMAN	D|R	191|426;357;458;458;63;401;154	.|ENSP00000365735:P426R;ENSP00000365727:P357R;ENSP00000365703:P458R;ENSP00000365720:P458R;ENSP00000365717:P63R;ENSP00000265284:P401R;ENSP00000418409:P154R	.|ENSP00000265284:P401R	H|P	+|+	1|2	0|0	TLE4|TLE4	81514371|81514371	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.559000|7.559000	0.82265|0.82265	2.813000|2.813000	0.96785|0.96785	0.655000|0.655000	0.94253|0.94253	CAC|CCA	.	.		0.423	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90535925	90535925	+	RNA	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:90535925C>G	ENST00000602681.1	+	0	1829							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCTCTTTCCCAGTCCTATCT	0.537																																					p.P368R		Atlas-SNP	.											.	.	.	.	0			c.C1103G						.						19.0	18.0	18.0					9																	90535925		691	1579	2270			441452	exon4			CTTTCCCAGTCCT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		chr9.hg19:g.90535925C>G		126.0	0.0		143.0	41.0	NM_001145124		Missense_Mutation	SNP	ENST00000602681.1	hg19																																																																																				.	.		0.537	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
SLC44A1	23446	hgsc.bcm.edu	37	9	108145486	108145486	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:108145486T>A	ENST00000374720.3	+	14	1962	c.1715T>A	c.(1714-1716)cTg>cAg	p.L572Q	SLC44A1_ENST00000343170.7_Missense_Mutation_p.L364Q|SLC44A1_ENST00000374723.1_Missense_Mutation_p.L572Q|SLC44A1_ENST00000374724.1_Missense_Mutation_p.L572Q	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	572					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	GTGCTGCCTCTGATCATCGTC	0.448																																					p.L572Q		Atlas-SNP	.											.	SLC44A1	61	.	0			c.T1715A						.						312.0	288.0	296.0					9																	108145486		2203	4300	6503	SO:0001583	missense	23446	exon14			TGCCTCTGATCAT	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1715T>A	chr9.hg19:g.108145486T>A	ENSP00000363852:p.Leu572Gln	63.0	0.0		75.0	11.0	NM_080546	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	ENST00000374720.3	hg19	CCDS6763.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.645622	0.87958	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.996;1.0	T	0.62025	-0.6941	10	0.72032	D	0.01	-7.8064	15.465	0.75394	0.0:0.0:0.0:1.0	.	572;572;572	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	Q	572;572;572;364	ENSP00000363855:L572Q;ENSP00000363852:L572Q;ENSP00000363856:L572Q;ENSP00000341856:L364Q	ENSP00000341856:L364Q	L	+	2	0	SLC44A1	107185307	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.538000	0.82048	2.115000	0.64714	0.528000	0.53228	CTG	.	.		0.448	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546	
DAB2IP	153090	hgsc.bcm.edu	37	9	124535752	124535752	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:124535752A>T	ENST00000408936.3	+	12	3127	c.2945A>T	c.(2944-2946)aAg>aTg	p.K982M	DAB2IP_ENST00000309989.1_Missense_Mutation_p.K858M|DAB2IP_ENST00000259371.2_Missense_Mutation_p.K954M			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	982					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CCAGAACTGAAGCCACGGGCA	0.647																																					p.K954M		Atlas-SNP	.											.	DAB2IP	150	.	0			c.A2861T						.						12.0	14.0	13.0					9																	124535752		2185	4294	6479	SO:0001583	missense	153090	exon12			AACTGAAGCCACG	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.2945A>T	chr9.hg19:g.124535752A>T	ENSP00000386183:p.Lys982Met	135.0	0.0		123.0	26.0	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	ENST00000408936.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.46	3.628550	0.67015	.	.	ENSG00000136848	ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	4.97	4.97	0.65823	.	0.367322	0.32640	N	0.005831	T	0.34629	0.0904	M	0.70275	2.135	0.58432	D	0.999996	D;D	0.69078	0.997;0.965	D;P	0.66497	0.944;0.875	T	0.12319	-1.0552	10	0.87932	D	0	.	13.8386	0.63424	1.0:0.0:0.0:0.0	.	982;954	Q5VWQ8;G3XA90	DAB2P_HUMAN;.	M	954;982;891;858	ENSP00000259371:K954M;ENSP00000386183:K982M;ENSP00000362887:K891M;ENSP00000310827:K858M	ENSP00000259371:K954M	K	+	2	0	DAB2IP	123575573	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	5.501000	0.66950	1.874000	0.54306	0.260000	0.18958	AAG	.	.		0.647	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
SSNA1	8636	hgsc.bcm.edu	37	9	140083520	140083520	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr9:140083520A>G	ENST00000322310.5	+	2	135	c.55A>G	c.(55-57)Ata>Gta	p.I19V	ANAPC2_ENST00000323927.2_5'Flank|SSNA1_ENST00000459860.1_3'UTR	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1	19					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		GCCCCCAGGCATAGAGGAGCT	0.701																																					p.I19V		Atlas-SNP	.											.	SSNA1	11	.	0			c.A55G						.						8.0	8.0	8.0					9																	140083520		2165	4253	6418	SO:0001583	missense	8636	exon2			CCAGGCATAGAGG	Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.55A>G	chr9.hg19:g.140083520A>G	ENSP00000313752:p.Ile19Val	89.0	0.0		100.0	15.0	NM_003731	Q5VSG0|Q6FG70|Q9BVW8	Missense_Mutation	SNP	ENST00000322310.5	hg19	CCDS7034.1	.	.	.	.	.	.	.	.	.	.	A	15.31	2.795245	0.50208	.	.	ENSG00000176101	ENST00000322310	D	0.82893	-1.66	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.86053	0.5841	M	0.92367	3.3	0.41029	D	0.985148	B	0.18863	0.031	B	0.23716	0.048	D	0.84586	0.0664	10	0.39692	T	0.17	-26.9482	11.7015	0.51573	1.0:0.0:0.0:0.0	.	19	O43805	SSNA1_HUMAN	V	19	ENSP00000313752:I19V	ENSP00000313752:I19V	I	+	1	0	SSNA1	139203341	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.437000	0.59955	1.699000	0.51192	0.459000	0.35465	ATA	.	.		0.701	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055311.1	NM_003731	
GDI2	2665	hgsc.bcm.edu	37	10	5842576	5842576	+	Silent	SNP	T	T	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:5842576T>G	ENST00000380191.4	-	2	428	c.138A>C	c.(136-138)atA>atC	p.I46I	GDI2_ENST00000380132.4_Silent_p.I50I|GDI2_ENST00000380181.3_Silent_p.I46I	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	46					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						CCAATGGTGTTATAGATGCAC	0.388																																					p.I46I		Atlas-SNP	.											.	GDI2	26	.	0			c.A138C						.						200.0	174.0	183.0					10																	5842576		2203	4300	6503	SO:0001819	synonymous_variant	2665	exon2			TGGTGTTATAGAT	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.138A>C	chr10.hg19:g.5842576T>G		84.0	0.0		104.0	34.0	NM_001115156	O43928|Q5SX88|Q9UQM6	Silent	SNP	ENST00000380191.4	hg19	CCDS7071.1																																																																																			.	.		0.388	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	NM_001494	
ITIH5	80760	hgsc.bcm.edu	37	10	7618817	7618817	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:7618817A>T	ENST00000256861.6	-	10	1655	c.1577T>A	c.(1576-1578)cTg>cAg	p.L526Q	ITIH5_ENST00000298441.6_Missense_Mutation_p.L312Q|ITIH5_ENST00000397145.2_Missense_Mutation_p.L526Q|ITIH5_ENST00000397146.2_Missense_Mutation_p.L526Q|ITIH5_ENST00000446830.2_Missense_Mutation_p.L308Q|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	526					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTCCACGTGCAGGTGATCCAG	0.557																																					p.L526Q		Atlas-SNP	.											.	ITIH5	343	.	0			c.T1577A						.						90.0	82.0	85.0					10																	7618817		2203	4300	6503	SO:0001583	missense	80760	exon10			ACGTGCAGGTGAT			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1577T>A	chr10.hg19:g.7618817A>T	ENSP00000256861:p.Leu526Gln	139.0	0.0		198.0	51.0	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	A	17.40	3.379338	0.61845	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	5.68	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	.	.	.	0.30154	N	0.802797	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.974;0.988	T	0.46596	-0.9180	9	0.87932	D	0	-19.1765	12.1201	0.53887	0.8712:0.0:0.0:0.1288	.	526;526;312	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	Q	526;526;312;308;526	ENSP00000256861:L526Q;ENSP00000380333:L526Q;ENSP00000298441:L312Q;ENSP00000387969:L308Q;ENSP00000380332:L526Q	ENSP00000256861:L526Q	L	-	2	0	ITIH5	7658823	1.000000	0.71417	0.016000	0.15963	0.777000	0.43975	8.832000	0.92079	0.953000	0.37825	0.379000	0.24179	CTG	.	.		0.557	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805483	21805483	+	Silent	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:21805483C>T	ENST00000449193.2	-	4	3521	c.1269G>A	c.(1267-1269)gaG>gaA	p.E423E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E344E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	342						nucleus (GO:0005634)											cctcctcttcctcctcctcct	0.627																																					p.E423E		Atlas-SNP	.											.	.	.	.	0			c.G1269A						.						5.0	6.0	6.0					10																	21805483		2007	4123	6130	SO:0001819	synonymous_variant	387640	exon4			CTCTTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1269G>A	chr10.hg19:g.21805483C>T		59.0	0.0		89.0	5.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.		0.627	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
BMS1	9790	hgsc.bcm.edu	37	10	43312077	43312077	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:43312077A>C	ENST00000374518.5	+	14	2423	c.2360A>C	c.(2359-2361)gAa>gCa	p.E787A		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	787					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GAAGACTTGGAAACAGGGGAC	0.527																																					p.E787A		Atlas-SNP	.											.	BMS1	132	.	0			c.A2360C						.						77.0	83.0	81.0					10																	43312077		2203	4300	6503	SO:0001583	missense	9790	exon14			ACTTGGAAACAGG	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2360A>C	chr10.hg19:g.43312077A>C	ENSP00000363642:p.Glu787Ala	16.0	0.0		16.0	5.0	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	hg19	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155567	0.57259	.	.	ENSG00000165733	ENST00000374518	T	0.57752	0.38	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.53400	0.1794	M	0.81239	2.535	0.58432	D	0.999994	P	0.52316	0.952	B	0.38842	0.283	T	0.64588	-0.6372	10	0.56958	D	0.05	.	13.853	0.63508	1.0:0.0:0.0:0.0	.	787	Q14692	BMS1_HUMAN	A	787	ENSP00000363642:E787A	ENSP00000363642:E787A	E	+	2	0	BMS1	42632083	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	9.052000	0.93855	1.679000	0.50963	0.372000	0.22366	GAA	.	.		0.527	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
WDFY4	57705	hgsc.bcm.edu	37	10	49939214	49939214	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:49939214A>T	ENST00000325239.5	+	8	1216	c.1189A>T	c.(1189-1191)Agt>Tgt	p.S397C	WDFY4_ENST00000360890.2_Missense_Mutation_p.S397C|WDFY4_ENST00000413659.2_Missense_Mutation_p.S397C	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	397						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCACAAAGCCAGTGACTCTGT	0.488																																					p.S397C		Atlas-SNP	.											.	WDFY4	205	.	0			c.A1189T						.						100.0	84.0	89.0					10																	49939214		692	1591	2283	SO:0001583	missense	57705	exon9			AAAGCCAGTGACT	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.1189A>T	chr10.hg19:g.49939214A>T	ENSP00000320563:p.Ser397Cys	65.0	0.0		107.0	23.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	hg19	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.757576	0.49468	.	.	ENSG00000128815	ENST00000360890;ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T;T	0.30448	1.53;3.38;3.38	5.58	3.25	0.37280	.	.	.	.	.	T	0.40619	0.1124	L	0.60455	1.87	0.09310	N	1	D;D	0.58970	0.979;0.984	P;P	0.53360	0.533;0.724	T	0.18618	-1.0331	9	0.62326	D	0.03	.	9.2306	0.37434	0.7855:0.0:0.2145:0.0	.	397;397	Q6ZS81;Q6ZS81-2	WDFY4_HUMAN;.	C	397;406;397;397;397	ENSP00000354141:S397C;ENSP00000320563:S397C;ENSP00000403789:S397C	ENSP00000320563:S397C	S	+	1	0	WDFY4	49609220	0.006000	0.16342	0.288000	0.24862	0.774000	0.43823	1.590000	0.36654	0.412000	0.25729	0.460000	0.39030	AGT	.	.		0.488	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
ZWINT	11130	hgsc.bcm.edu	37	10	58119616	58119616	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:58119616T>A	ENST00000373944.3	-	4	295		c.e4-2		ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000318387.2_5'Flank|ZWINT_ENST00000395405.1_Splice_Site|ZWINT_ENST00000361148.6_Splice_Site			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein						establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						CCTTCTGTCCTGAGATGAGCC	0.552																																					.		Atlas-SNP	.											.	ZWINT	39	.	0			c.257-2A>T						.						77.0	71.0	73.0					10																	58119616		2203	4300	6503	SO:0001630	splice_region_variant	11130	exon5			CTGTCCTGAGATG	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.257-2A>T	chr10.hg19:g.58119616T>A		53.0	0.0		85.0	23.0	NM_032997	A6NNV6|Q0D2I3|Q9BWD0	Splice_Site	SNP	ENST00000373944.3	hg19	CCDS7249.1	.	.	.	.	.	.	.	.	.	.	T	12.06	1.824330	0.32237	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000361148	.	.	.	4.21	2.97	0.34412	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3061	0.26449	0.0:0.0:0.2252:0.7748	.	.	.	.	.	-1	.	.	.	-	.	.	ZWINT	57789622	0.924000	0.31332	0.856000	0.33681	0.717000	0.41224	2.115000	0.41921	1.900000	0.55004	0.529000	0.55759	.	.	.		0.552	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1		Intron
IPMK	253430	hgsc.bcm.edu	37	10	59956280	59956280	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:59956280C>T	ENST00000373935.3	-	6	1130	c.808G>A	c.(808-810)Gac>Aac	p.D270N		NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	270					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						AAAGTTCTGTCATTCAATTTT	0.363																																					p.D270N		Atlas-SNP	.											.	IPMK	45	.	0			c.G808A						.						53.0	55.0	55.0					10																	59956280		2203	4300	6503	SO:0001583	missense	253430	exon6			TTCTGTCATTCAA	AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.808G>A	chr10.hg19:g.59956280C>T	ENSP00000363046:p.Asp270Asn	105.0	0.0		231.0	20.0	NM_152230		Missense_Mutation	SNP	ENST00000373935.3	hg19	CCDS7250.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662168	0.47572	.	.	ENSG00000151151	ENST00000373935	T	0.19105	2.17	5.97	5.97	0.96955	.	0.209202	0.50627	D	0.000112	T	0.33118	0.0852	M	0.68952	2.095	0.44380	D	0.997283	P	0.43231	0.801	P	0.45829	0.494	T	0.01042	-1.1471	9	.	.	.	-6.3015	17.9263	0.88985	0.0:1.0:0.0:0.0	.	270	Q8NFU5	IPMK_HUMAN	N	270	ENSP00000363046:D270N	.	D	-	1	0	IPMK	59626286	1.000000	0.71417	0.999000	0.59377	0.659000	0.38960	6.346000	0.72999	2.833000	0.97629	0.585000	0.79938	GAC	.	.		0.363	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048142.1	NM_152230	
DDX21	9188	hgsc.bcm.edu	37	10	70719759	70719759	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr10:70719759G>A	ENST00000354185.4	+	2	383	c.285G>A	c.(283-285)ttG>ttA	p.L95L		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	95					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CCAAAAGTTTGAGAAAGAAAA	0.363																																					p.L95L		Atlas-SNP	.											DDX21,lower_third,carcinoma,0,1	DDX21	57	.	0			c.G285A						.						42.0	45.0	44.0					10																	70719759		2202	4298	6500	SO:0001819	synonymous_variant	9188	exon2			AAGTTTGAGAAAG	U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.285G>A	chr10.hg19:g.70719759G>A		505.0	1.0		540.0	229.0	NM_004728	B2RDL0|Q13436|Q5VX41|Q68D35	Silent	SNP	ENST00000354185.4	hg19	CCDS31211.1																																																																																			.	.		0.363	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048374.1	NM_004728	
NLRP6	171389	hgsc.bcm.edu	37	11	279503	279503	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:279503C>A	ENST00000312165.5	+	2	206	c.206C>A	c.(205-207)gCc>gAc	p.A69D	NLRP6_ENST00000534750.1_Missense_Mutation_p.A69D	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	69	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GAGCAGCTGGCCCAGTTCTAC	0.761																																					p.A69D		Atlas-SNP	.											.	NLRP6	4	.	0			c.C206A						.						3.0	4.0	3.0					11																	279503		1806	3520	5326	SO:0001583	missense	171389	exon2			AGCTGGCCCAGTT	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.206C>A	chr11.hg19:g.279503C>A	ENSP00000309767:p.Ala69Asp	104.0	0.0		91.0	32.0	NM_138329	A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	hg19	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	C	9.579	1.123103	0.20959	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.42900	0.96;0.96	3.71	-2.94	0.05581	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.18509	0.0444	N	0.08118	0	0.09310	N	1	P;B	0.38677	0.642;0.411	B;B	0.37015	0.223;0.239	T	0.19128	-1.0315	9	0.27785	T	0.31	.	6.8456	0.23987	0.0:0.1794:0.1483:0.6723	.	69;69	E9PJZ8;P59044	.;NALP6_HUMAN	D	69	ENSP00000433617:A69D;ENSP00000309767:A69D	ENSP00000309767:A69D	A	+	2	0	NLRP6	269503	0.000000	0.05858	0.000000	0.03702	0.201000	0.24016	-0.450000	0.06803	-0.492000	0.06687	0.491000	0.48974	GCC	.	.		0.761	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
KRTAP5-3	387266	hgsc.bcm.edu	37	11	1629046	1629046	+	Silent	SNP	G	G	A	rs12808755		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:1629046G>A	ENST00000399685.1	-	1	647	c.570C>T	c.(568-570)tgC>tgT	p.C190C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	190	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		agcagggtttgcagcagctgg	0.622																																					p.C190C		Atlas-SNP	.											.	KRTAP5-3	33	.	0			c.C570T						.						161.0	162.0	162.0					11																	1629046		2202	4290	6492	SO:0001819	synonymous_variant	387266	exon1			GGGTTTGCAGCAG	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.570C>T	chr11.hg19:g.1629046G>A		47.0	0.0		57.0	6.0	NM_001012708	Q6PL44|Q701N3	Silent	SNP	ENST00000399685.1	hg19	CCDS41591.1																																																																																			.	.		0.622	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
OR51G1	79324	hgsc.bcm.edu	37	11	4945292	4945292	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:4945292T>C	ENST00000321961.2	-	1	345	c.278A>G	c.(277-279)gAg>gGg	p.E93G	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GATGCCAATCTCTCTGGTATC	0.488																																					p.E93G		Atlas-SNP	.											.	OR51G1	74	.	0			c.A278G						.						86.0	81.0	83.0					11																	4945292		2201	4298	6499	SO:0001583	missense	79324	exon1			CCAATCTCTCTGG	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.278A>G	chr11.hg19:g.4945292T>C	ENSP00000322546:p.Glu93Gly	133.0	0.0		168.0	30.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	hg19	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	T	11.09	1.535375	0.27475	.	.	ENSG00000176879	ENST00000321961	T	0.00479	7.12	4.2	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39475	U	0.001354	T	0.00356	0.0011	L	0.41492	1.28	0.09310	N	0.999999	B	0.18166	0.026	B	0.18561	0.022	T	0.45775	-0.9238	10	0.52906	T	0.07	.	6.6867	0.23148	0.0:0.1952:0.0:0.8048	.	93	Q8NGK1	O51G1_HUMAN	G	93	ENSP00000322546:E93G	ENSP00000322546:E93G	E	-	2	0	OR51G1	4901868	0.000000	0.05858	0.999000	0.59377	0.916000	0.54674	-0.955000	0.03869	1.760000	0.52011	0.455000	0.32223	GAG	.	.		0.488	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
OR8I2	120586	hgsc.bcm.edu	37	11	55861433	55861433	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:55861433A>G	ENST00000302124.2	+	1	681	c.650A>G	c.(649-651)tAt>tGt	p.Y217C		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					ACAGTCACTTATATCATCATC	0.478																																					p.Y217C		Atlas-SNP	.											.	OR8I2	119	.	0			c.A650G						.						140.0	120.0	127.0					11																	55861433		2201	4296	6497	SO:0001583	missense	120586	exon1			TCACTTATATCAT	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.650A>G	chr11.hg19:g.55861433A>G	ENSP00000303864:p.Tyr217Cys	81.0	0.0		70.0	26.0	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	hg19	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	A	9.953	1.220788	0.22457	.	.	ENSG00000172154	ENST00000302124	T	0.00520	6.85	4.33	3.16	0.36331	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36740	U	0.002431	T	0.01695	0.0054	H	0.96398	3.815	0.35035	D	0.759193	P	0.41159	0.74	P	0.50352	0.638	T	0.02121	-1.1210	10	0.87932	D	0	-13.2475	6.7167	0.23308	0.7601:0.154:0.0859:0.0	.	217	Q8N0Y5	OR8I2_HUMAN	C	217	ENSP00000303864:Y217C	ENSP00000303864:Y217C	Y	+	2	0	OR8I2	55618009	1.000000	0.71417	0.018000	0.16275	0.013000	0.08279	8.312000	0.89976	0.603000	0.29913	-0.724000	0.03597	TAT	.	.		0.478	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
ATG16L2	89849	hgsc.bcm.edu	37	11	72525573	72525573	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:72525573C>A	ENST00000321297.5	+	1	221	c.83C>A	c.(82-84)aCg>aAg	p.T28K	ATG16L2_ENST00000534905.1_Missense_Mutation_p.T28K	NM_033388.1	NP_203746.1	Q8NAA4	A16L2_HUMAN	autophagy related 16-like 2 (S. cerevisiae)	28					autophagy (GO:0006914)|negative stranded viral RNA replication (GO:0039689)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	14			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			CGGGACCGTACGCAAAAGGCG	0.741																																					p.T28K		Atlas-SNP	.											.	ATG16L2	26	.	0			c.C83A						.						26.0	28.0	27.0					11																	72525573		2177	4257	6434	SO:0001583	missense	89849	exon1			ACCGTACGCAAAA	AK024423	CCDS31634.1	11q13.4	2014-02-12	2012-06-06		ENSG00000168010	ENSG00000168010		"""WD repeat domain containing"""	25464	protein-coding gene	gene with protein product			"""ATG16 autophagy related 16-like 2 (S. cerevisiae)"""			11214971	Standard	XM_005274378		Approved	FLJ00012, WDR80, ATG16B	uc001otd.3	Q8NAA4	OTTHUMG00000167961	ENST00000321297.5:c.83C>A	chr11.hg19:g.72525573C>A	ENSP00000326340:p.Thr28Lys	131.0	0.0		141.0	25.0	NM_033388	A5PL30|B2RPK5|Q658V4|Q6PID3|Q8NBG0	Missense_Mutation	SNP	ENST00000321297.5	hg19	CCDS31634.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.81|16.81	3.224655|3.224655	0.58668|0.58668	.|.	.|.	ENSG00000168010|ENSG00000168010	ENST00000540567|ENST00000321297;ENST00000534905	.|T;T	.|0.42513	.|0.97;0.97	4.75|4.75	0.459|0.459	0.16678|0.16678	.|Autophagy-related protein 16 (1);	.|1.374300	.|0.04929	.|N	.|0.456436	T|T	0.22126|0.22126	0.0533|0.0533	N|N	0.12182|0.12182	0.205|0.205	0.27591|0.27591	N|N	0.949288|0.949288	.|B;B;B;P	.|0.49185	.|0.006;0.001;0.008;0.92	.|B;B;B;P	.|0.45829	.|0.01;0.01;0.03;0.494	T|T	0.17440|0.17440	-1.0369|-1.0369	5|10	.|0.05620	.|T	.|0.96	.|.	1.3522|1.3522	0.02175|0.02175	0.1665:0.4524:0.1829:0.1981|0.1665:0.4524:0.1829:0.1981	.|.	.|28;28;28;27	.|B4E090;F5GWZ9;Q8NAA4;Q2VPK0	.|.;.;A16L2_HUMAN;.	S|K	33|28	.|ENSP00000326340:T28K;ENSP00000441189:T28K	.|ENSP00000326340:T28K	R|T	+|+	1|2	0|0	ATG16L2|ATG16L2	72203221|72203221	0.987000|0.987000	0.35691|0.35691	0.997000|0.997000	0.53966|0.53966	0.438000|0.438000	0.31896|0.31896	0.203000|0.203000	0.17315|0.17315	0.229000|0.229000	0.21039|0.21039	-0.736000|-0.736000	0.03550|0.03550	CGC|ACG	.	.		0.741	ATG16L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397305.1	NM_033388	
FAM168A	23201	hgsc.bcm.edu	37	11	73141779	73141779	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:73141779T>A	ENST00000064778.4	-	3	391	c.107A>T	c.(106-108)tAc>tTc	p.Y36F	FAM168A_ENST00000450446.2_Missense_Mutation_p.Y36F|FAM168A_ENST00000356467.4_Missense_Mutation_p.Y36F			Q92567	F168A_HUMAN	family with sequence similarity 168, member A	36										endometrium(3)|kidney(1)|lung(1)	5						GCTGGGATTGTAGGCAGGGGC	0.468																																					p.Y36F		Atlas-SNP	.											.	FAM168A	18	.	0			c.A107T						.						103.0	105.0	104.0					11																	73141779		1926	4124	6050	SO:0001583	missense	23201	exon3			GGATTGTAGGCAG	BC014932	CCDS41689.1, CCDS66165.1, CCDS73346.1	11q13.4	2008-06-11	2008-06-11	2008-06-11		ENSG00000054965			28999	protein-coding gene	gene with protein product	"""tongue cancer chemotherapy resistance-associated protein 1"""		"""KIAA0280"""	KIAA0280			Standard	XM_005273852		Approved	TCRP1	uc001oty.1	Q92567		ENST00000064778.4:c.107A>T	chr11.hg19:g.73141779T>A	ENSP00000064778:p.Tyr36Phe	78.0	0.0		114.0	19.0	NM_015159	A2ICY2|A2ID81|Q86UG2	Missense_Mutation	SNP	ENST00000064778.4	hg19		.	.	.	.	.	.	.	.	.	.	T	25.6	4.656184	0.88056	.	.	ENSG00000054965	ENST00000064778;ENST00000450446;ENST00000356467	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.75744	0.3891	M	0.62723	1.935	0.52099	D	0.999943	D;P;P	0.56035	0.974;0.927;0.927	D;D;D	0.70487	0.969;0.953;0.953	T	0.78178	-0.2305	9	0.87932	D	0	.	13.3716	0.60717	0.0:0.0:0.0:1.0	.	36;36;36	Q92567-3;Q92567;Q92567-2	.;F168A_HUMAN;.	F	36	.	ENSP00000064778:Y36F	Y	-	2	0	FAM168A	72819427	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.516000	0.60496	2.188000	0.69820	0.533000	0.62120	TAC	.	.		0.468	FAM168A-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000397424.1	NM_015159	
TENM4	26011	hgsc.bcm.edu	37	11	78369171	78369171	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:78369171A>T	ENST00000278550.7	-	34	8704	c.8242T>A	c.(8242-8244)Tac>Aac	p.Y2748N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2748					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										AGTTCTGGGTACTGCTCGACA	0.587																																					p.Y2748N		Atlas-SNP	.											.	.	.	.	0			c.T8242A						.						199.0	211.0	207.0					11																	78369171		2129	4221	6350	SO:0001583	missense	26011	exon34			CTGGGTACTGCTC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.8242T>A	chr11.hg19:g.78369171A>T	ENSP00000278550:p.Tyr2748Asn	92.0	0.0		90.0	35.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	hg19	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515774	0.85495	.	.	ENSG00000149256	ENST00000278550	D	0.92299	-3.01	5.65	5.65	0.86999	.	0.065888	0.64402	D	0.000006	D	0.94591	0.8257	M	0.81239	2.535	0.58432	D	0.999999	D	0.61080	0.989	P	0.53450	0.726	D	0.94553	0.7755	9	.	.	.	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	2748	Q6N022	TEN4_HUMAN	N	2748	ENSP00000278550:Y2748N	.	Y	-	1	0	ODZ4	78046819	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.087000	0.94110	2.371000	0.80710	0.533000	0.62120	TAC	.	.		0.587	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TENM4	26011	hgsc.bcm.edu	37	11	78387204	78387204	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:78387204C>T	ENST00000278550.7	-	30	5951	c.5489G>A	c.(5488-5490)cGg>cAg	p.R1830Q		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1830					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CACCCGCAGCCGGCGCCCAAA	0.637																																					p.R1830Q		Atlas-SNP	.											.	.	.	.	0			c.G5489A						.						7.0	9.0	9.0					11																	78387204		1946	4058	6004	SO:0001583	missense	26011	exon30			CGCAGCCGGCGCC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5489G>A	chr11.hg19:g.78387204C>T	ENSP00000278550:p.Arg1830Gln	47.0	0.0		54.0	9.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	hg19	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	32	5.177671	0.94846	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89875	-2.58;0.86	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.91791	0.7403	L	0.43923	1.385	0.53688	D	0.999976	D	0.76494	0.999	D	0.72625	0.978	D	0.90877	0.4750	9	.	.	.	.	17.6814	0.88245	0.0:1.0:0.0:0.0	.	1830	Q6N022	TEN4_HUMAN	Q	1830;294	ENSP00000278550:R1830Q;ENSP00000431711:R294Q	.	R	-	2	0	ODZ4	78064852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.904000	0.56325	2.468000	0.83385	0.650000	0.86243	CGG	.	.		0.637	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TMEM135	65084	hgsc.bcm.edu	37	11	86802424	86802424	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:86802424A>T	ENST00000305494.5	+	4	422	c.383A>T	c.(382-384)tAt>tTt	p.Y128F	TMEM135_ENST00000535167.1_Intron|TMEM135_ENST00000355734.4_Missense_Mutation_p.Y128F|TMEM135_ENST00000340353.7_Missense_Mutation_p.Y128F|TMEM135_ENST00000532959.1_Intron	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	128					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CTCACAATTTATATGGCCAAC	0.269																																					p.Y128F		Atlas-SNP	.											.	TMEM135	40	.	0			c.A383T						.						112.0	114.0	113.0					11																	86802424		2201	4296	6497	SO:0001583	missense	65084	exon4			CAATTTATATGGC	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.383A>T	chr11.hg19:g.86802424A>T	ENSP00000306344:p.Tyr128Phe	93.0	0.0		134.0	26.0	NM_022918	Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	hg19	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959609	0.74016	.	.	ENSG00000166575	ENST00000340353;ENST00000526733;ENST00000525018;ENST00000355734;ENST00000305494	T;T;T;T	0.73469	0.41;0.18;2.61;-0.75	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.85075	0.5614	M	0.79614	2.46	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.87578	0.983;0.946;0.998	D	0.85886	0.1425	9	.	.	.	-12.9561	12.0643	0.53580	1.0:0.0:0.0:0.0	.	128;128;128	Q86UB9-2;Q86UB9;Q8N605	.;TM135_HUMAN;.	F	128;97;128;128;128	ENSP00000345513:Y128F;ENSP00000433927:Y128F;ENSP00000347973:Y128F;ENSP00000306344:Y128F	.	Y	+	2	0	TMEM135	86480072	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.824000	0.62701	2.103000	0.63969	0.383000	0.25322	TAT	.	.		0.269	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
TTC12	54970	hgsc.bcm.edu	37	11	113209515	113209515	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:113209515A>T	ENST00000529221.1	+	9	701	c.596A>T	c.(595-597)aAg>aTg	p.K199M	TTC12_ENST00000483239.2_Missense_Mutation_p.K205M|TTC12_ENST00000393020.1_Missense_Mutation_p.K199M|TTC12_ENST00000314756.3_Missense_Mutation_p.K199M	NM_017868.3	NP_060338.3	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	199										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		TGTTATAAGAAGATCTTAGAA	0.478																																					p.K199M		Atlas-SNP	.											.	TTC12	66	.	0			c.A596T						.						126.0	126.0	126.0					11																	113209515		2201	4296	6497	SO:0001583	missense	54970	exon9			ATAAGAAGATCTT	AK000542	CCDS8360.2	11q23.2	2013-01-10			ENSG00000149292	ENSG00000149292		"""Tetratricopeptide (TTC) repeat domain containing"""	23700	protein-coding gene	gene with protein product		610732				12964006	Standard	XM_005271607		Approved	FLJ13859, FLJ20535, TPARM	uc001pnu.3	Q9H892	OTTHUMG00000142832	ENST00000529221.1:c.596A>T	chr11.hg19:g.113209515A>T	ENSP00000433757:p.Lys199Met	122.0	0.0		139.0	62.0	NM_017868	Q8N5H9|Q9NWY3	Missense_Mutation	SNP	ENST00000529221.1	hg19	CCDS8360.2	.	.	.	.	.	.	.	.	.	.	A	20.3	3.971616	0.74246	.	.	ENSG00000149292	ENST00000529221;ENST00000442859;ENST00000529850;ENST00000314756;ENST00000525965;ENST00000393020;ENST00000483239;ENST00000524580	D;T;T;D;T;D;D	0.91011	-2.77;-0.64;-1.11;-2.77;-1.07;-2.77;-2.77	6.08	4.95	0.65309	Tetratricopeptide-like helical (1);Armadillo-type fold (1);Tetratricopeptide repeat-containing (1);	0.145302	0.64402	D	0.000010	D	0.95130	0.8422	M	0.87038	2.855	0.45403	D	0.99838	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	D	0.94866	0.8026	10	0.72032	D	0.01	-29.7996	10.2428	0.43324	0.9239:0.0:0.0761:0.0	.	199;199	A8K8G6;Q9H892	.;TTC12_HUMAN	M	199;199;179;199;155;199;205;25	ENSP00000433757:K199M;ENSP00000400039:K199M;ENSP00000431806:K179M;ENSP00000315160:K199M;ENSP00000435308:K155M;ENSP00000376743:K199M;ENSP00000419652:K205M	ENSP00000315160:K199M	K	+	2	0	TTC12	112714725	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.063000	0.57499	1.110000	0.41699	0.533000	0.62120	AAG	.	.		0.478	TTC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286455.2	NM_017868	
VWA5A	4013	hgsc.bcm.edu	37	11	124013257	124013257	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr11:124013257T>C	ENST00000456829.2	+	17	2383	c.2132T>C	c.(2131-2133)aTa>aCa	p.I711T	VWA5A_ENST00000392748.1_Missense_Mutation_p.I711T|VWA5A_ENST00000360334.4_3'UTR	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	711										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						TTGGAAGAAATAATGGCTGCA	0.423																																					p.I711T		Atlas-SNP	.											.	VWA5A	102	.	0			c.T2132C						.						111.0	104.0	107.0					11																	124013257		2201	4299	6500	SO:0001583	missense	4013	exon16			AAGAAATAATGGC	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.2132T>C	chr11.hg19:g.124013257T>C	ENSP00000407726:p.Ile711Thr	93.0	0.0		101.0	35.0	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	ENST00000456829.2	hg19	CCDS8444.1	.	.	.	.	.	.	.	.	.	.	T	9.180	1.023365	0.19433	.	.	ENSG00000110002	ENST00000456829;ENST00000392748	T;T	0.04406	3.63;3.63	5.59	4.47	0.54385	.	1.550680	0.03130	N	0.165070	T	0.05547	0.0146	L	0.36672	1.1	0.18873	N	0.999988	B	0.14012	0.009	B	0.10450	0.005	T	0.41052	-0.9530	10	0.21014	T	0.42	-0.0235	5.118	0.14845	0.0:0.1538:0.0:0.8462	.	711	O00534	VMA5A_HUMAN	T	711	ENSP00000407726:I711T;ENSP00000376504:I711T	ENSP00000376504:I711T	I	+	2	0	VWA5A	123518467	0.013000	0.17824	0.004000	0.12327	0.022000	0.10575	1.629000	0.37071	2.131000	0.65755	0.459000	0.35465	ATA	.	.		0.423	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
IPO8	10526	hgsc.bcm.edu	37	12	30837345	30837345	+	Silent	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:30837345T>A	ENST00000256079.4	-	3	551	c.213A>T	c.(211-213)cgA>cgT	p.R71R	IPO8_ENST00000538338.1_5'Flank	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	71	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GTGGAGGTTCTCGATCTGGCC	0.413																																					p.R71R		Atlas-SNP	.											.	IPO8	105	.	0			c.A213T						.						265.0	227.0	240.0					12																	30837345		2203	4300	6503	SO:0001819	synonymous_variant	10526	exon3			AGGTTCTCGATCT	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.213A>T	chr12.hg19:g.30837345T>A		107.0	0.0		162.0	51.0	NM_006390	B7Z7M3	Silent	SNP	ENST00000256079.4	hg19	CCDS8719.1																																																																																			.	.		0.413	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
CNTN1	1272	hgsc.bcm.edu	37	12	41410583	41410583	+	Missense_Mutation	SNP	C	C	T	rs566695601		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:41410583C>T	ENST00000551295.2	+	19	2401	c.2284C>T	c.(2284-2286)Cct>Tct	p.P762S	CNTN1_ENST00000348761.2_Missense_Mutation_p.P751S|CNTN1_ENST00000550305.1_3'UTR|CNTN1_ENST00000347616.1_Missense_Mutation_p.P762S	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	762	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.P762S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AGTTACTAATCCTGATACTGG	0.398													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19518	0.0		0.0	False		,,,				2504	0.0				p.P762S		Atlas-SNP	.											CNTN1,colon,carcinoma,0,1	CNTN1	207	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2284T						.						128.0	111.0	117.0					12																	41410583		2203	4300	6503	SO:0001583	missense	1272	exon19			ACTAATCCTGATA	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2284C>T	chr12.hg19:g.41410583C>T	ENSP00000447006:p.Pro762Ser	130.0	0.0		203.0	67.0	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548129	0.65311	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.55588	0.51;0.51;0.51	5.35	5.35	0.76521	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.053392	0.85682	D	0.000000	T	0.67711	0.2922	M	0.66506	2.035	0.80722	D	1	D;D	0.60575	0.984;0.988	P;P	0.60541	0.804;0.876	T	0.59710	-0.7403	10	0.17832	T	0.49	.	19.9544	0.97215	0.0:1.0:0.0:0.0	.	751;762	Q12860-2;Q12860	.;CNTN1_HUMAN	S	762;762;751	ENSP00000447006:P762S;ENSP00000325660:P762S;ENSP00000261160:P751S	ENSP00000325660:P762S	P	+	1	0	CNTN1	39696850	1.000000	0.71417	0.982000	0.44146	0.854000	0.48673	3.688000	0.54699	2.885000	0.99019	0.655000	0.94253	CCT	.	.		0.398	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
KRT74	121391	hgsc.bcm.edu	37	12	52962149	52962149	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:52962149C>T	ENST00000305620.2	-	7	1206	c.1159G>A	c.(1159-1161)Gct>Act	p.A387T	KRT74_ENST00000549343.1_Missense_Mutation_p.A401T	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	387	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		TCAGCGTCAGCGATGGCCGTC	0.577																																					p.A387T		Atlas-SNP	.											.	KRT74	67	.	0			c.G1159A						.						47.0	43.0	44.0					12																	52962149		2203	4300	6503	SO:0001583	missense	121391	exon7			CGTCAGCGATGGC	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.1159G>A	chr12.hg19:g.52962149C>T	ENSP00000307240:p.Ala387Thr	84.0	0.0		113.0	11.0	NM_175053	B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	hg19	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323785	0.41096	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;T	0.89415	-2.51;-1.02	4.24	3.33	0.38152	Filament (1);	0.000000	0.33199	N	0.005166	D	0.87649	0.6230	L	0.60455	1.87	0.09310	N	1	P	0.36222	0.544	B	0.42112	0.376	T	0.79472	-0.1789	10	0.40728	T	0.16	.	11.4988	0.50424	0.4852:0.5148:0.0:0.0	.	387	Q7RTS7	K2C74_HUMAN	T	401;387	ENSP00000447447:A401T;ENSP00000307240:A387T	ENSP00000307240:A387T	A	-	1	0	KRT74	51248416	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-0.592000	0.05747	1.053000	0.40415	0.655000	0.94253	GCT	.	.		0.577	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053	
KRT3	3850	hgsc.bcm.edu	37	12	53189455	53189455	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:53189455G>A	ENST00000417996.2	-	1	446	c.372C>T	c.(370-372)ggC>ggT	p.G124G	KRT3_ENST00000309505.3_Silent_p.G124G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	124	Gly-rich.|Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						cccctccaaagccaccagctc	0.627																																					p.G124G		Atlas-SNP	.											.	KRT3	65	.	0			c.C372T						.						155.0	196.0	182.0					12																	53189455		2195	4290	6485	SO:0001819	synonymous_variant	3850	exon1			TCCAAAGCCACCA		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.372C>T	chr12.hg19:g.53189455G>A		113.0	0.0		151.0	45.0	NM_057088	A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	hg19	CCDS44895.1																																																																																			.	.		0.627	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
HOXC12	3228	hgsc.bcm.edu	37	12	54348808	54348808	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:54348808C>A	ENST00000243103.3	+	1	191	c.95C>A	c.(94-96)tCc>tAc	p.S32Y	AC012531.23_ENST00000603432.1_lincRNA	NM_173860.1	NP_776272.1	P31275	HXC12_HUMAN	homeobox C12	32					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	12						TTCCGCGCGTCCGGGGCGCAG	0.652																																					p.S32Y		Atlas-SNP	.											.	HOXC12	19	.	0			c.C95A						.						31.0	37.0	35.0					12																	54348808		2203	4300	6503	SO:0001583	missense	3228	exon1			GCGCGTCCGGGGC	AF328962	CCDS8866.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123407	ENSG00000123407		"""Homeoboxes / ANTP class : HOXL subclass"""	5124	protein-coding gene	gene with protein product		142975	"""homeo box C12"""	HOX3, HOX3F, HOC3F		1973146, 1358459	Standard	NM_173860		Approved		uc010soq.2	P31275	OTTHUMG00000160010	ENST00000243103.3:c.95C>A	chr12.hg19:g.54348808C>A	ENSP00000243103:p.Ser32Tyr	188.0	0.0		299.0	87.0	NM_173860	Q9BXJ6	Missense_Mutation	SNP	ENST00000243103.3	hg19	CCDS8866.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402220	0.62288	.	.	ENSG00000123407	ENST00000243103	D	0.93763	-3.28	2.85	1.9	0.25705	.	0.000000	0.64402	D	0.000002	D	0.94162	0.8127	M	0.78916	2.43	0.43453	D	0.995648	D	0.61080	0.989	P	0.53450	0.726	D	0.93084	0.6494	10	0.59425	D	0.04	.	10.2809	0.43539	0.2003:0.7997:0.0:0.0	.	32	P31275	HXC12_HUMAN	Y	32	ENSP00000243103:S32Y	ENSP00000243103:S32Y	S	+	2	0	HOXC12	52635075	0.971000	0.33674	0.977000	0.42913	0.950000	0.60333	3.466000	0.53071	0.708000	0.31955	0.455000	0.32223	TCC	.	.		0.652	HOXC12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358868.2	NM_173860	
ITGA5	3678	hgsc.bcm.edu	37	12	54797997	54797997	+	Silent	SNP	G	G	A	rs567536197	byFrequency	TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:54797997G>A	ENST00000293379.4	-	15	1758	c.1497C>T	c.(1495-1497)ctC>ctT	p.L499L	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	499					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						GGAAGATGGTGAGGGAGGCAC	0.577											OREG0021554	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L499L		Atlas-SNP	.											.	ITGA5	99	.	0			c.C1497T						.						61.0	69.0	67.0					12																	54797997		2203	4300	6503	SO:0001819	synonymous_variant	3678	exon15			GATGGTGAGGGAG		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1497C>T	chr12.hg19:g.54797997G>A		106.0	0.0	1003	138.0	31.0	NM_002205	Q96HA5	Silent	SNP	ENST00000293379.4	hg19	CCDS8880.1																																																																																			.	.		0.577	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
WIF1	11197	hgsc.bcm.edu	37	12	65460513	65460513	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:65460513A>G	ENST00000286574.4	-	6	1012	c.638T>C	c.(637-639)cTt>cCt	p.L213P		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	213	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TGGGGTACAAAGGGCTTATAG	0.433			T	HMGA2	pleomorphic salivary gland adenoma																																p.L213P	Esophageal Squamous(148;1595 1816 48559 49439 49664)	Atlas-SNP	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1	96	.	0			c.T638C						.						76.0	72.0	73.0					12																	65460513		2203	4300	6503	SO:0001583	missense	11197	exon6			GTACAAAGGGCTT	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.638T>C	chr12.hg19:g.65460513A>G	ENSP00000286574:p.Leu213Pro	135.0	0.0		172.0	53.0	NM_007191	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	hg19	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.565601	0.45694	.	.	ENSG00000156076	ENST00000286574	T	0.05199	3.48	5.23	5.23	0.72850	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.068823	0.64402	D	0.000016	T	0.11750	0.0286	L	0.37561	1.115	0.80722	D	1	D	0.54772	0.968	P	0.53224	0.721	T	0.10474	-1.0628	9	.	.	.	.	15.8274	0.78725	1.0:0.0:0.0:0.0	.	213	Q9Y5W5	WIF1_HUMAN	P	213	ENSP00000286574:L213P	.	L	-	2	0	WIF1	63746780	1.000000	0.71417	0.982000	0.44146	0.098000	0.18820	7.369000	0.79578	2.279000	0.76181	0.533000	0.62120	CTT	.	.		0.433	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
KCNC2	3747	hgsc.bcm.edu	37	12	75601469	75601469	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:75601469C>A	ENST00000549446.1	-	2	975	c.295G>T	c.(295-297)Ggc>Tgc	p.G99C	KCNC2_ENST00000550433.1_Missense_Mutation_p.G99C|KCNC2_ENST00000548513.1_Missense_Mutation_p.G99C|KCNC2_ENST00000350228.2_Missense_Mutation_p.G99C|KCNC2_ENST00000540018.1_Missense_Mutation_p.G99C|KCNC2_ENST00000341669.3_Missense_Mutation_p.G99C|KCNC2_ENST00000393288.2_Missense_Mutation_p.G99C|KCNC2_ENST00000298972.1_Missense_Mutation_p.G99C	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	99	Gly/Pro-rich (insert).				action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AACTCGCGGCCGCCACCGGGA	0.726																																					p.G99C		Atlas-SNP	.											.	KCNC2	239	.	0			c.G295T						.						8.0	11.0	10.0					12																	75601469		2184	4279	6463	SO:0001583	missense	3747	exon2			CGCGGCCGCCACC	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.295G>T	chr12.hg19:g.75601469C>A	ENSP00000449253:p.Gly99Cys	224.0	0.0		304.0	81.0	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	hg19	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	c	12.77	2.038852	0.35989	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	3.04	3.04	0.35103	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.38164	U	0.001790	T	0.72763	0.3501	N	0.25332	0.735	0.31854	N	0.621903	B;B;B;B;D	0.57257	0.024;0.024;0.014;0.024;0.979	B;B;B;B;P	0.51974	0.022;0.022;0.038;0.022;0.686	T	0.77466	-0.2577	10	0.56958	D	0.05	.	11.9715	0.53065	0.0:1.0:0.0:0.0	.	99;99;99;99;99	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	C	99	ENSP00000448301:G99C;ENSP00000449941:G99C;ENSP00000449253:G99C;ENSP00000340121:G99C;ENSP00000298972:G99C;ENSP00000319877:G99C;ENSP00000438423:G99C;ENSP00000376966:G99C	ENSP00000298972:G99C	G	-	1	0	KCNC2	73887736	0.994000	0.37717	0.994000	0.49952	0.852000	0.48524	-0.266000	0.08631	2.004000	0.58718	0.457000	0.33378	GGC	.	.		0.726	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
PTPRQ	374462	hgsc.bcm.edu	37	12	80982127	80982127	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:80982127A>G	ENST00000266688.5	+	31	4493	c.4493A>G	c.(4492-4494)tAt>tGt	p.Y1498C	RP11-272K23.3_ENST00000550634.1_RNA			Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1544	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GAGACAGTATATGGATTAAAG	0.378																																					p.Y1330C		Atlas-SNP	.											.	PTPRQ	119	.	0			c.A3989G						.						96.0	85.0	89.0					12																	80982127		692	1591	2283	SO:0001583	missense	374462	exon23			CAGTATATGGATT	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4493A>G	chr12.hg19:g.80982127A>G	ENSP00000266688:p.Tyr1498Cys	127.0	0.0		147.0	48.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.63|14.63	2.592710|2.592710	0.46214|0.46214	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.56941	.|0.43	5.35|5.35	4.16|4.16	0.48862|0.48862	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.59211|0.59211	0.2177|0.2177	.|.	.|.	.|.	0.28729|0.28729	N|N	0.902615|0.902615	.|D	.|0.56968	.|0.978	.|P	.|0.54372	.|0.75	T|T	0.53802|0.53802	-0.8387|-0.8387	4|8	.|0.38643	.|T	.|0.18	.|.	11.6893|11.6893	0.51505|0.51505	0.9293:0.0:0.0707:0.0|0.9293:0.0:0.0707:0.0	.|.	.|1544	.|Q9UMZ3	.|PTPRQ_HUMAN	V|C	1199|1498	.|ENSP00000266688:Y1498C	.|ENSP00000266688:Y1498C	M|Y	+|+	1|2	0|0	PTPRQ|PTPRQ	79506258|79506258	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.785000|0.785000	0.44390|0.44390	3.771000|3.771000	0.55318|0.55318	0.931000|0.931000	0.37242|0.37242	0.533000|0.533000	0.62120|0.62120	ATG|TAT	.	.		0.378	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
ANO4	121601	hgsc.bcm.edu	37	12	101480526	101480526	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:101480526T>C	ENST00000392977.3	+	17	1835	c.1625T>C	c.(1624-1626)aTc>aCc	p.I542T	ANO4_ENST00000299222.9_Missense_Mutation_p.I62T|ANO4_ENST00000550015.1_Missense_Mutation_p.I62T|ANO4_ENST00000392979.3_Missense_Mutation_p.I507T			Q32M45	ANO4_HUMAN	anoctamin 4	542					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TGGGCGTTAATCAGGAATAAC	0.507										HNSCC(74;0.22)																											p.I507T		Atlas-SNP	.											.	ANO4	183	.	0			c.T1520C						.						306.0	252.0	271.0					12																	101480526		2203	4300	6503	SO:0001583	missense	121601	exon16			CGTTAATCAGGAA	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1625T>C	chr12.hg19:g.101480526T>C	ENSP00000376703:p.Ile542Thr	147.0	0.0		160.0	42.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	hg19		.	.	.	.	.	.	.	.	.	.	T	11.92	1.781366	0.31502	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.68765	-0.34;-0.33;-0.35;-0.33	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.69663	0.3136	L	0.43646	1.37	0.58432	D	0.999998	P;P;P	0.52692	0.915;0.955;0.855	P;P;P	0.58660	0.574;0.843;0.64	T	0.64441	-0.6407	10	0.07175	T	0.84	.	15.924	0.79597	0.0:0.0:0.0:1.0	.	62;542;507	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	T	507;62;542;62	ENSP00000376705:I507T;ENSP00000299222:I62T;ENSP00000376703:I542T;ENSP00000450192:I62T	ENSP00000299222:I62T	I	+	2	0	ANO4	100004657	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.997000	0.88414	2.217000	0.71921	0.533000	0.62120	ATC	.	.		0.507	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
MTUS2	23281	hgsc.bcm.edu	37	13	30066851	30066851	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr13:30066851T>A	ENST00000380808.2	+	5	727	c.511T>A	c.(511-513)Ttg>Atg	p.L171M	MTUS2-AS1_ENST00000323380.5_RNA|MTUS2_ENST00000431530.3_Missense_Mutation_p.L1202M|MTUS2_ENST00000542829.1_Missense_Mutation_p.L81M	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1192						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GCGGCTGTCATTGCAGGTTAG	0.363																																					p.L1202M		Atlas-SNP	.											.	MTUS2	279	.	0			c.T3604A						.						80.0	75.0	77.0					13																	30066851		1826	4083	5909	SO:0001583	missense	23281	exon10			CTGTCATTGCAGG	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.511T>A	chr13.hg19:g.30066851T>A	ENSP00000370186:p.Leu171Met	89.0	0.0		116.0	19.0	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000380808.2	hg19	CCDS41874.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042081	0.55003	.	.	ENSG00000132938	ENST00000431530;ENST00000380808;ENST00000542829;ENST00000417109	T;T;T	0.47177	1.74;0.95;0.85	5.15	-1.43	0.08884	.	0.000000	0.64402	D	0.000003	T	0.65709	0.2717	M	0.86178	2.8	0.48762	D	0.999703	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.66376	-0.5939	9	.	.	.	.	10.3517	0.43939	0.0:0.5778:0.0:0.4222	.	171;1192	Q5JR59-3;Q5JR59	.;MTUS2_HUMAN	M	1202;171;81;128	ENSP00000392057:L1202M;ENSP00000370186:L171M;ENSP00000445403:L81M	.	L	+	1	2	MTUS2	28964851	0.753000	0.28349	0.470000	0.27216	0.677000	0.39632	1.222000	0.32515	-0.194000	0.10399	-0.330000	0.08379	TTG	.	.		0.363	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270	
USPL1	10208	hgsc.bcm.edu	37	13	31205172	31205172	+	Silent	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr13:31205172A>G	ENST00000255304.4	+	4	771	c.429A>G	c.(427-429)ggA>ggG	p.G143G	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	143					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		AACATAATGGAGAAGTATATG	0.368																																					p.G143G	Ovarian(60;318 1180 1554 28110 31601)	Atlas-SNP	.											.	USPL1	82	.	0			c.A429G						.						69.0	70.0	70.0					13																	31205172		2203	4300	6503	SO:0001819	synonymous_variant	10208	exon4			TAATGGAGAAGTA	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.429A>G	chr13.hg19:g.31205172A>G		117.0	0.0		148.0	14.0	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Silent	SNP	ENST00000255304.4	hg19	CCDS9336.1																																																																																			.	.		0.368	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
SCEL	8796	hgsc.bcm.edu	37	13	78163340	78163340	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr13:78163340C>A	ENST00000349847.3	+	10	691	c.607C>A	c.(607-609)Cag>Aag	p.Q203K	SCEL_ENST00000535157.1_Missense_Mutation_p.Q181K|SCEL_ENST00000377246.3_Missense_Mutation_p.Q203K	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	203					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TTCTCCTAACCAGCTGAGACA	0.433																																					p.Q203K		Atlas-SNP	.											.	SCEL	85	.	0			c.C607A						.						128.0	129.0	129.0					13																	78163340		2203	4300	6503	SO:0001583	missense	8796	exon10			CCTAACCAGCTGA	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.607C>A	chr13.hg19:g.78163340C>A	ENSP00000302579:p.Gln203Lys	85.0	0.0		110.0	25.0	NM_003843	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	hg19	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	C	0.431	-0.903394	0.02453	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.26518	1.73;1.73;1.73	5.56	4.69	0.59074	.	1.003600	0.08033	N	0.993797	T	0.29028	0.0721	M	0.65975	2.015	0.09310	N	1	B;B;P	0.34615	0.4;0.274;0.459	B;B;B	0.29353	0.075;0.101;0.101	T	0.19192	-1.0313	10	0.34782	T	0.22	2.3654	11.5458	0.50693	0.1787:0.8213:0.0:0.0	.	181;203;203	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	K	180;181;203;203	ENSP00000437895:Q181K;ENSP00000366454:Q203K;ENSP00000302579:Q203K	ENSP00000315127:Q180K	Q	+	1	0	SCEL	77061341	0.064000	0.20934	0.369000	0.25952	0.343000	0.28985	0.846000	0.27682	1.296000	0.44742	0.591000	0.81541	CAG	.	.		0.433	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
EDNRB	1910	hgsc.bcm.edu	37	13	78472337	78472337	+	Nonstop_Mutation	SNP	A	A	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr13:78472337A>C	ENST00000334286.5	-	7	1563	c.1327T>G	c.(1327-1329)Tga>Gga	p.*443G	EDNRB_ENST00000377211.4_Nonstop_Mutation_p.*533G|EDNRB_ENST00000446573.1_Intron	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	0					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TTCTTCTTTCAAGATGAGCTG	0.323																																					p.X533G		Atlas-SNP	.											.	EDNRB	172	.	0			c.T1597G						.						96.0	88.0	91.0					13																	78472337		2202	4300	6502	SO:0001578	stop_lost	1910	exon8			TCTTTCAAGATGA	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.1327T>G	chr13.hg19:g.78472337A>C	ENSP00000335311:p.*443Argext*18	42.0	0.0		80.0	14.0	NM_001201397	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	hg19	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118662	0.56505	.	.	ENSG00000136160	ENST00000377211;ENST00000334286	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4116	0.83717	1.0:0.0:0.0:0.0	.	.	.	.	G	533;443	.	.	X	-	1	0	EDNRB	77370338	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.316000	0.72857	2.276000	0.75962	0.528000	0.53228	TGA	.	.		0.323	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
CCDC168	643677	hgsc.bcm.edu	37	13	103391517	103391517	+	5'Flank	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr13:103391517C>A	ENST00000322527.2	-	0	0					NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168																		AGATTACTTTCATCTTCCTGC	0.348																																					p.E3844X		Atlas-SNP	.											.	.	.	.	0			c.G11530T						.						137.0	118.0	124.0					13																	103391517		692	1591	2283	SO:0001631	upstream_gene_variant	643677	exon4			TACTTTCATCTTC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287		chr13.hg19:g.103391517C>A	Exception_encountered	142.0	0.0		148.0	66.0	NM_001146197	Q8N800	Nonsense_Mutation	SNP	ENST00000322527.2	hg19																																																																																				.	.		0.348	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
C14orf119	55017	hgsc.bcm.edu	37	14	23567275	23567275	+	Silent	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:23567275A>G	ENST00000319074.4	+	2	1264	c.408A>G	c.(406-408)acA>acG	p.T136T	C14orf119_ENST00000554203.1_Silent_p.T136T|ACIN1_ENST00000457657.1_5'Flank|ACIN1_ENST00000605057.1_5'Flank|ACIN1_ENST00000262710.1_5'Flank|ACIN1_ENST00000555053.1_5'Flank	NM_017924.3	NP_060394.1	Q9NWQ9	CN119_HUMAN	chromosome 14 open reading frame 119	136						mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(1)|lung(1)	3	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00649)		TGGCTGCTACAGCTGGTAAGG	0.473																																					p.T136T		Atlas-SNP	.											.	C14orf119	7	.	0			c.A408G						.						58.0	61.0	60.0					14																	23567275		2203	4300	6503	SO:0001819	synonymous_variant	55017	exon2			TGCTACAGCTGGT		CCDS9588.1	14q11.2	2012-09-25			ENSG00000179933	ENSG00000179933			20270	protein-coding gene	gene with protein product							Standard	NM_017924		Approved	FLJ20671	uc001wiu.3	Q9NWQ9	OTTHUMG00000028717	ENST00000319074.4:c.408A>G	chr14.hg19:g.23567275A>G		73.0	0.0		70.0	17.0	NM_017924	Q6IAA7	Silent	SNP	ENST00000319074.4	hg19	CCDS9588.1																																																																																			.	.		0.473	C14orf119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071713.3	NM_017924	
HECTD1	25831	hgsc.bcm.edu	37	14	31604292	31604292	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:31604292T>C	ENST00000399332.1	-	22	3852	c.3364A>G	c.(3364-3366)Aat>Gat	p.N1122D	HECTD1_ENST00000553700.1_Missense_Mutation_p.N1122D	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1122					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AAAGCTGAATTATCACGACTT	0.413																																					p.N1122D		Atlas-SNP	.											.	HECTD1	159	.	0			c.A3364G						.						161.0	143.0	149.0					14																	31604292		1906	4130	6036	SO:0001583	missense	25831	exon22			CTGAATTATCACG	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.3364A>G	chr14.hg19:g.31604292T>C	ENSP00000382269:p.Asn1122Asp	124.0	0.0		96.0	16.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.263184	0.59431	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.44083	0.93;0.93;0.93	6.03	4.87	0.63330	Galactose-binding domain-like (1);Sad1/UNC-like, C-terminal (1);	0.056301	0.64402	U	0.000002	T	0.28532	0.0706	N	0.14661	0.345	0.37834	D	0.928823	B;B	0.21309	0.054;0.005	B;B	0.19391	0.024;0.025	T	0.10268	-1.0637	10	0.49607	T	0.09	-18.083	13.5208	0.61566	0.0:0.0:0.1302:0.8698	.	1122;1122	D3DS86;Q9ULT8	.;HECD1_HUMAN	D	1122;1124;1122;596	ENSP00000450697:N1122D;ENSP00000382269:N1122D;ENSP00000451860:N596D	ENSP00000261312:N1124D	N	-	1	0	HECTD1	30674043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.021000	0.88750	1.081000	0.41110	0.533000	0.62120	AAT	.	.		0.413	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
FAM179B	23116	hgsc.bcm.edu	37	14	45465007	45465007	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:45465007T>G	ENST00000361577.3	+	2	2319	c.2105T>G	c.(2104-2106)gTc>gGc	p.V702G	FAM179B_ENST00000361462.2_Missense_Mutation_p.V702G|FAM179B_ENST00000382233.2_Missense_Mutation_p.V702G|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	702										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						GGAATGCCAGTCAATGATGAT	0.318																																					p.V702G		Atlas-SNP	.											.	FAM179B	115	.	0			c.T2105G						.						92.0	89.0	90.0					14																	45465007		2203	4299	6502	SO:0001583	missense	23116	exon2			TGCCAGTCAATGA	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2105T>G	chr14.hg19:g.45465007T>G	ENSP00000355045:p.Val702Gly	106.0	0.0		93.0	15.0	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	hg19	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.870680	0.51695	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233;ENST00000555874	T;T;T;T	0.03889	3.77;3.77;3.77;3.77	5.42	2.96	0.34315	Armadillo-type fold (1);	0.287440	0.24688	N	0.036414	T	0.02455	0.0075	N	0.12182	0.205	0.40305	D	0.978653	B;B;B;B	0.11235	0.004;0.001;0.003;0.002	B;B;B;B	0.12156	0.007;0.004;0.004;0.007	T	0.50583	-0.8811	10	0.36615	T	0.2	-0.562	1.619	0.02709	0.1359:0.1589:0.1408:0.5644	.	702;702;702;702	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	G	702;702;702;702;21	ENSP00000355045:V702G;ENSP00000354917:V702G;ENSP00000371668:V702G;ENSP00000451141:V21G	ENSP00000354917:V702G	V	+	2	0	FAM179B	44534757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.373000	0.20484	0.334000	0.23590	0.477000	0.44152	GTC	.	.		0.318	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
BMP4	652	hgsc.bcm.edu	37	14	54416923	54416923	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:54416923T>A	ENST00000245451.4	-	4	1447	c.1054A>T	c.(1054-1056)Acc>Tcc	p.T352S	BMP4_ENST00000417573.1_Missense_Mutation_p.T352S|BMP4_ENST00000558984.1_Missense_Mutation_p.T352S|MIR5580_ENST00000580850.1_RNA|BMP4_ENST00000559087.1_Missense_Mutation_p.T352S	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	352					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						GCATGGTTGGTTGAGTTGAGG	0.552																																					p.T352S		Atlas-SNP	.											.	BMP4	45	.	0			c.A1054T						.						155.0	129.0	138.0					14																	54416923		2203	4300	6503	SO:0001583	missense	652	exon4			GGTTGGTTGAGTT	AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.1054A>T	chr14.hg19:g.54416923T>A	ENSP00000245451:p.Thr352Ser	191.0	0.0		216.0	40.0	NM_130851	Q9UM80	Missense_Mutation	SNP	ENST00000245451.4	hg19	CCDS9715.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.090123	0.76756	.	.	ENSG00000125378	ENST00000245451;ENST00000417573	T;T	0.64438	-0.1;-0.1	5.53	5.53	0.82687	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.71970	0.3403	L	0.55017	1.72	0.80722	D	1	D	0.52996	0.957	P	0.58454	0.839	T	0.74957	-0.3487	10	0.87932	D	0	.	14.9972	0.71443	0.0:0.0:0.0:1.0	.	352	P12644	BMP4_HUMAN	S	352	ENSP00000245451:T352S;ENSP00000394165:T352S	ENSP00000245451:T352S	T	-	1	0	BMP4	53486673	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.861000	0.87004	2.324000	0.78689	0.533000	0.62120	ACC	.	.		0.552	BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276894.2	NM_001202	
KCNH5	27133	hgsc.bcm.edu	37	14	63246579	63246579	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:63246579T>C	ENST00000322893.7	-	10	2154	c.1886A>G	c.(1885-1887)aAc>aGc	p.N629S	KCNH5_ENST00000394968.1_Missense_Mutation_p.N571S|KCNH5_ENST00000420622.2_Intron	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	629					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TGCCCGGACGTTCGCACATGC	0.453																																					p.N629S		Atlas-SNP	.											.	KCNH5	320	.	0			c.A1886G						.						107.0	95.0	99.0					14																	63246579		2203	4300	6503	SO:0001583	missense	27133	exon10			CGGACGTTCGCAC	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1886A>G	chr14.hg19:g.63246579T>C	ENSP00000321427:p.Asn629Ser	144.0	0.0		115.0	22.0	NM_139318	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	hg19	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	T	9.964	1.223736	0.22457	.	.	ENSG00000140015	ENST00000322893;ENST00000394968	D;D	0.91686	-2.89;-2.89	5.72	5.72	0.89469	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.88749	0.6521	N	0.10809	0.05	0.80722	D	1	P;P	0.46395	0.537;0.877	B;P	0.51016	0.155;0.656	D	0.89976	0.4097	10	0.44086	T	0.13	.	16.0003	0.80288	0.0:0.0:0.0:1.0	.	571;629	Q8NCM2-3;Q8NCM2	.;KCNH5_HUMAN	S	629;571	ENSP00000321427:N629S;ENSP00000378419:N571S	ENSP00000321427:N629S	N	-	2	0	KCNH5	62316332	1.000000	0.71417	0.992000	0.48379	0.023000	0.10783	8.036000	0.88901	2.183000	0.69458	0.477000	0.44152	AAC	.	.		0.453	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
ZBTB1	22890	hgsc.bcm.edu	37	14	64998591	64998591	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:64998591G>A	ENST00000358738.3	+	3	2302	c.1911G>A	c.(1909-1911)ggG>ggA	p.G637G	RP11-973N13.4_ENST00000554918.1_RNA	NM_014950.2	NP_055765.2	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	0					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		GTGAAATAGGGCCTTCTAAAC	0.363																																					p.G637G		Atlas-SNP	.											.	ZBTB1	93	.	0			c.G1911A						.						174.0	164.0	167.0					14																	64998591		2203	4300	6503	SO:0001819	synonymous_variant	22890	exon3			AATAGGGCCTTCT	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000358738.3:c.1911G>A	chr14.hg19:g.64998591G>A		91.0	0.0		106.0	19.0	NM_014950	A8K6S8|Q86SW8	Silent	SNP	ENST00000358738.3	hg19	CCDS32097.1																																																																																			.	.		0.363	ZBTB1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000411913.1		
EML5	161436	hgsc.bcm.edu	37	14	89258735	89258735	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:89258735T>A	ENST00000380664.5	-	1	112	c.113A>T	c.(112-114)tAc>tTc	p.Y38F	EML5_ENST00000352093.5_Missense_Mutation_p.Y38F|EML5_ENST00000554922.1_Missense_Mutation_p.Y38F			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	38						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CGCCACGAAGTATACGATCTC	0.667																																					p.Y38F		Atlas-SNP	.											.	EML5	141	.	0			c.A113T						.						8.0	12.0	10.0					14																	89258735		1925	4073	5998	SO:0001583	missense	161436	exon1			ACGAAGTATACGA	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.113A>T	chr14.hg19:g.89258735T>A	ENSP00000370039:p.Tyr38Phe	95.0	0.0		64.0	14.0	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.513785	0.85389	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.43688	0.94;0.94;0.94	4.24	3.05	0.35203	HELP (1);	0.090074	0.46758	N	0.000266	T	0.60444	0.2269	M	0.82630	2.6	0.39162	D	0.962422	D	0.54207	0.965	P	0.60789	0.879	T	0.63739	-0.6569	10	0.56958	D	0.05	-4.9029	9.8227	0.40891	0.154:0.0:0.0:0.846	.	38	Q05BV3	EMAL5_HUMAN	F	38	ENSP00000451998:Y38F;ENSP00000298315:Y38F;ENSP00000370039:Y38F	ENSP00000298315:Y38F	Y	-	2	0	EML5	88328488	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.109000	0.77062	0.468000	0.27243	-0.669000	0.03829	TAC	.	.		0.667	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
TDRD9	122402	hgsc.bcm.edu	37	14	104436890	104436890	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr14:104436890A>G	ENST00000409874.4	+	6	826	c.778A>G	c.(778-780)Aca>Gca	p.T260A	TDRD9_ENST00000339063.5_Missense_Mutation_p.T260A	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	260	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ACACGAACGAACAGAAGAAAT	0.438																																					p.T260A		Atlas-SNP	.											.	TDRD9	175	.	0			c.A778G						.						216.0	180.0	191.0					14																	104436890		692	1591	2283	SO:0001583	missense	122402	exon6			GAACGAACAGAAG	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.778A>G	chr14.hg19:g.104436890A>G	ENSP00000387303:p.Thr260Ala	110.0	0.0		120.0	15.0	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	hg19	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	A	17.76	3.467886	0.63625	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.26810	1.71;1.71	5.87	5.87	0.94306	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	.	.	.	.	T	0.41488	0.1161	L	0.58510	1.815	0.58432	D	0.999995	B	0.29766	0.256	P	0.45276	0.475	T	0.33701	-0.9858	9	0.66056	D	0.02	.	16.2674	0.82597	1.0:0.0:0.0:0.0	.	260	Q8NDG6	TDRD9_HUMAN	A	260	ENSP00000387303:T260A;ENSP00000343545:T260A	ENSP00000343545:T260A	T	+	1	0	TDRD9	103506643	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.960000	0.76036	2.242000	0.73789	0.533000	0.62120	ACA	.	.		0.438	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
DISP2	85455	hgsc.bcm.edu	37	15	40660665	40660665	+	Silent	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:40660665C>A	ENST00000267889.3	+	8	2439	c.2352C>A	c.(2350-2352)ggC>ggA	p.G784G	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	784					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.G784G(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TGGACACTGGCGACCCTCTGG	0.682																																					p.G784G		Atlas-SNP	.											DISP2,NS,carcinoma,0,1	DISP2	86	.	1	Substitution - coding silent(1)	lung(1)	c.C2352A						.						73.0	80.0	78.0					15																	40660665		2203	4299	6502	SO:0001819	synonymous_variant	85455	exon8			CACTGGCGACCCT	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2352C>A	chr15.hg19:g.40660665C>A		87.0	0.0		114.0	33.0	NM_033510	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	hg19	CCDS10056.1																																																																																			.	.		0.682	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
MAP1A	4130	hgsc.bcm.edu	37	15	43819399	43819399	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:43819399C>T	ENST00000300231.5	+	4	6178	c.5728C>T	c.(5728-5730)Cgc>Tgc	p.R1910C	MAP1A_ENST00000382031.1_Missense_Mutation_p.R2148C|MAP1A_ENST00000399453.1_Missense_Mutation_p.R1910C			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1910					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GAAGGACTACCGCAAGGCTGA	0.592																																					p.R1910C		Atlas-SNP	.											.	MAP1A	189	.	0			c.C5728T						.						68.0	83.0	78.0					15																	43819399		2088	4235	6323	SO:0001583	missense	4130	exon4			GACTACCGCAAGG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.5728C>T	chr15.hg19:g.43819399C>T	ENSP00000300231:p.Arg1910Cys	176.0	0.0		218.0	39.0	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	hg19	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241773	0.39598	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01947	4.54;4.54;4.54	4.88	3.97	0.46021	.	0.250675	0.21186	N	0.078733	T	0.02688	0.0081	L	0.36672	1.1	0.38562	D	0.949739	B	0.15930	0.015	B	0.12156	0.007	T	0.45026	-0.9289	10	0.72032	D	0.01	-2.3585	10.5645	0.45165	0.0:0.9088:0.0:0.0912	.	1910	P78559	MAP1A_HUMAN	C	2148;1910;1910	ENSP00000371462:R2148C;ENSP00000382380:R1910C;ENSP00000300231:R1910C	ENSP00000300231:R1910C	R	+	1	0	MAP1A	41606691	0.883000	0.30277	1.000000	0.80357	0.992000	0.81027	0.420000	0.21263	1.281000	0.44480	0.563000	0.77884	CGC	.	.		0.592	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
USP8	9101	hgsc.bcm.edu	37	15	50751310	50751310	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:50751310C>T	ENST00000396444.3	+	5	787	c.449C>T	c.(448-450)gCt>gTt	p.A150V	USP8_ENST00000307179.4_Missense_Mutation_p.A150V|USP8_ENST00000433963.1_Missense_Mutation_p.A150V|USP8_ENST00000425032.3_Missense_Mutation_p.A73V	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	150					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GGCACATTGGCTAAAGGCTCT	0.413																																					p.A150V		Atlas-SNP	.											.	USP8	90	.	0			c.C449T						.						96.0	98.0	97.0					15																	50751310		2196	4294	6490	SO:0001583	missense	9101	exon5			CATTGGCTAAAGG	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.449C>T	chr15.hg19:g.50751310C>T	ENSP00000379721:p.Ala150Val	378.0	0.0		551.0	130.0	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	hg19	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.402494	0.25291	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032	T;T;T;T	0.19669	2.19;2.19;2.19;2.13	5.84	3.94	0.45596	.	0.525951	0.20912	N	0.083460	T	0.14399	0.0348	N	0.24115	0.695	0.19300	N	0.99998	B;B	0.24258	0.1;0.1	B;B	0.18561	0.022;0.022	T	0.16512	-1.0400	10	0.16896	T	0.51	-1.7553	15.019	0.71613	0.2602:0.7398:0.0:0.0	.	73;150	B4DKA8;P40818	.;UBP8_HUMAN	V	150;150;150;73	ENSP00000379721:A150V;ENSP00000405537:A150V;ENSP00000302239:A150V;ENSP00000412682:A73V	ENSP00000302239:A150V	A	+	2	0	USP8	48538602	0.009000	0.17119	0.100000	0.21137	0.183000	0.23260	1.515000	0.35845	0.779000	0.33543	0.650000	0.86243	GCT	.	.		0.413	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
TRPM7	54822	hgsc.bcm.edu	37	15	50885907	50885907	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:50885907T>C	ENST00000313478.7	-	25	3796	c.3515A>G	c.(3514-3516)gAt>gGt	p.D1172G	TRPM7_ENST00000560955.1_Missense_Mutation_p.D1172G	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1172					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CTCTTCAAAATCATGAAGTTT	0.343																																					p.D1172G		Atlas-SNP	.											.	TRPM7	145	.	0			c.A3515G						.						80.0	72.0	75.0					15																	50885907		1792	4058	5850	SO:0001583	missense	54822	exon25			TCAAAATCATGAA	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3515A>G	chr15.hg19:g.50885907T>C	ENSP00000320239:p.Asp1172Gly	70.0	0.0		102.0	31.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.523899	0.85600	.	.	ENSG00000092439	ENST00000313478	T	0.47177	0.85	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.63295	0.2499	M	0.70595	2.14	0.80722	D	1	D	0.60575	0.988	P	0.57204	0.815	T	0.67753	-0.5589	10	0.66056	D	0.02	-23.1566	15.5611	0.76249	0.0:0.0:0.0:1.0	.	1172	Q96QT4	TRPM7_HUMAN	G	1172	ENSP00000320239:D1172G	ENSP00000320239:D1172G	D	-	2	0	TRPM7	48673199	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.661000	0.83786	2.087000	0.62958	0.454000	0.30748	GAT	.	.		0.343	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
UBE2Q2	92912	hgsc.bcm.edu	37	15	76183289	76183289	+	Silent	SNP	G	G	C	rs142780659		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:76183289G>C	ENST00000267938.4	+	11	1345	c.963G>C	c.(961-963)tcG>tcC	p.S321S	UBE2Q2_ENST00000561851.1_Silent_p.S305S|UBE2Q2_ENST00000569423.1_Silent_p.S286S|UBE2Q2_ENST00000338677.4_Intron	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	321					protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.S321S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						CAATAGAATCGGTCATCATGC	0.388																																					p.S321S		Atlas-SNP	.											UBE2Q2,NS,carcinoma,0,1	UBE2Q2	26	.	1	Substitution - coding silent(1)	endometrium(1)	c.G963C						.						116.0	118.0	118.0					15																	76183289		2197	4294	6491	SO:0001819	synonymous_variant	92912	exon11			AGAATCGGTCATC	BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.963G>C	chr15.hg19:g.76183289G>C		104.0	0.0		154.0	42.0	NM_173469	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Silent	SNP	ENST00000267938.4	hg19	CCDS10286.1																																																																																			.	G|1.000;A|0.000		0.388	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469	
WDR61	80349	hgsc.bcm.edu	37	15	78582307	78582307	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:78582307G>C	ENST00000267973.2	-	6	725	c.454C>G	c.(454-456)Ctt>Gtt	p.L152V	WDR61_ENST00000558311.1_Missense_Mutation_p.L152V|WDR61_ENST00000558459.1_Missense_Mutation_p.L59V			Q9GZS3	WDR61_HUMAN	WD repeat domain 61	152					histone H3-K4 trimethylation (GO:0080182)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						GCAATACTAAGAATGAATTTT	0.423																																					p.L152V		Atlas-SNP	.											WDR61,NS,carcinoma,0,1	WDR61	26	.	0			c.C454G						.						88.0	85.0	86.0					15																	78582307		2196	4293	6489	SO:0001583	missense	80349	exon6			TACTAAGAATGAA		CCDS10300.1	15q25.1	2013-01-09			ENSG00000140395	ENSG00000140395		"""WD repeat domain containing"""	30300	protein-coding gene	gene with protein product		609540				12477932	Standard	NM_025234		Approved	REC14	uc002bdn.3	Q9GZS3	OTTHUMG00000143735	ENST00000267973.2:c.454C>G	chr15.hg19:g.78582307G>C	ENSP00000267973:p.Leu152Val	121.0	0.0		166.0	16.0	NM_025234	D3DW84|Q6IA22|Q7Z4X4	Missense_Mutation	SNP	ENST00000267973.2	hg19	CCDS10300.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.151101	0.78001	.	.	ENSG00000140395	ENST00000267973	T	0.60797	0.16	6.1	6.1	0.99115	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.52273	0.1724	L	0.41824	1.3	0.80722	D	1	P	0.44690	0.841	B	0.41723	0.365	T	0.41963	-0.9479	10	0.17369	T	0.5	-7.9757	19.7028	0.96062	0.0:0.0:1.0:0.0	.	152	Q9GZS3	WDR61_HUMAN	V	152	ENSP00000267973:L152V	ENSP00000267973:L152V	L	-	1	0	WDR61	76369362	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.554000	0.73923	2.902000	0.99343	0.650000	0.86243	CTT	.	.		0.423	WDR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289803.3	NM_025234	
NME3	4832	hgsc.bcm.edu	37	16	1821508	1821508	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr16:1821508C>T	ENST00000219302.3	-	1	223	c.28G>A	c.(28-30)Gct>Act	p.A10T	NME3_ENST00000563498.1_5'UTR|EME2_ENST00000307394.7_5'Flank|EME2_ENST00000568449.1_5'Flank	NM_002513.2	NP_002504.2	Q13232	NDK3_HUMAN	NME/NM23 nucleoside diphosphate kinase 3	10					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			lung(1)	1						AAGAGGTTAGCGAAGATGGTC	0.781																																					p.A10T		Atlas-SNP	.											.	NME3	4	.	0			c.G28A						.						4.0	3.0	3.0					16																	1821508		1120	1911	3031	SO:0001583	missense	4832	exon1			GGTTAGCGAAGAT	U29656	CCDS10443.1	16q13.3	2013-04-29	2012-05-18		ENSG00000103024	ENSG00000103024			7851	protein-coding gene	gene with protein product		601817	"""non-metastatic cells 3, protein expressed in"""			9067290, 19852809	Standard	NM_002513		Approved	DR-nm23, NM23-H3, NDPKC	uc002cmm.3	Q13232	OTTHUMG00000128635	ENST00000219302.3:c.28G>A	chr16.hg19:g.1821508C>T	ENSP00000219302:p.Ala10Thr	55.0	0.0		87.0	18.0	NM_002513	Q9BWH4	Missense_Mutation	SNP	ENST00000219302.3	hg19	CCDS10443.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.099262	0.56183	.	.	ENSG00000103024	ENST00000219302	T	0.64085	-0.08	3.97	1.86	0.25419	.	0.222141	0.35466	N	0.003200	T	0.44644	0.1303	L	0.43152	1.355	0.41624	D	0.988989	P	0.46912	0.886	B	0.35607	0.206	T	0.33471	-0.9867	10	0.39692	T	0.17	0.0136	7.2678	0.26239	0.1643:0.7404:0.0:0.0952	.	10	Q13232	NDK3_HUMAN	T	10	ENSP00000219302:A10T	ENSP00000219302:A10T	A	-	1	0	NME3	1761509	0.001000	0.12720	0.465000	0.27155	0.923000	0.55619	0.324000	0.19610	0.614000	0.30107	0.456000	0.33151	GCT	.	.		0.781	NME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250505.2	NM_002513	
TNRC6A	27327	hgsc.bcm.edu	37	16	24788429	24788429	+	Silent	SNP	A	A	G	rs10593507|rs60829899|rs71156436|rs71383714	byFrequency	TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr16:24788429A>G	ENST00000395799.3	+	5	468	c.339A>G	c.(337-339)ccA>ccG	p.P113P	TNRC6A_ENST00000315183.7_Silent_p.P113P	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	113	Gln-rich.|Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		agcagcagccacagccgcagc	0.597																																					p.P113P		Atlas-SNP	.											.	TNRC6A	171	.	0			c.A339G						.						18.0	23.0	22.0					16																	24788429		2059	4012	6071	SO:0001819	synonymous_variant	27327	exon5			GCAGCCACAGCCG	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.339A>G	chr16.hg19:g.24788429A>G		77.0	0.0		88.0	6.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.		0.597	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
NUTF2	10204	hgsc.bcm.edu	37	16	67902495	67902495	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr16:67902495A>T	ENST00000219169.4	+	4	546	c.263A>T	c.(262-264)cAg>cTg	p.Q88L	NUTF2_ENST00000568396.2_Missense_Mutation_p.Q88L|NUTF2_ENST00000569436.2_Missense_Mutation_p.Q88L	NM_005796.1	NP_005787.1	P61970	NTF2_HUMAN	nuclear transport factor 2	88	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				protein export from nucleus (GO:0006611)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	transporter activity (GO:0005215)			kidney(1)|lung(2)|upper_aerodigestive_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		GTTGTGGGCCAGCTTAAGGTA	0.547																																					p.Q88L		Atlas-SNP	.											.	NUTF2	11	.	0			c.A263T						.						113.0	106.0	109.0					16																	67902495		2198	4300	6498	SO:0001583	missense	10204	exon4			TGGGCCAGCTTAA	U43939	CCDS10848.1	16q22.1	2008-02-05			ENSG00000102898	ENSG00000102898			13722	protein-coding gene	gene with protein product		605813				7744965, 3380696	Standard	NM_005796		Approved	NTF2, PP15	uc002eup.3	P61970	OTTHUMG00000137540	ENST00000219169.4:c.263A>T	chr16.hg19:g.67902495A>T	ENSP00000219169:p.Gln88Leu	60.0	0.0		70.0	38.0	NM_005796	B2R4G7|P13662|Q6IB67	Missense_Mutation	SNP	ENST00000219169.4	hg19	CCDS10848.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.935562	0.92458	.	.	ENSG00000102898	ENST00000219169	.	.	.	5.7	5.7	0.88788	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.054532	0.85682	N	0.000000	T	0.79251	0.4414	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.80527	-0.1343	9	0.49607	T	0.09	-6.5165	15.6194	0.76793	1.0:0.0:0.0:0.0	.	88	P61970	NTF2_HUMAN	L	88	.	ENSP00000219169:Q88L	Q	+	2	0	NUTF2	66459996	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.883000	0.92426	2.178000	0.69098	0.533000	0.62120	CAG	.	.		0.547	NUTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268871.1		
TP53	7157	hgsc.bcm.edu	37	17	7577148	7577148	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:7577148G>A	ENST00000269305.4	-	8	979	c.790C>T	c.(790-792)Cta>Tta	p.L264L	TP53_ENST00000420246.2_Silent_p.L264L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Silent_p.L264L|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Silent_p.L264L|TP53_ENST00000445888.2_Silent_p.L264L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	264	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> I (in sporadic cancers; somatic mutation).|L -> P (in a sporadic cancer; somatic mutation).|L -> Q (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L264L(5)|p.L264del(4)|p.L264I(3)|p.?(3)|p.L264fs*81(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.S261_L264>R(1)|p.N263fs*5(1)|p.E258fs*71(1)|p.L264V(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGTCCCAGTAGATTACCACTA	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.L264L	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,+1,12	TP53	33396	.	35	Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - coding silent(5)|Substitution - Missense(4)|Unknown(3)|Complex - deletion inframe(1)	urinary_tract(6)|upper_aerodigestive_tract(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|lung(3)|central_nervous_system(2)|breast(2)|large_intestine(1)|eye(1)|genital_tract(1)|stomach(1)	c.C790T						.						43.0	39.0	40.0					17																	7577148		2203	4299	6502	SO:0001819	synonymous_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCAGTAGATTACC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.790C>T	chr17.hg19:g.7577148G>A		85.0	0.0		71.0	33.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
GUCY2D	3000	hgsc.bcm.edu	37	17	7909980	7909980	+	Silent	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:7909980A>T	ENST00000254854.4	+	4	1476	c.1326A>T	c.(1324-1326)gcA>gcT	p.A442A		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	442					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				GGGGATCAGCACCCGGACCTG	0.642																																					p.A442A		Atlas-SNP	.											.	GUCY2D	82	.	0			c.A1326T						.						23.0	22.0	23.0					17																	7909980		2203	4300	6503	SO:0001819	synonymous_variant	3000	exon4			ATCAGCACCCGGA	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1326A>T	chr17.hg19:g.7909980A>T		76.0	0.0		93.0	33.0	NM_000180	Q6LEA7	Silent	SNP	ENST00000254854.4	hg19	CCDS11127.1																																																																																			.	.		0.642	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11701056	11701056	+	Missense_Mutation	SNP	A	A	T	rs145239685		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:11701056A>T	ENST00000262442.4	+	43	8434	c.8366A>T	c.(8365-8367)aAt>aTt	p.N2789I	DNAH9_ENST00000454412.2_Missense_Mutation_p.N2789I	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2789	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAGAACCACAATGAAGTCAAC	0.478																																					p.N2789I		Atlas-SNP	.											.	DNAH9	695	.	0			c.A8366T						.						217.0	160.0	179.0					17																	11701056		2203	4300	6503	SO:0001583	missense	1770	exon43			ACCACAATGAAGT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8366A>T	chr17.hg19:g.11701056A>T	ENSP00000262442:p.Asn2789Ile	131.0	0.0		114.0	42.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487301	0.84854	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.55052	0.54;0.54	5.68	5.68	0.88126	Dynein heavy chain, P-loop containing D4 domain (1);	0.162638	0.52532	D	0.000062	D	0.83487	0.5265	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90128	0.4204	10	0.87932	D	0	.	15.9259	0.79615	1.0:0.0:0.0:0.0	.	2789	Q9NYC9	DYH9_HUMAN	I	2789;2789;1371	ENSP00000262442:N2789I;ENSP00000414874:N2789I	ENSP00000262442:N2789I	N	+	2	0	DNAH9	11641781	1.000000	0.71417	0.971000	0.41717	0.846000	0.48090	9.277000	0.95755	2.158000	0.67659	0.528000	0.53228	AAT	.	A|1.000;G|0.000		0.478	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
GIT1	28964	hgsc.bcm.edu	37	17	27909015	27909015	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:27909015G>T	ENST00000225394.3	-	5	801	c.553C>A	c.(553-555)Ctg>Atg	p.L185M	GIT1_ENST00000394869.3_Missense_Mutation_p.L185M|RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000579937.1_Missense_Mutation_p.L185M|GIT1_ENST00000581348.1_Missense_Mutation_p.L185M	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	185					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		ACTACAAGCAGCTCGGCCTGC	0.622																																					p.L185M	Colon(81;41 1719 20078 35068)	Atlas-SNP	.											.	GIT1	84	.	0			c.C553A						.						76.0	63.0	67.0					17																	27909015		2203	4300	6503	SO:0001583	missense	28964	exon5			CAAGCAGCTCGGC	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.553C>A	chr17.hg19:g.27909015G>T	ENSP00000225394:p.Leu185Met	41.0	0.0		55.0	7.0	NM_014030	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	ENST00000225394.3	hg19	CCDS11250.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364256	0.61513	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.71103	-0.54;-0.54	5.11	3.11	0.35812	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000005	T	0.76856	0.4046	L	0.48642	1.525	0.42278	D	0.992082	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.87578	0.998;0.956;0.974;0.998	T	0.76236	-0.3033	10	0.54805	T	0.06	.	10.0098	0.41979	0.0723:0.0:0.7895:0.1382	.	189;185;185;185	Q59FC3;Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;.;GIT1_HUMAN	M	185	ENSP00000225394:L185M;ENSP00000378338:L185M	ENSP00000225394:L185M	L	-	1	2	GIT1	24933141	1.000000	0.71417	0.957000	0.39632	0.995000	0.86356	1.474000	0.35398	0.855000	0.35359	0.655000	0.94253	CTG	.	.		0.622	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	NM_014030	
CPD	1362	hgsc.bcm.edu	37	17	28778776	28778776	+	Silent	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:28778776T>C	ENST00000225719.4	+	14	3193	c.3117T>C	c.(3115-3117)gaT>gaC	p.D1039D	CPD_ENST00000543464.2_Silent_p.D792D|CPD_ENST00000584051.1_3'UTR	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	1039	Carboxypeptidase-like 3.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						TAAATCCAGATGGGCGAGAGA	0.403																																					p.D1039D		Atlas-SNP	.											.	CPD	89	.	0			c.T3117C						.						161.0	150.0	154.0					17																	28778776		2203	4300	6503	SO:0001819	synonymous_variant	1362	exon14			TCCAGATGGGCGA	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.3117T>C	chr17.hg19:g.28778776T>C		135.0	0.0		141.0	53.0	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	hg19	CCDS11257.1																																																																																			.	.		0.403	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
RHOT1	55288	hgsc.bcm.edu	37	17	30538176	30538176	+	Intron	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:30538176C>G	ENST00000333942.6	+	18	1978				RHOT1_ENST00000545287.2_Missense_Mutation_p.T594R|RHOT1_ENST00000358365.3_Missense_Mutation_p.T626R|RHOT1_ENST00000583994.1_Intron|RHOT1_ENST00000394692.2_Intron|RHOT1_ENST00000354266.3_Intron	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AACAGGTGTACATTTTGCATC	0.418																																					p.T626R		Atlas-SNP	.											.	RHOT1	69	.	0			c.C1877G						.						156.0	142.0	147.0					17																	30538176		2203	4300	6503	SO:0001627	intron_variant	55288	exon20			GGTGTACATTTTG	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1739+2848C>G	chr17.hg19:g.30538176C>G		90.0	0.0		83.0	7.0	NM_001033568	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	hg19	CCDS32612.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993448	0.35131	.	.	ENSG00000126858	ENST00000358365;ENST00000354266	T	0.76316	-1.01	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.80675	0.4668	N	0.22421	0.69	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.83275	0.991;0.996	T	0.74147	-0.3759	10	0.12766	T	0.61	-12.982	19.9823	0.97331	0.0:1.0:0.0:0.0	.	594;626	Q8IXI2-5;Q8IXI2-3	.;.	R	626;594	ENSP00000351132:T626R	ENSP00000346215:T594R	T	+	2	0	RHOT1	27562289	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.419000	0.80179	2.788000	0.95919	0.650000	0.86243	ACA	.	.		0.418	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307	
KRTAP3-3	85293	hgsc.bcm.edu	37	17	39150197	39150197	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:39150197A>T	ENST00000391586.1	-	1	188	c.153T>A	c.(151-153)tgT>tgA	p.C51*		NM_033185.2	NP_149441.1	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	51	3 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			lung(2)|prostate(2)	4		Breast(137;0.00043)				AGGGTGGGGGACAGTTGTCAC	0.617																																					p.C51X		Atlas-SNP	.											.	KRTAP3-3	11	.	0			c.T153A						.						125.0	87.0	100.0					17																	39150197		2203	4296	6499	SO:0001587	stop_gained	85293	exon1			TGGGGGACAGTTG	AJ406933	CCDS32643.1	17q21.2	2013-06-25			ENSG00000212899	ENSG00000212899		"""Keratin associated proteins"""	18890	protein-coding gene	gene with protein product						11279113	Standard	NM_033185		Approved	KAP3.3	uc002hvr.1	Q9BYR6	OTTHUMG00000133591	ENST00000391586.1:c.153T>A	chr17.hg19:g.39150197A>T	ENSP00000375428:p.Cys51*	242.0	0.0		250.0	15.0	NM_033185	Q52LP0|Q6NTD4	Nonsense_Mutation	SNP	ENST00000391586.1	hg19	CCDS32643.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614439	0.87359	.	.	ENSG00000212899	ENST00000391586	.	.	.	5.89	0.489	0.16854	.	0.327533	0.27147	N	0.020712	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2123	0.31490	0.4144:0.0:0.5856:0.0	.	.	.	.	X	51	.	ENSP00000375428:C51X	C	-	3	2	KRTAP3-3	36403723	0.025000	0.19082	0.996000	0.52242	0.994000	0.84299	-0.357000	0.07651	-0.086000	0.12550	-0.248000	0.11899	TGT	.	.		0.617	KRTAP3-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257695.1		
DHX8	1659	hgsc.bcm.edu	37	17	41590838	41590838	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:41590838A>T	ENST00000262415.3	+	17	2683	c.2611A>T	c.(2611-2613)Att>Ttt	p.I871F	DHX8_ENST00000540306.1_Missense_Mutation_p.I871F	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	871	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CAAGACAGGGATTGACCAGCT	0.438																																					p.I871F	NSCLC(56;1548 1661 49258 49987)	Atlas-SNP	.											.	DHX8	98	.	0			c.A2611T						.						178.0	141.0	153.0					17																	41590838		2203	4300	6503	SO:0001583	missense	1659	exon17			ACAGGGATTGACC	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.2611A>T	chr17.hg19:g.41590838A>T	ENSP00000262415:p.Ile871Phe	151.0	0.0		161.0	72.0	NM_004941		Missense_Mutation	SNP	ENST00000262415.3	hg19	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	A	32	5.183427	0.94885	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.02737	4.18;4.18	5.87	5.87	0.94306	Helicase, C-terminal (3);	0.101679	0.64402	D	0.000004	T	0.06508	0.0167	L	0.45422	1.42	0.80722	D	1	P;P	0.45902	0.868;0.797	P;P	0.48334	0.494;0.574	T	0.12993	-1.0526	10	0.87932	D	0	.	15.5056	0.75739	1.0:0.0:0.0:0.0	.	871;871	F5H658;Q14562	.;DHX8_HUMAN	F	871	ENSP00000437886:I871F;ENSP00000262415:I871F	ENSP00000262415:I871F	I	+	1	0	DHX8	38946364	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	9.115000	0.94336	2.257000	0.74773	0.529000	0.55759	ATT	.	.		0.438	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
CACNA1G	8913	hgsc.bcm.edu	37	17	48655580	48655580	+	Silent	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:48655580C>T	ENST00000359106.5	+	9	1956	c.1956C>T	c.(1954-1956)agC>agT	p.S652S	CACNA1G_ENST00000514079.1_Silent_p.S652S|CACNA1G_ENST00000360761.4_Silent_p.S652S|CACNA1G_ENST00000507510.2_Silent_p.S652S|CACNA1G_ENST00000507896.1_Silent_p.S652S|CACNA1G_ENST00000354983.4_Silent_p.S652S|CACNA1G_ENST00000515165.1_Silent_p.S652S|CACNA1G_ENST00000416767.4_Silent_p.S652S|CACNA1G_ENST00000352832.5_Silent_p.S652S|CACNA1G_ENST00000512389.1_Silent_p.S652S|CACNA1G_ENST00000507336.1_Silent_p.S652S|CACNA1G_ENST00000515411.1_Silent_p.S652S|CACNA1G_ENST00000442258.2_Silent_p.S652S|CACNA1G_ENST00000358244.5_Silent_p.S652S|CACNA1G_ENST00000502264.1_Silent_p.S652S|CACNA1G_ENST00000513964.1_Silent_p.S652S|CACNA1G_ENST00000510366.1_Silent_p.S652S|CACNA1G_ENST00000429973.2_Silent_p.S652S|CACNA1G_ENST00000514717.1_Silent_p.S652S|CACNA1G_ENST00000503485.1_Silent_p.S652S|CACNA1G_ENST00000514181.1_Silent_p.S652S|CACNA1G_ENST00000510115.1_Silent_p.S652S|CACNA1G_ENST00000507609.1_Silent_p.S652S|CACNA1G_ENST00000513689.2_Silent_p.S652S|CACNA1G_ENST00000505165.1_Silent_p.S652S|CACNA1G_ENST00000515765.1_Silent_p.S652S	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	652					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	AGATCTCCAGCCCTTGCTTGA	0.617																																					p.S652S		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C1956T						.						43.0	48.0	46.0					17																	48655580		1985	4156	6141	SO:0001819	synonymous_variant	8913	exon9			CTCCAGCCCTTGC	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.1956C>T	chr17.hg19:g.48655580C>T		127.0	0.0		121.0	10.0	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.		0.617	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
KCNH6	81033	hgsc.bcm.edu	37	17	61623190	61623190	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:61623190G>A	ENST00000583023.1	+	14	2923	c.2912G>A	c.(2911-2913)gGc>gAc	p.G971D	KCNH6_ENST00000456941.2_Missense_Mutation_p.G882D|KCNH6_ENST00000581784.1_Missense_Mutation_p.G882D|KCNH6_ENST00000314672.5_Missense_Mutation_p.G935D	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	971					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GAACACCTTGGCTCTGTTCCC	0.572																																					p.G971D		Atlas-SNP	.											.	KCNH6	122	.	0			c.G2912A						.						107.0	101.0	103.0					17																	61623190		2203	4300	6503	SO:0001583	missense	81033	exon14			ACCTTGGCTCTGT	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2912G>A	chr17.hg19:g.61623190G>A	ENSP00000463533:p.Gly971Asp	73.0	0.0		68.0	26.0	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	hg19	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	G	5.004	0.186415	0.09495	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99220	-5.58	4.57	1.3	0.21679	.	0.553031	0.14655	N	0.306375	D	0.96944	0.9002	L	0.46157	1.445	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.001;0.001;0.002	D	0.91443	0.5175	10	0.12430	T	0.62	.	8.1601	0.31194	0.4387:0.0:0.5613:0.0	.	812;935;882;971	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	D	971;882	ENSP00000396900:G882D	ENSP00000318212:G971D	G	+	2	0	KCNH6	58976922	0.501000	0.26099	0.702000	0.30337	0.965000	0.64279	1.456000	0.35201	0.404000	0.25506	0.563000	0.77884	GGC	.	.		0.572	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
DDX42	11325	hgsc.bcm.edu	37	17	61895571	61895571	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:61895571C>T	ENST00000578681.1	+	19	3231	c.2630C>T	c.(2629-2631)gCa>gTa	p.A877V	DDX42_ENST00000457800.2_Missense_Mutation_p.A877V|DDX42_ENST00000582985.1_Intron|DDX42_ENST00000583590.1_Missense_Mutation_p.A877V|DDX42_ENST00000359353.5_Missense_Mutation_p.A758V|DDX42_ENST00000389924.2_Missense_Mutation_p.A877V	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	877	Gly-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AACCGGGGTGCAAATGATGGT	0.557																																					p.A877V		Atlas-SNP	.											.	DDX42	86	.	0			c.C2630T						.						97.0	93.0	94.0					17																	61895571		2203	4300	6503	SO:0001583	missense	11325	exon18			GGGGTGCAAATGA	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.2630C>T	chr17.hg19:g.61895571C>T	ENSP00000464050:p.Ala877Val	61.0	0.0		78.0	26.0	NM_203499	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	hg19	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	C	7.237	0.600555	0.13939	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T;T	0.19532	2.14;2.14;3.2	5.06	4.05	0.47172	.	2.449100	0.01420	N	0.014353	T	0.21387	0.0515	L	0.36672	1.1	0.09310	N	1	B;B	0.17038	0.02;0.02	B;B	0.15052	0.01;0.012	T	0.09975	-1.0650	10	0.36615	T	0.2	-1.1621	9.4757	0.38869	0.2282:0.6362:0.1356:0.0	.	423;877	B3KV84;Q86XP3	.;DDX42_HUMAN	V	877;877;594	ENSP00000374574:A877V;ENSP00000390121:A877V;ENSP00000352308:A594V	ENSP00000352308:A594V	A	+	2	0	DDX42	59249303	0.000000	0.05858	0.796000	0.32109	0.368000	0.29767	0.247000	0.18179	2.627000	0.88993	0.467000	0.42956	GCA	.	.		0.557	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372	
CD79B	974	hgsc.bcm.edu	37	17	62007563	62007563	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:62007563T>A	ENST00000006750.3	-	3	393	c.301A>T	c.(301-303)Aac>Tac	p.N101Y	CD79B_ENST00000392795.3_Missense_Mutation_p.N102Y|CD79B_ENST00000349817.2_Intron	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	101	Ig-like V-type.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						AGAGATTCGTTCTGGGACTCT	0.562			"""Mis, O"""		DLBCL																																p.N102Y		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	.	CD79B	38	.	0			c.A304T						.						157.0	132.0	141.0					17																	62007563		2203	4300	6503	SO:0001583	missense	974	exon3			ATTCGTTCTGGGA	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.301A>T	chr17.hg19:g.62007563T>A	ENSP00000006750:p.Asn101Tyr	73.0	0.0		85.0	7.0	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	hg19	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252815	0.59212	.	.	ENSG00000007312	ENST00000392795;ENST00000006750	T;T	0.70869	-0.52;-0.52	5.49	4.42	0.53409	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.537006	0.20823	N	0.085021	T	0.78848	0.4348	M	0.65320	2	0.21499	N	0.999668	D	0.89917	1.0	D	0.71184	0.972	T	0.68296	-0.5446	10	0.51188	T	0.08	-29.8364	8.0253	0.30434	0.0:0.0923:0.0:0.9077	.	101	P40259	CD79B_HUMAN	Y	102;101	ENSP00000376544:N102Y;ENSP00000006750:N101Y	ENSP00000006750:N101Y	N	-	1	0	CD79B	59361295	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.338000	0.19858	0.936000	0.37367	0.459000	0.35465	AAC	.	.		0.562	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
SMURF2	64750	hgsc.bcm.edu	37	17	62553767	62553767	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:62553767T>C	ENST00000262435.9	-	13	1577	c.1390A>G	c.(1390-1392)Att>Gtt	p.I464V		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	464	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			AATGTATAAATATCATCTCTT	0.343																																					p.I464V		Atlas-SNP	.											.	SMURF2	63	.	0			c.A1390G						.						95.0	96.0	96.0					17																	62553767		2203	4298	6501	SO:0001583	missense	64750	exon13			TATAAATATCATC	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1390A>G	chr17.hg19:g.62553767T>C	ENSP00000262435:p.Ile464Val	377.0	0.0		357.0	35.0	NM_022739	Q52LL1|Q9H260	Missense_Mutation	SNP	ENST00000262435.9	hg19	CCDS32707.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.715886	0.48622	.	.	ENSG00000108854	ENST00000262435	T	0.57273	0.41	5.81	5.81	0.92471	HECT (4);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	L	0.49350	1.555	0.80722	D	1	B	0.15141	0.012	B	0.18561	0.022	T	0.41645	-0.9497	10	0.39692	T	0.17	.	16.1607	0.81704	0.0:0.0:0.0:1.0	.	464	Q9HAU4	SMUF2_HUMAN	V	464	ENSP00000262435:I464V	ENSP00000262435:I464V	I	-	1	0	SMURF2	59984229	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.991000	0.88244	2.226000	0.72624	0.482000	0.46254	ATT	.	.		0.343	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445227.1	NM_022739	
DNAH17	8632	hgsc.bcm.edu	37	17	76445590	76445590	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:76445590A>T	ENST00000585328.1	-	69	11226	c.11102T>A	c.(11101-11103)cTg>cAg	p.L3701Q	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.L3692Q	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3692					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CTCGTCCGTCAGGTTGATCAC	0.562																																					p.L3706Q		Atlas-SNP	.											.	DNAH17	347	.	0			c.T11117A						.						122.0	92.0	103.0					17																	76445590		2203	4296	6499	SO:0001583	missense	8632	exon69			TCCGTCAGGTTGA	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.11102T>A	chr17.hg19:g.76445590A>T	ENSP00000465516:p.Leu3701Gln	114.0	0.0		131.0	54.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	A	22.2	4.252328	0.80135	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.68765	-0.35	4.85	4.85	0.62838	.	0.000000	0.43110	D	0.000602	D	0.87869	0.6286	H	0.97682	4.055	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.92084	0.5675	10	0.87932	D	0	.	14.456	0.67416	1.0:0.0:0.0:0.0	.	3701	E7EUM8	.	Q	3701;3692	ENSP00000374490:L3692Q	ENSP00000300671:L3701Q	L	-	2	0	DNAH17	73957185	1.000000	0.71417	0.997000	0.53966	0.708000	0.40852	9.153000	0.94687	1.821000	0.53095	0.459000	0.35465	CTG	.	.		0.562	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
SLC39A6	25800	hgsc.bcm.edu	37	18	33689641	33689641	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr18:33689641T>A	ENST00000590986.1	-	10	2472	c.2183A>T	c.(2182-2184)cAg>cTg	p.Q728L	SLC39A6_ENST00000269187.5_Missense_Mutation_p.Q728L			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	728					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						CCCAGCATTCTGTAAAAAGAA	0.348																																					p.Q728L		Atlas-SNP	.											.	SLC39A6	81	.	0			c.A2183T						.						126.0	125.0	125.0					18																	33689641		1824	4080	5904	SO:0001583	missense	25800	exon10			GCATTCTGTAAAA	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.2183A>T	chr18.hg19:g.33689641T>A	ENSP00000465915:p.Gln728Leu	339.0	0.0		378.0	196.0	NM_012319	B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	ENST00000590986.1	hg19	CCDS42428.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.683063	0.88542	.	.	ENSG00000141424	ENST00000269187;ENST00000543723	T	0.53640	0.61	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.63954	0.2555	L	0.53780	1.695	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66705	-0.5856	10	0.87932	D	0	-14.6662	13.8924	0.63747	0.0:0.0:0.0:1.0	.	728	Q13433	S39A6_HUMAN	L	728;383	ENSP00000269187:Q728L	ENSP00000269187:Q728L	Q	-	2	0	SLC39A6	31943639	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.841000	0.86834	2.229000	0.72834	0.482000	0.46254	CAG	.	.		0.348	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1		
NEDD4L	23327	hgsc.bcm.edu	37	18	56056334	56056334	+	Silent	SNP	C	C	T	rs375065890		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr18:56056334C>T	ENST00000400345.3	+	28	2848	c.2565C>T	c.(2563-2565)ctC>ctT	p.L855L	NEDD4L_ENST00000431212.2_Silent_p.L734L|NEDD4L_ENST00000586263.1_Silent_p.L827L|NEDD4L_ENST00000456173.2_Silent_p.L714L|NEDD4L_ENST00000256832.7_Silent_p.L715L|NEDD4L_ENST00000435432.2_Silent_p.L714L|NEDD4L_ENST00000356462.6_Silent_p.L791L|NEDD4L_ENST00000456986.1_Silent_p.L734L|NEDD4L_ENST00000382850.4_Silent_p.L835L|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000256830.9_Silent_p.L751L|NEDD4L_ENST00000357895.5_Silent_p.L847L	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	855	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						TGTGCGGCCTCGGTGATGTGG	0.488																																					p.L855L		Atlas-SNP	.											.	NEDD4L	126	.	0			c.C2565T						.	C	,,,,,,,,	0,4076		0,0,2038	99.0	100.0	100.0		2202,2202,2202,2565,2541,2481,2142,2142,2505	-5.8	0.5	18		100	1,8373		0,1,4186	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NEDD4L	NM_001144964.1,NM_001144965.1,NM_001144966.2,NM_001144967.2,NM_001144968.1,NM_001144969.1,NM_001144970.2,NM_001144971.1,NM_015277.5	,,,,,,,,	0,1,6224	TT,TC,CC		0.0119,0.0,0.0080	,,,,,,,,	734/855,734/855,734/855,855/976,847/968,827/948,714/835,714/835,835/956	56056334	1,12449	2038	4187	6225	SO:0001819	synonymous_variant	23327	exon28			CGGCCTCGGTGAT	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2565C>T	chr18.hg19:g.56056334C>T		123.0	0.0		108.0	7.0	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	hg19	CCDS45872.1																																																																																			.	.		0.488	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
SERPINB4	6318	hgsc.bcm.edu	37	18	61310753	61310753	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr18:61310753C>G	ENST00000341074.5	-	2	174	c.59G>C	c.(58-60)aGa>aCa	p.R20T	SERPINB4_ENST00000356424.6_Missense_Mutation_p.R20T	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	20					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						TTTTGATTTTCTGAACTGTTG	0.423																																					p.R20T		Atlas-SNP	.											.	SERPINB4	89	.	0			c.G59C						.						291.0	262.0	272.0					18																	61310753		2203	4300	6503	SO:0001583	missense	6318	exon2			GATTTTCTGAACT	X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.59G>C	chr18.hg19:g.61310753C>G	ENSP00000343445:p.Arg20Thr	220.0	0.0		190.0	85.0	NM_002974	A8K847	Missense_Mutation	SNP	ENST00000341074.5	hg19	CCDS11986.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.82|10.82	1.457554|1.457554	0.26161|0.26161	.|.	.|.	ENSG00000206073|ENSG00000206073	ENST00000413673|ENST00000341074;ENST00000356424;ENST00000436264	.|D;D;D	.|0.84146	.|-1.81;-1.81;-1.81	3.77|3.77	0.424|0.424	0.16468|0.16468	.|Serpin domain (3);	.|0.717201	.|0.11987	.|N	.|0.510226	D|D	0.82291|0.82291	0.5005|0.5005	L|L	0.38733|0.38733	1.17|1.17	0.09310|0.09310	N|N	1|1	.|P;B	.|0.40398	.|0.716;0.277	.|P;B	.|0.54924	.|0.764;0.297	T|T	0.69109|0.69109	-0.5232|-0.5232	5|10	.|0.18276	.|T	.|0.48	.|.	4.1902|4.1902	0.10417|0.10417	0.1608:0.5313:0.0:0.3079|0.1608:0.5313:0.0:0.3079	.|.	.|20;20	.|P48594;Q9BYF7	.|SPB4_HUMAN;.	Q|T	22|20	.|ENSP00000343445:R20T;ENSP00000348795:R20T;ENSP00000399796:R20T	.|ENSP00000343445:R20T	E|R	-|-	1|2	0|0	SERPINB4|SERPINB4	59461733|59461733	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.028000|0.028000	0.11728|0.11728	-0.334000|-0.334000	0.07883|0.07883	0.213000|0.213000	0.20722|0.20722	0.603000|0.603000	0.83216|0.83216	GAA|AGA	.	.		0.423	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041	
SMARCA4	6597	hgsc.bcm.edu	37	19	11143993	11143993	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr19:11143993C>T	ENST00000429416.3	+	27	3855	c.3574C>T	c.(3574-3576)Cgc>Tgc	p.R1192C	SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1192C|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1192C|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1192C|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1192C|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1192C|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1192C|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1192C|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1192C	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1192	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R1192C(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CCGAGCCCACCGCATCGGGCA	0.607			"""F, N, Mis"""		NSCLC																																p.R1192C		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,NS,carcinoma,0,3	SMARCA4	502	.	2	Substitution - Missense(1)|Unknown(1)	lung(1)|central_nervous_system(1)	c.C3574T						.						61.0	61.0	61.0					19																	11143993		2203	4300	6503	SO:0001583	missense	6597	exon26			GCCCACCGCATCG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3574C>T	chr19.hg19:g.11143993C>T	ENSP00000395654:p.Arg1192Cys	160.0	0.0		151.0	69.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507268	0.85282	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97888	-4.59;-4.59;-4.59;-4.59;-4.59;-4.59;-4.59	4.74	4.74	0.60224	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99498	0.9821	H	0.99982	5.21	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97352	0.9964	10	0.87932	D	0	-34.1151	16.7067	0.85374	0.0:1.0:0.0:0.0	.	1192;1192;1192;1192;1192;412;1192	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	C	1192;1192;1256;1192;1192;1192;1192;1192	ENSP00000395654:R1192C;ENSP00000350720:R1192C;ENSP00000343896:R1192C;ENSP00000445036:R1192C;ENSP00000392837:R1192C;ENSP00000397783:R1192C;ENSP00000414727:R1192C	ENSP00000343896:R1192C	R	+	1	0	SMARCA4	11004993	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.675000	0.68123	2.488000	0.83962	0.558000	0.71614	CGC	.	.		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
CLIP3	25999	hgsc.bcm.edu	37	19	36510204	36510204	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr19:36510204C>T	ENST00000360535.4	-	8	1150	c.923G>A	c.(922-924)gGc>gAc	p.G308D	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.G308D	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	308					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCGCAGTGTGCCCGTCTGGGG	0.652																																					p.G308D		Atlas-SNP	.											.	CLIP3	53	.	0			c.G923A						.						52.0	40.0	44.0					19																	36510204		2203	4299	6502	SO:0001583	missense	25999	exon7			AGTGTGCCCGTCT	AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.923G>A	chr19.hg19:g.36510204C>T	ENSP00000353732:p.Gly308Asp	38.0	0.0		40.0	25.0	NM_001199570	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	ENST00000360535.4	hg19	CCDS12486.1	.	.	.	.	.	.	.	.	.	.	c	31	5.060412	0.93846	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	D	0.90844	-2.74	5.25	5.25	0.73442	Cytoskeleton-associated protein, Gly-rich domain (3);	0.000000	0.85682	D	0.000000	D	0.97455	0.9167	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99050	1.0827	10	0.87932	D	0	-25.3401	16.3465	0.83134	0.0:1.0:0.0:0.0	.	308	Q96DZ5	CLIP3_HUMAN	D	308;190;284	ENSP00000353732:G308D	ENSP00000353732:G308D	G	-	2	0	CLIP3	41202044	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.608000	0.82898	2.478000	0.83669	0.580000	0.79431	GGC	.	.		0.652	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526	
WDR62	284403	hgsc.bcm.edu	37	19	36545927	36545927	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr19:36545927G>A	ENST00000270301.7	+	1	54	c.54G>A	c.(52-54)ctG>ctA	p.L18L	WDR62_ENST00000401500.2_Silent_p.L18L|WDR62_ENST00000378860.4_3'UTR|THAP8_ENST00000524106.1_5'Flank|WDR62_ENST00000388999.3_Silent_p.L18L|THAP8_ENST00000538849.1_5'Flank|THAP8_ENST00000292894.1_5'Flank			O43379	WDR62_HUMAN	WD repeat domain 62	18					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGGAGAAGCTGCCCTCTGTCA	0.721																																					p.L18L		Atlas-SNP	.											.	WDR62	102	.	0			c.G54A						.						12.0	11.0	11.0					19																	36545927		2065	4121	6186	SO:0001819	synonymous_variant	284403	exon1			GAAGCTGCCCTCT	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.54G>A	chr19.hg19:g.36545927G>A		138.0	0.0		165.0	108.0	NM_173636	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Silent	SNP	ENST00000270301.7	hg19	CCDS33001.1																																																																																			.	.		0.721	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671	
LMTK3	114783	hgsc.bcm.edu	37	19	49001083	49001083	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr19:49001083G>A	ENST00000600059.1	-	11	3470	c.3243C>T	c.(3241-3243)aaC>aaT	p.N1081N	LMTK3_ENST00000270238.3_Silent_p.N1110N			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1081	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CCAGCGTCCCGTTCTTGGGGG	0.736																																					p.N1110N		Atlas-SNP	.											.	LMTK3	125	.	0			c.C3330T						.						2.0	2.0	2.0					19																	49001083		1449	3344	4793	SO:0001819	synonymous_variant	114783	exon12			CGTCCCGTTCTTG	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.3243C>T	chr19.hg19:g.49001083G>A		27.0	0.0		31.0	15.0	NM_001080434	Q4G0U1	Silent	SNP	ENST00000600059.1	hg19																																																																																				.	.		0.736	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	
ZNF628	89887	hgsc.bcm.edu	37	19	55995139	55995139	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr19:55995139A>C	ENST00000598519.1	+	3	3132	c.2579A>C	c.(2578-2580)cAg>cCg	p.Q860P	ZNF628_ENST00000391718.2_Missense_Mutation_p.Q856P|NAT14_ENST00000205194.4_5'Flank|NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000591590.1_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	860	4 X approximate tandem repeats.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		CAGCCAGCACAGGAGGTGACC	0.637																																					p.Q860P		Atlas-SNP	.											.	ZNF628	75	.	0			c.A2579C						.						45.0	51.0	49.0					19																	55995139		2203	4300	6503	SO:0001583	missense	89887	exon3			CAGCACAGGAGGT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.2579A>C	chr19.hg19:g.55995139A>C	ENSP00000469591:p.Gln860Pro	125.0	0.0		140.0	72.0	NM_033113	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	hg19	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	12.72	2.023561	0.35701	.	.	ENSG00000197483	ENST00000391718	T	0.06371	3.31	4.12	4.12	0.48240	.	0.174973	0.26035	U	0.026733	T	0.04724	0.0128	N	0.14661	0.345	0.23076	N	0.998334	B	0.22080	0.064	B	0.20184	0.028	T	0.33904	-0.9850	10	0.87932	D	0	.	11.3774	0.49737	1.0:0.0:0.0:0.0	.	856	Q5EBL2	ZN628_HUMAN	P	856	ENSP00000375598:Q856P	ENSP00000375598:Q856P	Q	+	2	0	ZNF628	60686951	0.000000	0.05858	0.892000	0.35008	0.666000	0.39218	0.988000	0.29616	1.632000	0.50472	0.370000	0.22315	CAG	.	.		0.637	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
TGM6	343641	hgsc.bcm.edu	37	20	2413197	2413197	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr20:2413197A>C	ENST00000202625.2	+	13	2090	c.2029A>C	c.(2029-2031)Agt>Cgt	p.S677R	TGM6_ENST00000381423.1_3'UTR	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	677					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CCCCTCCAAAAGTGGCCCAAG	0.587																																					p.S677R		Atlas-SNP	.											.	TGM6	126	.	0			c.A2029C						.						129.0	106.0	114.0					20																	2413197		2203	4300	6503	SO:0001583	missense	343641	exon13			TCCAAAAGTGGCC	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.2029A>C	chr20.hg19:g.2413197A>C	ENSP00000202625:p.Ser677Arg	100.0	0.0		151.0	34.0	NM_198994	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	hg19	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114366	0.77210	.	.	ENSG00000166948	ENST00000202625	T	0.69306	-0.39	4.97	4.97	0.65823	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.291279	0.39341	N	0.001387	T	0.80380	0.4612	M	0.81497	2.545	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	T	0.82428	-0.0462	10	0.62326	D	0.03	-16.3713	11.2164	0.48830	1.0:0.0:0.0:0.0	.	677	O95932	TGM3L_HUMAN	R	677	ENSP00000202625:S677R	ENSP00000202625:S677R	S	+	1	0	TGM6	2361197	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.974000	0.63771	2.205000	0.71048	0.533000	0.62120	AGT	.	.		0.587	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
PLTP	5360	hgsc.bcm.edu	37	20	44533489	44533489	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr20:44533489C>T	ENST00000477313.1	-	9	1486	c.892G>A	c.(892-894)Gac>Aac	p.D298N	PLTP_ENST00000354050.4_Missense_Mutation_p.D246N|PLTP_ENST00000542937.1_Missense_Mutation_p.D318N|PLTP_ENST00000420868.2_Missense_Mutation_p.D203N|PLTP_ENST00000372420.1_Missense_Mutation_p.D210N|PLTP_ENST00000372431.3_Missense_Mutation_p.D298N			P55058	PLTP_HUMAN	phospholipid transfer protein	298					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				ATGTCCAGGTCGTGGGGCACC	0.602																																					p.D298N		Atlas-SNP	.											.	PLTP	49	.	0			c.G892A						.						110.0	104.0	106.0					20																	44533489		2203	4300	6503	SO:0001583	missense	5360	exon10			CCAGGTCGTGGGG	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.892G>A	chr20.hg19:g.44533489C>T	ENSP00000417138:p.Asp298Asn	192.0	0.0		292.0	109.0	NM_006227	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	hg19	CCDS13386.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922731	0.73213	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94;2.94	5.0	5.0	0.66597	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.150336	0.64402	D	0.000014	T	0.27731	0.0682	M	0.67953	2.075	0.58432	D	0.999998	D;D;D;D;D;D;D	0.71674	0.997;0.997;0.997;0.997;0.996;0.997;0.998	P;P;P;P;P;P;P	0.61070	0.883;0.883;0.834;0.883;0.868;0.883;0.883	T	0.00503	-1.1701	10	0.33141	T	0.24	-14.5091	16.6413	0.85127	0.0:1.0:0.0:0.0	.	203;203;210;298;246;298;318	E7EV16;B4DRB4;B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;.;PLTP_HUMAN;.	N	210;298;246;298;318;203	ENSP00000361497:D210N;ENSP00000361508:D298N;ENSP00000335290:D246N;ENSP00000417138:D298N;ENSP00000440296:D318N;ENSP00000411671:D203N	ENSP00000335290:D246N	D	-	1	0	PLTP	43966896	0.999000	0.42202	0.098000	0.21074	0.613000	0.37349	4.253000	0.58791	2.610000	0.88304	0.563000	0.77884	GAC	.	.		0.602	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
RBBP8NL	140893	hgsc.bcm.edu	37	20	60989520	60989520	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr20:60989520A>T	ENST00000252998.1	-	10	1043	c.887T>A	c.(886-888)cTg>cAg	p.L296Q		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	296						extracellular space (GO:0005615)											GTGCAGGGACAGGGGGCGGTT	0.711																																					p.L296Q		Atlas-SNP	.											.	.	.	.	0			c.T887A						.						3.0	5.0	4.0					20																	60989520		1759	3697	5456	SO:0001583	missense	140893	exon10			AGGGACAGGGGGC	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.887T>A	chr20.hg19:g.60989520A>T	ENSP00000252998:p.Leu296Gln	88.0	0.0		128.0	43.0	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	hg19	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	A	12.31	1.898564	0.33535	.	.	ENSG00000130701	ENST00000252998	T	0.38722	1.12	5.05	3.93	0.45458	.	0.111009	0.39407	N	0.001378	T	0.51363	0.1670	L	0.58810	1.83	0.09310	N	0.999997	D	0.60160	0.987	P	0.59703	0.862	T	0.41106	-0.9527	10	0.23891	T	0.37	-10.5506	10.3904	0.44164	0.8354:0.1646:0.0:0.0	.	296	Q8NC74	CT151_HUMAN	Q	296	ENSP00000252998:L296Q	ENSP00000252998:L296Q	L	-	2	0	C20orf151	60422915	0.137000	0.22531	0.006000	0.13384	0.007000	0.05969	2.874000	0.48483	0.738000	0.32606	0.402000	0.26972	CTG	.	.		0.711	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
ITGB2	3689	hgsc.bcm.edu	37	21	46321441	46321441	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr21:46321441C>A	ENST00000397850.2	-	7	1159	c.707G>T	c.(706-708)gGg>gTg	p.G236V	ITGB2_ENST00000397852.1_Missense_Mutation_p.G236V|ITGB2_ENST00000355153.4_Missense_Mutation_p.G236V|ITGB2_ENST00000397857.1_Missense_Mutation_p.G236V|ITGB2_ENST00000302347.5_Missense_Mutation_p.G236V|ITGB2_ENST00000397854.3_Missense_Mutation_p.G179V			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	236	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GGCGTCCAGCCCACCCTCGGG	0.652																																					p.G236V		Atlas-SNP	.											.	ITGB2	107	.	0			c.G707T						.						88.0	82.0	84.0					21																	46321441		2203	4300	6503	SO:0001583	missense	3689	exon6			TCCAGCCCACCCT	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.707G>T	chr21.hg19:g.46321441C>A	ENSP00000380948:p.Gly236Val	72.0	0.0		79.0	37.0	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	hg19	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163397	0.78226	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414;ENST00000320216	D;D;D;D;D;D;D	0.95238	-3.65;-3.65;-3.65;-3.65;-3.65;-3.65;-3.65	4.2	4.2	0.49525	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	.	.	.	.	D	0.97321	0.9124	M	0.88031	2.925	0.80722	D	1	D;D	0.76494	0.985;0.999	D;D	0.74023	0.955;0.982	D	0.98021	1.0371	9	0.87932	D	0	.	14.0752	0.64887	0.0:1.0:0.0:0.0	.	179;236	A8MYE6;P05107	.;ITB2_HUMAN	V	236;236;179;236;236;236;179;227	ENSP00000380950:G236V;ENSP00000380955:G236V;ENSP00000380952:G179V;ENSP00000347279:G236V;ENSP00000380948:G236V;ENSP00000303242:G236V;ENSP00000317697:G227V	ENSP00000303242:G236V	G	-	2	0	ITGB2	45145869	1.000000	0.71417	0.998000	0.56505	0.682000	0.39822	7.201000	0.77847	2.175000	0.68902	0.555000	0.69702	GGG	.	.		0.652	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
LSS	4047	hgsc.bcm.edu	37	21	47614405	47614405	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr21:47614405C>T	ENST00000397728.3	-	20	2066	c.1988G>A	c.(1987-1989)cGg>cAg	p.R663Q	LSS_ENST00000356396.4_Splice_Site_p.R663Q|AP001468.1_ENST00000594486.1_5'Flank|LSS_ENST00000457828.2_Splice_Site_p.R583Q|LSS_ENST00000522411.1_Splice_Site_p.R652Q	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	663					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					TCGTCCCCACCGAACGGCCAT	0.617																																					p.R663Q	Pancreas(114;955 2313 34923 50507)	Atlas-SNP	.											.	LSS	50	.	0			c.G1988A						.						81.0	66.0	71.0					21																	47614405		2203	4300	6503	SO:0001630	splice_region_variant	4047	exon20			CCCCACCGAACGG	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1988+1G>A	chr21.hg19:g.47614405C>T		51.0	0.0		67.0	29.0	NM_001001438	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	hg19	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506819	0.44558	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.07	5.07	0.68467	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.043393	0.85682	D	0.000000	T	0.25195	0.0612	L	0.39020	1.185	0.80722	D	1	D;D	0.71674	0.997;0.998	P;B	0.48227	0.571;0.446	T	0.00958	-1.1500	9	.	.	.	.	18.4342	0.90638	0.0:1.0:0.0:0.0	.	652;663	E9PEI9;P48449	.;ERG7_HUMAN	Q	663;583;663;652	ENSP00000348762:R663Q;ENSP00000409191:R583Q;ENSP00000380837:R663Q;ENSP00000429133:R652Q	.	R	-	2	0	LSS	46438833	1.000000	0.71417	1.000000	0.80357	0.063000	0.16089	7.201000	0.77847	2.523000	0.85059	0.655000	0.94253	CGG	.	.		0.617	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		Missense_Mutation
MICAL3	57553	hgsc.bcm.edu	37	22	18347692	18347692	+	Missense_Mutation	SNP	C	C	T	rs199950640	byFrequency	TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr22:18347692C>T	ENST00000441493.2	-	19	2930	c.2578G>A	c.(2578-2580)Gtg>Atg	p.V860M	MICAL3_ENST00000585038.1_Missense_Mutation_p.V984M|MICAL3_ENST00000400561.2_Missense_Mutation_p.V860M|MICAL3_ENST00000383094.3_Missense_Mutation_p.V860M|MICAL3_ENST00000444520.1_Missense_Mutation_p.V860M|MICAL3_ENST00000207726.7_Missense_Mutation_p.V888M|MICAL3_ENST00000429452.1_Missense_Mutation_p.V984M|MICAL3_ENST00000414725.2_Missense_Mutation_p.V888M	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	860					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GAGCTGGCCACGGCGTTGGCC	0.592													C|||	2	0.000399361	0.0	0.0	5008	,	,		11947	0.0		0.002	False		,,,				2504	0.0				p.V984M		Atlas-SNP	.											MICA3_HUMAN,NS,carcinoma,0,3	MICAL3	53	.	0			c.G2950A						.	C	MET/VAL,MET/VAL,MET/VAL	0,3136		0,0,1568	95.0	92.0	93.0		2578,2950,2578	-5.7	0.0	22		93	8,7156		0,8,3574	yes	missense,missense,missense	MICAL3	NM_001122731.1,NM_001136004.1,NM_015241.2	21,21,21	0,8,5142	TT,TC,CC		0.1117,0.0,0.0777	benign,benign,benign	860/967,984/1074,860/2003	18347692	8,10292	1568	3582	5150	SO:0001583	missense	57553	exon23			TGGCCACGGCGTT	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2578G>A	chr22.hg19:g.18347692C>T	ENSP00000416015:p.Val860Met	97.0	0.0		97.0	14.0	NM_001136004	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	hg19	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	C	8.157	0.788774	0.16258	0.0	0.001117	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.69435	-0.02;-0.4;-0.14;-0.14;-0.12;-0.13;-0.12	5.72	-5.71	0.02413	.	3.503140	0.00698	N	0.000764	T	0.62998	0.2474	N	0.19112	0.55	0.09310	N	1	D;P;P;P;B	0.71674	0.998;0.627;0.715;0.539;0.025	P;B;B;B;B	0.59171	0.853;0.172;0.073;0.107;0.005	T	0.60161	-0.7317	10	0.48119	T	0.1	.	7.7346	0.28806	0.0:0.3671:0.1925:0.4404	.	984;888;860;860;860	B2RXJ5;Q7RTP6-3;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	M	860;984;860;860;888;860;888	ENSP00000416015:V860M;ENSP00000414846:V984M;ENSP00000383406:V860M;ENSP00000410315:V860M;ENSP00000391827:V888M;ENSP00000372574:V860M;ENSP00000207726:V888M	ENSP00000207726:V888M	V	-	1	0	XXbac-B461K10.4;MICAL3	16727692	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.043000	0.01413	-0.782000	0.04541	0.655000	0.94253	GTG	.	.		0.592	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
TXN2	25828	hgsc.bcm.edu	37	22	36863964	36863964	+	Splice_Site	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr22:36863964C>G	ENST00000216185.2	-	4	854	c.388G>C	c.(388-390)Gtg>Ctg	p.V130L	TXN2_ENST00000416967.1_Splice_Site_p.V28L|TXN2_ENST00000487725.1_5'UTR|TXN2_ENST00000403313.1_Splice_Site_p.V130L			Q99757	THIOM_HUMAN	thioredoxin 2	130	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|cellular response to nutrient levels (GO:0031669)|glycerol ether metabolic process (GO:0006662)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)	dendrite (GO:0030425)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)	protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|lung(1)|prostate(1)	3						ACCGCTGACACCTGGGTGGAG	0.557																																					p.V130L		Atlas-SNP	.											.	TXN2	15	.	0			c.G388C						.						82.0	67.0	72.0					22																	36863964		2203	4300	6503	SO:0001630	splice_region_variant	25828	exon4			CTGACACCTGGGT	U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348			17772	protein-coding gene	gene with protein product		609063				9006939, 17220299	Standard	NM_012473		Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.388-1G>C	chr22.hg19:g.36863964C>G		65.0	0.0		77.0	54.0	NM_012473	Q5JZA0|Q6FH60|Q9UH29	Missense_Mutation	SNP	ENST00000216185.2	hg19	CCDS13928.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072645	0.76415	.	.	ENSG00000100348	ENST00000216185;ENST00000403313	T;T	0.07021	3.23;3.23	5.64	5.64	0.86602	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.130037	0.53938	D	0.000060	T	0.37100	0.0991	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.26430	-1.0103	10	0.72032	D	0.01	-1.0201	19.7137	0.96107	0.0:1.0:0.0:0.0	.	130	Q99757	THIOM_HUMAN	L	130	ENSP00000216185:V130L;ENSP00000385393:V130L	ENSP00000216185:V130L	V	-	1	0	TXN2	35193910	1.000000	0.71417	1.000000	0.80357	0.120000	0.20174	7.352000	0.79404	2.655000	0.90218	0.462000	0.41574	GTG	.	.		0.557	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319016.1	NM_012473	Missense_Mutation
MICALL1	85377	hgsc.bcm.edu	37	22	38328562	38328562	+	Silent	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr22:38328562C>G	ENST00000215957.6	+	11	2145	c.2019C>G	c.(2017-2019)gtC>gtG	p.V673V	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	673	RAB-binding domain (RBD); mediates the interaction with RAB13 and RAB35 and intramolecular interaction with the CH domain.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					TTGGGCAGGTCCAGGCTGACC	0.642																																					p.V673V		Atlas-SNP	.											.	MICALL1	53	.	0			c.C2019G						.						65.0	68.0	67.0					22																	38328562		2203	4300	6503	SO:0001819	synonymous_variant	85377	exon11			GCAGGTCCAGGCT	BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.2019C>G	chr22.hg19:g.38328562C>G		101.0	0.0		114.0	56.0	NM_033386	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Silent	SNP	ENST00000215957.6	hg19	CCDS13961.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594261	0.28445	.	.	ENSG00000100139	ENST00000454685	.	.	.	5.48	2.15	0.27550	.	.	.	.	.	T	0.43100	0.1232	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24835	-1.0149	4	.	.	.	.	1.5047	0.02484	0.1226:0.3697:0.2385:0.2692	.	.	.	.	A	249	.	.	P	+	1	0	MICALL1	36658508	0.511000	0.26179	1.000000	0.80357	0.803000	0.45373	-0.280000	0.08468	0.262000	0.21774	0.491000	0.48974	CCA	.	.		0.642	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	NM_033386	
MOSPD2	158747	hgsc.bcm.edu	37	X	14915270	14915270	+	Silent	SNP	A	A	T			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chrX:14915270A>T	ENST00000380492.3	+	5	475	c.387A>T	c.(385-387)atA>atT	p.I129I	MOSPD2_ENST00000482354.1_Silent_p.I129I|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	129	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					AGAAGCTCATAGCATTCTGGT	0.358																																					p.I129I		Atlas-SNP	.											.	MOSPD2	46	.	0			c.A387T						.						148.0	138.0	142.0					X																	14915270		2203	4300	6503	SO:0001819	synonymous_variant	158747	exon5			GCTCATAGCATTC	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.387A>T	chrX.hg19:g.14915270A>T		461.0	0.0		485.0	227.0	NM_152581	Q8N3H2|Q8NA83	Silent	SNP	ENST00000380492.3	hg19	CCDS14162.1																																																																																			.	.		0.358	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581	
DMD	1756	hgsc.bcm.edu	37	X	32716095	32716095	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chrX:32716095C>A	ENST00000357033.4	-	9	1058	c.852G>T	c.(850-852)caG>caT	p.Q284H	DMD_ENST00000288447.4_Missense_Mutation_p.Q276H|DMD_ENST00000378677.2_Missense_Mutation_p.Q280H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	284					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTCATATCCCTGTGCTAGAC	0.502																																					p.Q284H		Atlas-SNP	.											.	DMD	2127	.	0			c.G852T						.						130.0	90.0	104.0					X																	32716095		2202	4299	6501	SO:0001583	missense	1756	exon9			ATATCCCTGTGCT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.852G>T	chrX.hg19:g.32716095C>A	ENSP00000354923:p.Gln284His	173.0	0.0		171.0	46.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598076	0.66332	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.74106	-0.02;-0.01;-0.81	5.63	3.86	0.44501	.	0.000000	0.35436	U	0.003207	T	0.77968	0.4210	L	0.59436	1.845	0.80722	D	1	P;P;P;P	0.52061	0.93;0.95;0.844;0.917	P;P;B;P	0.53809	0.564;0.735;0.428;0.548	T	0.77536	-0.2551	10	0.66056	D	0.02	.	11.2987	0.49292	0.0:0.8487:0.0:0.1513	.	276;276;284;280	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	H	276;280;284;284;161;276	ENSP00000367948:Q280H;ENSP00000354923:Q284H;ENSP00000288447:Q276H	ENSP00000288447:Q276H	Q	-	3	2	DMD	32626016	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	3.506000	0.53364	0.541000	0.28827	0.538000	0.68166	CAG	.	.		0.502	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DCAF12L1	139170	hgsc.bcm.edu	37	X	125686535	125686535	+	Silent	SNP	G	G	A			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chrX:125686535G>A	ENST00000371126.1	-	1	299	c.57C>T	c.(55-57)gaC>gaT	p.D19D		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	19			D -> G (in dbSNP:rs11095722). {ECO:0000269|PubMed:15489334}.					p.G19G(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						AGCTCTCGGCGTCCGCCTCGA	0.726																																					p.D19D		Atlas-SNP	.											.	DCAF12L1	135	.	1	Substitution - coding silent(1)	prostate(1)	c.C57T						.						17.0	21.0	19.0					X																	125686535		2074	4074	6148	SO:0001819	synonymous_variant	139170	exon1			CTCGGCGTCCGCC	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.57C>T	chrX.hg19:g.125686535G>A		139.0	0.0		113.0	46.0	NM_178470	Q8IYK3	Silent	SNP	ENST00000371126.1	hg19	CCDS14610.1																																																																																			.	.		0.726	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
ELF4	2000	hgsc.bcm.edu	37	X	129205014	129205014	+	Splice_Site	SNP	C	C	G			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chrX:129205014C>G	ENST00000308167.5	-	7	1189		c.e7+1		ELF4_ENST00000335997.7_Splice_Site	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						ACAGCTCCTACCTTAGTGCCC	0.522			T	ERG	AML																																.		Atlas-SNP	.		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	ELF4	67	.	0			c.809+1G>C						.						201.0	172.0	182.0					X																	129205014		2203	4300	6503	SO:0001630	splice_region_variant	2000	exon8			CTCCTACCTTAGT	U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.809+1G>C	chrX.hg19:g.129205014C>G		65.0	0.0		77.0	13.0	NM_001421		Splice_Site	SNP	ENST00000308167.5	hg19	CCDS14617.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248415	0.59103	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9152	0.70792	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELF4	129032695	1.000000	0.71417	0.989000	0.46669	0.499000	0.33736	7.775000	0.85489	2.105000	0.64084	0.466000	0.42574	.	.	.		0.522	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	Intron
MT-CO1	4512	hgsc.bcm.edu	37	M	7210	7210	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chrM:7210T>C	ENST00000361624.2	+	1	1307	c.1307T>C	c.(1306-1308)aTg>aCg	p.M436T	MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TQ_ENST00000387372.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	436					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCTATCCGGAATGCCCCGACG	0.428																																					p.M436T		Atlas-SNP	.											.	.	.	.	0			c.T1307C						.																																			SO:0001583	missense	5742	exon1			CCGGAATGCCCCG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1307T>C	chrM.hg19:g.7210T>C	ENSP00000354499:p.Met436Thr	23.0	0.0		70.0	63.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.428	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
BBS4	585	hgsc.bcm.edu	37	15	73020331	73020332	+	Frame_Shift_Ins	INS	-	-	A	rs149663241		TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr15:73020331_73020332insA	ENST00000268057.4	+	9	679_680	c.638_639insA	c.(637-642)ttacagfs	p.Q214fs	BBS4_ENST00000542334.1_Frame_Shift_Ins_p.Q42fs|BBS4_ENST00000395205.2_Frame_Shift_Ins_p.Q222fs|BBS4_ENST00000539603.1_Frame_Shift_Ins_p.Q202fs	NM_033028.4	NP_149017.2	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	214	Interaction with PCM1.				adult behavior (GO:0030534)|brain morphogenesis (GO:0048854)|centrosome organization (GO:0051297)|cerebral cortex development (GO:0021987)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|dendrite development (GO:0016358)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|maintenance of protein location in nucleus (GO:0051457)|melanosome transport (GO:0032402)|metabolic process (GO:0008152)|microtubule anchoring at centrosome (GO:0034454)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of systemic arterial blood pressure (GO:0003085)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of cilium assembly (GO:0045724)|positive regulation of multicellular organism growth (GO:0040018)|protein localization to centrosome (GO:0071539)|protein localization to organelle (GO:0033365)|protein transport (GO:0015031)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of cytokinesis (GO:0032465)|regulation of lipid metabolic process (GO:0019216)|retina homeostasis (GO:0001895)|retinal rod cell development (GO:0046548)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)|spermatid development (GO:0007286)|striatum development (GO:0021756)|visual perception (GO:0007601)	BBSome (GO:0034464)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary membrane (GO:0060170)|cilium (GO:0005929)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|dynactin binding (GO:0034452)|microtubule motor activity (GO:0003777)|RNA polymerase II repressing transcription factor binding (GO:0001103)			autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(1)	19						TTACTCTACTTACAGGTAATGA	0.366									Bardet-Biedl syndrome																												p.L213fs		Atlas-INDEL	.											.	BBS4	34	.	0			c.638_639insA						.																																			SO:0001589	frameshift_variant	585	exon9	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	.	AF090947	CCDS10246.1, CCDS58377.1	15q22.3-q23	2013-01-10			ENSG00000140463	ENSG00000140463		"""Tetratricopeptide (TTC) repeat domain containing"""	969	protein-coding gene	gene with protein product		600374				7711739, 11381270	Standard	NM_033028		Approved		uc002avb.3	Q96RK4	OTTHUMG00000133510	ENST00000268057.4:c.639dupA	chr15.hg19:g.73020332_73020332dupA	ENSP00000268057:p.Gln214fs	72.0	0.0		81.0	22.0	NM_033028	B4E178|Q53DZ5|Q8NHU9|Q96H45	Frame_Shift_Ins	INS	ENST00000268057.4	hg19	CCDS10246.1																																																																																			.	.		0.366	BBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257473.2	NM_033028	
TP53	7157	hgsc.bcm.edu	37	17	7577149	7577150	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr17:7577149_7577150insC	ENST00000269305.4	-	8	977_978	c.788_789insG	c.(787-789)aatfs	p.N263fs	TP53_ENST00000420246.2_Frame_Shift_Ins_p.N263fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.N263fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Frame_Shift_Ins_p.N263fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.N263fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	263	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		GN -> PD (in a sporadic cancer; somatic mutation).|N -> D (in sporadic cancers; somatic mutation).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.N263I(2)|p.G262_S269delGNLLGRNS(2)|p.N263fs*5(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.N263K(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCCCAGTAGATTACCACTACT	0.52		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N263fs	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,colon,carcinoma,-1,1	TP53	33396	.	22	Whole gene deletion(8)|Deletion - In frame(4)|Unknown(3)|Deletion - Frameshift(3)|Substitution - Missense(3)|Complex - deletion inframe(1)	large_intestine(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|ovary(2)|eye(1)|urinary_tract(1)|stomach(1)	c.789_790insG						.																																			SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.788_789insG	chr17.hg19:g.7577149_7577150insC	ENSP00000269305:p.Asn263fs	83.0	0.0		71.0	33.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.520	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ETV6	2120	hgsc.bcm.edu	37	12	12006418	12006418	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACZ-01A-11D-A40R-10	TCGA-DD-AACZ-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f597b1b-500d-482d-ade1-61d7dffef94e	437561b3-e574-4171-b2ca-dafac20f5230	g.chr12:12006418delT	ENST00000396373.4	+	4	660	c.386delT	c.(385-387)cttfs	p.L129fs		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	129					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CCTCGGATTCTTTTTTCACCA	0.428			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																p.L129fs		Atlas-INDEL	.		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	.	ETV6	91	.	0			c.385delC						.						158.0	154.0	155.0					12																	12006418		2203	4300	6503	SO:0001589	frameshift_variant	2120	exon4			.	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.386delT	chr12.hg19:g.12006418delT	ENSP00000379658:p.Leu129fs	92.0	0.0		129.0	31.0	NM_001987	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Frame_Shift_Del	DEL	ENST00000396373.4	hg19	CCDS8643.1																																																																																			.	.		0.428	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987	
