#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	hgsc.bcm.edu	37	1	980903	980903	+	Splice_Site	SNP	C	C	A	rs138248828	byFrequency	TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:980903C>A	ENST00000379370.2	+	14	2586	c.2536C>A	c.(2536-2538)Ccc>Acc	p.P846T		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	846	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TGGCTGTACACGTGAGTGACA	0.657																																					p.P846T		Atlas-SNP	.											.	AGRN	110	.	0			c.C2536A						.						39.0	36.0	37.0					1																	980903		2203	4300	6503	SO:0001630	splice_region_variant	375790	exon14			TGTACACGTGAGT	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.2536+1C>A	chr1.hg19:g.980903C>A		48.0	0.0		27.0	26.0	NM_198576	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	hg19	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.710250	0.68730	.	.	ENSG00000188157	ENST00000379370	T	0.80909	-1.43	5.36	5.36	0.76844	EGF-like, laminin (2);	0.000000	0.64402	D	0.000003	D	0.92224	0.7534	M	0.92784	3.345	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.92983	0.6408	10	0.49607	T	0.09	-26.0382	19.0743	0.93154	0.0:1.0:0.0:0.0	.	846	O00468	AGRIN_HUMAN	T	846	ENSP00000368678:P846T	ENSP00000368678:P846T	P	+	1	0	AGRN	970766	1.000000	0.71417	1.000000	0.80357	0.285000	0.27093	4.432000	0.59922	2.520000	0.84964	0.655000	0.94253	CCC	.	C|1.000;T|0.000		0.657	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	Missense_Mutation
IGSF3	3321	hgsc.bcm.edu	37	1	117122291	117122291	+	Missense_Mutation	SNP	C	C	G	rs569343519	byFrequency	TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:117122291C>G	ENST00000369486.3	-	10	3822	c.3057G>C	c.(3055-3057)gaG>gaC	p.E1019D	IGSF3_ENST00000369483.1_Missense_Mutation_p.E1039D|IGSF3_ENST00000318837.6_Missense_Mutation_p.E1039D	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1019	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		cgtcgtcgtcctcctcctcct	0.637													C|||	12	0.00239617	0.0023	0.0	5008	,	,		18566	0.003		0.0	False		,,,				2504	0.0061				p.E1039D		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,0,4	IGSF3	294	.	0			c.G3117C						.						28.0	29.0	29.0					1																	117122291		2203	4300	6503	SO:0001583	missense	3321	exon11			GTCGTCCTCCTCC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3057G>C	chr1.hg19:g.117122291C>G	ENSP00000358498:p.Glu1019Asp	68.0	0.0		70.0	4.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	0.860	-0.735766	0.03111	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02863	4.15;4.13;4.13	2.7	-5.4	0.02656	Immunoglobulin subtype (1);Immunoglobulin-like (1);	1.696000	0.03619	N	0.236120	T	0.00384	0.0012	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.48768	-0.9006	10	0.15952	T	0.53	-1.3732	1.6073	0.02687	0.152:0.1895:0.1511:0.5074	.	1019;1039	O75054;A6NJZ6	IGSF3_HUMAN;.	D	1019;1039;1039	ENSP00000358498:E1019D;ENSP00000358495:E1039D;ENSP00000321184:E1039D	ENSP00000321184:E1039D	E	-	3	2	IGSF3	116923814	0.018000	0.18449	0.000000	0.03702	0.117000	0.20001	-1.573000	0.02134	-1.538000	0.01734	0.462000	0.41574	GAG	.	.		0.637	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
ATP8B2	57198	hgsc.bcm.edu	37	1	154318730	154318730	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:154318730G>A	ENST00000368489.3	+	25	2901	c.2901G>A	c.(2899-2901)atG>atA	p.M967I		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	953					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGCGGAGCATGGAGTACCCTA	0.582																																					p.M967I		Atlas-SNP	.											.	ATP8B2	158	.	0			c.G2901A						.						92.0	90.0	90.0					1																	154318730		2203	4300	6503	SO:0001583	missense	57198	exon25			GAGCATGGAGTAC	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.2901G>A	chr1.hg19:g.154318730G>A	ENSP00000357475:p.Met967Ile	115.0	0.0		151.0	38.0	NM_020452	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	hg19	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489484	0.44249	.	.	ENSG00000143515	ENST00000368489	T	0.69306	-0.39	4.34	4.34	0.51931	.	0.292573	0.33217	N	0.005159	T	0.37919	0.1021	N	0.13327	0.33	0.80722	D	1	B	0.24186	0.099	B	0.28011	0.085	T	0.38650	-0.9651	10	0.40728	T	0.16	.	15.581	0.76439	0.0:0.0:1.0:0.0	.	967	P98198-3	.	I	967	ENSP00000357475:M967I	ENSP00000357475:M967I	M	+	3	0	ATP8B2	152585354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.421000	0.59848	2.211000	0.71520	0.561000	0.74099	ATG	.	.		0.582	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
TMEM79	84283	hgsc.bcm.edu	37	1	156261286	156261286	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:156261286T>C	ENST00000405535.2	+	4	1253	c.1082T>C	c.(1081-1083)tTc>tCc	p.F361S	C1orf85_ENST00000482579.1_5'Flank|TMEM79_ENST00000295694.5_Missense_Mutation_p.F361S|TMEM79_ENST00000357501.2_Silent_p.V122V|TMEM79_ENST00000495881.1_3'UTR	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	361					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					TACTACATGTTCGTGGTGGAG	0.667																																					p.F361S		Atlas-SNP	.											.	TMEM79	43	.	0			c.T1082C						.						127.0	121.0	123.0					1																	156261286		2203	4300	6503	SO:0001583	missense	84283	exon4			ACATGTTCGTGGT	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.1082T>C	chr1.hg19:g.156261286T>C	ENSP00000384748:p.Phe361Ser	58.0	0.0		87.0	25.0	NM_032323	B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	hg19	CCDS1138.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118018	0.77323	.	.	ENSG00000163472	ENST00000295694;ENST00000405535	T;T	0.65732	-0.17;-0.17	5.7	5.7	0.88788	.	0.112146	0.64402	D	0.000009	T	0.66655	0.2811	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.71892	-0.4455	10	0.87932	D	0	0.8416	14.8012	0.69916	0.0:0.0:0.0:1.0	.	361	Q9BSE2	TMM79_HUMAN	S	361	ENSP00000295694:F361S;ENSP00000384748:F361S	ENSP00000295694:F361S	F	+	2	0	TMEM79	154527910	1.000000	0.71417	0.994000	0.49952	0.537000	0.34900	4.651000	0.61447	2.170000	0.68504	0.533000	0.62120	TTC	.	.		0.667	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
TMEM79	84283	hgsc.bcm.edu	37	1	156261289	156261289	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:156261289T>C	ENST00000405535.2	+	4	1256	c.1085T>C	c.(1084-1086)gTg>gCg	p.V362A	C1orf85_ENST00000482579.1_5'Flank|TMEM79_ENST00000295694.5_Missense_Mutation_p.V362A|TMEM79_ENST00000357501.2_Silent_p.R123R|TMEM79_ENST00000495881.1_3'UTR	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	362					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					TACATGTTCGTGGTGGAGCCG	0.662																																					p.V362A		Atlas-SNP	.											.	TMEM79	43	.	0			c.T1085C						.						125.0	119.0	121.0					1																	156261289		2203	4300	6503	SO:0001583	missense	84283	exon4			TGTTCGTGGTGGA	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.1085T>C	chr1.hg19:g.156261289T>C	ENSP00000384748:p.Val362Ala	59.0	0.0		85.0	23.0	NM_032323	B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	hg19	CCDS1138.1	.	.	.	.	.	.	.	.	.	.	T	8.842	0.942379	0.18281	.	.	ENSG00000163472	ENST00000295694;ENST00000405535	T;T	0.47528	0.84;0.84	5.7	2.15	0.27550	.	0.911947	0.09531	N	0.789595	T	0.10508	0.0257	N	0.08118	0	0.18873	N	0.999984	B	0.06786	0.001	B	0.04013	0.001	T	0.34825	-0.9813	10	0.35671	T	0.21	-4.44	8.6411	0.33978	0.0:0.2219:0.0:0.7781	.	362	Q9BSE2	TMM79_HUMAN	A	362	ENSP00000295694:V362A;ENSP00000384748:V362A	ENSP00000295694:V362A	V	+	2	0	TMEM79	154527913	0.145000	0.22656	0.892000	0.35008	0.021000	0.10359	2.703000	0.47110	0.119000	0.18210	-0.250000	0.11733	GTG	.	.		0.662	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
COPA	1314	hgsc.bcm.edu	37	1	160309715	160309715	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:160309715T>C	ENST00000241704.7	-	3	441	c.212A>G	c.(211-213)gAt>gGt	p.D71G	COPA_ENST00000368069.3_Missense_Mutation_p.D71G	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	71					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTTATAGTCATCTCCTCCAGA	0.463																																					p.D71G		Atlas-SNP	.											.	COPA	181	.	0			c.A212G						.						123.0	126.0	125.0					1																	160309715		2203	4300	6503	SO:0001583	missense	1314	exon3			TAGTCATCTCCTC	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.212A>G	chr1.hg19:g.160309715T>C	ENSP00000241704:p.Asp71Gly	71.0	0.0		105.0	61.0	NM_001098398	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	hg19	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	T	31	5.063761	0.93898	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.60672	0.17;0.17	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70561	0.3238	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75605	-0.3260	10	0.87932	D	0	-19.2365	14.9083	0.70737	0.0:0.0:0.0:1.0	.	71;71	P53621;P53621-2	COPA_HUMAN;.	G	71	ENSP00000357048:D71G;ENSP00000241704:D71G	ENSP00000241704:D71G	D	-	2	0	COPA	158576339	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.191000	0.70037	0.533000	0.62120	GAT	.	.		0.463	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
USF1	7391	hgsc.bcm.edu	37	1	161011957	161011957	+	Silent	SNP	A	A	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:161011957A>C	ENST00000368021.3	-	5	429	c.225T>G	c.(223-225)acT>acG	p.T75T	USF1_ENST00000368020.1_Silent_p.T75T|USF1_ENST00000435396.1_Silent_p.T16T|USF1_ENST00000368019.1_Silent_p.T75T	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	75					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CAGTTCCCTCAGTTTGGCCAT	0.527																																					p.T75T		Atlas-SNP	.											.	USF1	29	.	0			c.T225G						.						76.0	67.0	70.0					1																	161011957		2203	4300	6503	SO:0001819	synonymous_variant	7391	exon5			TCCCTCAGTTTGG	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.225T>G	chr1.hg19:g.161011957A>C		87.0	0.0		167.0	53.0	NM_001276373	B2RBZ4|Q5SY46|Q7Z5Y1	Silent	SNP	ENST00000368021.3	hg19	CCDS1214.1																																																																																			.	.		0.527	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
C1orf112	55732	hgsc.bcm.edu	37	1	169799444	169799444	+	Silent	SNP	C	C	A	rs532518246	byFrequency	TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:169799444C>A	ENST00000286031.6	+	14	2059	c.1359C>A	c.(1357-1359)acC>acA	p.T453T	C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Silent_p.T453T	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	453										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATATGATCACCTCTTTGTTAG	0.333																																					p.T453T		Atlas-SNP	.											.	C1orf112	74	.	0			c.C1359A						.						226.0	209.0	215.0					1																	169799444		2203	4300	6503	SO:0001819	synonymous_variant	55732	exon14			GATCACCTCTTTG	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1359C>A	chr1.hg19:g.169799444C>A		49.0	0.0		84.0	34.0	NM_018186	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Silent	SNP	ENST00000286031.6	hg19	CCDS1285.1																																																																																			.	.		0.333	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
CR1	1378	hgsc.bcm.edu	37	1	207785177	207785177	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:207785177C>T	ENST00000367049.4	+	38	6451	c.6451C>T	c.(6451-6453)Cct>Tct	p.P2151S	CR1_ENST00000400960.2_Missense_Mutation_p.P1701S|CR1_ENST00000367051.1_Missense_Mutation_p.P1701S|CR1_ENST00000367052.1_Missense_Mutation_p.P1701S|CR1_ENST00000367053.1_Missense_Mutation_p.P1701S	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1701					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGACTGGAGCCCTGAAGCCCC	0.532																																					p.P2151S		Atlas-SNP	.											.	CR1	354	.	0			c.C6451T						.						127.0	131.0	130.0					1																	207785177		1935	4127	6062	SO:0001583	missense	1378	exon38			TGGAGCCCTGAAG	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6451C>T	chr1.hg19:g.207785177C>T	ENSP00000356016:p.Pro2151Ser	125.0	0.0		189.0	124.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	hg19	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	9.275	1.046645	0.19748	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	3.48	2.54	0.30619	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.66086	0.2754	L	0.42008	1.315	0.20196	N	0.999926	D;D	0.89917	0.99;1.0	P;D	0.87578	0.813;0.998	T	0.54268	-0.8319	9	0.10902	T	0.67	.	8.3958	0.32557	0.2316:0.7684:0.0:0.0	.	1701;2151	P17927;E9PDY4	CR1_HUMAN;.	S	1701;1701;1701;1701;2151	ENSP00000356019:P1701S;ENSP00000356018:P1701S;ENSP00000356020:P1701S;ENSP00000383744:P1701S;ENSP00000356016:P2151S	ENSP00000356016:P2151S	P	+	1	0	CR1	205851800	0.158000	0.22850	0.667000	0.29798	0.217000	0.24651	0.347000	0.20014	0.994000	0.38892	0.561000	0.74099	CCT	.	.		0.532	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
CAMK1G	57172	hgsc.bcm.edu	37	1	209785166	209785166	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:209785166C>A	ENST00000009105.1	+	11	1190	c.945C>A	c.(943-945)caC>caA	p.H315Q	CAMK1G_ENST00000494990.1_3'UTR|CAMK1G_ENST00000361322.2_Missense_Mutation_p.H315Q			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	315	Autoinhibitory domain. {ECO:0000250}.|Calmodulin-binding. {ECO:0000250}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CTGTGGTGCACCACATGAGGA	0.567																																					p.H315Q	Ovarian(163;530 1939 9680 28669 48710)	Atlas-SNP	.											.	CAMK1G	49	.	0			c.C945A						.						95.0	99.0	97.0					1																	209785166		2203	4300	6503	SO:0001583	missense	57172	exon11			GGTGCACCACATG		CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.945C>A	chr1.hg19:g.209785166C>A	ENSP00000009105:p.His315Gln	38.0	0.0		72.0	25.0	NM_020439	Q86UH5|Q9Y3J7	Missense_Mutation	SNP	ENST00000009105.1	hg19	CCDS1486.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.645393	0.47258	.	.	ENSG00000008118	ENST00000009105;ENST00000361322	T;T	0.66638	-0.22;-0.22	5.46	-0.322	0.12713	Protein kinase-like domain (1);	0.315637	0.27518	N	0.019016	T	0.40694	0.1127	N	0.11201	0.11	0.43771	D	0.996295	B;B	0.14438	0.01;0.002	B;B	0.12156	0.007;0.003	T	0.10177	-1.0641	10	0.48119	T	0.1	.	6.6192	0.22794	0.0:0.5171:0.1209:0.362	.	315;315	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	Q	315	ENSP00000009105:H315Q;ENSP00000354861:H315Q	ENSP00000009105:H315Q	H	+	3	2	CAMK1G	207851789	0.920000	0.31207	1.000000	0.80357	0.993000	0.82548	0.308000	0.19314	0.277000	0.22141	0.558000	0.71614	CAC	.	.		0.567	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088526.1	NM_020439	
FBXO28	23219	hgsc.bcm.edu	37	1	224340935	224340935	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:224340935T>G	ENST00000366862.5	+	4	651	c.608T>G	c.(607-609)aTa>aGa	p.I203R	FBXO28_ENST00000424254.2_Intron	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	203										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		TTAAGGGATATATCCTCTATG	0.378																																					p.I203R		Atlas-SNP	.											.	FBXO28	34	.	0			c.T608G						.						132.0	144.0	140.0					1																	224340935		2203	4300	6503	SO:0001583	missense	23219	exon4			GGGATATATCCTC	AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.608T>G	chr1.hg19:g.224340935T>G	ENSP00000355827:p.Ile203Arg	86.0	0.0		154.0	53.0	NM_015176	E9PEM8|O75070	Missense_Mutation	SNP	ENST00000366862.5	hg19	CCDS1539.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741392	0.89573	.	.	ENSG00000143756	ENST00000366862	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.77785	0.4182	M	0.67700	2.07	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.79978	-0.1575	9	0.87932	D	0	-14.1634	15.5489	0.76133	0.0:0.0:0.0:1.0	.	203	Q9NVF7	FBX28_HUMAN	R	203	.	ENSP00000355827:I203R	I	+	2	0	FBXO28	222407558	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	7.422000	0.80217	2.254000	0.74563	0.528000	0.53228	ATA	.	.		0.378	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176	
OBSCN	84033	hgsc.bcm.edu	37	1	228548151	228548151	+	Intron	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:228548151G>T	ENST00000422127.1	+	80	18705				OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000284548.11_Missense_Mutation_p.A6520S|OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000366709.4_Missense_Mutation_p.A3639S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGTGGGGCATGCACTGGGTCC	0.697																																					p.A6520S		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G19558T						.						19.0	23.0	21.0					1																	228548151		1979	4145	6124	SO:0001627	intron_variant	84033	exon81			GGGCATGCACTGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2126G>T	chr1.hg19:g.228548151G>T		39.0	0.0		62.0	19.0	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648454	0.67358	.	.	ENSG00000154358	ENST00000284548;ENST00000366709	T;T	0.55930	0.49;0.63	4.25	3.34	0.38264	.	.	.	.	.	T	0.34019	0.0883	N	0.08118	0	0.24853	N	0.992398	B	0.29301	0.241	B	0.27500	0.08	T	0.27400	-1.0075	9	0.52906	T	0.07	.	13.5187	0.61555	0.0:0.8198:0.1802:0.0	.	6520	Q5VST9-3	.	S	6520;3639	ENSP00000284548:A6520S;ENSP00000355670:A3639S	ENSP00000284548:A6520S	A	+	1	0	OBSCN	226614774	0.069000	0.21087	0.006000	0.13384	0.055000	0.15305	2.119000	0.41958	1.011000	0.39340	0.591000	0.81541	GCA	.	.		0.697	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RHOU	58480	hgsc.bcm.edu	37	1	228871685	228871685	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:228871685G>A	ENST00000366691.3	+	1	862	c.196G>A	c.(196-198)Gtg>Atg	p.V66M		NM_021205.5	NP_067028.1			ras homolog family member U											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	13	Breast(184;0.162)	Prostate(94;0.183)				GACGAGCCTGGTGGTGAGCTA	0.751																																					p.V66M		Atlas-SNP	.											.	RHOU	20	.	0			c.G196A						.						20.0	25.0	23.0					1																	228871685		2197	4293	6490	SO:0001583	missense	58480	exon1			AGCCTGGTGGTGA		CCDS1575.1	1q42.11-q42.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000116574	ENSG00000116574			17794	protein-coding gene	gene with protein product	"""Ryu GTPase"", ""Wnt-1 responsive Cdc42 homolog"", ""2310026M05Rik"", ""GTP-binding protein like 1"", ""CDC42-like GTPase"", ""GTP-binding protein SB128"", ""ras-like gene family member U"""	606366	"""ras homolog gene family, member U"""	ARHU		11459829	Standard	NM_021205		Approved	WRCH-1, DJ646B12.2, FLJ10616, WRCH1, CDC42L1, hG28K, fJ646B12.2	uc001htf.3	Q7L0Q8	OTTHUMG00000037919	ENST00000366691.3:c.196G>A	chr1.hg19:g.228871685G>A	ENSP00000355652:p.Val66Met	32.0	0.0		76.0	25.0	NM_021205		Missense_Mutation	SNP	ENST00000366691.3	hg19	CCDS1575.1	.	.	.	.	.	.	.	.	.	.	.	13.33	2.204161	0.38905	.	.	ENSG00000116574	ENST00000366691	T	0.79141	-1.24	3.68	3.68	0.42216	Small GTP-binding protein domain (1);	0.257891	0.32918	N	0.005496	T	0.79106	0.4390	L	0.39326	1.205	0.41770	D	0.989767	D	0.56968	0.978	P	0.60789	0.879	T	0.80551	-0.1332	10	0.87932	D	0	.	9.0721	0.36500	0.0:0.2264:0.7736:0.0	.	66	Q7L0Q8	RHOU_HUMAN	M	66	ENSP00000355652:V66M	ENSP00000355652:V66M	V	+	1	0	RHOU	226938308	1.000000	0.71417	0.978000	0.43139	0.047000	0.14425	2.868000	0.48436	1.859000	0.53934	0.450000	0.29827	GTG	.	.		0.751	RHOU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092555.1	NM_021205	
ZNF124	7678	hgsc.bcm.edu	37	1	247320147	247320147	+	Silent	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:247320147T>C	ENST00000543802.2	-	4	866	c.777A>G	c.(775-777)gaA>gaG	p.E259E	ZNF124_ENST00000491848.1_5'Flank|ZNF124_ENST00000340684.6_Silent_p.E197E|ZNF124_ENST00000491356.1_Intron|ZNF124_ENST00000472531.1_Intron			Q15973	ZN124_HUMAN	zinc finger protein 124	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(2)	14	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			GATAGGGTTCTTCACCAGCAT	0.438																																					p.E197E		Atlas-SNP	.											.	ZNF124	39	.	0			c.A591G						.						132.0	127.0	128.0					1																	247320147		2203	4300	6503	SO:0001819	synonymous_variant	7678	exon4			GGGTTCTTCACCA	S54641	CCDS31089.1, CCDS58067.1, CCDS73057.1	1q44	2013-01-08	2006-06-13		ENSG00000196418	ENSG00000196418		"""Zinc fingers, C2H2-type"", ""-"""	12907	protein-coding gene	gene with protein product		194631	"""zinc finger protein 124 (HZF-16)"""			7916577	Standard	XM_005273256		Approved	HZF16, HZF-16	uc001icj.1	Q15973	OTTHUMG00000041112	ENST00000543802.2:c.777A>G	chr1.hg19:g.247320147T>C		95.0	0.0		141.0	39.0	NM_003431	B3KNP3|J3KSE1|Q15974|Q4VAJ7|Q5T2V4	Silent	SNP	ENST00000543802.2	hg19																																																																																				.	.		0.438	ZNF124-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000447393.1	NM_003431	
MBOAT2	129642	hgsc.bcm.edu	37	2	9017206	9017206	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:9017206T>A	ENST00000305997.3	-	7	842	c.644A>T	c.(643-645)aAt>aTt	p.N215I	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	215					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTCTTTTCCATTTTCACCAGA	0.398																																					p.N215I	Ovarian(194;1699 3813 22401)	Atlas-SNP	.											.	MBOAT2	36	.	0			c.A644T						.						218.0	193.0	202.0					2																	9017206		2203	4300	6503	SO:0001583	missense	129642	exon7			TTTCCATTTTCAC	BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.644A>T	chr2.hg19:g.9017206T>A	ENSP00000302177:p.Asn215Ile	117.0	0.0		108.0	54.0	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	hg19	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805688	0.70682	.	.	ENSG00000143797	ENST00000305997	T	0.48836	0.8	5.56	3.18	0.36537	.	1.176190	0.06361	N	0.711654	T	0.61286	0.2335	M	0.70595	2.14	0.48040	D	0.999579	P;P	0.50272	0.933;0.933	P;P	0.53988	0.739;0.739	T	0.41805	-0.9488	10	0.39692	T	0.17	-2.266	9.7598	0.40526	0.0:0.1396:0.0:0.8604	.	215;215	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	I	215	ENSP00000302177:N215I	ENSP00000302177:N215I	N	-	2	0	MBOAT2	8934657	0.691000	0.27709	0.000000	0.03702	0.156000	0.22039	1.577000	0.36515	0.410000	0.25675	0.528000	0.53228	AAT	.	.		0.398	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
MBOAT2	129642	hgsc.bcm.edu	37	2	9017208	9017208	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:9017208T>G	ENST00000305997.3	-	7	840	c.642A>C	c.(640-642)gaA>gaC	p.E214D	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	214					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTTTTCCATTTTCACCAGATT	0.403																																					p.E214D	Ovarian(194;1699 3813 22401)	Atlas-SNP	.											.	MBOAT2	36	.	0			c.A642C						.						216.0	192.0	200.0					2																	9017208		2203	4300	6503	SO:0001583	missense	129642	exon7			TCCATTTTCACCA	BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.642A>C	chr2.hg19:g.9017208T>G	ENSP00000302177:p.Glu214Asp	121.0	0.0		108.0	55.0	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	hg19	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.301998	0.23736	.	.	ENSG00000143797	ENST00000305997	T	0.42131	0.98	5.56	-1.7	0.08159	.	1.069410	0.07347	N	0.881810	T	0.20861	0.0502	N	0.22421	0.69	0.24276	N	0.995229	B;B	0.09022	0.002;0.002	B;B	0.10450	0.005;0.005	T	0.24119	-1.0169	10	0.07482	T	0.82	-0.4668	2.5261	0.04691	0.1178:0.1343:0.3653:0.3826	.	214;214	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	D	214	ENSP00000302177:E214D	ENSP00000302177:E214D	E	-	3	2	MBOAT2	8934659	0.709000	0.27886	0.000000	0.03702	0.120000	0.20174	0.176000	0.16782	-0.173000	0.10761	0.528000	0.53228	GAA	.	.		0.403	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
GREB1	9687	hgsc.bcm.edu	37	2	11751071	11751071	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:11751071C>T	ENST00000381486.2	+	18	3224	c.2924C>T	c.(2923-2925)gCg>gTg	p.A975V	GREB1_ENST00000396123.1_5'Flank|GREB1_ENST00000234142.5_Missense_Mutation_p.A975V	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	975						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GCCCGGCTGGCGCTGGAGGAG	0.687																																					p.A975V	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.C2924T						.						13.0	16.0	15.0					2																	11751071		1997	4150	6147	SO:0001583	missense	9687	exon18			GGCTGGCGCTGGA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2924C>T	chr2.hg19:g.11751071C>T	ENSP00000370896:p.Ala975Val	184.0	0.0		177.0	71.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618183	0.87359	.	.	ENSG00000196208	ENST00000381486;ENST00000234142	T;T	0.50548	0.74;0.74	5.17	5.17	0.71159	.	0.236828	0.35936	N	0.002900	T	0.42426	0.1202	L	0.47716	1.5	0.38494	D	0.948048	P	0.43909	0.821	B	0.38616	0.277	T	0.53961	-0.8364	10	0.87932	D	0	-46.7919	14.3023	0.66362	0.0:0.8514:0.1486:0.0	.	975	Q4ZG55	GREB1_HUMAN	V	975	ENSP00000370896:A975V;ENSP00000234142:A975V	ENSP00000234142:A975V	A	+	2	0	GREB1	11668522	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	3.980000	0.56895	2.410000	0.81850	0.563000	0.77884	GCG	.	.		0.687	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
THADA	63892	hgsc.bcm.edu	37	2	43460007	43460007	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:43460007G>T	ENST00000405006.4	-	37	5662	c.5311C>A	c.(5311-5313)Cag>Aag	p.Q1771K	THADA_ENST00000415080.2_Missense_Mutation_p.Q1452K|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Missense_Mutation_p.Q1771K|AC010883.5_ENST00000423354.1_RNA	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1771										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GCATCCACCTGGCAGAAGGCA	0.607																																					p.Q1771K		Atlas-SNP	.											.	THADA	131	.	0			c.C5311A						.						26.0	28.0	27.0					2																	43460007		2037	4198	6235	SO:0001583	missense	63892	exon37			CCACCTGGCAGAA	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.5311C>A	chr2.hg19:g.43460007G>T	ENSP00000385995:p.Gln1771Lys	180.0	0.0		189.0	85.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	hg19	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986800	0.53934	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006	T;T;T	0.65549	-0.16;-0.16;-0.16	5.39	4.32	0.51571	.	0.438767	0.21810	N	0.068796	T	0.47948	0.1473	M	0.63428	1.95	0.26586	N	0.973286	P;B	0.46395	0.877;0.41	B;B	0.40134	0.32;0.071	T	0.49579	-0.8925	10	0.06365	T	0.9	-27.1315	4.0593	0.09831	0.0873:0.1333:0.5222:0.2573	.	1698;1771	B6ZDQ0;Q6YHU6	.;THADA_HUMAN	K	1771;1698;1452;1771	ENSP00000386088:Q1771K;ENSP00000416048:Q1452K;ENSP00000385995:Q1771K	ENSP00000349464:Q1698K	Q	-	1	0	THADA	43313511	0.997000	0.39634	1.000000	0.80357	0.960000	0.62799	0.963000	0.29293	2.526000	0.85167	0.561000	0.74099	CAG	.	.		0.607	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
SFXN5	94097	hgsc.bcm.edu	37	2	73195626	73195626	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:73195626G>A	ENST00000272433.2	-	12	908	c.778C>T	c.(778-780)Ccc>Tcc	p.P260S	SFXN5_ENST00000410065.1_Intron|SFXN5_ENST00000474528.1_5'UTR	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	260					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						ATGGGCATGGGCAGGACCACT	0.657																																					p.P260S		Atlas-SNP	.											.	SFXN5	31	.	0			c.C778T						.						55.0	47.0	50.0					2																	73195626		2203	4300	6503	SO:0001583	missense	94097	exon12			GCATGGGCAGGAC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.778C>T	chr2.hg19:g.73195626G>A	ENSP00000272433:p.Pro260Ser	209.0	0.0		211.0	95.0	NM_144579	A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	ENST00000272433.2	hg19	CCDS1922.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139109	0.77775	.	.	ENSG00000144040	ENST00000272433	T	0.27557	1.66	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.46698	0.1406	L	0.48218	1.51	0.80722	D	1	D;B;D	0.89917	1.0;0.387;0.999	D;B;D	0.87578	0.998;0.349;0.974	T	0.17806	-1.0357	10	0.14656	T	0.56	-20.6576	16.3047	0.82843	0.0:0.0:1.0:0.0	.	109;156;260	B4DIJ8;B4DGS9;Q8TD22	.;.;SFXN5_HUMAN	S	260	ENSP00000272433:P260S	ENSP00000272433:P260S	P	-	1	0	SFXN5	73049134	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.250000	0.95477	2.456000	0.83038	0.655000	0.94253	CCC	.	.		0.657	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579	
CCT7	10574	hgsc.bcm.edu	37	2	73479792	73479792	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:73479792A>T	ENST00000258091.5	+	12	1576	c.1435A>T	c.(1435-1437)Atc>Ttc	p.I479F	CCT7_ENST00000398422.2_Missense_Mutation_p.I275F|CCT7_ENST00000538797.1_Missense_Mutation_p.I351F|CCT7_ENST00000539919.1_Missense_Mutation_p.I435F|CCT7_ENST00000537131.1_Missense_Mutation_p.I379F|CCT7_ENST00000540468.1_Missense_Mutation_p.I392F	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	479					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						TGGAGTAGACATCAACAACGA	0.473																																					p.I479F		Atlas-SNP	.											.	CCT7	60	.	0			c.A1435T						.						86.0	89.0	88.0					2																	73479792		2020	4194	6214	SO:0001583	missense	10574	exon12			GTAGACATCAACA	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.1435A>T	chr2.hg19:g.73479792A>T	ENSP00000258091:p.Ile479Phe	230.0	0.0		234.0	92.0	NM_006429	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Missense_Mutation	SNP	ENST00000258091.5	hg19	CCDS46336.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.737211	0.49045	.	.	ENSG00000135624	ENST00000540468;ENST00000539919;ENST00000258091;ENST00000398422;ENST00000537131;ENST00000538797;ENST00000409081	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.0	-1.9	0.07665	.	0.275122	0.42420	D	0.000701	T	0.80412	0.4618	M	0.67625	2.065	0.53005	D	0.999965	P;P;P;P;B;D	0.53151	0.932;0.911;0.925;0.845;0.004;0.958	P;P;P;D;B;D	0.66602	0.645;0.871;0.861;0.918;0.024;0.945	T	0.74962	-0.3485	10	0.29301	T	0.29	-7.0484	6.5687	0.22527	0.3387:0.0:0.5088:0.1524	.	392;351;379;437;275;479	B7Z4Z7;B7Z1C9;F5GZK5;B8ZZC9;A8MWI8;Q99832	.;.;.;.;.;TCPH_HUMAN	F	392;435;479;275;379;351;437	ENSP00000442058:I392F;ENSP00000437824:I435F;ENSP00000258091:I479F;ENSP00000381456:I275F;ENSP00000444379:I379F;ENSP00000438462:I351F	ENSP00000258091:I479F	I	+	1	0	CCT7	73333300	1.000000	0.71417	0.997000	0.53966	0.719000	0.41307	1.143000	0.31553	-0.090000	0.12462	0.533000	0.62120	ATC	.	.		0.473	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
CTNNA2	1496	hgsc.bcm.edu	37	2	80816543	80816544	+	Missense_Mutation	DNP	GG	GG	TT	rs537442409		TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:80816543_80816544GG>TT	ENST00000402739.4	+	14	2127_2128	c.2122_2123GG>TT	c.(2122-2124)GGc>TTc	p.G708F	AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000540488.1_Missense_Mutation_p.G708F|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000361291.4_Missense_Mutation_p.G742F|CTNNA2_ENST00000541047.1_Missense_Mutation_p.G708F|AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000343114.3_Missense_Mutation_p.G387F|CTNNA2_ENST00000466387.1_Missense_Mutation_p.G708F|CTNNA2_ENST00000496558.1_Missense_Mutation_p.G708F|AC008067.2_ENST00000430876.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	708					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GGACGACAGCGGCAATGATATC	0.475																																					p.G708C|p.G708V		Atlas-SNP	.											.	CTNNA2	462	.	0			c.G2122T|c.G2123T						.																																			SO:0001583	missense	1496	exon15			GACAGCGGCAATG|ACAGCGGCAATGA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	Exception_encountered	chr2.hg19:g.80816543_80816544delinsTT	ENSP00000384638:p.Gly708Phe	230.0|234.0	0.0		215.0|211.0	94.0|91.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	hg19																																																																																				.	.		0.475	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
TMEM87B	84910	hgsc.bcm.edu	37	2	112839010	112839010	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:112839010G>A	ENST00000283206.4	+	8	1122	c.753G>A	c.(751-753)tgG>tgA	p.W251*		NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	251						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						TCCAGTTCTGGATTGCAGCTG	0.348																																					p.W251X		Atlas-SNP	.											.	TMEM87B	52	.	0			c.G753A						.						142.0	152.0	149.0					2																	112839010		2203	4300	6503	SO:0001587	stop_gained	84910	exon8			GTTCTGGATTGCA	AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.753G>A	chr2.hg19:g.112839010G>A	ENSP00000283206:p.Trp251*	74.0	0.0		96.0	47.0	NM_032824	A8K2M9|Q1RLN2|Q53R54	Nonsense_Mutation	SNP	ENST00000283206.4	hg19	CCDS33275.1	.	.	.	.	.	.	.	.	.	.	G	38	7.149870	0.98096	.	.	ENSG00000153214	ENST00000283206	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.606	17.1792	0.86850	0.0:0.0:1.0:0.0	.	.	.	.	X	251	.	ENSP00000283206:W251X	W	+	3	0	TMEM87B	112555481	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.650000	0.89964	0.585000	0.79938	TGG	.	.		0.348	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330500.1	NM_032824	
ZC3H6	376940	hgsc.bcm.edu	37	2	113089743	113089743	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:113089743G>T	ENST00000409871.1	+	12	3649	c.3248G>T	c.(3247-3249)aGt>aTt	p.S1083I	AC115115.2_ENST00000607612.1_RNA|ZC3H6_ENST00000343936.4_Missense_Mutation_p.S1083I	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	1083							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						TTAAAAAGTAGTGACAAAACT	0.493																																					p.S1083I		Atlas-SNP	.											.	ZC3H6	93	.	0			c.G3248T						.						45.0	44.0	44.0					2																	113089743		1863	4114	5977	SO:0001583	missense	376940	exon12			AAAGTAGTGACAA	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.3248G>T	chr2.hg19:g.113089743G>T	ENSP00000386764:p.Ser1083Ile	310.0	0.0		302.0	148.0	NM_198581	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	hg19	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	G	9.375	1.071457	0.20147	.	.	ENSG00000188177	ENST00000409871;ENST00000343936	T;T	0.16897	2.31;2.31	5.43	2.04	0.26737	.	0.959069	0.08744	N	0.900058	T	0.19805	0.0476	L	0.56769	1.78	0.09310	N	0.999998	P	0.41041	0.736	B	0.41988	0.372	T	0.21655	-1.0239	10	0.72032	D	0.01	-2.1916	5.7125	0.17943	0.3664:0.181:0.4525:0.0	.	1083	P61129	ZC3H6_HUMAN	I	1083	ENSP00000386764:S1083I;ENSP00000340298:S1083I	ENSP00000340298:S1083I	S	+	2	0	ZC3H6	112806214	0.458000	0.25760	0.977000	0.42913	0.716000	0.41182	1.065000	0.30592	0.586000	0.29626	0.655000	0.94253	AGT	.	.		0.493	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
BAZ2B	29994	hgsc.bcm.edu	37	2	160257109	160257109	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:160257109C>A	ENST00000392783.2	-	17	3394		c.e17+1		AC008277.1_ENST00000608714.1_RNA|BAZ2B_ENST00000392782.1_Splice_Site|AC008277.1_ENST00000594921.1_RNA|BAZ2B_ENST00000355831.2_Splice_Site|BAZ2B_ENST00000343439.5_Splice_Site|AC008277.1_ENST00000420020.1_RNA	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						aaGACTTCTACCTCTAGAATT	0.269																																					.		Atlas-SNP	.											.	BAZ2B	196	.	0			c.2898+1G>T						.						42.0	37.0	39.0					2																	160257109		1775	4051	5826	SO:0001630	splice_region_variant	29994	exon18			CTTCTACCTCTAG	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2898+1G>T	chr2.hg19:g.160257109C>A		249.0	1.0		277.0	134.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Splice_Site	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046166	0.75846	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000294905	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9988	0.92824	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BAZ2B	159965355	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.395000	0.79876	2.465000	0.83290	0.585000	0.79938	.	.	.		0.269	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		Intron
ABCA12	26154	hgsc.bcm.edu	37	2	215876718	215876718	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:215876718G>T	ENST00000272895.7	-	16	2317	c.2098C>A	c.(2098-2100)Ccc>Acc	p.P700T	ABCA12_ENST00000389661.4_Missense_Mutation_p.P382T	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	700					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACACTTCTGGGCAGATGCATT	0.408																																					p.P700T	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.C2098A						.						244.0	234.0	238.0					2																	215876718		2203	4300	6503	SO:0001583	missense	26154	exon16			TTCTGGGCAGATG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2098C>A	chr2.hg19:g.215876718G>T	ENSP00000272895:p.Pro700Thr	92.0	0.0		95.0	49.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365648	0.24684	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.87412	-2.25;-2.25	5.73	0.291	0.15732	.	0.239374	0.30011	N	0.010625	T	0.67059	0.2853	N	0.14661	0.345	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.001;0.002	T	0.53322	-0.8455	10	0.06494	T	0.89	.	4.0818	0.09929	0.3873:0.1705:0.4422:0.0	.	700;382	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	T	700;382	ENSP00000272895:P700T;ENSP00000374312:P382T	ENSP00000272895:P700T	P	-	1	0	ABCA12	215584963	0.998000	0.40836	0.974000	0.42286	0.978000	0.69477	0.408000	0.21065	0.372000	0.24591	0.655000	0.94253	CCC	.	.		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SCG2	7857	hgsc.bcm.edu	37	2	224462698	224462698	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:224462698C>A	ENST00000305409.2	-	2	1535	c.1303G>T	c.(1303-1305)Gat>Tat	p.D435Y		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTTAAAATATCCTCAACACTG	0.473																																					p.D435Y		Atlas-SNP	.											.	SCG2	99	.	0			c.G1303T						.						85.0	86.0	86.0					2																	224462698		2203	4300	6503	SO:0001583	missense	7857	exon2			AAATATCCTCAAC	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1303G>T	chr2.hg19:g.224462698C>A	ENSP00000304133:p.Asp435Tyr	61.0	0.0		83.0	41.0	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000305409.2	hg19	CCDS2457.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374561	0.61735	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	T	0.02050	4.48	5.86	5.86	0.93980	.	0.120203	0.53938	D	0.000046	T	0.13756	0.0333	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00018	-1.2373	10	0.87932	D	0	.	20.1986	0.98248	0.0:1.0:0.0:0.0	.	435	P13521	SCG2_HUMAN	Y	435;295	ENSP00000304133:D435Y	ENSP00000304133:D435Y	D	-	1	0	SCG2	224170942	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.508000	0.53378	2.781000	0.95711	0.650000	0.86243	GAT	.	.		0.473	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
SP110	3431	hgsc.bcm.edu	37	2	231042313	231042313	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr2:231042313C>T	ENST00000358662.4	-	14	1609	c.1531G>A	c.(1531-1533)Gca>Aca	p.A511T	SP110_ENST00000258382.5_Missense_Mutation_p.A511T|SP110_ENST00000392048.3_Missense_Mutation_p.A509T|SP110_ENST00000258381.6_Missense_Mutation_p.A511T|SP110_ENST00000540870.1_Missense_Mutation_p.A517T|SP110_ENST00000338556.3_Missense_Mutation_p.A213T	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	511	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		CAGTTCTTTGCGTTCCTTCCT	0.428																																					p.A517T		Atlas-SNP	.											SP110_ENST00000540870,right_upper_lobe,carcinoma,0,2	SP110	105	.	0			c.G1549A						.						334.0	312.0	319.0					2																	231042313		2203	4300	6503	SO:0001583	missense	3431	exon15			TCTTTGCGTTCCT	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1531G>A	chr2.hg19:g.231042313C>T	ENSP00000351488:p.Ala511Thr	93.0	0.0		102.0	39.0	NM_001185015	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	ENST00000358662.4	hg19	CCDS2474.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637080	0.29157	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000338556	T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	4.83	-0.844	0.10741	SAND domain-like (2);SAND domain (3);	1.300420	0.05910	N	0.631442	T	0.38374	0.1038	N	0.10874	0.06	0.09310	N	1	B;B;B;B;B	0.14012	0.0;0.009;0.0;0.002;0.002	B;B;B;B;B	0.12837	0.001;0.008;0.001;0.004;0.001	T	0.15925	-1.0420	10	0.24483	T	0.36	.	4.978	0.14151	0.3973:0.2829:0.0:0.3197	.	509;213;517;511;511	G5E9C0;E7ER70;F5H1M1;Q9HB58;Q9HB58-6	.;.;.;SP110_HUMAN;.	T	511;511;509;511;517;213	ENSP00000258381:A511T;ENSP00000351488:A511T;ENSP00000375902:A509T;ENSP00000258382:A511T;ENSP00000439558:A517T;ENSP00000344049:A213T	ENSP00000258381:A511T	A	-	1	0	SP110	230750557	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.427000	0.06999	-0.191000	0.10448	-0.339000	0.08088	GCA	.	.		0.428	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424	
BHLHE40	8553	hgsc.bcm.edu	37	3	5022091	5022091	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:5022091A>C	ENST00000256495.3	+	3	859	c.256A>C	c.(256-258)Aca>Cca	p.T86P	BHLHE40-AS1_ENST00000420832.1_RNA|BHLHE40-AS1_ENST00000441386.2_RNA|BHLHE40-AS1_ENST00000434530.1_RNA	NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	86	Essential for its interaction with ARNTL/BMAL1, E-box binding and repressor activity against the CLOCK-ARNTL/BMAL1 heterodimer.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						TCTCAAACTTACAGTAAGTGA	0.577											OREG0015367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T86P		Atlas-SNP	.											.	BHLHE40	35	.	0			c.A256C						.						52.0	54.0	54.0					3																	5022091		2203	4300	6503	SO:0001583	missense	8553	exon3			AAACTTACAGTAA	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.256A>C	chr3.hg19:g.5022091A>C	ENSP00000256495:p.Thr86Pro	98.0	0.0	623	106.0	50.0	NM_003670	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	hg19	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.042795	0.75732	.	.	ENSG00000134107	ENST00000256495	D	0.97976	-4.64	3.99	3.99	0.46301	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.95436	0.8518	N	0.14661	0.345	0.80722	D	1	P	0.50819	0.939	P	0.52031	0.688	D	0.95592	0.8655	10	0.54805	T	0.06	.	13.2035	0.59782	1.0:0.0:0.0:0.0	.	86	O14503	BHE40_HUMAN	P	86	ENSP00000256495:T86P	ENSP00000256495:T86P	T	+	1	0	BHLHE40	4997091	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.781000	0.91805	1.584000	0.49913	0.482000	0.46254	ACA	.	.		0.577	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
TATDN2	9797	hgsc.bcm.edu	37	3	10301858	10301858	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:10301858C>G	ENST00000287652.4	+	3	1503	c.452C>G	c.(451-453)tCt>tGt	p.S151C	RP11-438J1.1_ENST00000450534.1_Intron|TATDN2_ENST00000448281.2_Missense_Mutation_p.S151C	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	151					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TCCACAAACTCTGAATTTGCA	0.433																																					p.S151C		Atlas-SNP	.											.	TATDN2	59	.	0			c.C452G						.						57.0	58.0	58.0					3																	10301858		2203	4300	6503	SO:0001583	missense	9797	exon3			CAAACTCTGAATT	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.452C>G	chr3.hg19:g.10301858C>G	ENSP00000287652:p.Ser151Cys	192.0	0.0		198.0	94.0	NM_014760	Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	hg19	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566441	0.45694	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.35605	1.3;1.3	4.41	3.53	0.40419	.	0.236309	0.22045	N	0.065391	T	0.51517	0.1679	M	0.62723	1.935	0.32603	N	0.525705	D	0.89917	1.0	D	0.68192	0.956	T	0.62661	-0.6807	10	0.87932	D	0	-12.039	8.4327	0.32769	0.0:0.896:0.0:0.104	.	151	Q93075	TATD2_HUMAN	C	151	ENSP00000287652:S151C;ENSP00000408736:S151C	ENSP00000287652:S151C	S	+	2	0	TATDN2	10276858	1.000000	0.71417	0.987000	0.45799	0.558000	0.35554	2.128000	0.42045	1.455000	0.47813	0.655000	0.94253	TCT	.	.		0.433	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
TTC21A	199223	hgsc.bcm.edu	37	3	39159608	39159608	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:39159608C>T	ENST00000431162.2	+	7	899	c.765C>T	c.(763-765)acC>acT	p.T255T	TTC21A_ENST00000301819.6_Silent_p.T255T|TTC21A_ENST00000440121.1_Silent_p.T214T			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	255								p.T255T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AAATTCTAACCGTGCATGAGC	0.423																																					p.T255T		Atlas-SNP	.											TTC21A,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	TTC21A	96	.	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C765T						.						165.0	167.0	166.0					3																	39159608		2050	4195	6245	SO:0001819	synonymous_variant	199223	exon7			TCTAACCGTGCAT	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.765C>T	chr3.hg19:g.39159608C>T		83.0	0.0		72.0	35.0	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Silent	SNP	ENST00000431162.2	hg19	CCDS46800.1																																																																																			.	.		0.423	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	C	A	rs121913416|rs121913403		TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:41266113C>A	ENST00000349496.5	+	3	390	c.110C>A	c.(109-111)tCt>tAt	p.S37Y	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S37Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S30Y|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S37Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S37Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	37			S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes). {ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> C (in PTR, hepatoblastoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:9927029}.|S -> F (in PTR). {ECO:0000269|PubMed:10192393}.|S -> Y (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|SG -> W (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S37F(172)|p.S37C(141)|p.A5_A80del(53)|p.S37Y(31)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.S37_G38>W(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GGAATCCATTCTGGTGCCACT	0.498	S37C(JHUEM2_ENDOMETRIUM)|S37C(SNU398_LIVER)|S37F(HUTU80_SMALL_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S37Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,1	CTNNB1	4904	.	474	Substitution - Missense(344)|Deletion - In frame(102)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(145)|endometrium(64)|stomach(38)|skin(34)|ovary(33)|central_nervous_system(28)|pancreas(28)|large_intestine(22)|pituitary(22)|lung(21)|biliary_tract(15)|thyroid(4)|soft_tissue(4)|urinary_tract(4)|small_intestine(3)|oesophagus(3)|adrenal_gland(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|bone(1)|breast(1)	c.C110A						.						93.0	78.0	83.0					3																	41266113		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TCCATTCTGGTGC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.110C>A	chr3.hg19:g.41266113C>A	ENSP00000344456:p.Ser37Tyr	144.0	0.0		121.0	57.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475777	0.84640	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72819	0.3508	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75297	-0.3367	10	0.87932	D	0	-15.9763	19.9596	0.97236	0.0:1.0:0.0:0.0	.	37	P35222	CTNB1_HUMAN	Y	30;37;37;37;37;30;37;37;37	ENSP00000400508:S30Y;ENSP00000385604:S37Y;ENSP00000412219:S37Y;ENSP00000379486:S37Y;ENSP00000344456:S37Y;ENSP00000411226:S30Y;ENSP00000379488:S37Y;ENSP00000409302:S37Y;ENSP00000401599:S37Y	ENSP00000344456:S37Y	S	+	2	0	CTNNB1	41241117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
PRSS42	339906	hgsc.bcm.edu	37	3	46871983	46871983	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:46871983C>T	ENST00000429665.1	-	5	792	c.793G>A	c.(793-795)Gga>Aga	p.G265R	PRSS42_ENST00000447340.1_Splice_Site_p.G92E	NM_182702.1	NP_874361.1	Q7Z5A4	PRS42_HUMAN	protease, serine, 42	265	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				germ cell development (GO:0007281)|spermatogenesis (GO:0007283)	anchored component of plasma membrane (GO:0046658)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	8						CCAGAATCTCCCTAGAGAAAG	0.502																																					p.G265R		Atlas-SNP	.											.	PRSS42	17	.	0			c.G793A						.						32.0	32.0	32.0					3																	46871983		1849	4091	5940	SO:0001630	splice_region_variant	339906	exon5			AATCTCCCTAGAG		CCDS46816.1	3p21.31	2010-05-07			ENSG00000178055	ENSG00000178055		"""Serine peptidases / Serine peptidases"""	30716	protein-coding gene	gene with protein product	"""testis serine protease 2"""					12838346	Standard	NM_182702		Approved	TESSP2	uc011bap.2	Q7Z5A4	OTTHUMG00000156496	ENST00000429665.1:c.793-1G>A	chr3.hg19:g.46871983C>T		79.0	0.0		60.0	27.0	NM_182702		Missense_Mutation	SNP	ENST00000429665.1	hg19	CCDS46816.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.522414|4.522414	0.85600|0.85600	.|.	.|.	ENSG00000178055|ENSG00000178055	ENST00000447340|ENST00000429665	T|D	0.77877|0.98044	-1.13|-4.68	4.36|4.36	4.36|4.36	0.52297|0.52297	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000|0.000000	0.32093|0.32093	N|N	0.006582|0.006582	D|D	0.98966|0.98966	0.9648|0.9648	M|M	0.93854|0.93854	3.465|3.465	0.80722|0.80722	D|D	1|1	D|D	0.63046|0.89917	0.992|1.0	P|D	0.62740|0.97110	0.906|1.0	D|D	0.99174|0.99174	1.0865|1.0865	10|10	0.87932|0.87932	D|D	0|0	.|.	14.8301|14.8301	0.70142|0.70142	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	92|265	C9JX34|Q7Z5A4	.|PRS42_HUMAN	E|R	92|265	ENSP00000401581:G92E|ENSP00000401701:G265R	ENSP00000401581:G92E|ENSP00000401701:G265R	G|G	-|-	2|1	0|0	PRSS42|PRSS42	46846987|46846987	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	6.775000|6.775000	0.75018|0.75018	2.441000|2.441000	0.82636|0.82636	0.650000|0.650000	0.86243|0.86243	GGG|GGA	.	.		0.502	PRSS42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344347.1	NM_182702	Missense_Mutation
SETD2	29072	hgsc.bcm.edu	37	3	47161670	47161670	+	Splice_Site	SNP	A	A	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:47161670A>C	ENST00000409792.3	-	3	4497		c.e3+1			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AATTAGACTTACCTTTCTGTT	0.323			"""N, F, S, Mis"""		clear cell renal carcinoma																																.		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.4454+2T>G						.						51.0	52.0	52.0					3																	47161670		2203	4298	6501	SO:0001630	splice_region_variant	29072	exon4			AGACTTACCTTTC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4454+1T>G	chr3.hg19:g.47161670A>C		34.0	0.0		42.0	24.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	22.3	4.277500	0.80580	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1821	0.72968	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47136674	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.328000	0.79160	2.172000	0.68678	0.460000	0.39030	.	.	.		0.323	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Intron
GMPPB	29925	hgsc.bcm.edu	37	3	49755432	49755432	+	3'UTR	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:49755432G>T	ENST00000480687.1	-	0	4952				AMIGO3_ENST00000535833.1_Silent_p.G489G|RNF123_ENST00000327697.6_Intron|RNF123_ENST00000433785.1_Intron|AMIGO3_ENST00000320431.7_Silent_p.G489G			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CGGACTCAGAGCCAGCCTTCA	0.657																																					p.G489G		Atlas-SNP	.											.	AMIGO3	40	.	0			c.C1467A						.						38.0	42.0	40.0					3																	49755432		2203	4300	6503	SO:0001624	3_prime_UTR_variant	386724	exon1			CTCAGAGCCAGCC	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3753C>A	chr3.hg19:g.49755432G>T		44.0	0.0		58.0	8.0	NM_198722	A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	hg19	CCDS2803.1																																																																																			.	.		0.657	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	
SLC9C1	285335	hgsc.bcm.edu	37	3	111901012	111901012	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:111901012C>A	ENST00000305815.5	-	21	2869	c.2617G>T	c.(2617-2619)Gat>Tat	p.D873Y	SLC9C1_ENST00000487372.1_Missense_Mutation_p.D825Y	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	873					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TTGTTTTTATCTAGCCACGGA	0.264																																					p.D873Y		Atlas-SNP	.											.	.	.	.	0			c.G2617T						.						58.0	62.0	61.0					3																	111901012		2203	4299	6502	SO:0001583	missense	285335	exon21			TTTTATCTAGCCA	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.2617G>T	chr3.hg19:g.111901012C>A	ENSP00000306627:p.Asp873Tyr	270.0	1.0		319.0	143.0	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	hg19	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.110871	0.37242	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.44881	0.91;0.91	5.45	3.29	0.37713	Cyclic nucleotide-binding-like (1);Cyclic nucleotide-binding domain (1);	0.516231	0.19154	N	0.121367	T	0.52565	0.1742	L	0.60455	1.87	0.25058	N	0.991087	D;D	0.64830	0.994;0.989	P;P	0.61592	0.891;0.817	T	0.38845	-0.9642	10	0.66056	D	0.02	.	7.8646	0.29530	0.0:0.7738:0.0:0.2262	.	825;873	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	Y	873;825	ENSP00000306627:D873Y;ENSP00000420688:D825Y	ENSP00000306627:D873Y	D	-	1	0	SLC9A10	113383702	0.949000	0.32298	0.990000	0.47175	0.401000	0.30781	0.572000	0.23684	1.262000	0.44165	0.536000	0.68110	GAT	.	.		0.264	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
TM4SF4	7104	hgsc.bcm.edu	37	3	149205519	149205519	+	Silent	SNP	A	A	G	rs571739504	byFrequency	TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:149205519A>G	ENST00000305354.4	+	3	1282	c.378A>G	c.(376-378)acA>acG	p.T126T		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	126					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CCAATAGTACATGGGGCTACC	0.522													A|||	3	0.000599042	0.0	0.0	5008	,	,		21028	0.003		0.0	False		,,,				2504	0.0				p.T126T		Atlas-SNP	.											.	TM4SF4	27	.	0			c.A378G						.						122.0	115.0	118.0					3																	149205519		1963	4164	6127	SO:0001819	synonymous_variant	7104	exon3			TAGTACATGGGGC		CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.378A>G	chr3.hg19:g.149205519A>G		95.0	0.0		89.0	38.0	NM_004617	B2RDA4	Silent	SNP	ENST00000305354.4	hg19	CCDS46932.1																																																																																			.	.		0.522	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1		
PIK3CA	5290	hgsc.bcm.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047L	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,adenocarcinoma,0,2044	PIK3CA	8460	.	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140T						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	chr3.hg19:g.178952085A>T	ENSP00000263967:p.His1047Leu	120.0	0.0		148.0	63.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
KCNMB3	27094	hgsc.bcm.edu	37	3	178968889	178968889	+	Start_Codon_SNP	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr3:178968889C>T	ENST00000314235.5	-	1	514	c.3G>A	c.(1-3)atG>atA	p.M1I	KCNMB3_ENST00000497599.1_Intron|KCNMB3_ENST00000392685.2_5'UTR|KCNMB3_ENST00000349697.2_Intron|KCNMB3_ENST00000485523.1_Intron	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	1					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	GTGAAAAGTCCATCTAAATAA	0.398																																					p.M1I		Atlas-SNP	.											.	KCNMB3	46	.	0			c.G3A						.						114.0	112.0	113.0					3																	178968889		2203	4300	6503	SO:0001582	initiator_codon_variant	27094	exon1			AAAGTCCATCTAA	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.3G>A	chr3.hg19:g.178968889C>T	ENSP00000319370:p.Met1Ile	107.0	0.0		92.0	38.0	NM_014407	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	ENST00000314235.5	hg19	CCDS3226.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099159	0.37048	.	.	ENSG00000171121	ENST00000314235	T	0.09163	3.01	4.68	-0.583	0.11706	.	2.563350	0.02378	U	0.078577	T	0.07863	0.0197	.	.	.	0.09310	N	0.999999	B	0.09022	0.002	B	0.01281	0.0	T	0.40040	-0.9584	9	0.87932	D	0	-1.2578	0.6144	0.00767	0.1777:0.3585:0.1737:0.2901	.	1	Q9NPA1	KCMB3_HUMAN	I	1	ENSP00000319370:M1I	ENSP00000319370:M1I	M	-	3	0	KCNMB3	180451583	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.160000	0.10041	0.055000	0.16094	0.655000	0.94253	ATG	.	.		0.398	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348484.1		Missense_Mutation
TADA2B	93624	hgsc.bcm.edu	37	4	7056326	7056326	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr4:7056326G>T	ENST00000310074.7	+	2	997	c.808G>T	c.(808-810)Gag>Tag	p.E270*	TADA2B_ENST00000512388.1_Nonsense_Mutation_p.E195*|TADA2B_ENST00000515646.1_Nonsense_Mutation_p.E178*	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	270					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E270Q(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						GTCATGCAAGGAGTTTGATGA	0.517																																					p.E270X		Atlas-SNP	.											TADA2B,NS,carcinoma,0,1	TADA2B	29	.	1	Substitution - Missense(1)	lung(1)	c.G808T						.						40.0	46.0	44.0					4																	7056326		2056	4186	6242	SO:0001587	stop_gained	93624	exon2			TGCAAGGAGTTTG	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.808G>T	chr4.hg19:g.7056326G>T	ENSP00000308022:p.Glu270*	111.0	0.0		125.0	54.0	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Nonsense_Mutation	SNP	ENST00000310074.7	hg19	CCDS47007.1	.	.	.	.	.	.	.	.	.	.	G	47	13.781184	0.99763	.	.	ENSG00000173011	ENST00000310074;ENST00000512388;ENST00000515646	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-46.6096	18.2471	0.89989	0.0:0.0:1.0:0.0	.	.	.	.	X	270;195;178	.	ENSP00000308022:E270X	E	+	1	0	TADA2B	7107227	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.135000	0.77276	2.307000	0.77673	0.561000	0.74099	GAG	.	.		0.517	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
PCDH10	57575	hgsc.bcm.edu	37	4	134072506	134072506	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr4:134072506G>T	ENST00000264360.5	+	1	2037	c.1211G>T	c.(1210-1212)cGc>cTc	p.R404L	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	404	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GTGCCTTTCCGCCTCAAGTCT	0.612																																					p.R404L		Atlas-SNP	.											.	PCDH10	290	.	0			c.G1211T						.						145.0	149.0	147.0					4																	134072506		2203	4300	6503	SO:0001583	missense	57575	exon1			CTTTCCGCCTCAA	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1211G>T	chr4.hg19:g.134072506G>T	ENSP00000264360:p.Arg404Leu	73.0	0.0		75.0	35.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	hg19	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307806	0.40795	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.01767	4.65	4.68	3.82	0.43975	Cadherin (4);Cadherin-like (1);	0.000000	0.46145	D	0.000318	T	0.03136	0.0092	L	0.43598	1.365	0.46901	D	0.999243	P;B	0.49862	0.929;0.074	P;B	0.45639	0.488;0.069	T	0.55173	-0.8182	10	0.72032	D	0.01	.	13.7341	0.62807	0.0:0.0:0.8449:0.1551	.	404;404	Q9P2E7;Q96SF0	PCD10_HUMAN;.	L	404	ENSP00000264360:R404L	ENSP00000264360:R404L	R	+	2	0	PCDH10	134291956	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.953000	0.49105	1.146000	0.42352	0.561000	0.74099	CGC	.	.		0.612	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
TTC29	83894	hgsc.bcm.edu	37	4	147724829	147724829	+	Silent	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr4:147724829G>A	ENST00000325106.4	-	11	1336	c.1110C>T	c.(1108-1110)taC>taT	p.Y370Y	TTC29_ENST00000398886.4_Silent_p.Y396Y|TTC29_ENST00000513335.1_Silent_p.Y396Y|TTC29_ENST00000506019.1_5'UTR	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	370										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					AAGCTTTGTTGTAGTATCCCT	0.378																																					p.Y370Y		Atlas-SNP	.											.	TTC29	63	.	0			c.C1110T						.						41.0	39.0	39.0					4																	147724829		1860	4104	5964	SO:0001819	synonymous_variant	83894	exon11			TTTGTTGTAGTAT	AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1110C>T	chr4.hg19:g.147724829G>A		39.0	0.0		49.0	22.0	NM_031956	A4GU95|Q9BXB6	Silent	SNP	ENST00000325106.4	hg19	CCDS47141.1																																																																																			.	.		0.378	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_031956	
ICE1	23379	hgsc.bcm.edu	37	5	5461382	5461382	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr5:5461382C>T	ENST00000296564.7	+	13	2157	c.1935C>T	c.(1933-1935)ccC>ccT	p.P645P		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		645					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GCAGTAATCCCCAGTCTTCTT	0.393																																					p.P645P		Atlas-SNP	.											.	KIAA0947	301	.	0			c.C1935T						.						89.0	89.0	89.0					5																	5461382		1889	4109	5998	SO:0001819	synonymous_variant	23379	exon13			TAATCCCCAGTCT																												ENST00000296564.7:c.1935C>T	chr5.hg19:g.5461382C>T		95.0	0.0		110.0	53.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	hg19	CCDS47187.1																																																																																			.	.		0.393	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
NIPBL	25836	hgsc.bcm.edu	37	5	36971138	36971138	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr5:36971138C>T	ENST00000282516.8	+	7	1270	c.771C>T	c.(769-771)gaC>gaT	p.D257D	NIPBL_ENST00000448238.2_Splice_Site_p.D257D|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	257					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TAAGTAGTGACGTATGTAATA	0.353																																					p.D257D		Atlas-SNP	.											.	NIPBL	513	.	0			c.C771T						.						81.0	74.0	76.0					5																	36971138		2203	4300	6503	SO:0001630	splice_region_variant	25836	exon7			TAGTGACGTATGT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.771+1C>T	chr5.hg19:g.36971138C>T		190.0	0.0		201.0	84.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.		0.353	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	Silent
TRIM36	55521	hgsc.bcm.edu	37	5	114469810	114469810	+	Silent	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr5:114469810G>A	ENST00000282369.3	-	8	1402	c.1281C>T	c.(1279-1281)agC>agT	p.S427S	TRIM36_ENST00000513154.1_Silent_p.S415S|TRIM36_ENST00000514154.1_Silent_p.S272S	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	427	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TATAAACTTTGCTCTGTTCCT	0.333																																					p.S427S		Atlas-SNP	.											.	TRIM36	126	.	0			c.C1281T						.						94.0	86.0	88.0					5																	114469810		2202	4300	6502	SO:0001819	synonymous_variant	55521	exon8			AACTTTGCTCTGT	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1281C>T	chr5.hg19:g.114469810G>A		65.0	0.0		63.0	25.0	NM_018700	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Silent	SNP	ENST00000282369.3	hg19	CCDS4115.1																																																																																			.	.		0.333	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
SLC23A1	9963	hgsc.bcm.edu	37	5	138713935	138713935	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr5:138713935C>G	ENST00000348729.3	-	11	1331	c.1285G>C	c.(1285-1287)Ggg>Cgg	p.G429R	SLC23A1_ENST00000353963.3_Missense_Mutation_p.G433R|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	429					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	AACATGCCCCCCAGGATGGGG	0.667																																					p.G433R		Atlas-SNP	.											.	SLC23A1	51	.	0			c.G1297C						.						48.0	47.0	48.0					5																	138713935		2202	4293	6495	SO:0001583	missense	9963	exon11			TGCCCCCCAGGAT	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1285G>C	chr5.hg19:g.138713935C>G	ENSP00000302701:p.Gly429Arg	249.0	0.0		281.0	116.0	NM_152685	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	hg19	CCDS4212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.240002|5.240002	0.95240|0.95240	.|.	.|.	ENSG00000170482|ENSG00000170482	ENST00000353963;ENST00000348729|ENST00000453898	T;T|.	0.33865|.	1.39;1.39|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.046521|.	0.85682|.	D|.	0.000000|.	D|D	0.87629|0.87629	0.6225|0.6225	H|H	0.96142|0.96142	3.775|3.775	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	D|D	0.89137|0.89137	0.3514|0.3514	10|6	0.87932|0.38643	D|T	0|0.18	-24.5758|-24.5758	18.5419|18.5419	0.91031|0.91031	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	429;433|.	Q9UHI7;Q9UHI7-2|.	S23A1_HUMAN;.|.	R|C	433;429|383	ENSP00000302851:G433R;ENSP00000302701:G429R|.	ENSP00000302701:G429R|ENSP00000406720:W383C	G|W	-|-	1|3	0|0	SLC23A1|SLC23A1	138741834|138741834	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.763000|0.763000	0.43281|0.43281	5.590000|5.590000	0.67530|0.67530	2.716000|2.716000	0.92895|0.92895	0.491000|0.491000	0.48974|0.48974	GGG|TGG	.	.		0.667	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685	
RARS	5917	hgsc.bcm.edu	37	5	167919732	167919732	+	Silent	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr5:167919732C>G	ENST00000231572.3	+	3	303	c.249C>G	c.(247-249)gtC>gtG	p.V83V	RARS_ENST00000538719.1_5'UTR	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	83					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		TACAAGAGGTCTTTGGTCATG	0.398																																					p.V83V		Atlas-SNP	.											.	RARS	58	.	0			c.C249G						.						123.0	123.0	123.0					5																	167919732		2203	4300	6503	SO:0001819	synonymous_variant	5917	exon3			AGAGGTCTTTGGT	BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.249C>G	chr5.hg19:g.167919732C>G		120.0	0.0		105.0	59.0	NM_002887	B2RBS9|Q53GY4|Q9BWA1	Silent	SNP	ENST00000231572.3	hg19	CCDS4367.1																																																																																			.	.		0.398	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887	
SCUBE3	222663	hgsc.bcm.edu	37	6	35207632	35207632	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr6:35207632C>G	ENST00000274938.7	+	8	933	c.933C>G	c.(931-933)atC>atG	p.I311M	SCUBE3_ENST00000394681.1_Missense_Mutation_p.I327M	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						AGCTTCTCATCAATGAGAGGA	0.512																																					p.I311M		Atlas-SNP	.											.	SCUBE3	99	.	0			c.C933G						.						68.0	61.0	63.0					6																	35207632		2203	4300	6503	SO:0001583	missense	222663	exon8			TCTCATCAATGAG	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.933C>G	chr6.hg19:g.35207632C>G	ENSP00000274938:p.Ile311Met	48.0	0.0		75.0	43.0	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	hg19	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460031	0.63401	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.96265	-3.96;-3.96	5.66	5.66	0.87406	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.053027	0.85682	D	0.000000	D	0.93416	0.7900	N	0.10809	0.05	0.39049	D	0.960288	D;D	0.62365	0.989;0.991	P;P	0.60345	0.814;0.873	D	0.95164	0.8284	10	0.66056	D	0.02	.	13.8148	0.63285	0.2695:0.7305:0.0:0.0	.	327;311	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	M	327;311	ENSP00000378174:I327M;ENSP00000274938:I311M	ENSP00000274938:I311M	I	+	3	3	SCUBE3	35315610	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.167000	0.31847	2.648000	0.89879	0.655000	0.94253	ATC	.	.		0.512	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
GPR111	222611	hgsc.bcm.edu	37	6	47647896	47647896	+	Silent	SNP	A	A	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr6:47647896A>G	ENST00000296862.1	+	5	561	c.561A>G	c.(559-561)ctA>ctG	p.L187L	GPR111_ENST00000398742.2_Silent_p.L119L|GPR111_ENST00000507065.1_Silent_p.L119L			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	187					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						ATATGTTGCTACAAAAGTGTC	0.383																																					p.L119L		Atlas-SNP	.											.	GPR111	123	.	0			c.A357G						.						103.0	95.0	98.0					6																	47647896		1863	4105	5968	SO:0001819	synonymous_variant	222611	exon6			GTTGCTACAAAAG	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.561A>G	chr6.hg19:g.47647896A>G		207.0	0.0		213.0	93.0	NM_153839	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Silent	SNP	ENST00000296862.1	hg19																																																																																				.	.		0.383	GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839	
ERMARD	55780	hgsc.bcm.edu	37	6	170181592	170181592	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr6:170181592A>G	ENST00000366773.3	+	18	2053	c.2020A>G	c.(2020-2022)Agt>Ggt	p.S674G	ERMARD_ENST00000588451.1_Missense_Mutation_p.S538G|ERMARD_ENST00000392095.4_Missense_Mutation_p.S548G|ERMARD_ENST00000418781.3_Missense_Mutation_p.S601G|ERMARD_ENST00000366772.2_Missense_Mutation_p.S627G	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	674					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAAATCCACAAGTAAAGTACT	0.323																																					p.S674G		Atlas-SNP	.											.	C6orf70	63	.	0			c.A2020G						.						56.0	57.0	57.0					6																	170181592		2203	4300	6503	SO:0001583	missense	55780	exon18			TCCACAAGTAAAG	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.2020A>G	chr6.hg19:g.170181592A>G	ENSP00000355735:p.Ser674Gly	185.0	0.0		90.0	85.0	NM_018341	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	hg19	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.239575	0.39598	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095;ENST00000366771	T;T	0.46451	0.87;0.87	5.05	3.87	0.44632	.	2.408730	0.01876	N	0.037558	T	0.14960	0.0361	N	0.24115	0.695	0.09310	N	1	B;B;B	0.31817	0.008;0.341;0.131	B;B;B	0.28011	0.022;0.085;0.039	T	0.08932	-1.0698	10	0.41790	T	0.15	.	8.73	0.34494	0.9094:0.0:0.0906:0.0	.	627;601;674	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	G	674;627;601;548;322	ENSP00000355735:S674G;ENSP00000375945:S548G	ENSP00000355733:S322G	S	+	1	0	C6orf70	169923517	0.007000	0.16637	0.014000	0.15608	0.366000	0.29705	1.644000	0.37228	1.900000	0.55004	0.402000	0.26972	AGT	.	.		0.323	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341	
DFNA5	1687	hgsc.bcm.edu	37	7	24784273	24784273	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr7:24784273C>T	ENST00000342947.3	-	3	737	c.312G>A	c.(310-312)ggG>ggA	p.G104G	DFNA5_ENST00000419307.1_5'UTR|DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000409775.3_Silent_p.G104G|DFNA5_ENST00000409970.1_5'UTR	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	104					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						GGCTGCTGCCCCCCAGGTTCA	0.562																																					p.G104G	GBM(78;184 1250 20134 20900 23600)	Atlas-SNP	.											.	DFNA5	51	.	0			c.G312A						.						87.0	79.0	82.0					7																	24784273		2203	4300	6503	SO:0001819	synonymous_variant	1687	exon3			GCTGCCCCCCAGG	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.312G>A	chr7.hg19:g.24784273C>T		72.0	0.0		119.0	41.0	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Silent	SNP	ENST00000342947.3	hg19	CCDS5389.1																																																																																			.	.		0.562	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
SSPO	23145	hgsc.bcm.edu	37	7	149483308	149483308	+	RNA	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr7:149483308G>A	ENST00000378016.2	+	0	3376							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCTCTGGGATGGAGATCAGGC	0.642																																					p.G1126R		Atlas-SNP	.											.	.	.	.	0			c.G3376A						.						29.0	34.0	33.0					7																	149483308		2137	4223	6360			23145	exon23			TGGGATGGAGATC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149483308G>A		38.0	0.0		31.0	12.0	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.642	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SHH	6469	hgsc.bcm.edu	37	7	155595681	155595681	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr7:155595681C>T	ENST00000297261.2	-	3	1452	c.1302G>A	c.(1300-1302)tgG>tgA	p.W434*		NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	434					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGCGAGTACCAGTGGATGC	0.736																																					p.W434X		Atlas-SNP	.											.	SHH	34	.	0			c.G1302A						.						11.0	12.0	12.0					7																	155595681		1610	3429	5039	SO:0001587	stop_gained	6469	exon3			CGAGTACCAGTGG		CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.1302G>A	chr7.hg19:g.155595681C>T	ENSP00000297261:p.Trp434*	862.0	0.0		765.0	370.0	NM_000193	A4D247|Q75MC9	Nonsense_Mutation	SNP	ENST00000297261.2	hg19	CCDS5942.1	.	.	.	.	.	.	.	.	.	.	C	37	6.525458	0.97637	.	.	ENSG00000164690	ENST00000297261	.	.	.	3.8	3.8	0.43715	.	0.158188	0.45867	D	0.000324	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0393	0.64665	0.0:1.0:0.0:0.0	.	.	.	.	X	434	.	ENSP00000297261:W434X	W	-	3	0	SHH	155288442	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	6.990000	0.76225	1.954000	0.56735	0.561000	0.74099	TGG	.	.		0.736	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	NM_000193	
RP1	6101	hgsc.bcm.edu	37	8	55539105	55539105	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr8:55539105C>G	ENST00000220676.1	+	4	2811	c.2663C>G	c.(2662-2664)gCt>gGt	p.A888G		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	888					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAACAACATGCTACAACCAGG	0.328																																					p.A888G	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.C2663G						.						33.0	36.0	35.0					8																	55539105		2199	4295	6494	SO:0001583	missense	6101	exon4			AACATGCTACAAC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2663C>G	chr8.hg19:g.55539105C>G	ENSP00000220676:p.Ala888Gly	124.0	0.0		167.0	82.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	hg19	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	6.312	0.425664	0.11987	.	.	ENSG00000104237	ENST00000220676	T	0.46063	0.88	5.33	-1.29	0.09288	.	1.626540	0.03514	N	0.220068	T	0.27524	0.0676	N	0.22421	0.69	0.09310	N	1	P	0.34462	0.454	B	0.27380	0.079	T	0.30001	-0.9993	10	0.72032	D	0.01	.	7.0516	0.25075	0.1357:0.1966:0.0:0.6677	.	888	P56715	RP1_HUMAN	G	888	ENSP00000220676:A888G	ENSP00000220676:A888G	A	+	2	0	RP1	55701658	0.000000	0.05858	0.000000	0.03702	0.313000	0.28021	-0.131000	0.10482	-0.237000	0.09739	0.655000	0.94253	GCT	.	.		0.328	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
ARHGAP39	80728	hgsc.bcm.edu	37	8	145772918	145772918	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr8:145772918C>G	ENST00000276826.5	-	4	1753	c.1552G>C	c.(1552-1554)Gtg>Ctg	p.V518L	ARHGAP39_ENST00000377307.2_Missense_Mutation_p.V518L|ARHGAP39_ENST00000528810.1_5'Flank|ARHGAP39_ENST00000540274.1_Missense_Mutation_p.V518L			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	518					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						GGCTGCTCCACAAGCAGGTCC	0.726																																					p.V518L		Atlas-SNP	.											.	ARHGAP39	80	.	0			c.G1552C						.						4.0	5.0	5.0					8																	145772918		2012	4028	6040	SO:0001583	missense	80728	exon6			GCTCCACAAGCAG		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.1552G>C	chr8.hg19:g.145772918C>G	ENSP00000276826:p.Val518Leu	26.0	0.0		56.0	18.0	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	hg19		.	.	.	.	.	.	.	.	.	.	C	1.742	-0.491430	0.04322	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.67345	-0.26;-0.0;-0.26	5.0	-4.09	0.03951	.	1.450250	0.04111	N	0.314607	T	0.40694	0.1127	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.14282	-1.0478	10	0.41790	T	0.15	-12.8646	2.9044	0.05716	0.1112:0.2954:0.1211:0.4723	.	518;518	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	L	518	ENSP00000276826:V518L;ENSP00000366522:V518L;ENSP00000445075:V518L	ENSP00000276826:V518L	V	-	1	0	ARHGAP39	145743726	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.959000	0.03853	-0.777000	0.04572	-0.910000	0.02820	GTG	.	.		0.726	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
APBA1	320	hgsc.bcm.edu	37	9	72131502	72131502	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr9:72131502C>T	ENST00000265381.4	-	2	847	c.625G>A	c.(625-627)Gca>Aca	p.A209T		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	209					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CCGTCGCGTGCGTCCAGCTCG	0.721																																					p.A209T		Atlas-SNP	.											.	APBA1	96	.	0			c.G625A						.						18.0	20.0	19.0					9																	72131502		2198	4296	6494	SO:0001583	missense	320	exon2			CGCGTGCGTCCAG	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.625G>A	chr9.hg19:g.72131502C>T	ENSP00000265381:p.Ala209Thr	15.0	0.0		24.0	11.0	NM_001163	O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	hg19	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405888	0.42715	.	.	ENSG00000107282	ENST00000265381	T	0.04015	3.73	5.26	4.37	0.52481	.	0.379769	0.28398	N	0.015499	T	0.02767	0.0083	N	0.14661	0.345	0.30068	N	0.810262	B	0.31519	0.327	B	0.17098	0.017	T	0.34104	-0.9842	10	0.22706	T	0.39	.	10.685	0.45837	0.0:0.8519:0.0:0.1481	.	209	Q02410	APBA1_HUMAN	T	209	ENSP00000265381:A209T	ENSP00000265381:A209T	A	-	1	0	APBA1	71321322	0.002000	0.14202	1.000000	0.80357	0.915000	0.54546	0.742000	0.26216	1.363000	0.46019	0.561000	0.74099	GCA	.	.		0.721	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
FNBP1	23048	hgsc.bcm.edu	37	9	132662721	132662721	+	Missense_Mutation	SNP	C	C	T	rs200153012	byFrequency	TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr9:132662721C>T	ENST00000446176.2	-	14	1720	c.1534G>A	c.(1534-1536)Gcc>Acc	p.A512T	FNBP1_ENST00000355681.3_Missense_Mutation_p.A483T|FNBP1_ENST00000420781.1_Missense_Mutation_p.A503T|FNBP1_ENST00000443566.2_Missense_Mutation_p.A140T|FNBP1_ENST00000478129.1_5'UTR	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	512	Interaction with PDE6G. {ECO:0000250}.|Interaction with RND2. {ECO:0000250}.|Required for self-association and induction of membrane tubulation.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		CGGTCCTGGGCGCAGTTGTTG	0.582			T	MLL	AML																																p.A512T		Atlas-SNP	.		Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	.	FNBP1	51	.	0			c.G1534A						.						45.0	50.0	48.0					9																	132662721		2032	4177	6209	SO:0001583	missense	23048	exon14			CCTGGGCGCAGTT	AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1534G>A	chr9.hg19:g.132662721C>T	ENSP00000413625:p.Ala512Thr	84.0	0.0		70.0	37.0	NM_015033	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	hg19	CCDS48040.1	.	.	.	.	.	.	.	.	.	.	C	9.474	1.096361	0.20552	.	.	ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000443566;ENST00000355681	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	4.24	4.24	0.50183	.	0.452086	0.23235	N	0.050411	T	0.67795	0.2931	L	0.46614	1.455	0.58432	D	0.999998	B;P;P;B;B;P;B;P	0.41232	0.033;0.5;0.743;0.003;0.024;0.5;0.024;0.5	B;B;B;B;B;B;B;B	0.38842	0.03;0.102;0.283;0.007;0.016;0.102;0.027;0.102	T	0.67288	-0.5708	10	0.25751	T	0.34	-18.395	16.1327	0.81454	0.0:1.0:0.0:0.0	.	507;502;140;446;483;463;507;512	B7ZL12;B7ZL13;E7EPB7;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3	.;.;.;.;.;.;.;FNBP1_HUMAN	T	512;512;503;512;140;483	ENSP00000413625:A512T;ENSP00000407548:A503T;ENSP00000389117:A140T;ENSP00000347907:A483T	ENSP00000347907:A483T	A	-	1	0	FNBP1	131702542	1.000000	0.71417	0.402000	0.26371	0.221000	0.24807	4.878000	0.63093	2.340000	0.79590	0.313000	0.20887	GCC	.	.		0.582	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2		
FCN1	2219	hgsc.bcm.edu	37	9	137804337	137804337	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr9:137804337G>C	ENST00000371806.3	-	7	684	c.593C>G	c.(592-594)gCc>gGc	p.A198G		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	198	B domain; contributes to trimerization.|Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		CCTACCCTGGGCAGTCAGGGC	0.637																																					p.A198G		Atlas-SNP	.											.	FCN1	62	.	0			c.C593G						.						43.0	41.0	41.0					9																	137804337		2203	4300	6503	SO:0001583	missense	2219	exon7			CCCTGGGCAGTCA	D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.593C>G	chr9.hg19:g.137804337G>C	ENSP00000360871:p.Ala198Gly	24.0	0.0		40.0	25.0	NM_002003	Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	hg19	CCDS6985.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657097	0.29425	.	.	ENSG00000085265	ENST00000371806;ENST00000308299	T	0.20332	2.08	3.57	2.66	0.31614	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	.	.	.	.	T	0.22399	0.0540	L	0.61036	1.89	0.27524	N	0.951308	B	0.21071	0.051	B	0.21546	0.035	T	0.10823	-1.0613	9	0.52906	T	0.07	.	8.6147	0.33824	0.1212:0.0:0.8788:0.0	.	198	O00602	FCN1_HUMAN	G	198;186	ENSP00000360871:A198G	ENSP00000308877:A186G	A	-	2	0	FCN1	136944158	0.012000	0.17670	0.994000	0.49952	0.478000	0.33099	1.830000	0.39131	1.988000	0.58038	0.549000	0.68633	GCC	.	.		0.637	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003	
CCDC183	84960	hgsc.bcm.edu	37	9	139694929	139694929	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr9:139694929T>A	ENST00000338005.6	+	5	562	c.527T>A	c.(526-528)cTg>cAg	p.L176Q	RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.L206Q|RP11-216L13.18_ENST00000471502.1_RNA|KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		176										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		TTGGACCTGCTGGATTATCTG	0.632																																					p.L176Q		Atlas-SNP	.											.	KIAA1984	39	.	0			c.T527A						.						43.0	46.0	45.0					9																	139694929		1974	4151	6125	SO:0001583	missense	84960	exon5			ACCTGCTGGATTA																												ENST00000338005.6:c.527T>A	chr9.hg19:g.139694929T>A	ENSP00000338013:p.Leu176Gln	77.0	0.0		83.0	38.0	NM_001039374	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	hg19	CCDS43906.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.374885	0.42105	.	.	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.13307	2.6	4.4	4.4	0.53042	.	0.275088	0.19040	U	0.124317	T	0.31199	0.0789	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.01416	-1.1360	10	0.44086	T	0.13	-13.1308	10.0186	0.42029	0.0:0.0:0.0:1.0	.	176	Q5T5S1	K1984_HUMAN	Q	176	ENSP00000338013:L176Q	ENSP00000338013:L176Q	L	+	2	0	KIAA1984	138814750	1.000000	0.71417	0.990000	0.47175	0.207000	0.24258	1.024000	0.30077	1.617000	0.50277	0.254000	0.18369	CTG	.	.		0.632	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
NSUN6	221078	hgsc.bcm.edu	37	10	18840757	18840757	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr10:18840757T>A	ENST00000377304.4	-	9	1484	c.1066A>T	c.(1066-1068)Act>Tct	p.T356S	NSUN6_ENST00000493816.1_5'Flank	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	356							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						CATACTGCAGTGAAGAGTTTT	0.428																																					p.T356S		Atlas-SNP	.											.	NSUN6	46	.	0			c.A1066T						.						169.0	141.0	150.0					10																	18840757		2203	4300	6503	SO:0001583	missense	221078	exon9			CTGCAGTGAAGAG	BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.1066A>T	chr10.hg19:g.18840757T>A	ENSP00000366519:p.Thr356Ser	117.0	0.0		127.0	57.0	NM_182543	B0YJ54	Missense_Mutation	SNP	ENST00000377304.4	hg19	CCDS7130.1	.	.	.	.	.	.	.	.	.	.	T	0.894	-0.724502	0.03158	.	.	ENSG00000241058	ENST00000377304	T	0.19938	2.11	5.8	-4.74	0.03249	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.697963	0.15563	N	0.255843	T	0.05318	0.0141	N	0.05280	-0.08	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.33445	-0.9868	10	0.09338	T	0.73	.	1.1283	0.01740	0.4004:0.1784:0.0978:0.3235	.	356	Q8TEA1	NSUN6_HUMAN	S	356	ENSP00000366519:T356S	ENSP00000366519:T356S	T	-	1	0	NSUN6	18880763	0.986000	0.35501	0.164000	0.22755	0.144000	0.21451	0.459000	0.21908	-0.872000	0.04037	0.459000	0.35465	ACT	.	.		0.428	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543	
PARG	8505	hgsc.bcm.edu	37	10	51028243	51028243	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr10:51028243T>C	ENST00000402038.3	-	13	1288	c.1289A>G	c.(1288-1290)cAc>cGc	p.H430R		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	915	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		AAGGAAAATGTGCATGCTGTA	0.428																																					p.H915R		Atlas-SNP	.											.	PARG	46	.	0			c.A2744G						.						141.0	117.0	124.0					10																	51028243		692	1591	2283	SO:0001583	missense	8505	exon17			AAAATGTGCATGC	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.1289A>G	chr10.hg19:g.51028243T>C	ENSP00000384408:p.His430Arg	108.0	0.0		102.0	50.0	NM_003631	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.8|20.8	4.051718|4.051718	0.75960|0.75960	.|.	.|.	ENSG00000227345|ENSG00000227345	ENST00000402038|ENST00000432127	.|.	.|.	.|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|.	.|.	.|.	.|.	T|T	0.71273|0.71273	0.3320|0.3320	L|L	0.58101|0.58101	1.795|1.795	.|.	.|.	.|.	D;D;D;D;D;D;D|.	0.76494|.	0.999;0.999;0.974;0.987;0.987;0.987;0.999|.	D;D;P;P;P;P;D|.	0.74023|.	0.982;0.959;0.719;0.794;0.794;0.794;0.949|.	T|T	0.70809|0.70809	-0.4771|-0.4771	7|4	0.38643|.	T|.	0.18|.	-12.5834|-12.5834	16.5582|16.5582	0.84512|0.84512	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	833;915;466;183;430;455;915|.	Q86W56-2;Q86W56;A5YBK3;B4DHS4;Q5SQP4;B4DX76;Q0MQR4|.	.;PARG_HUMAN;.;.;.;.;.|.	R|A	430|131	.|.	ENSP00000384408:H430R|.	H|T	-|-	2|1	0|0	PARG|PARG	50698249|50698249	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.199000|7.199000	0.77831|0.77831	2.308000|2.308000	0.77769|0.77769	0.533000|0.533000	0.62120|0.62120	CAC|ACA	.	.		0.428	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
PHYHIPL	84457	hgsc.bcm.edu	37	10	61005248	61005248	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr10:61005248G>C	ENST00000373880.4	+	5	1292	c.1028G>C	c.(1027-1029)gGc>gCc	p.G343A	PHYHIPL_ENST00000373878.3_Missense_Mutation_p.G317A	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	343						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						CTTTCTGTGGGCACCGTGGCA	0.453																																					p.G343A		Atlas-SNP	.											.	PHYHIPL	44	.	0			c.G1028C						.						75.0	70.0	72.0					10																	61005248		2203	4300	6503	SO:0001583	missense	84457	exon5			CTGTGGGCACCGT	AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.1028G>C	chr10.hg19:g.61005248G>C	ENSP00000362987:p.Gly343Ala	98.0	0.0		47.0	45.0	NM_032439	B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Missense_Mutation	SNP	ENST00000373880.4	hg19	CCDS7254.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931341	0.73442	.	.	ENSG00000165443	ENST00000373880;ENST00000373878	D;D	0.90563	-2.69;-2.69	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	D	0.96005	0.8699	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96243	0.9177	10	0.87932	D	0	-22.0001	19.5263	0.95208	0.0:0.0:1.0:0.0	.	317;343	Q96FC7-2;Q96FC7	.;PHIPL_HUMAN	A	343;317	ENSP00000362987:G343A;ENSP00000362985:G317A	ENSP00000362985:G317A	G	+	2	0	PHYHIPL	60675254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	2.608000	0.88229	0.655000	0.94253	GGC	.	.		0.453	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048156.1	NM_032439	
EIF5AL1	143244	hgsc.bcm.edu	37	10	81272785	81272785	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr10:81272785A>C	ENST00000520547.2	+	1	429	c.380A>C	c.(379-381)tAc>tCc	p.Y127S	AL133481.1_ENST00000538322.1_5'Flank	NM_001099692.1	NP_001093162.1	Q6IS14	IF5AL_HUMAN	eukaryotic translation initiation factor 5A-like 1	127					mRNA transport (GO:0051028)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|protein transport (GO:0015031)|translational frameshifting (GO:0006452)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)	ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			endometrium(1)	1	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GAGCAGAAGTACGACTGTGGA	0.552																																					p.Y127S		Atlas-SNP	.											EIF5AL1_ENST00000520547,NS,carcinoma,0,2	EIF5AL1	24	.	0			c.A380C						.						116.0	129.0	125.0					10																	81272785		2198	4298	6496	SO:0001583	missense	143244	exon1			AGAAGTACGACTG		CCDS53546.1	10q22.3	2012-04-19			ENSG00000253626	ENSG00000253626			17419	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 5A pseudogene 1"""	EIF5AP1			Standard	NM_001099692		Approved	bA342M3.3	uc009xrx.3	Q6IS14	OTTHUMG00000018563	ENST00000520547.2:c.380A>C	chr10.hg19:g.81272785A>C	ENSP00000430706:p.Tyr127Ser	145.0	0.0		84.0	26.0	NM_001099692		Missense_Mutation	SNP	ENST00000520547.2	hg19	CCDS53546.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.537149	0.27475	.	.	ENSG00000253626	ENST00000520547	T	0.42131	0.98	0.843	0.843	0.18935	Nucleic acid-binding, OB-fold-like (1);Translation elongation factor, IF5A C-terminal (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.38081	0.1027	M	0.71036	2.16	0.24973	N	0.991655	P	0.41947	0.766	B	0.38428	0.273	T	0.32402	-0.9908	9	0.87932	D	0	.	5.6445	0.17582	1.0:0.0:0.0:0.0	.	127	Q6IS14	IF5AL_HUMAN	S	127	ENSP00000430706:Y127S	ENSP00000430706:Y127S	Y	+	2	0	EIF5AL1	80942791	0.994000	0.37717	0.368000	0.25939	0.447000	0.32167	0.621000	0.24418	0.311000	0.23014	0.305000	0.20034	TAC	.	.		0.552	EIF5AL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048954.4	NM_001099692	
PTEN	5728	hgsc.bcm.edu	37	10	89720875	89720875	+	Splice_Site	SNP	G	G	T	rs398123313|rs398123314		TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr10:89720875G>T	ENST00000371953.3	+	8	2383	c.1026G>T	c.(1024-1026)aaG>aaT	p.K342N	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	342	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.		K -> N (in CWS1; reduced phosphatase activity towards Ins(1,3,4,5)P4 but PtdIns(3,4,5)P3 phosphatase activity is similar to wild-type).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.K342N(2)|p.G165_*404del(1)|p.D326_K342del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAAATTTTAAGGTCAGTTAAA	0.328		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.K342N		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,colon,carcinoma,+1,2	PTEN	3652	.	52	Whole gene deletion(37)|Deletion - Frameshift(9)|Substitution - Missense(2)|Deletion - In frame(2)|Unknown(2)	prostate(16)|central_nervous_system(11)|skin(6)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|breast(3)|ovary(3)|endometrium(2)|urinary_tract(2)|soft_tissue(1)	c.G1026T						.						45.0	48.0	47.0					10																	89720875		2203	4299	6502	SO:0001630	splice_region_variant	5728	exon8	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	TTTTAAGGTCAGT	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.1026+1G>T	chr10.hg19:g.89720875G>T		265.0	0.0		136.0	117.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301086	0.81136	.	.	ENSG00000171862	ENST00000371953	D	0.86769	-2.17	5.37	5.37	0.77165	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92747	0.7694	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.92741	0.6208	9	.	.	.	-6.3339	12.4512	0.55679	0.0771:0.0:0.9229:0.0	.	342	P60484	PTEN_HUMAN	N	342	ENSP00000361021:K342N	.	K	+	3	2	PTEN	89710855	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.290000	0.65661	2.516000	0.84829	0.591000	0.81541	AAG	.	.		0.328	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	Missense_Mutation
HMX3	340784	hgsc.bcm.edu	37	10	124895764	124895764	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr10:124895764C>T	ENST00000357878.5	+	1	287	c.198C>T	c.(196-198)gcC>gcT	p.A66A		NM_001105574.1	NP_001099044.1	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	66	Ala-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|embryo implantation (GO:0007566)|inner ear morphogenesis (GO:0042472)|maternal process involved in female pregnancy (GO:0060135)|neuromuscular process controlling balance (GO:0050885)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(4)	4		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		ccgccgccgccgctgccgctg	0.751																																					p.A66A		Atlas-SNP	.											.	HMX3	24	.	0			c.C198T						.						2.0	2.0	2.0					10																	124895764		902	2340	3242	SO:0001819	synonymous_variant	340784	exon1			CGCCGCCGCTGCC		CCDS41575.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188620	ENSG00000188620		"""Homeoboxes / ANTP class : NKL subclass"""	5019	protein-coding gene	gene with protein product		613380	"""homeo box (H6 family) 3"""				Standard	NM_001105574		Approved	NKX5-1	uc010quc.2	A6NHT5	OTTHUMG00000019199	ENST00000357878.5:c.198C>T	chr10.hg19:g.124895764C>T		127.0	0.0		122.0	5.0	NM_001105574	A8MU06	Silent	SNP	ENST00000357878.5	hg19	CCDS41575.1																																																																																			.	.		0.751	HMX3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050842.4	XM_291716	
ANO9	338440	hgsc.bcm.edu	37	11	431763	431763	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:431763T>C	ENST00000332826.6	-	7	554	c.470A>G	c.(469-471)gAg>gGg	p.E157G		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	157					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						CAGGCGTCCCTCCCCCTGGCT	0.647																																					p.E157G		Atlas-SNP	.											ANO9,bladder,carcinoma,0,1	ANO9	61	.	0			c.A470G						.						58.0	58.0	58.0					11																	431763		2203	4298	6501	SO:0001583	missense	338440	exon7			CGTCCCTCCCCCT	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.470A>G	chr11.hg19:g.431763T>C	ENSP00000332788:p.Glu157Gly	45.0	0.0		59.0	5.0	NM_001012302	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	hg19	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.167925	0.57476	.	.	ENSG00000185101	ENST00000332826	T	0.69435	-0.4	4.25	4.25	0.50352	.	1.072170	0.07407	U	0.891802	T	0.56337	0.1978	L	0.29908	0.895	0.23889	N	0.996556	B	0.26577	0.153	B	0.19391	0.025	T	0.41016	-0.9532	10	0.28530	T	0.3	.	12.9873	0.58598	0.0:0.0:0.0:1.0	.	157	A1A5B4	ANO9_HUMAN	G	157	ENSP00000332788:E157G	ENSP00000332788:E157G	E	-	2	0	ANO9	421763	0.078000	0.21339	0.025000	0.17156	0.030000	0.12068	2.690000	0.47001	1.930000	0.55929	0.397000	0.26171	GAG	.	.		0.647	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302	
TIMM10B	26515	hgsc.bcm.edu	37	11	6503054	6503054	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:6503054T>C	ENST00000254616.6	+	2	177	c.107T>C	c.(106-108)tTg>tCg	p.L36S	ARFIP2_ENST00000254584.2_5'Flank|ARFIP2_ENST00000396777.3_5'Flank|ARFIP2_ENST00000445086.2_5'Flank|TIMM10B_ENST00000530751.1_Intron|TIMM10B_ENST00000472836.1_Missense_Mutation_p.L36S|ARFIP2_ENST00000525235.1_5'Flank|ARFIP2_ENST00000423813.2_5'Flank	NM_012192.3	NP_036324.1	Q9Y5J6	T10B_HUMAN	translocase of inner mitochondrial membrane 10 homolog B (yeast)	36					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial intermembrane space protein transporter complex (GO:0042719)	metal ion binding (GO:0046872)										GTGCCCAGCTTGCACCACCGA	0.562																																					p.L36S		Atlas-SNP	.											.	.	.	.	0			c.T107C						.						75.0	69.0	71.0					11																	6503054		2201	4296	6497	SO:0001583	missense	26515	exon2			CCAGCTTGCACCA	AF150105	CCDS7766.1	11p15.4	2012-12-07	2012-12-07	2012-12-07	ENSG00000132286	ENSG00000132286			4022	protein-coding gene	gene with protein product		607388	"""fracture callus 1 (rat) homolog"", ""fracture callus 1 homolog (rat)"""	FXC1		10552927	Standard	NM_012192		Approved	Tim9b, TIM10B	uc001mdn.4	Q9Y5J6	OTTHUMG00000133400	ENST00000254616.6:c.107T>C	chr11.hg19:g.6503054T>C	ENSP00000254616:p.Leu36Ser	40.0	0.0		45.0	22.0	NM_012192	Q96FF3	Missense_Mutation	SNP	ENST00000254616.6	hg19	CCDS7766.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.520846	0.85495	.	.	ENSG00000132286	ENST00000254616;ENST00000533379	T;T	0.65549	-0.16;-0.16	5.82	5.82	0.92795	.	0.200578	0.44483	D	0.000451	T	0.77170	0.4091	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.79629	-0.1724	10	0.87932	D	0	-8.9917	14.3986	0.67027	0.0:0.0:0.0:1.0	.	36	Q9Y5J6	TIM9B_HUMAN	S	36	ENSP00000254616:L36S;ENSP00000436948:L36S	ENSP00000254616:L36S	L	+	2	0	FXC1	6459630	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.170000	0.71920	2.214000	0.71695	0.460000	0.39030	TTG	.	.		0.562	TIMM10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257257.2	NM_012192	
TAF10	6881	hgsc.bcm.edu	37	11	6632187	6632187	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:6632187C>A	ENST00000299424.4	-	5	1100	c.623G>T	c.(622-624)gGc>gTc	p.G208V	RP11-732A19.2_ENST00000527398.1_RNA|TAF10_ENST00000531760.1_5'Flank	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	208					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACATTGATGCCATACTCGCT	0.517																																					p.G208V		Atlas-SNP	.											.	TAF10	9	.	0			c.G623T						.						161.0	140.0	147.0					11																	6632187		2201	4296	6497	SO:0001583	missense	6881	exon5			TTGATGCCATACT	U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402	ENST00000299424.4:c.623G>T	chr11.hg19:g.6632187C>A	ENSP00000299424:p.Gly208Val	154.0	0.0		172.0	84.0	NM_006284	O00703|Q13175|Q6FH13	Missense_Mutation	SNP	ENST00000299424.4	hg19	CCDS7769.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419623	0.62622	.	.	ENSG00000166337	ENST00000299424	T	0.79749	-1.3	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.91486	0.7312	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93089	0.6498	10	0.87932	D	0	-15.8773	17.0075	0.86397	0.0:1.0:0.0:0.0	.	208	Q12962	TAF10_HUMAN	V	208	ENSP00000299424:G208V	ENSP00000299424:G208V	G	-	2	0	TAF10	6588763	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.804000	0.69135	2.582000	0.87167	0.655000	0.94253	GGC	.	.		0.517	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257259.2	NM_006284	
OR5D14	219436	hgsc.bcm.edu	37	11	55563231	55563231	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:55563231A>C	ENST00000335605.1	+	1	200	c.200A>C	c.(199-201)cAc>cCc	p.H67P		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TTCCTTAGTCACCTCTCTTTT	0.383																																					p.H67P		Atlas-SNP	.											.	OR5D14	116	.	0			c.A200C						.						220.0	198.0	206.0					11																	55563231		2200	4296	6496	SO:0001583	missense	219436	exon1			TTAGTCACCTCTC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.200A>C	chr11.hg19:g.55563231A>C	ENSP00000334456:p.His67Pro	78.0	0.0		75.0	40.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	hg19	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	a	9.284	1.048796	0.19827	.	.	ENSG00000186113	ENST00000335605	T	0.12569	2.67	5.08	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000233	T	0.31040	0.0784	H	0.94771	3.58	0.09310	N	1	P	0.52577	0.954	P	0.49708	0.62	T	0.31420	-0.9944	10	0.72032	D	0.01	-12.2834	5.8009	0.18414	0.7686:0.0:0.0831:0.1483	.	67	Q8NGL3	OR5DE_HUMAN	P	67	ENSP00000334456:H67P	ENSP00000334456:H67P	H	+	2	0	OR5D14	55319807	0.003000	0.15002	0.234000	0.24042	0.016000	0.09150	2.096000	0.41738	0.792000	0.33850	-0.263000	0.10527	CAC	.	.		0.383	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
MS4A6E	245802	hgsc.bcm.edu	37	11	60107402	60107402	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:60107402G>C	ENST00000300182.4	+	3	483	c.418G>C	c.(418-420)Gtg>Ctg	p.V140L		NM_139249.2	NP_640342.1	Q96DS6	M4A6E_HUMAN	membrane-spanning 4-domains, subfamily A, member 6E	140						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(9)|stomach(1)	13						GCTCACTGCTGTGCTGCAGTG	0.483																																					p.V140L		Atlas-SNP	.											.	MS4A6E	22	.	0			c.G418C						.						237.0	217.0	224.0					11																	60107402		2203	4300	6503	SO:0001583	missense	245802	exon3			ACTGCTGTGCTGC	AF354931	CCDS7984.1	11q12	2008-03-25				ENSG00000166926			14285	protein-coding gene	gene with protein product		608402				11486273	Standard	NM_139249		Approved		uc001npd.3	Q96DS6		ENST00000300182.4:c.418G>C	chr11.hg19:g.60107402G>C	ENSP00000300182:p.Val140Leu	44.0	0.0		42.0	18.0	NM_139249	Q3MIL2|Q8NE56|Q96PG4|Q96PG5	Missense_Mutation	SNP	ENST00000300182.4	hg19	CCDS7984.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470450	0.26423	.	.	ENSG00000166926	ENST00000300182	T	0.02498	4.27	1.6	0.641	0.17759	.	2.663120	0.01548	N	0.019541	T	0.08088	0.0202	L	0.42686	1.345	0.09310	N	1	P	0.48230	0.907	P	0.58820	0.846	T	0.18493	-1.0335	10	0.52906	T	0.07	.	3.7255	0.08473	0.2524:0.0:0.7476:0.0	.	140	Q96DS6	M4A6E_HUMAN	L	140	ENSP00000300182:V140L	ENSP00000300182:V140L	V	+	1	0	MS4A6E	59863978	0.002000	0.14202	0.132000	0.22025	0.108000	0.19459	-0.792000	0.04594	0.219000	0.20840	0.195000	0.17529	GTG	.	.		0.483	MS4A6E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394296.1		
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810480	65810480	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:65810480G>A	ENST00000312006.4	-	3	1075	c.794C>T	c.(793-795)gCc>gTc	p.A265V	GAL3ST3_ENST00000527878.1_Missense_Mutation_p.A265V	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	265					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						GTTGAGCTTGGCGTAGAGCAC	0.711																																					p.A265V		Atlas-SNP	.											.	GAL3ST3	40	.	0			c.C794T						.						18.0	18.0	18.0					11																	65810480		2199	4291	6490	SO:0001583	missense	89792	exon3			AGCTTGGCGTAGA	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.794C>T	chr11.hg19:g.65810480G>A	ENSP00000308591:p.Ala265Val	35.0	0.0		51.0	25.0	NM_033036	Q14D05	Missense_Mutation	SNP	ENST00000312006.4	hg19	CCDS8128.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958602	0.53400	.	.	ENSG00000175229	ENST00000312006;ENST00000527878	T;T	0.14516	2.5;2.5	4.41	4.41	0.53225	.	0.154383	0.42682	D	0.000668	T	0.07863	0.0197	N	0.16478	0.41	0.39558	D	0.969088	B	0.18013	0.025	B	0.11329	0.006	T	0.26950	-1.0088	10	0.25106	T	0.35	-19.3267	8.6749	0.34174	0.1056:0.0:0.8944:0.0	.	265	Q96A11	G3ST3_HUMAN	V	265	ENSP00000308591:A265V;ENSP00000434829:A265V	ENSP00000308591:A265V	A	-	2	0	GAL3ST3	65567056	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.054000	0.71096	2.157000	0.67596	0.561000	0.74099	GCC	.	.		0.711	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
SPTBN2	6712	hgsc.bcm.edu	37	11	66456306	66456306	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:66456306C>A	ENST00000533211.1	-	31	6380	c.6049G>T	c.(6049-6051)Gtg>Ttg	p.V2017L	SPTBN2_ENST00000309996.2_Missense_Mutation_p.V2017L|SPTBN2_ENST00000529997.1_Missense_Mutation_p.V2017L			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2017					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTTCCAAACACAAGCACCTCC	0.612																																					p.V2017L		Atlas-SNP	.											.	SPTBN2	188	.	0			c.G6049T						.						37.0	40.0	39.0					11																	66456306		2200	4295	6495	SO:0001583	missense	6712	exon30			CAAACACAAGCAC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.6049G>T	chr11.hg19:g.66456306C>A	ENSP00000432568:p.Val2017Leu	33.0	0.0		33.0	10.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586045	0.46110	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.47528	0.84;0.84;0.84	4.77	1.8	0.24995	.	0.312185	0.31531	N	0.007494	T	0.16599	0.0399	N	0.01202	-0.96	0.29311	N	0.86799	B	0.06786	0.001	B	0.10450	0.005	T	0.15665	-1.0429	10	0.25751	T	0.34	.	6.8592	0.24058	0.0:0.4958:0.0:0.5042	.	2017	O15020	SPTN2_HUMAN	L	2017	ENSP00000432568:V2017L;ENSP00000311489:V2017L;ENSP00000433593:V2017L	ENSP00000311489:V2017L	V	-	1	0	SPTBN2	66212882	0.430000	0.25538	0.929000	0.37066	0.965000	0.64279	0.707000	0.25704	0.202000	0.20498	-0.229000	0.12294	GTG	.	.		0.612	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
DLG2	1740	hgsc.bcm.edu	37	11	84996347	84996347	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr11:84996347C>G	ENST00000376104.2	-	4	414	c.103G>C	c.(103-105)Gaa>Caa	p.E35Q	DLG2_ENST00000543673.1_Missense_Mutation_p.E35Q	NM_001142699.1	NP_001136171.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTGGCTTCTTCTATCTTCTGC	0.353																																					p.E35Q		Atlas-SNP	.											.	DLG2	448	.	0			c.G103C						.						200.0	180.0	186.0					11																	84996347		1568	3581	5149	SO:0001583	missense	1740	exon4			CTTCTTCTATCTT	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000376104.2:c.103G>C	chr11.hg19:g.84996347C>G	ENSP00000365272:p.Glu35Gln	64.0	0.0		82.0	36.0	NM_001142699	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000376104.2	hg19	CCDS44690.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897745	0.52227	.	.	ENSG00000150672	ENST00000376104;ENST00000543673;ENST00000546021	T;T	0.12879	2.64;2.64	5.88	4.92	0.64577	.	0.312743	0.25222	N	0.032224	T	0.12646	0.0307	L	0.34521	1.04	0.80722	D	1	B	0.14012	0.009	B	0.08055	0.003	T	0.11324	-1.0592	9	.	.	.	.	18.3479	0.90328	0.0:0.8717:0.1283:0.0	.	35	Q15700-2	.	Q	35	ENSP00000365272:E35Q;ENSP00000441994:E35Q	.	E	-	1	0	DLG2	84673995	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.693000	0.47027	2.779000	0.95612	0.650000	0.86243	GAA	.	.		0.353	DLG2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259245.3	NM_001364	
CACNA1C	775	hgsc.bcm.edu	37	12	2613673	2613673	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr12:2613673C>T	ENST00000399617.1	+	8	1185	c.1185C>T	c.(1183-1185)ttC>ttT	p.F395F	CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399629.1_Intron|CACNA1C_ENST00000399591.1_Intron|CACNA1C_ENST00000399638.1_Intron|CACNA1C_ENST00000399634.1_Silent_p.F395F|CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000399641.1_Silent_p.F395F|CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000399637.1_Intron|CACNA1C_ENST00000347598.4_Intron|CACNA1C_ENST00000399603.1_Silent_p.F395F|CACNA1C_ENST00000480911.1_Intron|CACNA1C_ENST00000327702.7_Intron|CACNA1C_ENST00000491104.1_3'UTR|CACNA1C_ENST00000406454.3_Silent_p.F395F|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000399649.1_Intron|CACNA1C_ENST00000399601.1_Intron|CACNA1C_ENST00000399595.1_Intron	NM_001167624.1	NP_001161096.1	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	395					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GATCCTTTTTCGTTCTAAATC	0.488																																					p.F395F		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.C1185T						.						295.0	247.0	261.0					12																	2613673		1568	3582	5150	SO:0001819	synonymous_variant	775	exon8			CTTTTTCGTTCTA	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000399617.1:c.1185C>T	chr12.hg19:g.2613673C>T		119.0	0.0		139.0	56.0	NM_001167623	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000399617.1	hg19	CCDS53733.1																																																																																			.	.		0.488	CACNA1C-013	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317031.1	NM_000719	
DCN	1634	hgsc.bcm.edu	37	12	91552214	91552214	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr12:91552214G>A	ENST00000052754.5	-	4	898	c.397C>T	c.(397-399)Cga>Tga	p.R133*	DCN_ENST00000420120.2_Intron|DCN_ENST00000441303.2_Intron|DCN_ENST00000228329.5_Intron|DCN_ENST00000303320.3_Intron|DCN_ENST00000547568.2_Intron|DCN_ENST00000425043.1_Intron|DCN_ENST00000552962.1_Nonsense_Mutation_p.R133*|DCN_ENST00000393155.1_Nonsense_Mutation_p.R133*|DCN_ENST00000456569.2_Intron	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	133					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)	p.R133*(1)		central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						AGATAAAGTCGTTCCAACTTC	0.408																																					p.R133X		Atlas-SNP	.											DCN,rectum,carcinoma,+2,1	DCN	61	.	1	Substitution - Nonsense(1)	central_nervous_system(1)	c.C397T						.						131.0	127.0	128.0					12																	91552214		2203	4300	6503	SO:0001587	stop_gained	1634	exon4			AAAGTCGTTCCAA	AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.397C>T	chr12.hg19:g.91552214G>A	ENSP00000052754:p.Arg133*	114.0	0.0		116.0	42.0	NM_001920	Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Nonsense_Mutation	SNP	ENST00000052754.5	hg19	CCDS9039.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860018	0.91433	.	.	ENSG00000011465	ENST00000052754;ENST00000393155;ENST00000552962;ENST00000547937;ENST00000552145;ENST00000550563	.	.	.	5.69	1.07	0.20283	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	15.2272	0.73359	0.0:0.0:0.2263:0.7737	.	.	.	.	X	133	.	ENSP00000052754:R133X	R	-	1	2	DCN	90076345	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.109000	0.31135	0.276000	0.22118	0.650000	0.86243	CGA	.	.		0.408	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507	
FREM2	341640	hgsc.bcm.edu	37	13	39435611	39435611	+	Silent	SNP	G	G	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr13:39435611G>C	ENST00000280481.7	+	15	7779	c.7563G>C	c.(7561-7563)ccG>ccC	p.P2521P		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2521					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GAGCAGAGCCGTTCTCAGCTA	0.438																																					p.P2521P		Atlas-SNP	.											.	FREM2	385	.	0			c.G7563C						.						151.0	125.0	133.0					13																	39435611		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon15			AGAGCCGTTCTCA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7563G>C	chr13.hg19:g.39435611G>C		43.0	0.0		57.0	30.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	hg19	CCDS31960.1																																																																																			.	.		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PHF11	51131	hgsc.bcm.edu	37	13	50092193	50092193	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr13:50092193T>A	ENST00000378319.3	+	4	405	c.364T>A	c.(364-366)Tgt>Agt	p.C122S	PHF11_ENST00000357596.3_Missense_Mutation_p.C83S|PHF11_ENST00000488958.1_Missense_Mutation_p.C83S	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		CACCGTGGGATGTGATTTAAA	0.343																																					p.C122S		Atlas-SNP	.											.	PHF11	20	.	0			c.T364A						.						73.0	76.0	75.0					13																	50092193		2203	4300	6503	SO:0001583	missense	51131	exon4			GTGGGATGTGATT	AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.364T>A	chr13.hg19:g.50092193T>A	ENSP00000367570:p.Cys122Ser	307.0	0.0		298.0	134.0	NM_001040443	Q5W0A4|Q5W0A6|Q9Y5A2	Missense_Mutation	SNP	ENST00000378319.3	hg19	CCDS31975.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.52|16.52	3.147599|3.147599	0.57151|0.57151	.|.	.|.	ENSG00000136147|ENSG00000136147	ENST00000378319;ENST00000496612;ENST00000357596;ENST00000485919;ENST00000442195;ENST00000488958|ENST00000426879	D;D;D;D;D;D|.	0.98249|.	-4.82;-4.82;-4.82;-4.82;-4.82;-4.82|.	4.2|4.2	4.2|4.2	0.49525|0.49525	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|D	0.86289|0.86289	0.5897|0.5897	H|H	0.96777|0.96777	3.88|3.88	0.42650|0.42650	D|D	0.993444|0.993444	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.77557|.	0.99;0.977|.	D|D	0.89843|0.89843	0.4004|0.4004	10|5	0.87932|.	D|.	0|.	-0.7518|-0.7518	11.1707|11.1707	0.48569|0.48569	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	122;122|.	B4DTX8;Q9UIL8|.	.;PHF11_HUMAN|.	S|E	122;54;83;83;83;83|76	ENSP00000367570:C122S;ENSP00000419229:C54S;ENSP00000350209:C83S;ENSP00000420129:C83S;ENSP00000405227:C83S;ENSP00000417539:C83S|.	ENSP00000350209:C83S|.	C|D	+|+	1|3	0|2	PHF11|PHF11	48990194|48990194	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.381000|0.381000	0.30169|0.30169	4.032000|4.032000	0.57274|0.57274	1.878000|1.878000	0.54408|0.54408	0.533000|0.533000	0.62120|0.62120	TGT|GAT	.	.		0.343	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044915.1	NM_016119	
PSMB11	122706	hgsc.bcm.edu	37	14	23512092	23512092	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr14:23512092G>A	ENST00000408907.2	+	1	717	c.658G>A	c.(658-660)Ggg>Agg	p.G220R		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	220					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		TGCCTATTCAGGGGGCTCTGT	0.612																																					p.G220R		Atlas-SNP	.											.	PSMB11	40	.	0			c.G658A						.						39.0	41.0	40.0					14																	23512092		2115	4232	6347	SO:0001583	missense	122706	exon1			TATTCAGGGGGCT		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.658G>A	chr14.hg19:g.23512092G>A	ENSP00000386212:p.Gly220Arg	70.0	0.0		42.0	20.0	NM_001099780		Missense_Mutation	SNP	ENST00000408907.2	hg19	CCDS41923.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301046	0.60195	.	.	ENSG00000222028	ENST00000408907	T	0.43688	0.94	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.77315	0.4112	H	0.97265	3.97	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86395	0.1738	10	0.87932	D	0	-30.1628	16.824	0.85926	0.0:0.0:1.0:0.0	.	220	A5LHX3	PSB11_HUMAN	R	220	ENSP00000386212:G220R	ENSP00000386212:G220R	G	+	1	0	PSMB11	22581932	1.000000	0.71417	0.961000	0.40146	0.023000	0.10783	9.131000	0.94446	2.260000	0.74910	0.655000	0.94253	GGG	.	.		0.612	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408294.1	NM_001099780	
MYH6	4624	hgsc.bcm.edu	37	14	23869968	23869968	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr14:23869968G>A	ENST00000356287.3	-	12	1389	c.1360C>T	c.(1360-1362)Cgc>Tgc	p.R454C	MYH6_ENST00000405093.3_Missense_Mutation_p.R454C			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	454	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AAGTACTGGCGTGGCTGCTTG	0.567																																					p.R454C		Atlas-SNP	.											MYH6,NS,malignant_melanoma,+1,1	MYH6	274	.	0			c.C1360T						.						120.0	97.0	104.0					14																	23869968		2203	4300	6503	SO:0001583	missense	4624	exon13			ACTGGCGTGGCTG	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1360C>T	chr14.hg19:g.23869968G>A	ENSP00000348634:p.Arg454Cys	108.0	0.0		107.0	51.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	hg19	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	18.71	3.683022	0.68157	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.87887	-2.31;-2.31	4.03	4.03	0.46877	Myosin head, motor domain (2);	.	.	.	.	D	0.94538	0.8241	H	0.95470	3.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	D	0.94986	0.8130	9	0.87932	D	0	.	9.9841	0.41830	0.0:0.0:0.6697:0.3303	.	454;454	D9YZU2;P13533	.;MYH6_HUMAN	C	454	ENSP00000386041:R454C;ENSP00000348634:R454C	ENSP00000348634:R454C	R	-	1	0	MYH6	22939808	0.921000	0.31238	0.997000	0.53966	0.999000	0.98932	1.388000	0.34442	1.978000	0.57642	0.580000	0.79431	CGC	.	.		0.567	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
LRRC16B	90668	hgsc.bcm.edu	37	14	24530143	24530143	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr14:24530143C>G	ENST00000342740.5	+	26	2352	c.2198C>G	c.(2197-2199)cCc>cGc	p.P733R	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	733						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CAGCTGTTTCCCAGCCTCTAT	0.582																																					p.P733R		Atlas-SNP	.											.	LRRC16B	120	.	0			c.C2198G						.						48.0	37.0	41.0					14																	24530143		2006	3853	5859	SO:0001583	missense	90668	exon26			TGTTTCCCAGCCT	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2198C>G	chr14.hg19:g.24530143C>G	ENSP00000340467:p.Pro733Arg	51.0	0.0		48.0	27.0	NM_138360	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	hg19	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.708211	0.68615	.	.	ENSG00000186648	ENST00000342740	T	0.24350	1.86	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000001	T	0.48519	0.1504	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.41502	-0.9505	10	0.66056	D	0.02	-10.2806	16.5424	0.84405	0.0:1.0:0.0:0.0	.	733	Q8ND23	LR16B_HUMAN	R	733	ENSP00000340467:P733R	ENSP00000340467:P733R	P	+	2	0	LRRC16B	23599983	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.794000	0.75135	2.774000	0.95407	0.561000	0.74099	CCC	.	.		0.582	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
SYNE2	23224	hgsc.bcm.edu	37	14	64653174	64653174	+	Silent	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr14:64653174G>A	ENST00000344113.4	+	97	17801	c.17589G>A	c.(17587-17589)caG>caA	p.Q5863Q	SYNE2_ENST00000357395.3_Silent_p.Q2248Q|SYNE2_ENST00000394768.2_Silent_p.Q2248Q|SYNE2_ENST00000554584.1_Intron|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Silent_p.Q2497Q|SYNE2_ENST00000358025.3_Silent_p.Q5863Q	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5863					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCTGGACTCAGAACTTGAAAG	0.448																																					p.Q5863Q		Atlas-SNP	.											.	SYNE2	577	.	0			c.G17589A						.						205.0	214.0	211.0					14																	64653174		2203	4300	6503	SO:0001819	synonymous_variant	23224	exon97			GACTCAGAACTTG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.17589G>A	chr14.hg19:g.64653174G>A		152.0	0.0		159.0	65.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.448	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
PLEKHH1	57475	hgsc.bcm.edu	37	14	68042127	68042127	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr14:68042127A>C	ENST00000329153.5	+	15	2239	c.2107A>C	c.(2107-2109)Aag>Cag	p.K703Q		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	703	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TGGCCACTCCAAGGTGGTCTG	0.473																																					p.K703Q		Atlas-SNP	.											.	PLEKHH1	118	.	0			c.A2107C						.						69.0	66.0	67.0					14																	68042127		1950	4139	6089	SO:0001583	missense	57475	exon15			CACTCCAAGGTGG	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2107A>C	chr14.hg19:g.68042127A>C	ENSP00000330278:p.Lys703Gln	83.0	0.0		71.0	33.0	NM_020715	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	hg19	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	A	31	5.093100	0.94149	.	.	ENSG00000054690	ENST00000329153	T	0.31769	1.48	5.9	5.9	0.94986	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.60261	0.2255	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.75484	0.983;0.986	T	0.66052	-0.6019	10	0.87932	D	0	.	16.3245	0.82970	1.0:0.0:0.0:0.0	.	218;703	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	Q	703	ENSP00000330278:K703Q	ENSP00000330278:K703Q	K	+	1	0	PLEKHH1	67111880	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.254000	0.74563	0.460000	0.39030	AAG	.	.		0.473	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
SYNDIG1L	646658	hgsc.bcm.edu	37	14	74876360	74876360	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr14:74876360G>C	ENST00000554823.1	-	1	149	c.88C>G	c.(88-90)Ccc>Gcc	p.P30A	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.P30A			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	30					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						GACCAGCTGGGTGGGGTCTCC	0.657																																					p.P30A		Atlas-SNP	.											.	SYNDIG1L	24	.	0			c.C88G						.						36.0	41.0	40.0					14																	74876360		1937	4135	6072	SO:0001583	missense	646658	exon2			AGCTGGGTGGGGT		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.88C>G	chr14.hg19:g.74876360G>C	ENSP00000450439:p.Pro30Ala	115.0	0.0		119.0	60.0	NM_001105579		Missense_Mutation	SNP	ENST00000554823.1	hg19	CCDS41970.1	.	.	.	.	.	.	.	.	.	.	G	9.001	0.980158	0.18812	.	.	ENSG00000183379	ENST00000331628;ENST00000554823;ENST00000554953	D;D	0.95205	-3.64;-3.64	4.44	3.53	0.40419	.	0.142496	0.47852	D	0.000220	D	0.88537	0.6463	N	0.19112	0.55	0.42940	D	0.994345	B	0.17038	0.02	B	0.12156	0.007	D	0.84034	0.0361	10	0.44086	T	0.13	-1.9818	12.0086	0.53274	0.0:0.0:0.8271:0.1729	.	30	A6NDD5	SYN1L_HUMAN	A	30	ENSP00000331474:P30A;ENSP00000450439:P30A	ENSP00000331474:P30A	P	-	1	0	SYNDIG1L	73946113	1.000000	0.71417	0.788000	0.31933	0.190000	0.23558	3.521000	0.53472	1.042000	0.40150	0.467000	0.42956	CCC	.	.		0.657	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412341.1	XM_938515	
NDN	4692	hgsc.bcm.edu	37	15	23932089	23932089	+	Silent	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr15:23932089C>A	ENST00000331837.4	-	1	361	c.276G>T	c.(274-276)ccG>ccT	p.P92P		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	92					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CCGGGGCTGGCGGTGCCGGGC	0.697									Prader-Willi syndrome																												p.P92P		Atlas-SNP	.											.	NDN	79	.	0			c.G276T						.						21.0	22.0	22.0					15																	23932089		2202	4293	6495	SO:0001819	synonymous_variant	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	GGCTGGCGGTGCC	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.276G>T	chr15.hg19:g.23932089C>A		36.0	0.0		35.0	20.0	NM_002487	B2R6Z5	Silent	SNP	ENST00000331837.4	hg19	CCDS10014.1																																																																																			.	.		0.697	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
NUSAP1	51203	hgsc.bcm.edu	37	15	41657598	41657598	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr15:41657598A>T	ENST00000559596.1	+	7	747		c.e7-1		NUSAP1_ENST00000450318.1_Splice_Site|NUSAP1_ENST00000558123.1_Splice_Site|NUSAP1_ENST00000560747.1_Intron|NUSAP1_ENST00000450592.2_Intron|NUSAP1_ENST00000560177.1_Splice_Site|NUSAP1_ENST00000260359.6_Splice_Site|NUSAP1_ENST00000414849.2_Intron			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		TTTTCTCTTCAGCAGCAGCCC	0.498																																					.		Atlas-SNP	.											.	NUSAP1	32	.	0			c.661-2A>T						.						38.0	37.0	37.0					15																	41657598		1904	4130	6034	SO:0001630	splice_region_variant	51203	exon7			CTCTTCAGCAGCA	AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.661-1A>T	chr15.hg19:g.41657598A>T		41.0	0.0		68.0	31.0	NM_016359	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Splice_Site	SNP	ENST00000559596.1	hg19	CCDS45234.1	.	.	.	.	.	.	.	.	.	.	A	9.138	1.013026	0.19277	.	.	ENSG00000137804	ENST00000260359;ENST00000450318	.	.	.	4.53	2.08	0.27032	.	.	.	.	.	.	.	.	.	.	.	0.20563	N	0.999884	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9308	0.13916	0.6168:0.2034:0.0:0.1798	.	.	.	.	.	-1	.	.	.	+	.	.	NUSAP1	39444890	0.990000	0.36364	0.010000	0.14722	0.133000	0.20885	2.723000	0.47277	0.314000	0.23086	0.482000	0.46254	.	.	.		0.498	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419427.1	NM_016359	Intron
RCN2	5955	hgsc.bcm.edu	37	15	77236169	77236169	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr15:77236169A>G	ENST00000394885.3	+	4	741	c.518A>G	c.(517-519)gAa>gGa	p.E173G	RCN2_ENST00000320963.5_Missense_Mutation_p.E191G|RCN2_ENST00000394883.3_Missense_Mutation_p.E72G	NM_002902.2	NP_002893.1	Q14257	RCN2_HUMAN	reticulocalbin 2, EF-hand calcium binding domain	173	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(2)|large_intestine(2)|lung(1)	7						AGTCTTGAAGAATTTATTGCT	0.303																																					p.E191G		Atlas-SNP	.											.	RCN2	16	.	0			c.A572G						.						72.0	74.0	73.0					15																	77236169		2196	4294	6490	SO:0001583	missense	5955	exon5			TTGAAGAATTTAT	X78669	CCDS10291.1, CCDS61719.1	15q22.33-q24.1	2013-01-10			ENSG00000117906	ENSG00000117906		"""EF-hand domain containing"""	9935	protein-coding gene	gene with protein product	"""Reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD)"""	602584				9533013, 7624774	Standard	NM_002902		Approved	ERC-55, E6BP, ERC55, TCBP49	uc002bcd.3	Q14257	OTTHUMG00000143730	ENST00000394885.3:c.518A>G	chr15.hg19:g.77236169A>G	ENSP00000378349:p.Glu173Gly	230.0	0.0		286.0	138.0	NM_001271837	A8MTG6|F8WCY5|Q53XN8	Missense_Mutation	SNP	ENST00000394885.3	hg19	CCDS10291.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.827514	0.90955	.	.	ENSG00000117906	ENST00000394885;ENST00000320963;ENST00000394883	T;T;T	0.70399	-0.48;-0.48;-0.22	6.17	6.17	0.99709	EF-hand-like domain (1);	0.042626	0.85682	N	0.000000	D	0.87958	0.6309	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.994	D	0.90566	0.4519	10	0.87932	D	0	-29.6729	16.0034	0.80327	1.0:0.0:0.0:0.0	.	72;191;173	A8MXP8;F8WCY5;Q14257	.;.;RCN2_HUMAN	G	173;191;72	ENSP00000378349:E173G;ENSP00000319739:E191G;ENSP00000378347:E72G	ENSP00000319739:E191G	E	+	2	0	RCN2	75023224	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.409000	0.80053	2.371000	0.80710	0.533000	0.62120	GAA	.	.		0.303	RCN2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289795.1	NM_002902	
NTRK3	4916	hgsc.bcm.edu	37	15	88476268	88476268	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr15:88476268G>T	ENST00000360948.2	-	15	2025	c.1864C>A	c.(1864-1866)Cat>Aat	p.H622N	NTRK3_ENST00000355254.2_Missense_Mutation_p.H622N|NTRK3_ENST00000557856.1_Missense_Mutation_p.H614N|NTRK3_ENST00000357724.2_Missense_Mutation_p.H614N|NTRK3_ENST00000542733.2_Missense_Mutation_p.H524N|NTRK3_ENST00000558676.1_Missense_Mutation_p.H614N|NTRK3_ENST00000394480.2_Missense_Mutation_p.H622N	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	622	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGGTCTCCATGCTTCATGTAT	0.542			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.H622N		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.C1864A						.						80.0	69.0	73.0					15																	88476268		2201	4299	6500	SO:0001583	missense	4916	exon16			CTCCATGCTTCAT	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1864C>A	chr15.hg19:g.88476268G>T	ENSP00000354207:p.His622Asn	95.0	0.0		78.0	28.0	NM_001012338	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110965	0.77210	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000343782	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32	5.49	5.49	0.81192	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85570	0.5727	N	0.04203	-0.255	0.80722	D	1	B;D;D;D;D	0.63880	0.276;0.993;0.975;0.991;0.975	B;D;D;D;P	0.72982	0.219;0.979;0.934;0.964;0.893	D	0.86052	0.1526	10	0.27082	T	0.32	.	18.3583	0.90365	0.0:0.0:1.0:0.0	.	524;614;614;622;622	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	N	622;622;614;622;524;118	ENSP00000377990:H622N;ENSP00000354207:H622N;ENSP00000350356:H614N;ENSP00000347397:H622N;ENSP00000437773:H524N	ENSP00000342792:H118N	H	-	1	0	NTRK3	86277272	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.623000	0.83113	2.574000	0.86865	0.650000	0.86243	CAT	.	.		0.542	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
CAPN15	6650	hgsc.bcm.edu	37	16	601629	601629	+	Missense_Mutation	SNP	G	G	C	rs534348403	byFrequency	TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr16:601629G>C	ENST00000219611.2	+	9	2673	c.2310G>C	c.(2308-2310)gaG>gaC	p.E770D	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	770	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GCAGCAGTGAGGGTGTCTTCT	0.682																																					p.E770D		Atlas-SNP	.											.	SOLH	47	.	0			c.G2310C						.						43.0	51.0	48.0					16																	601629		2199	4297	6496	SO:0001583	missense	6650	exon9			CAGTGAGGGTGTC	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.2310G>C	chr16.hg19:g.601629G>C	ENSP00000219611:p.Glu770Asp	35.0	0.0		27.0	16.0	NM_005632	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	hg19	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	13.48	2.248500	0.39797	.	.	ENSG00000103326	ENST00000219611	T	0.33216	1.42	5.26	2.2	0.27929	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.08179	0.0204	N	0.00690	-1.25	0.53688	D	0.999974	P	0.43431	0.807	B	0.41946	0.371	T	0.30060	-0.9991	10	0.02654	T	1	.	10.0439	0.42175	0.2178:0.0:0.7822:0.0	.	770	O75808	CAN15_HUMAN	D	770	ENSP00000219611:E770D	ENSP00000219611:E770D	E	+	3	2	SOLH	541630	1.000000	0.71417	0.997000	0.53966	0.503000	0.33858	1.222000	0.32515	0.225000	0.20959	0.556000	0.70494	GAG	.	.		0.682	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
ITGAD	3681	hgsc.bcm.edu	37	16	31422694	31422694	+	Silent	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr16:31422694G>A	ENST00000389202.2	+	14	1612	c.1563G>A	c.(1561-1563)ggG>ggA	p.G521G		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	521					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GCCGCTTTGGGGCAGCCCTGA	0.622																																					p.G521G		Atlas-SNP	.											.	ITGAD	154	.	0			c.G1563A						.						110.0	112.0	111.0					16																	31422694		2197	4300	6497	SO:0001819	synonymous_variant	3681	exon14			CTTTGGGGCAGCC	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1563G>A	chr16.hg19:g.31422694G>A		100.0	0.0		112.0	56.0	NM_005353	Q15575|Q15576	Silent	SNP	ENST00000389202.2	hg19	CCDS32438.1																																																																																			.	.		0.622	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
CNOT1	23019	hgsc.bcm.edu	37	16	58579334	58579334	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr16:58579334C>A	ENST00000317147.5	-	30	4400	c.4068G>T	c.(4066-4068)caG>caT	p.Q1356H	CNOT1_ENST00000245138.4_Missense_Mutation_p.Q207H|CNOT1_ENST00000569240.1_Missense_Mutation_p.Q1351H|CNOT1_ENST00000441024.2_Missense_Mutation_p.Q1356H	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1356	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GGTAGCTGTACTGTGGCTGTG	0.438																																					p.Q1356H		Atlas-SNP	.											.	CNOT1	359	.	0			c.G4068T						.						247.0	196.0	213.0					16																	58579334		2198	4300	6498	SO:0001583	missense	23019	exon30			GCTGTACTGTGGC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4068G>T	chr16.hg19:g.58579334C>A	ENSP00000320949:p.Gln1356His	148.0	0.0		184.0	103.0	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703545	0.48412	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.48836	0.86;0.8	5.71	4.75	0.60458	.	0.051608	0.85682	D	0.000000	T	0.50326	0.1609	L	0.31420	0.93	0.80722	D	1	B;D;B;B	0.71674	0.027;0.998;0.098;0.157	B;P;B;B	0.62560	0.016;0.904;0.013;0.03	T	0.25572	-1.0128	10	0.12766	T	0.61	-8.87	14.9778	0.71289	0.0:0.9306:0.0:0.0694	.	207;1356;1356;1351	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	H	1356;207;1351;1356	ENSP00000320949:Q1356H;ENSP00000413113:Q1356H	ENSP00000245138:Q207H	Q	-	3	2	CNOT1	57136835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.527000	0.45615	2.697000	0.92050	0.655000	0.94253	CAG	.	.		0.438	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
TAT	6898	hgsc.bcm.edu	37	16	71604715	71604715	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr16:71604715T>C	ENST00000355962.4	-	8	912	c.779A>G	c.(778-780)tAt>tGt	p.Y260C	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	260					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	CAGTGGTTCATATTTGCAATC	0.557																																					p.Y260C	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Atlas-SNP	.											.	TAT	80	.	0			c.A779G						.						124.0	103.0	110.0					16																	71604715		2198	4300	6498	SO:0001583	missense	6898	exon8			GGTTCATATTTGC		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.779A>G	chr16.hg19:g.71604715T>C	ENSP00000348234:p.Tyr260Cys	114.0	0.0		115.0	51.0	NM_000353	B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	hg19	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	T	11.39	1.624474	0.28889	.	.	ENSG00000198650	ENST00000355962	D	0.90788	-2.73	5.2	4.1	0.47936	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.325296	0.36703	N	0.002458	D	0.84795	0.5551	L	0.43923	1.385	0.34583	D	0.714688	B	0.10296	0.003	B	0.12156	0.007	T	0.82112	-0.0618	10	0.66056	D	0.02	-7.2444	5.5068	0.16858	0.3891:0.0:0.1267:0.4842	.	260	P17735	ATTY_HUMAN	C	260	ENSP00000348234:Y260C	ENSP00000348234:Y260C	Y	-	2	0	TAT	70162216	0.955000	0.32602	0.975000	0.42487	0.945000	0.59286	0.777000	0.26718	0.809000	0.34255	0.460000	0.39030	TAT	.	.		0.557	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		
HEATR9	256957	hgsc.bcm.edu	37	17	34192249	34192249	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr17:34192249T>A	ENST00000311880.2	-	3	438	c.290A>T	c.(289-291)aAg>aTg	p.K97M	C17orf66_ENST00000587585.1_5'UTR|C17orf66_ENST00000592980.1_Missense_Mutation_p.K97M	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		97					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCTCAACATCTTCTCAGCCTC	0.488																																					p.K97M		Atlas-SNP	.											.	C17orf66	57	.	0			c.A290T						.						253.0	222.0	232.0					17																	34192249		2203	4300	6503	SO:0001583	missense	256957	exon3			AACATCTTCTCAG																												ENST00000311880.2:c.290A>T	chr17.hg19:g.34192249T>A	ENSP00000309560:p.Lys97Met	96.0	0.0		124.0	58.0	NM_152781	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Missense_Mutation	SNP	ENST00000311880.2	hg19	CCDS11299.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065808	0.55539	.	.	ENSG00000172653	ENST00000311880	T	0.54866	0.55	4.82	1.07	0.20283	.	0.394856	0.21663	N	0.070983	T	0.49609	0.1567	L	0.34521	1.04	0.09310	N	1	D;D;D	0.69078	0.997;0.995;0.996	D;P;P	0.63192	0.912;0.847;0.819	T	0.39502	-0.9611	10	0.72032	D	0.01	.	1.3007	0.02078	0.1755:0.1079:0.1822:0.5344	.	63;97;97	A2RTY3-4;A2RTY3-3;A2RTY3	.;.;CQ066_HUMAN	M	97	ENSP00000309560:K97M	ENSP00000309560:K97M	K	-	2	0	C17orf66	31216362	0.042000	0.20092	0.001000	0.08648	0.115000	0.19883	1.193000	0.32162	0.047000	0.15862	0.533000	0.62120	AAG	.	.		0.488	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
KRTAP1-3	81850	hgsc.bcm.edu	37	17	39191019	39191019	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr17:39191019T>C	ENST00000344363.5	-	1	88	c.55A>G	c.(55-57)Aca>Gca	p.T19A		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	19						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GAGCCGCATGTCCCACTGGTG	0.582																																					p.T19A		Atlas-SNP	.											.	KRTAP1-3	18	.	0			c.A55G						.						49.0	56.0	54.0					17																	39191019		1972	4169	6141	SO:0001583	missense	81850	exon1			CGCATGTCCCACT	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.55A>G	chr17.hg19:g.39191019T>C	ENSP00000344420:p.Thr19Ala	99.0	0.0		138.0	99.0	NM_030966	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	hg19	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	T	9.721	1.159792	0.21454	.	.	ENSG00000221880	ENST00000344363	T	0.36157	1.27	4.31	2.04	0.26737	.	.	.	.	.	T	0.25232	0.0613	.	.	.	0.23473	N	0.997605	B	0.20887	0.049	B	0.22152	0.038	T	0.27640	-1.0068	8	0.72032	D	0.01	.	4.1403	0.10189	0.0:0.1075:0.2107:0.6817	.	19	Q8IUG1	KRA13_HUMAN	A	19	ENSP00000344420:T19A	ENSP00000344420:T19A	T	-	1	0	KRTAP1-3	36444545	0.090000	0.21635	0.593000	0.28771	0.495000	0.33615	1.629000	0.37071	0.412000	0.25729	0.460000	0.39030	ACA	.	.		0.582	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
MPP3	4356	hgsc.bcm.edu	37	17	41898313	41898313	+	Silent	SNP	G	G	A	rs377033537		TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr17:41898313G>A	ENST00000398389.4	-	11	963	c.798C>T	c.(796-798)gaC>gaT	p.D266D	MPP3_ENST00000398393.1_Silent_p.D291D	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	266	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		ACGTGGGGTCGTCCTGGCTCA	0.677																																					p.D266D		Atlas-SNP	.											.	MPP3	42	.	0			c.C798T						.						29.0	33.0	31.0					17																	41898313		1985	4144	6129	SO:0001819	synonymous_variant	4356	exon11			GGGGTCGTCCTGG		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.798C>T	chr17.hg19:g.41898313G>A		99.0	0.0		153.0	41.0	NM_001932	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Silent	SNP	ENST00000398389.4	hg19	CCDS42344.1																																																																																			.	.		0.677	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932	
TBC1D16	125058	hgsc.bcm.edu	37	17	77921567	77921567	+	Silent	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr17:77921567G>A	ENST00000310924.2	-	9	1720	c.1605C>T	c.(1603-1605)gaC>gaT	p.D535D	TBC1D16_ENST00000340848.7_Silent_p.D173D|TBC1D16_ENST00000572862.1_Silent_p.D173D|TBC1D16_ENST00000576768.1_Silent_p.D160D|TBC1D16_ENST00000570373.1_Silent_p.D174D	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	535	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GCGCCACCAGGTCCGACATCC	0.607																																					p.D535D	Ovarian(14;397 562 4850 31922 49378)	Atlas-SNP	.											.	TBC1D16	48	.	0			c.C1605T						.						109.0	82.0	91.0					17																	77921567		2203	4300	6503	SO:0001819	synonymous_variant	125058	exon9			CACCAGGTCCGAC	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1605C>T	chr17.hg19:g.77921567G>A		98.0	0.0		126.0	47.0	NM_019020	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Silent	SNP	ENST00000310924.2	hg19	CCDS11766.1																																																																																			.	.		0.607	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020	
ZNF516	9658	hgsc.bcm.edu	37	18	74153982	74153982	+	Silent	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr18:74153982C>A	ENST00000443185.2	-	3	1346	c.1029G>T	c.(1027-1029)ctG>ctT	p.L343L	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GGTTTGTAAACAGGTTCCCGC	0.667																																					p.L343L		Atlas-SNP	.											.	ZNF516	102	.	0			c.G1029T						.						40.0	47.0	45.0					18																	74153982		2153	4261	6414	SO:0001819	synonymous_variant	9658	exon3			TGTAAACAGGTTC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.1029G>T	chr18.hg19:g.74153982C>A		42.0	0.0		48.0	17.0	NM_014643		Silent	SNP	ENST00000443185.2	hg19																																																																																				.	.		0.667	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
ARRDC5	645432	hgsc.bcm.edu	37	19	4896768	4896768	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:4896768A>G	ENST00000381781.2	-	2	415	c.416T>C	c.(415-417)aTg>aCg	p.M139T		NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	139										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		TTCCCTGCCCATGCAGGAAGC	0.468																																					p.M139T		Atlas-SNP	.											.	ARRDC5	19	.	0			c.T416C						.						138.0	129.0	132.0					19																	4896768		1919	4141	6060	SO:0001583	missense	645432	exon2			CTGCCCATGCAGG		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.416T>C	chr19.hg19:g.4896768A>G	ENSP00000371200:p.Met139Thr	167.0	0.0		158.0	77.0	NM_001080523		Missense_Mutation	SNP	ENST00000381781.2	hg19	CCDS45929.1	.	.	.	.	.	.	.	.	.	.	A	8.064	0.768665	0.15983	.	.	ENSG00000205784	ENST00000381781	T	0.16324	2.35	4.37	1.09	0.20402	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.791479	0.11031	N	0.607239	T	0.10981	0.0268	L	0.40543	1.245	0.21105	N	0.99979	B	0.14012	0.009	B	0.12837	0.008	T	0.40289	-0.9571	10	0.15066	T	0.55	-13.1819	3.2263	0.06732	0.5017:0.2152:0.2831:0.0	.	139	A6NEK1	ARRD5_HUMAN	T	139	ENSP00000371200:M139T	ENSP00000371200:M139T	M	-	2	0	ARRDC5	4847768	0.816000	0.29132	0.994000	0.49952	0.846000	0.48090	1.345000	0.33953	0.307000	0.22880	0.472000	0.43445	ATG	.	.		0.468	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450443.1	XM_292803	
ZNF177	7730	hgsc.bcm.edu	37	19	9488995	9488995	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:9488995C>A	ENST00000589262.1	+	2	74	c.8C>A	c.(7-9)gCa>gAa	p.A3E	ZNF177_ENST00000446085.4_Missense_Mutation_p.A3E|ZNF177_ENST00000434737.2_Missense_Mutation_p.A3E|ZNF177_ENST00000590616.1_Missense_Mutation_p.A3E|ZNF177_ENST00000605471.1_3'UTR|ZNF177_ENST00000541595.2_Missense_Mutation_p.A3E|ZNF177_ENST00000343499.4_Missense_Mutation_p.A3E|ZNF177_ENST00000602856.1_Missense_Mutation_p.A3E|ZNF177_ENST00000602738.1_Missense_Mutation_p.A3E	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	3					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						AGAATGGCTGCAGGGTGGCTG	0.507																																					p.A3E		Atlas-SNP	.											.	ZNF177	57	.	0			c.C8A						.						64.0	60.0	62.0					19																	9488995		2203	4300	6503	SO:0001583	missense	7730	exon5			TGGCTGCAGGGTG	U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.8C>A	chr19.hg19:g.9488995C>A	ENSP00000468531:p.Ala3Glu	289.0	0.0		296.0	135.0	NM_003451	B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	ENST00000589262.1	hg19	CCDS54214.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183903	0.38609	.	.	ENSG00000188629	ENST00000541595;ENST00000446085;ENST00000343499;ENST00000434737	T;T;T;T	0.06294	3.45;5.58;3.45;3.32	2.14	2.14	0.27477	.	.	.	.	.	T	0.04724	0.0128	N	0.21545	0.675	0.25721	N	0.985377	P	0.37594	0.601	B	0.39119	0.291	T	0.27157	-1.0082	8	0.22109	T	0.4	.	7.8522	0.29462	0.0:1.0:0.0:0.0	.	3	Q13360	ZN177_HUMAN	E	3	ENSP00000445323:A3E;ENSP00000413568:A3E;ENSP00000341497:A3E;ENSP00000415070:A3E	ENSP00000341497:A3E	A	+	2	0	ZNF177	9349995	0.012000	0.17670	0.618000	0.29105	0.788000	0.44548	0.866000	0.27954	1.518000	0.48934	0.467000	0.42956	GCA	.	.		0.507	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449028.1	NM_003451	
ZNF93	81931	hgsc.bcm.edu	37	19	20044590	20044590	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:20044590A>T	ENST00000343769.5	+	4	854	c.826A>T	c.(826-828)Aag>Tag	p.K276*	AC007204.2_ENST00000592245.1_lincRNA	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						TACTAAACATAAGAAAATTCA	0.353																																					p.K276X		Atlas-SNP	.											.	ZNF93	81	.	0			c.A826T						.						39.0	41.0	41.0					19																	20044590		2203	4298	6501	SO:0001587	stop_gained	81931	exon4			AAACATAAGAAAA	M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.826A>T	chr19.hg19:g.20044590A>T	ENSP00000342002:p.Lys276*	66.0	0.0		76.0	41.0	NM_031218	A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Nonsense_Mutation	SNP	ENST00000343769.5	hg19	CCDS32973.1	.	.	.	.	.	.	.	.	.	.	a	15.78	2.935689	0.52972	.	.	ENSG00000184635	ENST00000343769;ENST00000427325	.	.	.	0.85	-1.7	0.08159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4846	0.11783	0.3838:0.6161:0.0:0.0	.	.	.	.	X	276	.	ENSP00000342002:K276X	K	+	1	0	ZNF93	19905590	0.000000	0.05858	0.053000	0.19242	0.053000	0.15095	-1.142000	0.03203	0.166000	0.19597	0.164000	0.16699	AAG	.	.		0.353	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460808.2	NM_031218	
ZBTB32	27033	hgsc.bcm.edu	37	19	36207625	36207625	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:36207625C>A	ENST00000392197.2	+	7	1753	c.1435C>A	c.(1435-1437)Ccc>Acc	p.P479T	KMT2B_ENST00000222270.7_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.P479T|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000420124.1_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	479					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCGACCTCTCCCTGTTGTCC	0.627											OREG0025433	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P479T		Atlas-SNP	.											.	ZBTB32	33	.	0			c.C1435A						.						97.0	88.0	91.0					19																	36207625		2203	4300	6503	SO:0001583	missense	27033	exon6			ACCTCTCCCTGTT	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.1435C>A	chr19.hg19:g.36207625C>A	ENSP00000376035:p.Pro479Thr	38.0	0.0	861	33.0	13.0	NM_014383	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	hg19	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.364321	0.61513	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.09350	2.99;2.99	4.34	3.26	0.37387	.	0.827279	0.10455	N	0.672671	T	0.07279	0.0184	N	0.19112	0.55	0.09310	N	0.999999	B	0.15719	0.014	B	0.11329	0.006	T	0.39941	-0.9589	10	0.16896	T	0.51	-3.831	9.422	0.38557	0.2125:0.7875:0.0:0.0	.	479	Q9Y2Y4	ZBT32_HUMAN	T	479	ENSP00000262630:P479T;ENSP00000376035:P479T	ENSP00000262630:P479T	P	+	1	0	ZBTB32	40899465	0.008000	0.16893	0.028000	0.17463	0.709000	0.40893	0.578000	0.23773	1.112000	0.41740	0.462000	0.41574	CCC	.	.		0.627	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383	
KMT2B	9757	hgsc.bcm.edu	37	19	36213570	36213570	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:36213570C>G	ENST00000222270.7	+	5	2672	c.2672C>G	c.(2671-2673)cCt>cGt	p.P891R	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.P891R	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	891					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GAAGATGTCCCTCGCCTCAGT	0.652																																					p.P891R		Atlas-SNP	.											.	MLL4	229	.	0			c.C2672G						.						38.0	41.0	40.0					19																	36213570		2041	4182	6223	SO:0001583	missense	8085	exon5			ATGTCCCTCGCCT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2672C>G	chr19.hg19:g.36213570C>G	ENSP00000222270:p.Pro891Arg	81.0	0.0		79.0	41.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323512	0.60634	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.85556	-2.0;-2.0	5.39	5.39	0.77823	.	0.000000	0.40222	N	0.001151	D	0.90861	0.7129	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91262	0.5037	10	0.87932	D	0	.	18.0965	0.89492	0.0:1.0:0.0:0.0	.	891	Q9UMN6	MLL4_HUMAN	R	891	ENSP00000222270:P891R;ENSP00000398837:P891R	ENSP00000222270:P891R	P	+	2	0	AD000671.1	40905410	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.969000	0.76092	2.804000	0.96469	0.655000	0.94253	CCT	.	.		0.652	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
KMT2B	9757	hgsc.bcm.edu	37	19	36219050	36219050	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:36219050C>T	ENST00000222270.7	+	19	4549	c.4549C>T	c.(4549-4551)Cga>Tga	p.R1517*	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Nonsense_Mutation_p.R1517*	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1517					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CAAGTACTGGCGACGGAGTAC	0.637																																					p.R1517X		Atlas-SNP	.											.	MLL4	229	.	0			c.C4549T						.						14.0	15.0	15.0					19																	36219050		2006	4176	6182	SO:0001587	stop_gained	8085	exon19			TACTGGCGACGGA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.4549C>T	chr19.hg19:g.36219050C>T	ENSP00000222270:p.Arg1517*	61.0	0.0		63.0	29.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	43	10.083437	0.99332	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.31	3.01	0.34805	.	0.000000	0.34750	N	0.003713	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	10.3294	0.43814	0.4541:0.5459:0.0:0.0	.	.	.	.	X	1517	.	ENSP00000222270:R1517X	R	+	1	2	AD000671.1	40910890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.896000	0.39789	1.403000	0.46800	0.655000	0.94253	CGA	.	.		0.637	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48204913	48204913	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:48204913C>T	ENST00000396720.3	+	15	4118	c.3924C>T	c.(3922-3924)ctC>ctT	p.L1308L	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1308										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCATCGGGCTCAAGCTCAAGA	0.701																																					p.L1308L		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.C3924T						.						7.0	9.0	8.0					19																	48204913		1892	4035	5927	SO:0001819	synonymous_variant	29998	exon15			CGGGCTCAAGCTC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.3924C>T	chr19.hg19:g.48204913C>T		156.0	0.0		164.0	83.0	NM_015711	A8MW01	Silent	SNP	ENST00000396720.3	hg19	CCDS46134.1																																																																																			.	.		0.701	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
ZNF321P	399669	hgsc.bcm.edu	37	19	53432594	53432594	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:53432594C>T	ENST00000391777.3	-	4	385	c.264G>A	c.(262-264)ggG>ggA	p.G88G	ZNF816-ZNF321P_ENST00000313956.4_RNA|ZNF816_ENST00000549216.1_Silent_p.G19G|ZNF816_ENST00000434371.2_Silent_p.G88G			Q8N8H1	ZN321_HUMAN	zinc finger protein 321, pseudogene	19										endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TTTGCAATGTCCCTGTGTGGA	0.373																																					p.G88G		Atlas-SNP	.											.	.	.	.	0			c.G264A						.						132.0	140.0	137.0					19																	53432594		2202	4300	6502	SO:0001819	synonymous_variant	100529240	exon4			CAATGTCCCTGTG	AK096828		19q13.4	2013-01-08	2011-04-19	2011-04-19	ENSG00000221874	ENSG00000221874			13827	pseudogene	pseudogene			"""zinc finger protein 321"""	ZNF321			Standard	NR_037805		Approved	MGC35402		Q8N8H1	OTTHUMG00000167760	ENST00000391777.3:c.264G>A	chr19.hg19:g.53432594C>T		64.0	0.0		64.0	21.0	NM_001202473	B7ZB38|Q68DZ0|Q86SS5	Silent	SNP	ENST00000391777.3	hg19	CCDS56101.1																																																																																			.	.		0.373	ZNF321P-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000396130.1	NR_037805	
ZNF835	90485	hgsc.bcm.edu	37	19	57175001	57175001	+	Silent	SNP	A	A	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:57175001A>G	ENST00000537055.2	-	2	1797	c.1566T>C	c.(1564-1566)tgT>tgC	p.C522C		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						ACCCCTGTTGACAGGTTTCTC	0.582																																					p.C522C		Atlas-SNP	.											.	ZNF835	106	.	0			c.T1566C						.						62.0	68.0	66.0					19																	57175001		2126	4248	6374	SO:0001819	synonymous_variant	90485	exon2			CTGTTGACAGGTT	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1566T>C	chr19.hg19:g.57175001A>G		109.0	0.0		107.0	40.0	NM_001005850	B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	hg19	CCDS56105.1																																																																																			.	.		0.582	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
CLDN8	9073	hgsc.bcm.edu	37	21	31587841	31587841	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr21:31587841T>G	ENST00000399899.1	-	1	550	c.403A>C	c.(403-405)Atc>Ctc	p.I135L	CLDN8_ENST00000286809.1_Missense_Mutation_p.I135L	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	135					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						CTCACAGGGATGAGCACCACC	0.493																																					p.I135L		Atlas-SNP	.											.	CLDN8	40	.	0			c.A403C						.						93.0	85.0	87.0					21																	31587841		2203	4300	6503	SO:0001583	missense	9073	exon1			CAGGGATGAGCAC	AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.403A>C	chr21.hg19:g.31587841T>G	ENSP00000382783:p.Ile135Leu	67.0	0.0		69.0	31.0	NM_199328	D3DSE3|Q53EX7	Missense_Mutation	SNP	ENST00000399899.1	hg19	CCDS13587.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359075	0.61403	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.89746	-2.56;-2.56	4.84	2.52	0.30459	.	0.000000	0.85682	D	0.000000	D	0.93151	0.7819	M	0.84082	2.675	0.50171	D	0.999857	D	0.57899	0.981	D	0.66716	0.946	D	0.92694	0.6169	10	0.72032	D	0.01	.	9.5194	0.39126	0.0:0.1557:0.0:0.8443	.	135	P56748	CLD8_HUMAN	L	135	ENSP00000382783:I135L;ENSP00000286809:I135L	ENSP00000286809:I135L	I	-	1	0	CLDN8	30509712	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	1.685000	0.37659	0.989000	0.38761	-0.263000	0.10527	ATC	.	.		0.493	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182260.1	NM_199328	
RUNX1	861	hgsc.bcm.edu	37	21	36193995	36193995	+	Intron	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr21:36193995T>A	ENST00000344691.4	-	4	2302				RUNX1_ENST00000399240.1_Intron|RUNX1_ENST00000325074.5_Intron|RUNX1_ENST00000300305.3_Intron|RUNX1_ENST00000358356.5_Splice_Site|RUNX1_ENST00000437180.1_Intron	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1						behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						TGTCTTCCTCTGAGGGAGCCA	0.502			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																.		Atlas-SNP	.		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	.	RUNX1	687	.	0			c.725-2A>T						.						56.0	58.0	57.0					21																	36193995		1568	3578	5146	SO:0001627	intron_variant	861	exon6			TTCCTCTGAGGGA	X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.724+12711A>T	chr21.hg19:g.36193995T>A		128.0	0.0		122.0	55.0	NM_001122607	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Splice_Site	SNP	ENST00000344691.4	hg19	CCDS42922.1	.	.	.	.	.	.	.	.	.	.	T	3.417	-0.119055	0.06838	.	.	ENSG00000159216	ENST00000358356	.	.	.	2.82	-4.11	0.03928	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.3962	0.02261	0.1873:0.3988:0.1757:0.2382	.	.	.	.	.	-1	.	.	.	-	.	.	RUNX1	35115865	0.000000	0.05858	0.000000	0.03702	0.117000	0.20001	-1.373000	0.02568	-1.005000	0.03417	0.528000	0.53228	.	.	.		0.502	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1		
SGSM1	129049	hgsc.bcm.edu	37	22	25251281	25251281	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr22:25251281A>G	ENST00000400359.4	+	7	560	c.553A>G	c.(553-555)Atg>Gtg	p.M185V	SGSM1_ENST00000400358.4_Missense_Mutation_p.M185V	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	185	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GTACACCAAGATGAAGACTGC	0.622																																					p.M185V		Atlas-SNP	.											.	SGSM1	150	.	0			c.A553G						.						29.0	31.0	31.0					22																	25251281		2064	4196	6260	SO:0001583	missense	129049	exon7			ACCAAGATGAAGA	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.553A>G	chr22.hg19:g.25251281A>G	ENSP00000383212:p.Met185Val	61.0	0.0		61.0	26.0	NM_001098497	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	hg19	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177388	0.38413	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.28666	1.6;1.6	4.48	4.48	0.54585	RUN (3);	0.000000	0.85682	D	0.000000	T	0.44787	0.1310	L	0.39566	1.225	0.58432	D	0.999999	P;P;B;D;P	0.60575	0.954;0.843;0.082;0.988;0.508	D;D;B;D;P	0.74348	0.943;0.926;0.219;0.983;0.59	T	0.34700	-0.9818	10	0.48119	T	0.1	-7.259	13.2818	0.60219	1.0:0.0:0.0:0.0	.	185;160;318;185;160	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1;B9A6J4	.;.;.;SGSM1_HUMAN;.	V	160;185;185	ENSP00000383211:M185V;ENSP00000383212:M185V	ENSP00000383211:M185V	M	+	1	0	SGSM1	23581281	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.278000	0.58946	1.792000	0.52537	0.472000	0.43445	ATG	.	.		0.622	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	
PLXNB2	23654	hgsc.bcm.edu	37	22	50719562	50719562	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr22:50719562C>A	ENST00000449103.1	-	23	3859	c.3719G>T	c.(3718-3720)gGc>gTc	p.G1240V	PLXNB2_ENST00000359337.4_Missense_Mutation_p.G1240V|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1240					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTCCTCCAGGCCCTCCAGCTG	0.662																																					p.G1240V		Atlas-SNP	.											.	PLXNB2	172	.	0			c.G3719T						.						31.0	36.0	34.0					22																	50719562		2173	4281	6454	SO:0001583	missense	23654	exon23			TCCAGGCCCTCCA		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3719G>T	chr22.hg19:g.50719562C>A	ENSP00000409171:p.Gly1240Val	56.0	0.0		54.0	26.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	hg19	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206927	0.79127	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.03272	3.99;3.99	4.74	4.74	0.60224	.	0.000000	0.64402	D	0.000010	T	0.14614	0.0353	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.13335	-1.0513	10	0.22109	T	0.4	.	17.6935	0.88275	0.0:1.0:0.0:0.0	.	1240	O15031	PLXB2_HUMAN	V	1240	ENSP00000409171:G1240V;ENSP00000352288:G1240V	ENSP00000352288:G1240V	G	-	2	0	PLXNB2	49061689	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	3.423000	0.52756	2.184000	0.69523	0.462000	0.41574	GGC	.	.		0.662	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
SSX7	280658	hgsc.bcm.edu	37	X	52682011	52682011	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:52682011G>T	ENST00000298181.5	-	3	251	c.93C>A	c.(91-93)taC>taA	p.Y31*		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	31	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.Y31*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					TCTTAGAGAAGTATTTGGCAA	0.393																																					p.Y31X		Atlas-SNP	.											.	SSX7	34	.	1	Substitution - Nonsense(1)	endometrium(1)	c.C93A						.						140.0	116.0	124.0					X																	52682011		2203	4300	6503	SO:0001587	stop_gained	280658	exon3			AGAGAAGTATTTG	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.93C>A	chrX.hg19:g.52682011G>T	ENSP00000298181:p.Tyr31*	695.0	0.0		736.0	340.0	NM_173358		Nonsense_Mutation	SNP	ENST00000298181.5	hg19	CCDS14343.1	.	.	.	.	.	.	.	.	.	.	N	11.27	1.588339	0.28357	.	.	ENSG00000187754	ENST00000298181	.	.	.	0.56	-1.12	0.09808	.	0.000000	0.44285	D	0.000466	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	31	.	ENSP00000298181:Y31X	Y	-	3	2	SSX7	52698736	0.962000	0.33011	0.037000	0.18230	0.010000	0.07245	2.195000	0.42677	-0.516000	0.06470	-1.166000	0.01754	TAC	.	.		0.393	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056671.1	NM_173358	
SMC1A	8243	hgsc.bcm.edu	37	X	53442011	53442011	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:53442011G>A	ENST00000322213.4	-	2	344	c.217C>T	c.(217-219)Cca>Tca	p.P73S	SMC1A_ENST00000375340.6_Missense_Mutation_p.P73S	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	73					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TTGGCAGCTGGCTTGCCCACA	0.567																																					p.P73S		Atlas-SNP	.											.	SMC1A	112	.	0			c.C217T						.						64.0	53.0	57.0					X																	53442011		2203	4300	6503	SO:0001583	missense	8243	exon2			CAGCTGGCTTGCC	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.217C>T	chrX.hg19:g.53442011G>A	ENSP00000323421:p.Pro73Ser	104.0	0.0		117.0	46.0	NM_006306	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	hg19	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175423	0.57692	.	.	ENSG00000072501	ENST00000322213;ENST00000375340;ENST00000340213	T;T	0.66280	-0.2;-0.2	4.67	4.67	0.58626	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.78272	0.4257	M	0.73598	2.24	0.37577	D	0.919666	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.78314	0.99;0.991;0.971	T	0.82851	-0.0253	10	0.52906	T	0.07	.	15.8202	0.78633	0.0:0.0:1.0:0.0	.	73;51;73	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	S	73	ENSP00000323421:P73S;ENSP00000364489:P73S	ENSP00000323421:P73S	P	-	1	0	SMC1A	53458736	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	9.640000	0.98453	2.067000	0.61834	0.600000	0.82982	CCA	.	.		0.567	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
DGAT2L6	347516	hgsc.bcm.edu	37	X	69424178	69424178	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:69424178C>A	ENST00000333026.3	+	6	771	c.671C>A	c.(670-672)tCc>tAc	p.S224Y		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	224					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						CCTTCATATTCCTTTGGTGAG	0.483																																					p.S224Y		Atlas-SNP	.											.	DGAT2L6	40	.	0			c.C671A						.						51.0	42.0	45.0					X																	69424178		2203	4300	6503	SO:0001583	missense	347516	exon6			CATATTCCTTTGG	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.671C>A	chrX.hg19:g.69424178C>A	ENSP00000328036:p.Ser224Tyr	237.0	0.0		243.0	121.0	NM_198512	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	hg19	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016304	0.75161	.	.	ENSG00000184210	ENST00000333026	D	0.93133	-3.17	4.43	4.43	0.53597	.	0.092869	0.46758	D	0.000265	D	0.96078	0.8722	M	0.89968	3.075	0.58432	D	0.999999	P	0.45827	0.867	P	0.53224	0.721	D	0.96852	0.9626	10	0.87932	D	0	-9.1114	13.4557	0.61197	0.0:1.0:0.0:0.0	.	224	Q6ZPD8	DG2L6_HUMAN	Y	224	ENSP00000328036:S224Y	ENSP00000328036:S224Y	S	+	2	0	DGAT2L6	69340903	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	6.908000	0.75730	2.035000	0.60131	0.600000	0.82982	TCC	.	.		0.483	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
CHIC1	53344	hgsc.bcm.edu	37	X	72783364	72783364	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:72783364C>T	ENST00000373502.5	+	1	321	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	MAP2K4P1_ENST00000602584.1_RNA|CHIC1_ENST00000373504.6_Missense_Mutation_p.R82W	NM_001039840.2	NP_001034929.2	Q5VXU3	CHIC1_HUMAN	cysteine-rich hydrophobic domain 1	82						cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(2)	4	Renal(35;0.156)					GGAGCATCTGCGGAGATATGC	0.602																																					p.R82W		Atlas-SNP	.											.	CHIC1	13	.	0			c.C244T						.						25.0	20.0	21.0					X																	72783364		2200	4293	6493	SO:0001583	missense	53344	exon1			CATCTGCGGAGAT	Y11897	CCDS35335.2, CCDS75993.1	Xq13.2	2008-05-14			ENSG00000204116	ENSG00000204116			1934	protein-coding gene	gene with protein product		300922				9321471, 11257495	Standard	NM_001039840		Approved	BRX	uc004ebk.4	Q5VXU3	OTTHUMG00000021835	ENST00000373502.5:c.244C>T	chrX.hg19:g.72783364C>T	ENSP00000362601:p.Arg82Trp	198.0	0.0		210.0	90.0	NM_001039840	A0PJZ2|B0QZ87|B9EGS5|Q5CZ84	Missense_Mutation	SNP	ENST00000373502.5	hg19	CCDS35335.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119836	0.77323	.	.	ENSG00000204116	ENST00000373502;ENST00000373504	.	.	.	4.71	2.86	0.33363	.	0.336090	0.27236	N	0.020288	T	0.42040	0.1185	N	0.08118	0	0.34486	D	0.704467	D;D;D	0.69078	0.997;0.997;0.994	P;P;P	0.59948	0.841;0.866;0.739	T	0.57370	-0.7823	9	0.66056	D	0.02	-8.04	10.8659	0.46856	0.3404:0.6596:0.0:0.0	.	82;82;82	B7Z3I1;Q5VXU3-2;Q5VXU3	.;.;CHIC1_HUMAN	W	82	.	ENSP00000362601:R82W	R	+	1	2	CHIC1	72700089	0.990000	0.36364	1.000000	0.80357	0.962000	0.63368	0.801000	0.27055	0.332000	0.23536	0.292000	0.19580	CGG	.	.		0.602	CHIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057233.3		
ARMCX6	54470	hgsc.bcm.edu	37	X	100871397	100871397	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:100871397C>T	ENST00000361910.4	-	3	558	c.214G>A	c.(214-216)Gat>Aat	p.D72N	ARMCX6_ENST00000538627.1_Missense_Mutation_p.D72N|ARMCX6_ENST00000539247.1_Missense_Mutation_p.D72N|ARMCX6_ENST00000497931.1_Intron	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	72						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						CAATCCCCATCCTCAGTCCAG	0.587																																					p.D72N		Atlas-SNP	.											.	ARMCX6	21	.	0			c.G214A						.						73.0	67.0	69.0					X																	100871397		2203	4300	6503	SO:0001583	missense	54470	exon4			CCCCATCCTCAGT	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.214G>A	chrX.hg19:g.100871397C>T	ENSP00000354708:p.Asp72Asn	91.0	0.0		99.0	42.0	NM_001184768	Q9NWJ3	Missense_Mutation	SNP	ENST00000361910.4	hg19	CCDS14488.1	.	.	.	.	.	.	.	.	.	.	.	11.79	1.745007	0.30865	.	.	ENSG00000198960	ENST00000361910;ENST00000539247;ENST00000538627	T;T;T	0.46063	0.88;0.88;0.88	3.56	2.69	0.31865	.	0.156544	0.30260	N	0.010028	T	0.26774	0.0655	L	0.36672	1.1	0.28202	N	0.927317	B	0.17038	0.02	B	0.12837	0.008	T	0.13495	-1.0507	10	0.18276	T	0.48	-6.4337	6.0133	0.19588	0.0:0.8561:0.0:0.1439	.	72	Q7L4S7	ARMX6_HUMAN	N	72	ENSP00000354708:D72N;ENSP00000444537:D72N;ENSP00000440648:D72N	ENSP00000354708:D72N	D	-	1	0	ARMCX6	100758053	0.988000	0.35896	1.000000	0.80357	0.828000	0.46876	0.242000	0.18087	0.891000	0.36235	0.472000	0.43445	GAT	.	.		0.587	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057562.1	NM_019007	
COL4A5	1287	hgsc.bcm.edu	37	X	107821329	107821329	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:107821329C>T	ENST00000361603.2	+	12	911	c.667C>T	c.(667-669)Cag>Tag	p.Q223*	COL4A5_ENST00000328300.6_Nonsense_Mutation_p.Q223*	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	223	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CTTAAATTTCCAGGGACCCAA	0.363									Alport syndrome with Diffuse Leiomyomatosis																												p.Q223X		Atlas-SNP	.											.	COL4A5	262	.	0			c.C667T						.						37.0	38.0	38.0					X																	107821329		2182	4288	6470	SO:0001587	stop_gained	1287	exon12	Familial Cancer Database		AATTTCCAGGGAC	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.667C>T	chrX.hg19:g.107821329C>T	ENSP00000354505:p.Gln223*	490.0	0.0		548.0	233.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Nonsense_Mutation	SNP	ENST00000361603.2	hg19	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	39	7.488624	0.98316	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	.	.	.	5.0	5.0	0.66597	.	0.074820	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	17.4744	0.87655	0.0:1.0:0.0:0.0	.	.	.	.	X	223	.	ENSP00000331902:Q223X	Q	+	1	0	COL4A5	107707985	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.394000	0.66285	2.051000	0.60960	0.600000	0.82982	CAG	.	.		0.363	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
GUCY2F	2986	hgsc.bcm.edu	37	X	108718938	108718938	+	Silent	SNP	C	C	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:108718938C>T	ENST00000218006.2	-	2	519	c.228G>A	c.(226-228)gcG>gcA	p.A76A		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	76					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TGGCTAATCGCGCAGCAACCT	0.532											OREG0019905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A76A		Atlas-SNP	.											.	GUCY2F	178	.	0			c.G228A						.						80.0	75.0	76.0					X																	108718938		2203	4300	6503	SO:0001819	synonymous_variant	2986	exon2			TAATCGCGCAGCA	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.228G>A	chrX.hg19:g.108718938C>T		420.0	0.0	1414	392.0	181.0	NM_001522	Q9UJF1	Silent	SNP	ENST00000218006.2	hg19	CCDS14545.1																																																																																			.	.		0.532	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
TENM1	10178	hgsc.bcm.edu	37	X	123870898	123870898	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:123870898G>T	ENST00000371130.3	-	4	748	c.685C>A	c.(685-687)Cca>Aca	p.P229T	TENM1_ENST00000422452.2_Missense_Mutation_p.P229T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	229	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGAGCAGCTGGGCTGGGCTGG	0.602																																					p.P229T		Atlas-SNP	.											.	.	.	.	0			c.C685A						.						126.0	119.0	121.0					X																	123870898		2203	4300	6503	SO:0001583	missense	10178	exon4			CAGCTGGGCTGGG	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.685C>A	chrX.hg19:g.123870898G>T	ENSP00000360171:p.Pro229Thr	79.0	0.0		89.0	45.0	NM_001163278	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	hg19	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021729	0.75275	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.50548	0.74;0.74	5.13	5.13	0.70059	Teneurin intracellular, N-terminal (2);	0.191381	0.36268	N	0.002686	T	0.47116	0.1428	L	0.29908	0.895	0.53005	D	0.999969	P;P;B	0.47841	0.901;0.901;0.028	B;P;B	0.47864	0.419;0.559;0.038	T	0.52373	-0.8584	10	0.72032	D	0.01	.	17.6714	0.88218	0.0:0.0:1.0:0.0	.	229;229;229	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	229	ENSP00000360171:P229T;ENSP00000403954:P229T	ENSP00000360171:P229T	P	-	1	0	ODZ1	123698579	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.230000	0.95299	2.102000	0.63906	0.600000	0.82982	CCA	.	.		0.602	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
RAB39B	116442	hgsc.bcm.edu	37	X	154490389	154490389	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrX:154490389T>A	ENST00000369454.3	-	2	641	c.341A>T	c.(340-342)tAc>tTc	p.Y114F		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	114					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TACAATTTGGTAGGGCTGAAC	0.493																																					p.Y114F		Atlas-SNP	.											.	RAB39B	37	.	0			c.A341T						.						177.0	163.0	167.0					X																	154490389		2203	4300	6503	SO:0001583	missense	116442	exon2			ATTTGGTAGGGCT	AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.341A>T	chrX.hg19:g.154490389T>A	ENSP00000358466:p.Tyr114Phe	64.0	0.0		68.0	36.0	NM_171998	Q5JT79|Q8NEX3	Missense_Mutation	SNP	ENST00000369454.3	hg19	CCDS14766.1	.	.	.	.	.	.	.	.	.	.	T	7.684	0.689541	0.14973	.	.	ENSG00000155961	ENST00000369454	T	0.76578	-1.03	4.77	4.77	0.60923	Small GTP-binding protein domain (1);	0.063404	0.64402	D	0.000005	T	0.62490	0.2432	N	0.20574	0.59	0.38924	D	0.957807	B	0.02656	0.0	B	0.04013	0.001	T	0.59337	-0.7473	10	0.24483	T	0.36	.	11.6344	0.51196	0.0:0.0:0.0:1.0	.	114	Q96DA2	RB39B_HUMAN	F	114	ENSP00000358466:Y114F	ENSP00000358466:Y114F	Y	-	2	0	RAB39B	154143583	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	3.992000	0.56980	1.824000	0.53156	0.417000	0.27973	TAC	.	.		0.493	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058792.1	NM_171998	
MT-CO3	4514	hgsc.bcm.edu	37	M	9295	9295	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrM:9295G>A	ENST00000362079.2	+	1	89	c.89G>A	c.(88-90)gGc>gAc	p.G30D	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	30					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AATGACCTCCGGCCTAGCCAT	0.498																																					p.G30D		Atlas-SNP	.											.	.	.	.	0			c.G89A						.																																			SO:0001583	missense	5742	exon1			CCTCCGGCCTAGC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.89G>A	chrM.hg19:g.9295G>A	ENSP00000354982:p.Gly30Asp	5.0	0.0		19.0	5.0	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.498	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
MT-ND4	4538	hgsc.bcm.edu	37	M	10911	10911	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chrM:10911G>A	ENST00000361381.2	+	1	152	c.152G>A	c.(151-153)aGc>aAc	p.S51N	MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	51					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CAACCTATTTAGCTGTTCCCC	0.438																																					p.S51N		Atlas-SNP	.											.	.	.	.	0			c.G152A						.																																			SO:0001583	missense	0	exon1			TATTTAGCTGTTC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.152G>A	chrM.hg19:g.10911G>A	ENSP00000354961:p.Ser51Asn	7.0	0.0		15.0	15.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.438	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
CMAHP	8418	hgsc.bcm.edu	37	6	25108883	25108883	+	RNA	DEL	C	C	-			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr6:25108883delC	ENST00000377989.4	-	0	1313							Q9Y471	CMAH_HUMAN	cytidine monophospho-N-acetylneuraminic acid hydroxylase, pseudogene						CMP-N-acetylneuraminate metabolic process (GO:0046381)	cytoplasm (GO:0005737)	2 iron, 2 sulfur cluster binding (GO:0051537)|oxidoreductase activity (GO:0016491)			NS(1)	1						GAGCAACCTTCATAGGCAGCC	0.403																																					.		Atlas-INDEL	.											.	CMAHP	6	.	0			.						.																																					8418	.			.			6p23-p22	2011-04-28	2011-04-28	2011-04-28	ENSG00000168405	ENSG00000168405			2098	pseudogene	pseudogene		603209	"""cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase)(pseudogene)"""	CMAH		7608218, 9624188	Standard	NR_002174		Approved		uc003ner.4	Q9Y471	OTTHUMG00000016099		chr6.hg19:g.25108883delC		92.0	0.0		92.0	45.0	.	O95250|Q5TD41|Q5TD42|Q5TD43|Q5TD44|Q68DC3|Q9UEE7	RNA	DEL	ENST00000377989.4	hg19																																																																																				.	.		0.403	CMAHP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000043292.2	NR_002174	
SMIM20	389203	hgsc.bcm.edu	37	4	25930802	25930802	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr4:25930802delG	ENST00000514384.1	+	2	141	c.136delG	c.(136-138)ggcfs	p.G46fs	SMIM20_ENST00000515764.2_3'UTR|SMIM20_ENST00000506197.2_Frame_Shift_Del_p.G65fs			Q8N5G0	SMI20_HUMAN	small integral membrane protein 20	166						integral component of membrane (GO:0016021)											TGATCCATTTGGCAGGAAATG	0.428																																					p.F64fs		Atlas-INDEL	.											.	.	.	.	0			c.192delT						.						282.0	239.0	252.0					4																	25930802		692	1591	2283	SO:0001589	frameshift_variant	0	exon3			.		CCDS47038.1	4p15.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000250317	ENSG00000250317			37260	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 52"""	C4orf52			Standard	NM_001145432		Approved		uc003grw.4	Q8N5G0	OTTHUMG00000160330	ENST00000514384.1:c.136delG	chr4.hg19:g.25930802delG	ENSP00000429820:p.Gly46fs	68.0	0.0		122.0	49.0	NM_001145432	C9JYT8|Q9BRT5	Frame_Shift_Del	DEL	ENST00000514384.1	hg19																																																																																				.	.		0.428	SMIM20-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000360257.2	NM_001145432	
RCOR3	55758	hgsc.bcm.edu	37	1	211486101	211486105	+	Frame_Shift_Del	DEL	ATGTA	ATGTA	-			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	ATGTA	ATGTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:211486101_211486105delATGTA	ENST00000367005.4	+	10	1082_1086	c.941_945delATGTA	c.(940-945)gatgtafs	p.DV314fs	RCOR3_ENST00000526255.1_3'UTR|RCOR3_ENST00000419091.2_Frame_Shift_Del_p.DV372fs|RCOR3_ENST00000367006.4_Intron|RCOR3_ENST00000452621.2_Frame_Shift_Del_p.DV372fs	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	314	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		GCTATTGCAGATGTAATTGGCAACA	0.415																																					p.372_373del		Atlas-INDEL	.											.	RCOR3	51	.	0			c.1114_1118del						.																																			SO:0001589	frameshift_variant	55758	exon11			.	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.941_945delATGTA	chr1.hg19:g.211486101_211486105delATGTA	ENSP00000355972:p.Asp314fs	154.0	0.0		252.0	77.0	NM_001136225	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Frame_Shift_Del	DEL	ENST00000367005.4	hg19	CCDS31016.1																																																																																			.	.		0.415	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
MYO9B	4650	hgsc.bcm.edu	37	19	17298768	17298768	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:17298768delC	ENST00000594824.1	+	19	2749	c.2602delC	c.(2602-2604)ctgfs	p.L868fs	MYO9B_ENST00000397274.2_Frame_Shift_Del_p.L868fs|MYO9B_ENST00000595618.1_Frame_Shift_Del_p.L868fs			Q13459	MYO9B_HUMAN	myosin IXB	868	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TGACGACGAGCTGGTCCTGCA	0.597																																					p.E867fs		Atlas-INDEL	.											.	MYO9B	264	.	0			c.2601delG						.						40.0	39.0	39.0					19																	17298768		2199	4296	6495	SO:0001589	frameshift_variant	4650	exon19			.		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2602delC	chr19.hg19:g.17298768delC	ENSP00000471367:p.Leu868fs	48.0	0.0		54.0	34.0	NM_004145	O75314|Q9NUJ2|Q9UHN0	Frame_Shift_Del	DEL	ENST00000594824.1	hg19																																																																																				.	.		0.597	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
KRT2	3849	hgsc.bcm.edu	37	12	53045637	53045638	+	In_Frame_Ins	INS	-	-	CAAAGCCGCTGCCGCCTC			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr12:53045637_53045638insCAAAGCCGCTGCCGCCTC	ENST00000309680.3	-	1	310_311	c.289_290insGAGGCGGCAGCGGCTTTG	c.(289-291)gga>gGAGGCGGCAGCGGCTTTGga	p.97_97G>GGGSGFG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	97	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		gctgccgcctccaaaaccacct	0.619																																					p.G97delinsGGGSGFG		Atlas-INDEL	.											.,2	KRT2	94	.	0			c.290_291insGAGGCGGCAGCGGCTTTG						.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.289_290insGAGGCGGCAGCGGCTTTG	chr12.hg19:g.53045637_53045638insCAAAGCCGCTGCCGCCTC	Exception_encountered	153.0	0.0		156.0	71.0	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.		0.619	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
ZNF506	440515	hgsc.bcm.edu	37	19	19905517	19905544	+	Frame_Shift_Del	DEL	TCCAGTATGAATTATCTTATGTTCAGTT	TCCAGTATGAATTATCTTATGTTCAGTT	-	rs368740670		TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	TCCAGTATGAATTATCTTATGTTCAGTT	TCCAGTATGAATTATCTTATGTTCAGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr19:19905517_19905544delTCCAGTATGAATTATCTTATGTTCAGTT	ENST00000540806.2	-	4	1240_1267	c.1152_1179delAACTGAACATAAGATAATTCATACTGGA	c.(1150-1179)ctaactgaacataagataattcatactggafs	p.LTEHKIIHTG384fs	CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA|ZNF506_ENST00000443905.2_Frame_Shift_Del_p.LTEHKIIHTG384fs|ZNF506_ENST00000450683.2_Frame_Shift_Del_p.LTEHKIIHTG352fs|ZNF506_ENST00000587461.1_Intron|CTC-559E9.6_ENST00000589657.1_RNA			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						ACGGTTTCTCTCCAGTATGAATTATCTTATGTTCAGTTAGAGTTGAGA	0.39																																					p.385_394del		Atlas-INDEL	.											.	ZNF506	36	.	0			c.1153_1180del						.																																			SO:0001589	frameshift_variant	440515	exon4			.	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.1152_1179delAACTGAACATAAGATAATTCATACTGGA	chr19.hg19:g.19905517_19905544delTCCAGTATGAATTATCTTATGTTCAGTT	ENSP00000440625:p.Leu384fs	60.0	0.0		48.0	16.0	NM_001099269	B3KTH6	Frame_Shift_Del	DEL	ENST00000540806.2	hg19	CCDS42531.1																																																																																			.	.		0.390	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218	
ESPN	83715	hgsc.bcm.edu	37	1	6505818	6505819	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AAD0-01A-11D-A40R-10	TCGA-DD-AAD0-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4463ea73-26d1-4e24-a97d-0302bb2dd21b	15b4a966-4206-4903-8558-da5d6cb55540	g.chr1:6505818_6505819insC	ENST00000377828.1	+	7	1455_1456	c.1287_1288insC	c.(1288-1290)cccfs	p.P430fs	RP1-202O8.2_ENST00000419034.1_RNA|ESPN_ENST00000461727.1_5'Flank	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	430	Pro-rich.				locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GGAAGcccacacccccaccacc	0.688																																					p.T429fs		Atlas-INDEL	.											.	ESPN	32	.	0			c.1287_1288insC						.																																			SO:0001589	frameshift_variant	83715	exon7			.	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1292dupC	chr1.hg19:g.6505823_6505823dupC	ENSP00000367059:p.Pro430fs	65.0	0.0		61.0	10.0	NM_031475	Q6XYB2|Q9H0A2|Q9Y329	Frame_Shift_Ins	INS	ENST00000377828.1	hg19	CCDS70.1																																																																																			.	.		0.688	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
