#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CASP9	842	hgsc.bcm.edu	37	1	15821795	15821795	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:15821795T>C	ENST00000333868.5	-	7	1115	c.1021A>G	c.(1021-1023)Atc>Gtc	p.I341V	CASP9_ENST00000348549.5_Missense_Mutation_p.I191V|CASP9_ENST00000546424.1_Missense_Mutation_p.I341V|CASP9_ENST00000375890.4_Missense_Mutation_p.I258V	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	341					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		GACACAAAGATGTCACTGGGT	0.587																																					p.I341V		Atlas-SNP	.											.	CASP9	40	.	0			c.A1021G						.						102.0	73.0	83.0					1																	15821795		2203	4300	6503	SO:0001583	missense	842	exon7			CAAAGATGTCACT	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.1021A>G	chr1.hg19:g.15821795T>C	ENSP00000330237:p.Ile341Val	217.0	0.0		148.0	6.0	NM_001229	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	ENST00000333868.5	hg19	CCDS158.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.692149	0.88735	.	.	ENSG00000132906	ENST00000546424;ENST00000333868;ENST00000348549;ENST00000375890;ENST00000447522	T;T;T;T;T	0.03065	4.06;4.06;4.06;4.06;4.06	5.36	5.36	0.76844	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.000000	0.85682	D	0.000000	T	0.15652	0.0377	M	0.69358	2.11	0.54753	D	0.999985	P;D;D	0.71674	0.93;0.998;0.981	D;D;D	0.76575	0.915;0.988;0.953	T	0.00149	-1.1987	10	0.62326	D	0.03	.	13.3131	0.60390	0.0:0.0:0.0:1.0	.	191;341;341	P55211-2;P55211;F8VVS7	.;CASP9_HUMAN;.	V	341;341;191;258;258	ENSP00000449584:I341V;ENSP00000330237:I341V;ENSP00000255256:I191V;ENSP00000365051:I258V;ENSP00000396540:I258V	ENSP00000330237:I341V	I	-	1	0	CASP9	15694382	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.976000	0.76135	2.037000	0.60232	0.459000	0.35465	ATC	.	.		0.587	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996	
TMEM54	113452	hgsc.bcm.edu	37	1	33361532	33361532	+	Silent	SNP	G	G	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:33361532G>T	ENST00000373463.3	-	3	368	c.249C>A	c.(247-249)cgC>cgA	p.R83R	TMEM54_ENST00000475208.1_Intron|TMEM54_ENST00000329151.5_Intron	NM_033504.2	NP_277039.1	Q969K7	TMM54_HUMAN	transmembrane protein 54	83						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TAGGGAGGTAGCGTGACAACA	0.642																																					p.R83R		Atlas-SNP	.											.	TMEM54	12	.	0			c.C249A						.						68.0	58.0	61.0					1																	33361532		2203	4300	6503	SO:0001819	synonymous_variant	113452	exon3			GAGGTAGCGTGAC		CCDS371.1	1p35-p34	2008-02-05			ENSG00000121900	ENSG00000121900			24143	protein-coding gene	gene with protein product						9500206	Standard	NM_033504		Approved	CAC-1	uc001bwi.1	Q969K7	OTTHUMG00000004016	ENST00000373463.3:c.249C>A	chr1.hg19:g.33361532G>T		86.0	0.0		85.0	6.0	NM_033504	Q6UV18|Q8IVD0|Q9UM12	Silent	SNP	ENST00000373463.3	hg19	CCDS371.1																																																																																			.	.		0.642	TMEM54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011474.1	NM_033504	
MAP7D1	55700	hgsc.bcm.edu	37	1	36643703	36643703	+	Missense_Mutation	SNP	A	A	G	rs3045695|rs141305015|rs200892098	byFrequency	TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:36643703A>G	ENST00000373151.2	+	9	1825	c.1609A>G	c.(1609-1611)Aag>Gag	p.K537E	MAP7D1_ENST00000373150.4_Missense_Mutation_p.K505E|MAP7D1_ENST00000373148.4_Missense_Mutation_p.K83E|MAP7D1_ENST00000316156.4_Missense_Mutation_p.K500E	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	537	Pro-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CAGTAACGAGAAGGAGTCAGC	0.721																																					p.K537E		Atlas-SNP	.											.,2	MAP7D1	62	.	0			c.A1609G						.						29.0	29.0	29.0					1																	36643703		2192	4270	6462	SO:0001583	missense	55700	exon9			AACGAGAAGGAGT	AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.1609A>G	chr1.hg19:g.36643703A>G	ENSP00000362244:p.Lys537Glu	2.0	0.0		26.0	25.0	NM_018067	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	ENST00000373151.2	hg19	CCDS30673.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.555|6.555	0.470598|0.470598	0.12461|0.12461	.|.	.|.	ENSG00000116871|ENSG00000116871	ENST00000530975|ENST00000316156;ENST00000373150;ENST00000373151;ENST00000373148	T|T;T;T;T	0.57752|0.49720	0.38|0.77;0.77;0.77;0.77	5.03|5.03	2.66|2.66	0.31614|0.31614	.|.	.|0.493263	.|0.17209	.|N	.|0.182837	T|T	0.36358|0.36358	0.0964|0.0964	L|L	0.50333|0.50333	1.59|1.59	0.31867|0.31867	N|N	0.620209|0.620209	.|B;B;B;B;B	.|0.12013	.|0.001;0.001;0.005;0.002;0.001	.|B;B;B;B;B	.|0.08055	.|0.003;0.001;0.003;0.003;0.001	T|T	0.34875|0.34875	-0.9811|-0.9811	7|10	0.62326|0.19147	D|T	0.03|0.46	-11.1212|-11.1212	7.538|7.538	0.27721|0.27721	0.8218:0.0:0.1782:0.0|0.8218:0.0:0.1782:0.0	.|.	.|83;537;500;505;537	.|Q3KQU3-3;D3DPS3;Q3KQU3-2;Q3KQU3-4;Q3KQU3	.|.;.;.;.;MA7D1_HUMAN	G|E	119|500;505;537;83	ENSP00000437046:E119G|ENSP00000320228:K500E;ENSP00000362243:K505E;ENSP00000362244:K537E;ENSP00000362241:K83E	ENSP00000437046:E119G|ENSP00000320228:K500E	E|K	+|+	2|1	0|0	MAP7D1|MAP7D1	36416290|36416290	0.997000|0.997000	0.39634|0.39634	0.990000|0.990000	0.47175|0.47175	0.119000|0.119000	0.20118|0.20118	1.102000|1.102000	0.31050|0.31050	0.951000|0.951000	0.37770|0.37770	0.528000|0.528000	0.53228|0.53228	GAA|AAG	.	.		0.721	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067	
B4GALT2	8704	hgsc.bcm.edu	37	1	44456052	44456052	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:44456052C>T	ENST00000356836.6	+	7	1841	c.1051C>T	c.(1051-1053)Cgg>Tgg	p.R351W	B4GALT2_ENST00000372324.1_Missense_Mutation_p.R351W|B4GALT2_ENST00000309519.7_Missense_Mutation_p.R380W|CCDC24_ENST00000372318.3_5'Flank|B4GALT2_ENST00000434555.2_Missense_Mutation_p.R285W	NM_001005417.2|NM_030587.2	NP_001005417.1|NP_085076.2	O60909	B4GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2	351					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			N-Acetyl-D-glucosamine(DB00141)	GGAGGTGTCTCGGCAACCACT	0.557																																					p.R380W		Atlas-SNP	.											.	B4GALT2	35	.	0			c.C1138T						.						177.0	179.0	178.0					1																	44456052		2203	4300	6503	SO:0001583	missense	8704	exon7			GTGTCTCGGCAAC	AF038660	CCDS506.1, CCDS55596.1	1p34-p33	2013-02-19			ENSG00000117411	ENSG00000117411		"""Beta 4-glycosyltransferases"""	925	protein-coding gene	gene with protein product		604013				9405390, 9597550	Standard	NM_003780		Approved	beta4Gal-T2	uc010okl.2	O60909	OTTHUMG00000008296	ENST00000356836.6:c.1051C>T	chr1.hg19:g.44456052C>T	ENSP00000349293:p.Arg351Trp	150.0	0.0		133.0	20.0	NM_030587	B3KTP0|B4DE14|D3DPY6|D3DPY7|O60511|Q4V9L9|Q5T4X5|Q5T4Y5|Q9BUP6|Q9NSY7	Missense_Mutation	SNP	ENST00000356836.6	hg19	CCDS506.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.879174	0.72294	.	.	ENSG00000117411	ENST00000372324;ENST00000434555;ENST00000356836;ENST00000309519	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.3	2.21	0.28008	.	0.130705	0.48767	D	0.000176	T	0.49167	0.1541	L	0.58101	1.795	0.42593	D	0.993258	B;D;D	0.89917	0.042;1.0;0.999	B;D;P	0.71184	0.003;0.972;0.878	T	0.41305	-0.9516	10	0.40728	T	0.16	-7.7526	8.6777	0.34189	0.3718:0.5587:0.0:0.0695	.	380;285;351	B4DE14;O60909-2;O60909	.;.;B4GT2_HUMAN	W	351;285;351;380	ENSP00000361399:R351W;ENSP00000407468:R285W;ENSP00000349293:R351W;ENSP00000310696:R380W	ENSP00000310696:R380W	R	+	1	2	B4GALT2	44228639	0.984000	0.35163	1.000000	0.80357	0.960000	0.62799	1.569000	0.36428	0.720000	0.32209	0.543000	0.68304	CGG	.	.		0.557	B4GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022840.1	NM_003780	
CYP4A22	284541	hgsc.bcm.edu	37	1	47611805	47611805	+	Silent	SNP	G	G	T	rs140647389		TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:47611805G>T	ENST00000371891.3	+	11	1375	c.1344G>T	c.(1342-1344)ctG>ctT	p.L448L	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000371890.3_Silent_p.L350L|CYP4A22_ENST00000294337.3_Silent_p.L448L|CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	448						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACGCTTTCCTGCCCTTCTCAG	0.527																																					p.L448L	Pancreas(88;1240 1470 2099 14214 37557)	Atlas-SNP	.											.	CYP4A22	60	.	0			c.G1344T						.						270.0	262.0	265.0					1																	47611805		2203	4298	6501	SO:0001819	synonymous_variant	284541	exon11			TTTCCTGCCCTTC		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1344G>T	chr1.hg19:g.47611805G>T		292.0	0.0		198.0	53.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Silent	SNP	ENST00000371891.3	hg19	CCDS30707.1																																																																																			.	G|1.000;A|0.000		0.527	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
BARHL2	343472	hgsc.bcm.edu	37	1	91180225	91180225	+	Silent	SNP	A	A	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:91180225A>T	ENST00000370445.4	-	2	755	c.714T>A	c.(712-714)gcT>gcA	p.A238A		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	238					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		GGTCGGAAAAAGCTGTCCTTG	0.552																																					p.A238A	GBM(199;3561 4100 22440)	Atlas-SNP	.											.	BARHL2	62	.	0			c.T714A						.						190.0	180.0	183.0					1																	91180225		2203	4300	6503	SO:0001819	synonymous_variant	343472	exon2			GGAAAAAGCTGTC	AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.714T>A	chr1.hg19:g.91180225A>T		135.0	0.0		141.0	9.0	NM_020063	A0AVP2|Q7Z4N7	Silent	SNP	ENST00000370445.4	hg19	CCDS730.1																																																																																			.	.		0.552	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2		
NBPF6	653149	hgsc.bcm.edu	37	1	109010228	109010228	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:109010228C>T	ENST00000444143.2	+	14	2034	c.1816C>T	c.(1816-1818)Ccg>Tcg	p.P606S	NBPF6_ENST00000495380.2_Missense_Mutation_p.P606S|NBPF6_ENST00000294652.8_3'UTR|NBPF6_ENST00000370040.3_Missense_Mutation_p.P635S			Q5VWK0	NBPF6_HUMAN	neuroblastoma breakpoint family, member 6	606						cytoplasm (GO:0005737)				endometrium(2)	2						AAGAAGACTCCCGTTCAGCAA	0.517																																					p.P635S		Atlas-SNP	.											.	NBPF6	4	.	0			c.C1903T						.						11.0	25.0	21.0					1																	109010228		655	1521	2176	SO:0001583	missense	653149	exon15			AGACTCCCGTTCA		CCDS44184.1	1p13.3	2013-01-17				ENSG00000186086		"""neuroblastoma breakpoint family"""	31988	protein-coding gene	gene with protein product		613996				16079250	Standard	NM_001143987		Approved		uc009wep.3	Q5VWK0	OTTHUMG00000039830	ENST00000444143.2:c.1816C>T	chr1.hg19:g.109010228C>T	ENSP00000402703:p.Pro606Ser	1128.0	0.0		944.0	163.0	NM_001143987	A4QN25	Missense_Mutation	SNP	ENST00000444143.2	hg19	CCDS44184.1	.	.	.	.	.	.	.	.	.	.	c	3.600	-0.081833	0.07141	.	.	ENSG00000186086	ENST00000444143;ENST00000370040;ENST00000495380	T;T;T	0.02369	4.34;4.32;4.34	1.06	0.0977	0.14495	.	.	.	.	.	T	0.00754	0.0025	L	0.36672	1.1	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.46373	-0.9196	9	0.33940	T	0.23	.	3.4561	0.07516	0.0:0.717:0.0:0.283	.	606;635	Q5VWK0;E9PDL3	NBPF6_HUMAN;.	S	606;635;606	ENSP00000402703:P606S;ENSP00000359057:P635S;ENSP00000417277:P606S	ENSP00000359057:P635S	P	+	1	0	NBPF6	108811751	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.218000	0.02976	0.032000	0.15435	0.281000	0.19383	CCG	.	.		0.517	NBPF6-203	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276886.3	XM_926213	
LCE5A	254910	hgsc.bcm.edu	37	1	152484138	152484138	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:152484138C>T	ENST00000334269.2	+	2	304	c.128C>T	c.(127-129)cCa>cTa	p.P43L	CRCT1_ENST00000368790.3_5'Flank	NM_178438.4	NP_848525.1	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	43	Cys-rich.				keratinization (GO:0031424)					lung(3)|ovary(1)|prostate(3)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTTCAGCCCCATGCCCACCT	0.622																																					p.P43L		Atlas-SNP	.											.	LCE5A	15	.	0			c.C128T						.						90.0	85.0	87.0					1																	152484138		2203	4300	6503	SO:0001583	missense	254910	exon2			CAGCCCCATGCCC	BI670518	CCDS1011.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000186207	ENSG00000186207		"""Late cornified envelopes"""	16614	protein-coding gene	gene with protein product		612619	"""small proline rich-like (epidermal differentiation complex) 5A"""	SPRL5A		11698679	Standard	NM_178438		Approved	LEP18	uc001ezy.3	Q5TCM9	OTTHUMG00000014401	ENST00000334269.2:c.128C>T	chr1.hg19:g.152484138C>T	ENSP00000333952:p.Pro43Leu	194.0	0.0		220.0	9.0	NM_178438		Missense_Mutation	SNP	ENST00000334269.2	hg19	CCDS1011.1	.	.	.	.	.	.	.	.	.	.	C	6.492	0.459010	0.12342	.	.	ENSG00000186207	ENST00000334269	T	0.03607	3.87	4.08	1.54	0.23209	.	.	.	.	.	T	0.01061	0.0035	L	0.43152	1.355	0.09310	N	1	B	0.21225	0.053	B	0.17098	0.017	T	0.47497	-0.9113	9	0.38643	T	0.18	.	3.6105	0.08058	0.0:0.5651:0.2316:0.2033	.	43	Q5TCM9	LCE5A_HUMAN	L	43	ENSP00000333952:P43L	ENSP00000333952:P43L	P	+	2	0	LCE5A	150750762	0.011000	0.17503	0.001000	0.08648	0.805000	0.45488	0.815000	0.27253	0.087000	0.17167	0.505000	0.49811	CCA	.	.		0.622	LCE5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040059.1	NM_178438	
GON4L	54856	hgsc.bcm.edu	37	1	155823539	155823539	+	Silent	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:155823539C>A	ENST00000368331.1	-	2	81	c.33G>T	c.(31-33)gtG>gtT	p.V11V	GON4L_ENST00000271883.5_Silent_p.V11V|GON4L_ENST00000437809.1_Silent_p.V11V|GON4L_ENST00000361040.5_Silent_p.V11V|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	11					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGGACTCTGTCACTGTAGTTC	0.383																																					p.V11V		Atlas-SNP	.											.	GON4L	392	.	0			c.G33T						.						97.0	89.0	92.0					1																	155823539		2203	4300	6503	SO:0001819	synonymous_variant	54856	exon2			CTCTGTCACTGTA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.33G>T	chr1.hg19:g.155823539C>A		132.0	0.0		120.0	55.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	hg19																																																																																				.	.		0.383	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
FAM163A	148753	hgsc.bcm.edu	37	1	179783118	179783118	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:179783118C>A	ENST00000341785.4	+	5	694	c.298C>A	c.(298-300)Cca>Aca	p.P100T	RP11-12M5.3_ENST00000453051.1_RNA|RP11-12M5.3_ENST00000415218.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	100						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						TACCTGCTCCCCATACAGCTC	0.652																																					p.P100T		Atlas-SNP	.											.	FAM163A	24	.	0			c.C298A						.						51.0	47.0	48.0					1																	179783118		2203	4300	6503	SO:0001583	missense	148753	exon5			TGCTCCCCATACA	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.298C>A	chr1.hg19:g.179783118C>A	ENSP00000354891:p.Pro100Thr	249.0	0.0		245.0	55.0	NM_173509	A8K8R7	Missense_Mutation	SNP	ENST00000341785.4	hg19	CCDS1333.1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.592372	0.66219	.	.	ENSG00000143340	ENST00000341785	.	.	.	4.44	3.44	0.39384	.	0.069861	0.64402	D	0.000018	T	0.55257	0.1909	L	0.50333	1.59	0.48762	D	0.9997	B	0.20550	0.046	B	0.23419	0.046	T	0.55761	-0.8090	9	0.35671	T	0.21	-0.1809	13.0098	0.58725	0.1621:0.8378:0.0:0.0	.	100	Q96GL9	F163A_HUMAN	T	100	.	ENSP00000354891:P100T	P	+	1	0	FAM163A	178049741	1.000000	0.71417	0.937000	0.37676	0.849000	0.48306	5.283000	0.65621	2.187000	0.69744	0.462000	0.41574	CCA	.	.		0.652	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509	
GNPAT	8443	hgsc.bcm.edu	37	1	231376848	231376848	+	5'Flank	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:231376848C>A	ENST00000366647.4	+	0	0				C1orf131_ENST00000366649.2_Nonsense_Mutation_p.E14*|C1orf131_ENST00000471936.1_5'UTR|GNPAT_ENST00000366646.3_5'Flank|C1orf131_ENST00000366651.3_Nonsense_Mutation_p.E14*|C1orf131_ENST00000318906.2_Nonsense_Mutation_p.E14*	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase						cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				GGCCCTTGCTCCTGCGACATT	0.652																																					p.E14X		Atlas-SNP	.											.	C1orf131	30	.	0			c.G40T						.						96.0	99.0	98.0					1																	231376848		2203	4300	6503	SO:0001631	upstream_gene_variant	128061	exon1			CTTGCTCCTGCGA	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024		chr1.hg19:g.231376848C>A	Exception_encountered	235.0	0.0		261.0	16.0	NM_152379	B4DNM9|Q5TBH7|Q9BWC2	Nonsense_Mutation	SNP	ENST00000366647.4	hg19	CCDS1592.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350688	0.82132	.	.	ENSG00000143633	ENST00000366649;ENST00000318906;ENST00000366651;ENST00000366648	.	.	.	5.06	2.14	0.27477	.	0.743246	0.12591	N	0.455591	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-23.9359	6.0374	0.19716	0.0:0.6723:0.1562:0.1714	.	.	.	.	X	14;14;14;4	.	ENSP00000321341:E14X	E	-	1	0	C1orf131	229443471	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.713000	0.25794	0.301000	0.22738	-0.142000	0.14014	GAG	.	.		0.652	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1		
RGS7	6000	hgsc.bcm.edu	37	1	240969620	240969620	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr1:240969620C>G	ENST00000407727.1	-	14	1088	c.1089G>C	c.(1087-1089)tgG>tgC	p.W363C	RGS7_ENST00000366565.1_Missense_Mutation_p.W363C|RGS7_ENST00000401882.1_Missense_Mutation_p.W310C|RGS7_ENST00000366564.1_Missense_Mutation_p.W363C|RGS7_ENST00000366562.4_Missense_Mutation_p.W363C|RGS7_ENST00000331110.7_Missense_Mutation_p.W337C|RGS7_ENST00000446183.2_Missense_Mutation_p.W279C|RGS7_ENST00000348120.2_Missense_Mutation_p.W310C|RGS7_ENST00000366563.1_Missense_Mutation_p.W363C			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	363	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CCACTGCCAGCCAGAATCTAT	0.468																																					p.W363C		Atlas-SNP	.											.	RGS7	308	.	0			c.G1089C						.						91.0	88.0	89.0					1																	240969620		2203	4300	6503	SO:0001583	missense	6000	exon15			TGCCAGCCAGAAT	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1089G>C	chr1.hg19:g.240969620C>G	ENSP00000384428:p.Trp363Cys	86.0	0.0		114.0	63.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.7	4.326660	0.81690	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.95	5.95	0.96441	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81356	0.4805	H	0.97465	4.01	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.997;0.999;0.995;1.0;0.998	D	0.87158	0.2213	10	0.87932	D	0	.	19.3906	0.94581	0.0:1.0:0.0:0.0	.	279;337;310;363;363;363;363	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	C	337;363;363;363;194;310;279;363;363;310	ENSP00000331485:W337C;ENSP00000355523:W363C;ENSP00000355522:W363C;ENSP00000355521:W363C;ENSP00000404399:W194C;ENSP00000341242:W310C;ENSP00000390138:W279C;ENSP00000355520:W363C;ENSP00000384428:W363C;ENSP00000385508:W310C	ENSP00000331485:W337C	W	-	3	0	RGS7	239036243	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.818000	0.86416	2.827000	0.97445	0.650000	0.86243	TGG	.	.		0.468	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
RBKS	64080	hgsc.bcm.edu	37	2	28113208	28113210	+	Start_Codon_SNP	TNP	GCC	GCC	AAA			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G|C|C	G|C|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr2:28113208_28113210GCC>AAA	ENST00000302188.3	-	1	755_757	c.3_5GGC>TTT	c.(1-6)atGGCg>atTTTg	p.1_2MA>IL	BRE_ENST00000361704.2_5'Flank|RBKS_ENST00000444339.2_Start_Codon_SNP_p.1_2MA>IL|BRE_ENST00000379624.1_5'Flank|BRE_ENST00000379632.2_5'Flank|BRE_ENST00000344773.2_5'Flank|BRE_ENST00000342045.2_5'Flank	NM_022128.1	NP_071411.1	Q9H477	RBSK_HUMAN	ribokinase	1					D-ribose catabolic process (GO:0019303)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ribokinase activity (GO:0004747)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(172;0.155)					CCCAGACGCCGCCATCGCTCAAA	0.665																																					p.A2V|p.A2S|p.M1I		Atlas-SNP	.											.	RBKS	23	.	0			c.C5T|c.G4T|c.G3T						.																																			SO:0001582	initiator_codon_variant	64080	exon1			GACGCCGCCATCG|ACGCCGCCATCGC|CGCCGCCATCGCT	BC017425	CCDS1762.1	2p23.3	2008-02-05			ENSG00000171174	ENSG00000171174	2.7.1.15		30325	protein-coding gene	gene with protein product		611132				8382990	Standard	NM_022128		Approved	DKFZp686G13268, RBSK	uc002rlo.1	Q9H477	OTTHUMG00000097833	ENST00000302188.3:c.3_5GGC>TTT	chr2.hg19:g.28113208GCC>AAA	ENSP00000306817:p.M1_A2delinsIL	37.0	0.0		33.0|33.0|32.0	13.0	NM_022128	A9UK04|B4DV96	Missense_Mutation	SNP	ENST00000302188.3	hg19	CCDS1762.1																																																																																			.	.		0.665	RBKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215118.1	NM_022128	Missense_Mutation
DCTN1	1639	hgsc.bcm.edu	37	2	74596526	74596526	+	Silent	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr2:74596526C>A	ENST00000361874.3	-	14	1802	c.1485G>T	c.(1483-1485)cgG>cgT	p.R495R	DCTN1_ENST00000407639.2_Silent_p.R361R|DCTN1_ENST00000409567.3_Silent_p.R475R|DCTN1_ENST00000409240.1_Silent_p.R458R|DCTN1_ENST00000409438.1_Silent_p.R361R|DCTN1_ENST00000409868.1_Silent_p.R478R|DCTN1_ENST00000394003.3_Silent_p.R488R|DCTN1_ENST00000495643.1_5'Flank	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	495			R -> Q (in dbSNP:rs17721059).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CCTCACGAACCCGCGCGCCTG	0.597																																					p.R495R		Atlas-SNP	.											.	DCTN1	110	.	0			c.G1485T						.						93.0	94.0	93.0					2																	74596526		2203	4300	6503	SO:0001819	synonymous_variant	1639	exon14			ACGAACCCGCGCG		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1485G>T	chr2.hg19:g.74596526C>A		92.0	0.0		98.0	32.0	NM_004082	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Silent	SNP	ENST00000361874.3	hg19	CCDS1939.1																																																																																			.	.		0.597	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
GGCX	2677	hgsc.bcm.edu	37	2	85788530	85788530	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr2:85788530C>T	ENST00000233838.4	-	1	102	c.22G>A	c.(22-24)Gcg>Acg	p.A8T	VAMP8_ENST00000432071.1_5'Flank|GGCX_ENST00000430215.3_Missense_Mutation_p.A8T	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	8					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	GAGGTCCGCGCGGACCCGGCA	0.697																																					p.A8T		Atlas-SNP	.											.	GGCX	44	.	0			c.G22A						.						6.0	8.0	8.0					2																	85788530		2132	4207	6339	SO:0001583	missense	2677	exon1			TCCGCGCGGACCC		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.22G>A	chr2.hg19:g.85788530C>T	ENSP00000233838:p.Ala8Thr	220.0	0.0		173.0	60.0	NM_000821	B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	ENST00000233838.4	hg19	CCDS1978.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033844	0.54896	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	D;D	0.94537	-3.45;-3.27	3.16	2.28	0.28536	.	0.963056	0.08539	N	0.930906	D	0.89815	0.6824	L	0.36672	1.1	0.09310	N	1	B;B	0.24426	0.001;0.103	B;B	0.17098	0.001;0.017	T	0.80986	-0.1137	10	0.48119	T	0.1	-2.1536	6.619	0.22792	0.0:0.866:0.0:0.134	.	8;8	E9PEE1;P38435	.;VKGC_HUMAN	T	8	ENSP00000233838:A8T;ENSP00000408045:A8T	ENSP00000233838:A8T	A	-	1	0	GGCX	85642041	0.074000	0.21230	0.115000	0.21578	0.260000	0.26232	0.093000	0.15086	0.887000	0.36136	0.555000	0.69702	GCG	.	.		0.697	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252490.3	NM_000821	
ERBB4	2066	hgsc.bcm.edu	37	2	212543805	212543805	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr2:212543805A>G	ENST00000342788.4	-	13	1904	c.1594T>C	c.(1594-1596)Tgc>Cgc	p.C532R	ERBB4_ENST00000402597.1_Missense_Mutation_p.C532R|ERBB4_ENST00000436443.1_Missense_Mutation_p.C532R	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	532	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GACTCTATGCAGATCCTTCCT	0.468										TSP Lung(8;0.080)																											p.C532R		Atlas-SNP	.											.	ERBB4	480	.	0			c.T1594C						.						72.0	63.0	66.0					2																	212543805		2203	4300	6503	SO:0001583	missense	2066	exon13			CTATGCAGATCCT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1594T>C	chr2.hg19:g.212543805A>G	ENSP00000342235:p.Cys532Arg	351.0	0.0		339.0	33.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863343	0.71949	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	D;D;D	0.98192	-4.78;-4.78;-4.78	5.33	5.33	0.75918	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.99363	0.9776	H	0.97783	4.075	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98452	1.0592	10	0.87932	D	0	.	14.2874	0.66254	1.0:0.0:0.0:0.0	.	532;532;391;532;532	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.;.;.;.;ERBB4_HUMAN	R	532	ENSP00000342235:C532R;ENSP00000403204:C532R;ENSP00000385565:C532R	ENSP00000342235:C532R	C	-	1	0	ERBB4	212252050	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	8.566000	0.90734	2.018000	0.59344	0.482000	0.46254	TGC	.	.		0.468	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ZCWPW2	152098	hgsc.bcm.edu	37	3	28476749	28476749	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr3:28476749A>G	ENST00000383768.2	+	4	669	c.481A>G	c.(481-483)Atc>Gtc	p.I161V	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.I161V			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	161	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						ACATTATAGTATCACATTAAA	0.318																																					p.I161V		Atlas-SNP	.											.	ZCWPW2	49	.	0			c.A481G						.						92.0	95.0	94.0					3																	28476749		2203	4300	6503	SO:0001583	missense	152098	exon3			TATAGTATCACAT	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.481A>G	chr3.hg19:g.28476749A>G	ENSP00000373278:p.Ile161Val	355.0	0.0		381.0	123.0	NM_001040432		Missense_Mutation	SNP	ENST00000383768.2	hg19	CCDS33723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.28|10.28	1.306992|1.306992	0.23821|0.23821	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000428875;ENST00000419130	T;T|.	0.31247|.	1.5;1.5|.	6.06|6.06	-0.402|-0.402	0.12404|0.12404	PWWP (1);|.	0.696518|.	0.14211|.	N|.	0.334049|.	T|T	0.24236|0.24236	0.0587|0.0587	L|L	0.31294|0.31294	0.92|0.92	0.22827|0.22827	N|N	0.99869|0.99869	B|.	0.10296|.	0.003|.	B|.	0.12156|.	0.007|.	T|T	0.27739|0.27739	-1.0065|-1.0065	10|5	0.27785|.	T|.	0.31|.	-0.0519|-0.0519	5.1496|5.1496	0.15002|0.15002	0.5138:0.1588:0.3274:0.0|0.5138:0.1588:0.3274:0.0	.|.	161|.	Q504Y3|.	ZCPW2_HUMAN|.	V|C	161|144;12	ENSP00000373278:I161V;ENSP00000412386:I161V|.	ENSP00000373278:I161V|.	I|Y	+|+	1|2	0|0	ZCWPW2|ZCWPW2	28451753|28451753	0.820000|0.820000	0.29190|0.29190	0.987000|0.987000	0.45799|0.45799	0.972000|0.972000	0.66771|0.66771	0.518000|0.518000	0.22847|0.22847	-0.059000|-0.059000	0.13154|0.13154	-0.297000|-0.297000	0.09499|0.09499	ATC|TAT	.	.		0.318	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
APEH	327	hgsc.bcm.edu	37	3	49723115	49723115	+	IGR	SNP	C	C	T	rs397833185		TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr3:49723115C>T	ENST00000296456.5	+	0	3220				AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.R434Q	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ATCTGGGTTCCGGCAGAAGTT	0.582																																					p.R434Q		Atlas-SNP	.											.	MST1	84	.	0			c.G1301A						.						44.0	43.0	43.0					3																	49723115		2203	4300	6503	SO:0001628	intergenic_variant	4485	exon11			GGGTTCCGGCAGA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		chr3.hg19:g.49723115C>T		140.0	0.0		146.0	6.0	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	hg19	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	C	35	5.586034	0.96578	.	.	ENSG00000173531	ENST00000449682	D	0.96774	-4.12	5.22	5.22	0.72569	.	0.000000	0.39020	N	0.001499	D	0.98576	0.9524	H	0.99634	4.67	0.80722	D	1	P	0.42649	0.786	P	0.46796	0.527	D	0.99848	1.1068	10	0.72032	D	0.01	.	17.5442	0.87856	0.0:1.0:0.0:0.0	.	434	G3XAK1	.	Q	434	ENSP00000414287:R434Q	ENSP00000414287:R434Q	R	-	2	0	MST1	49698119	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.441000	0.80485	2.428000	0.82296	0.655000	0.94253	CGG	.	.		0.582	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
IMPG2	50939	hgsc.bcm.edu	37	3	100947684	100947684	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr3:100947684C>A	ENST00000193391.7	-	18	3857	c.3670G>T	c.(3670-3672)Gcc>Tcc	p.A1224S		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1224					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GGATCATTGGCATACAGTTCC	0.393																																					p.A1224S		Atlas-SNP	.											.	IMPG2	164	.	0			c.G3670T						.						111.0	110.0	111.0					3																	100947684		2203	4300	6503	SO:0001583	missense	50939	exon18			CATTGGCATACAG	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.3670G>T	chr3.hg19:g.100947684C>A	ENSP00000193391:p.Ala1224Ser	122.0	0.0		93.0	24.0	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	hg19	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858571	0.91433	.	.	ENSG00000081148	ENST00000193391	T	0.32023	1.47	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	T	0.57198	0.2037	M	0.71581	2.175	0.53005	D	0.999967	D;D	0.76494	0.999;0.999	D;D	0.68943	0.961;0.961	T	0.58696	-0.7591	10	0.87932	D	0	-12.1046	19.819	0.96583	0.0:1.0:0.0:0.0	.	1224;1224	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	S	1224	ENSP00000193391:A1224S	ENSP00000193391:A1224S	A	-	1	0	IMPG2	102430374	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.695000	0.54749	2.691000	0.91804	0.655000	0.94253	GCC	.	.		0.393	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
SI	6476	hgsc.bcm.edu	37	3	164773036	164773036	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr3:164773036C>G	ENST00000264382.3	-	13	1520	c.1458G>C	c.(1456-1458)tgG>tgC	p.W486C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	486	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATTCATTTGCCCACCAATCAA	0.348										HNSCC(35;0.089)																											p.W486C		Atlas-SNP	.											.	SI	500	.	0			c.G1458C						.						125.0	120.0	121.0					3																	164773036		2203	4300	6503	SO:0001583	missense	6476	exon13			ATTTGCCCACCAA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1458G>C	chr3.hg19:g.164773036C>G	ENSP00000264382:p.Trp486Cys	111.0	0.0		102.0	29.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	hg19	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980608	0.74474	.	.	ENSG00000090402	ENST00000264382	D	0.95342	-3.68	5.13	5.13	0.70059	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98707	0.9566	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.99651	1.0991	10	0.87932	D	0	.	17.5495	0.87872	0.0:1.0:0.0:0.0	.	486	P14410	SUIS_HUMAN	C	486	ENSP00000264382:W486C	ENSP00000264382:W486C	W	-	3	0	SI	166255730	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.048000	0.76606	2.368000	0.80403	0.585000	0.79938	TGG	.	.		0.348	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
GPR78	27201	hgsc.bcm.edu	37	4	8582915	8582915	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr4:8582915G>A	ENST00000382487.4	+	1	623	c.206G>A	c.(205-207)cGc>cAc	p.R69H	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	69					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						GGTGTGATGCGCGGGCGGACA	0.692																																					p.R69H		Atlas-SNP	.											.	GPR78	58	.	0			c.G206A						.						22.0	25.0	24.0					4																	8582915		2203	4298	6501	SO:0001583	missense	27201	exon1			TGATGCGCGGGCG	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.206G>A	chr4.hg19:g.8582915G>A	ENSP00000371927:p.Arg69His	67.0	0.0		52.0	13.0	NM_080819	Q8NGV3	Missense_Mutation	SNP	ENST00000382487.4	hg19	CCDS3403.1	.	.	.	.	.	.	.	.	.	.	G	1.661	-0.511435	0.04231	.	.	ENSG00000155269	ENST00000382487	T	0.37058	1.22	2.59	-1.06	0.10002	GPCR, rhodopsin-like superfamily (1);	0.771052	0.09787	U	0.755863	T	0.11196	0.0273	N	0.02802	-0.49	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.26189	-1.0110	10	0.15952	T	0.53	.	0.7649	0.01013	0.2375:0.1845:0.39:0.1879	.	69	Q96P69	GPR78_HUMAN	H	69	ENSP00000371927:R69H	ENSP00000371927:R69H	R	+	2	0	GPR78	8633815	0.003000	0.15002	0.003000	0.11579	0.295000	0.27426	1.149000	0.31626	-0.381000	0.07882	-0.657000	0.03884	CGC	.	.		0.692	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		
FAM47E-STBD1	100631383	hgsc.bcm.edu	37	4	77231063	77231063	+	Silent	SNP	G	G	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr4:77231063G>T	ENST00000237642.6	+	2	1731	c.987G>T	c.(985-987)ggG>ggT	p.G329G	FAM47E-STBD1_ENST00000539752.1_Silent_p.G180G|FAM47E_ENST00000515604.1_3'UTR	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough																		TAGAGAATGGGGGAGTTACCC	0.483																																					p.G329G		Atlas-SNP	.											.	STBD1	22	.	0			c.G987T						.						162.0	159.0	160.0					4																	77231063		2203	4300	6503	SO:0001819	synonymous_variant	8987	exon2			GAATGGGGGAGTT		CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.987G>T	chr4.hg19:g.77231063G>T		116.0	0.0		113.0	53.0	NM_003943		Silent	SNP	ENST00000237642.6	hg19	CCDS3578.1																																																																																			.	.		0.483	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
ADH5	128	hgsc.bcm.edu	37	4	100002517	100002517	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr4:100002517T>A	ENST00000296412.8	-	4	393	c.343A>T	c.(343-345)Aga>Tga	p.R115*	ADH5_ENST00000512991.1_5'UTR	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		GATACTAACCTTATCTTCTGG	0.373																																					p.R115X		Atlas-SNP	.											.	ADH5	23	.	0			c.A343T						.						57.0	52.0	54.0					4																	100002517		1837	4095	5932	SO:0001630	splice_region_variant	128	exon4			CTAACCTTATCTT	M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.344+1A>T	chr4.hg19:g.100002517T>A		429.0	0.0		304.0	130.0	NM_000671		Nonsense_Mutation	SNP	ENST00000296412.8	hg19	CCDS47111.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.776759	0.90195	.	.	ENSG00000197894	ENST00000296412;ENST00000503130	.	.	.	4.88	3.66	0.41972	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7857	0.52041	0.0:0.0:0.1471:0.8529	.	.	.	.	X	115;102	.	.	R	-	1	2	ADH5	100221540	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.622000	0.46427	0.865000	0.35603	0.524000	0.50904	AGA	.	.		0.373	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364224.1	NM_000671	Nonsense_Mutation
FAT4	79633	hgsc.bcm.edu	37	4	126242565	126242565	+	Missense_Mutation	SNP	A	A	G	rs369211657		TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr4:126242565A>G	ENST00000394329.3	+	1	5012	c.4999A>G	c.(4999-5001)Att>Gtt	p.I1667V		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1667	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGAGTATTATATTGTTTCAGT	0.438																																					p.I1667V		Atlas-SNP	.											.	FAT4	1752	.	0			c.A4999G						.						92.0	91.0	91.0					4																	126242565		1847	4091	5938	SO:0001583	missense	79633	exon1			TATTATATTGTTT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4999A>G	chr4.hg19:g.126242565A>G	ENSP00000377862:p.Ile1667Val	159.0	0.0		237.0	58.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	5.827	0.336809	0.11013	.	.	ENSG00000196159	ENST00000394329	T	0.45276	0.9	4.35	4.35	0.52113	Cadherin (3);Cadherin-like (1);	0.000000	0.34725	U	0.003733	T	0.39886	0.1095	L	0.53780	1.695	0.80722	D	1	P	0.47350	0.894	B	0.42995	0.404	T	0.23084	-1.0198	10	0.25106	T	0.35	.	13.7352	0.62813	1.0:0.0:0.0:0.0	.	1667	Q6V0I7	FAT4_HUMAN	V	1667	ENSP00000377862:I1667V	ENSP00000377862:I1667V	I	+	1	0	FAT4	126462015	1.000000	0.71417	0.955000	0.39395	0.457000	0.32468	7.148000	0.77389	1.840000	0.53500	0.533000	0.62120	ATT	.	.		0.438	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TIGD4	201798	hgsc.bcm.edu	37	4	153691328	153691328	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr4:153691328G>C	ENST00000304337.2	-	2	1649	c.829C>G	c.(829-831)Caa>Gaa	p.Q277E		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	277	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					TGCTGGGCTTGAAATTCCTCA	0.403																																					p.Q277E		Atlas-SNP	.											.	TIGD4	53	.	0			c.C829G						.						129.0	135.0	133.0					4																	153691328		2203	4300	6503	SO:0001583	missense	201798	exon2			GGGCTTGAAATTC	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.829C>G	chr4.hg19:g.153691328G>C	ENSP00000355162:p.Gln277Glu	124.0	0.0		131.0	16.0	NM_145720	Q96LP5	Missense_Mutation	SNP	ENST00000304337.2	hg19	CCDS34079.1	.	.	.	.	.	.	.	.	.	.	G	5.132	0.209948	0.09757	.	.	ENSG00000169989	ENST00000304337	T	0.40756	1.02	6.03	6.03	0.97812	.	0.000000	0.48286	D	0.000190	T	0.21022	0.0506	N	0.05230	-0.09	0.29721	N	0.838652	B	0.18968	0.032	B	0.21151	0.033	T	0.08576	-1.0715	10	0.06365	T	0.9	-19.7998	13.652	0.62316	0.0:0.0:0.7351:0.2649	.	277	Q8IY51	TIGD4_HUMAN	E	277	ENSP00000355162:Q277E	ENSP00000355162:Q277E	Q	-	1	0	TIGD4	153910778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.960000	0.49161	2.861000	0.98227	0.655000	0.94253	CAA	.	.		0.403	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720	
LRAT	9227	hgsc.bcm.edu	37	4	155665788	155665788	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr4:155665788A>C	ENST00000336356.3	+	2	563	c.310A>C	c.(310-312)Aaa>Caa	p.K104Q	LRAT_ENST00000507827.1_Missense_Mutation_p.K104Q	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	104					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	CGTTATTGTCAAAGTGGCCAG	0.577																																					p.K104Q		Atlas-SNP	.											.	LRAT	29	.	0			c.A310C						.						66.0	68.0	67.0					4																	155665788		2203	4300	6503	SO:0001583	missense	9227	exon2			ATTGTCAAAGTGG	AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.310A>C	chr4.hg19:g.155665788A>C	ENSP00000337224:p.Lys104Gln	120.0	0.0		118.0	40.0	NM_004744	A8K983|Q8N716	Missense_Mutation	SNP	ENST00000336356.3	hg19	CCDS3789.1	.	.	.	.	.	.	.	.	.	.	A	17.03	3.285046	0.59867	.	.	ENSG00000121207	ENST00000507827;ENST00000336356	T;T	0.23552	1.9;1.9	5.53	2.98	0.34508	.	0.321668	0.40728	N	0.001023	T	0.48447	0.1500	M	0.83603	2.65	0.36789	D	0.884721	D	0.63046	0.992	P	0.60541	0.876	T	0.60136	-0.7322	10	0.62326	D	0.03	-4.0879	12.3403	0.55091	0.7327:0.2672:0.0:0.0	.	104	O95237	LRAT_HUMAN	Q	104	ENSP00000426761:K104Q;ENSP00000337224:K104Q	ENSP00000337224:K104Q	K	+	1	0	LRAT	155885238	0.838000	0.29461	0.028000	0.17463	0.667000	0.39255	4.454000	0.60068	0.337000	0.23665	-0.321000	0.08615	AAA	.	.		0.577	LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365246.1	NM_004744	
DDX4	54514	hgsc.bcm.edu	37	5	55081630	55081630	+	Silent	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr5:55081630C>A	ENST00000505374.1	+	13	887	c.795C>A	c.(793-795)ggC>ggA	p.G265G	DDX4_ENST00000514278.2_Silent_p.G245G|DDX4_ENST00000354991.5_Silent_p.G231G|DDX4_ENST00000353507.5_Silent_p.G231G|DDX4_ENST00000511853.1_Silent_p.G116G	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	265					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				ATCAGACAGGCATAAACTTCG	0.403																																					p.G265G		Atlas-SNP	.											.	DDX4	194	.	0			c.C795A						.						99.0	82.0	88.0					5																	55081630		2203	4300	6503	SO:0001819	synonymous_variant	54514	exon13			GACAGGCATAAAC	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.795C>A	chr5.hg19:g.55081630C>A		245.0	0.0		217.0	63.0	NM_024415	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Silent	SNP	ENST00000505374.1	hg19	CCDS3969.1																																																																																			.	.		0.403	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
PLK2	10769	hgsc.bcm.edu	37	5	57750578	57750578	+	Silent	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr5:57750578T>C	ENST00000274289.3	-	14	2190	c.1890A>G	c.(1888-1890)acA>acG	p.T630T	PLK2_ENST00000502671.1_Intron	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	630	POLO box 2. {ECO:0000255|PROSITE- ProRule:PRU00154}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TGATGATTTTTGTATGATCAT	0.338																																					p.T630T		Atlas-SNP	.											.	PLK2	71	.	0			c.A1890G						.						93.0	86.0	88.0					5																	57750578		2203	4300	6503	SO:0001819	synonymous_variant	10769	exon14			GATTTTTGTATGA		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.1890A>G	chr5.hg19:g.57750578T>C		181.0	0.0		167.0	46.0	NM_006622	O60679|Q96CV7|Q9UE61	Silent	SNP	ENST00000274289.3	hg19	CCDS3974.1																																																																																			.	.		0.338	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
PCDHB5	26167	hgsc.bcm.edu	37	5	140516856	140516856	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr5:140516856T>C	ENST00000231134.5	+	1	2057	c.1840T>C	c.(1840-1842)Ttc>Ctc	p.F614L		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	614	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCGGGCTGTTCAGCATGTG	0.687																																					p.F614L		Atlas-SNP	.											.	PCDHB5	184	.	0			c.T1840C						.						52.0	55.0	54.0					5																	140516856		2177	4256	6433	SO:0001583	missense	26167	exon1			GGGCTGTTCAGCA	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1840T>C	chr5.hg19:g.140516856T>C	ENSP00000231134:p.Phe614Leu	74.0	0.0		47.0	15.0	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	hg19	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.366750	0.61513	.	.	ENSG00000113209	ENST00000231134	T	0.70749	-0.51	4.65	4.65	0.58169	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.86510	0.5950	M	0.91510	3.215	0.46521	D	0.999083	D	0.76494	0.999	D	0.73380	0.98	D	0.89808	0.3980	9	0.87932	D	0	.	14.3871	0.66953	0.0:0.0:0.0:1.0	.	614	Q9Y5E4	PCDB5_HUMAN	L	614	ENSP00000231134:F614L	ENSP00000231134:F614L	F	+	1	0	PCDHB5	140497040	1.000000	0.71417	0.989000	0.46669	0.170000	0.22686	6.027000	0.70881	1.863000	0.54032	0.352000	0.21897	TTC	.	.		0.687	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
FGFR4	2264	hgsc.bcm.edu	37	5	176520328	176520328	+	Missense_Mutation	SNP	G	G	T	rs200070761		TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr5:176520328G>T	ENST00000292408.4	+	9	1492	c.1247G>T	c.(1246-1248)cGa>cTa	p.R416L	FGFR4_ENST00000393637.1_Intron|FGFR4_ENST00000292410.3_Intron|FGFR4_ENST00000502906.1_Missense_Mutation_p.R416L|FGFR4_ENST00000393648.2_Intron	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	416					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CCTCTGGCCCGACAGGTACTG	0.667										TSP Lung(9;0.080)																											p.R416L		Atlas-SNP	.											.	FGFR4	174	.	0			c.G1247T						.						62.0	67.0	66.0					5																	176520328		2203	4300	6503	SO:0001583	missense	2264	exon9			TGGCCCGACAGGT	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1247G>T	chr5.hg19:g.176520328G>T	ENSP00000292408:p.Arg416Leu	179.0	0.0		131.0	6.0	NM_002011	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	hg19	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.898874	0.91962	.	.	ENSG00000160867	ENST00000292408;ENST00000502906;ENST00000377207	D;D	0.90563	-2.69;-2.69	4.25	4.25	0.50352	.	0.166797	0.50627	D	0.000108	D	0.94902	0.8352	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.95041	0.8178	10	0.51188	T	0.08	.	16.4541	0.84007	0.0:0.0:1.0:0.0	.	416	P22455	FGFR4_HUMAN	L	416;416;644	ENSP00000292408:R416L;ENSP00000424960:R416L	ENSP00000292408:R416L	R	+	2	0	FGFR4	176452934	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.254000	0.95512	2.210000	0.71456	0.561000	0.74099	CGA	.	G|1.000;A|0.000		0.667	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
BMP6	654	hgsc.bcm.edu	37	6	7879308	7879308	+	Splice_Site	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:7879308T>C	ENST00000283147.6	+	5	1365	c.1206T>C	c.(1204-1206)gaT>gaC	p.D402D		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	402					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					CTCCAACAGATTACAACAGCA	0.468																																					p.D402D		Atlas-SNP	.											.	BMP6	67	.	0			c.T1206C						.						150.0	150.0	150.0					6																	7879308		2203	4300	6503	SO:0001630	splice_region_variant	654	exon5			AACAGATTACAAC	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.1205-1T>C	chr6.hg19:g.7879308T>C		142.0	0.0		173.0	50.0	NM_001718	Q5TCP3	Silent	SNP	ENST00000283147.6	hg19	CCDS4503.1																																																																																			.	.		0.468	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	Silent
RANBP9	10048	hgsc.bcm.edu	37	6	13622650	13622650	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:13622650C>T	ENST00000011619.3	-	14	2192	c.2134G>A	c.(2134-2136)Gct>Act	p.A712T	RANBP9_ENST00000469916.1_5'UTR|NOL7_ENST00000474485.1_Intron|AL441883.1_ENST00000600057.1_5'Flank|RANBP9_ENST00000539980.1_Missense_Mutation_p.A483T	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	712	Interaction with FMR1.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			CCTGATCGAGCCATCAGTCCT	0.438																																					p.A712T		Atlas-SNP	.											.	RANBP9	42	.	0			c.G2134A						.						127.0	105.0	112.0					6																	13622650		2203	4300	6503	SO:0001583	missense	10048	exon14			ATCGAGCCATCAG	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.2134G>A	chr6.hg19:g.13622650C>T	ENSP00000011619:p.Ala712Thr	93.0	0.0		128.0	35.0	NM_005493	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	hg19	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752121	0.89753	.	.	ENSG00000010017	ENST00000011619;ENST00000539980	T	0.78816	-1.21	6.17	6.17	0.99709	Ran binding protein-like, CRA domain (1);Ran binding protein, CRA domain (1);	0.000000	0.85682	D	0.000000	D	0.85579	0.5729	L	0.56769	1.78	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.84819	0.0795	10	0.72032	D	0.01	-15.8012	20.8794	0.99867	0.0:1.0:0.0:0.0	.	712	Q96S59	RANB9_HUMAN	T	712;483	ENSP00000011619:A712T	ENSP00000011619:A712T	A	-	1	0	RANBP9	13730629	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.456000	0.80751	2.941000	0.99782	0.655000	0.94253	GCT	.	.		0.438	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
NOTCH4	4855	hgsc.bcm.edu	37	6	32183114	32183114	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:32183114T>G	ENST00000375023.3	-	12	2048	c.1910A>C	c.(1909-1911)aAg>aCg	p.K637T	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	637	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						ACATATCTGCTTGGGCTGGCA	0.572																																					p.K637T		Atlas-SNP	.											.	NOTCH4	201	.	0			c.A1910C						.						98.0	69.0	80.0					6																	32183114		1511	2709	4220	SO:0001583	missense	4855	exon12			ATCTGCTTGGGCT		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1910A>C	chr6.hg19:g.32183114T>G	ENSP00000364163:p.Lys637Thr	66.0	0.0		111.0	22.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	hg19	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	T	11.67	1.707419	0.30322	.	.	ENSG00000204301	ENST00000375023	T	0.68025	-0.3	4.23	0.39	0.16275	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.119980	0.06883	N	0.802840	T	0.34221	0.0890	L	0.48642	1.525	0.09310	N	1	P	0.38922	0.651	B	0.35470	0.203	T	0.32134	-0.9918	10	0.59425	D	0.04	.	3.2286	0.06740	0.0:0.2406:0.2151:0.5443	.	637	Q99466	NOTC4_HUMAN	T	637	ENSP00000364163:K637T	ENSP00000364163:K637T	K	-	2	0	NOTCH4	32291092	0.000000	0.05858	0.048000	0.18961	0.955000	0.61496	-0.354000	0.07681	-0.008000	0.14320	0.459000	0.35465	AAG	.	.		0.572	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
SLC39A7	7922	hgsc.bcm.edu	37	6	33170833	33170833	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:33170833G>A	ENST00000374677.3	+	6	1460	c.1087G>A	c.(1087-1089)Gag>Aag	p.E363K	HSD17B8_ENST00000374662.3_5'Flank|SLC39A7_ENST00000374675.3_Missense_Mutation_p.E363K|RXRB_ENST00000374680.3_5'Flank|SLC39A7_ENST00000463972.1_3'UTR|RXRB_ENST00000413614.2_5'Flank|RXRB_ENST00000374685.4_5'Flank|RXRB_ENST00000544186.1_5'Flank	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	363					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						AGTGCCCCACGAGGTCGGAGA	0.552																																					p.E363K		Atlas-SNP	.											.	SLC39A7	32	.	0			c.G1087A						.						184.0	213.0	203.0					6																	33170833		1386	2616	4002	SO:0001583	missense	7922	exon6			CCCCACGAGGTCG	AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.1087G>A	chr6.hg19:g.33170833G>A	ENSP00000363809:p.Glu363Lys	114.0	0.0		121.0	33.0	NM_006979	B0UXF6|Q5STP8|Q9UIQ0	Missense_Mutation	SNP	ENST00000374677.3	hg19	CCDS43453.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019190	0.93462	.	.	ENSG00000112473	ENST00000374675;ENST00000446283;ENST00000445037;ENST00000374677	T;T	0.54479	0.57;0.57	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.79992	0.4542	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86707	0.1933	10	0.87932	D	0	-13.1223	15.8729	0.79136	0.0:0.0:1.0:0.0	.	344;363	B4DVK8;Q92504	.;S39A7_HUMAN	K	363;344;268;363	ENSP00000363807:E363K;ENSP00000363809:E363K	ENSP00000363807:E363K	E	+	1	0	SLC39A7	33278811	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.915000	0.87484	2.603000	0.88011	0.448000	0.29417	GAG	.	.		0.552	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076499.2	NM_006979	
KCNK17	89822	hgsc.bcm.edu	37	6	39271749	39271749	+	Silent	SNP	G	G	A	rs533411945	byFrequency	TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:39271749G>A	ENST00000373231.4	-	4	904	c.672C>T	c.(670-672)ttC>ttT	p.F224F	KCNK17_ENST00000453413.2_Silent_p.F224F	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	224					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						CGTAGTCGCCGAAGCCCACGG	0.617													G|||	2	0.000399361	0.0	0.0	5008	,	,		19215	0.0		0.0	False		,,,				2504	0.002				p.F224F		Atlas-SNP	.											KCNK17_ENST00000453413,NS,carcinoma,0,4	KCNK17	61	.	0			c.C672T						.						98.0	93.0	94.0					6																	39271749		2203	4300	6503	SO:0001819	synonymous_variant	89822	exon4			GTCGCCGAAGCCC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.672C>T	chr6.hg19:g.39271749G>A		80.0	0.0		101.0	6.0	NM_001135111	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Silent	SNP	ENST00000373231.4	hg19	CCDS4842.1																																																																																			.	.		0.617	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
TJAP1	93643	hgsc.bcm.edu	37	6	43470061	43470061	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:43470061G>A	ENST00000372445.5	+	7	707	c.331G>A	c.(331-333)Gag>Aag	p.E111K	TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000372449.1_Missense_Mutation_p.E111K|TJAP1_ENST00000259751.1_Missense_Mutation_p.E111K|TJAP1_ENST00000438588.2_Missense_Mutation_p.E111K|TJAP1_ENST00000372444.2_Missense_Mutation_p.E111K|TJAP1_ENST00000372452.1_Missense_Mutation_p.E111K|TJAP1_ENST00000436109.2_Missense_Mutation_p.E111K	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	111					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GACCAACCAGGAGTTGGAGGA	0.557																																					p.E111K		Atlas-SNP	.											.	TJAP1	35	.	0			c.G331A						.						95.0	76.0	83.0					6																	43470061		2203	4300	6503	SO:0001583	missense	93643	exon7			AACCAGGAGTTGG	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.331G>A	chr6.hg19:g.43470061G>A	ENSP00000361522:p.Glu111Lys	65.0	0.0		107.0	22.0	NM_080604	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	hg19	CCDS55004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.617397|5.617397	0.96649|0.96649	.|.	.|.	ENSG00000137221|ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000442878;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588|ENST00000454762	T;T;T;T;T;T;T;T|.	0.50001|.	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.128709|.	0.52532|.	D|.	0.000066|.	T|T	0.61426|0.61426	0.2346|0.2346	L|L	0.55481|0.55481	1.735|1.735	0.47094|0.47094	D|D	0.999319|0.999319	B;D;P|.	0.63880|.	0.338;0.993;0.873|.	B;P;P|.	0.58520|.	0.115;0.84;0.461|.	T|T	0.60747|0.60747	-0.7202|-0.7202	10|5	0.49607|.	T|.	0.09|.	-15.4577|-15.4577	16.4138|16.4138	0.83727|0.83727	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	111;111;111|.	E2QRK7;Q5JTD0;Q5JTD0-2|.	.;TJAP1_HUMAN;.|.	K|E	111|68	ENSP00000361521:E111K;ENSP00000361522:E111K;ENSP00000407080:E111K;ENSP00000390981:E111K;ENSP00000259751:E111K;ENSP00000361530:E111K;ENSP00000361527:E111K;ENSP00000408769:E111K|.	ENSP00000259751:E111K|.	E|G	+|+	1|2	0|0	TJAP1|TJAP1	43578039|43578039	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	8.702000|8.702000	0.91338|0.91338	2.298000|2.298000	0.77334|0.77334	0.563000|0.563000	0.77884|0.77884	GAG|GGA	.	.		0.557	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
TINAG	27283	hgsc.bcm.edu	37	6	54191649	54191649	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr6:54191649G>T	ENST00000259782.4	+	4	655	c.559G>T	c.(559-561)Ggt>Tgt	p.G187C	TINAG_ENST00000370864.3_Missense_Mutation_p.G169C|TINAG_ENST00000370869.3_Missense_Mutation_p.G183C	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	187					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TTTAGAAGATGGTTTTAAATT	0.378																																					p.G187C		Atlas-SNP	.											.	TINAG	102	.	0			c.G559T						.						143.0	132.0	135.0					6																	54191649		2203	4300	6503	SO:0001583	missense	27283	exon4			GAAGATGGTTTTA	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.559G>T	chr6.hg19:g.54191649G>T	ENSP00000259782:p.Gly187Cys	178.0	0.0		216.0	9.0	NM_014464	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	hg19	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118357	0.77323	.	.	ENSG00000137251	ENST00000370869;ENST00000339741;ENST00000259782;ENST00000370864	T;T;T	0.52983	0.64;0.64;0.64	5.82	5.82	0.92795	.	0.180155	0.40064	N	0.001181	T	0.68504	0.3008	M	0.87827	2.91	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.73597	-0.3932	10	0.87932	D	0	.	15.6145	0.76753	0.0:0.0:1.0:0.0	.	187	Q9UJW2	TINAG_HUMAN	C	183;137;187;169	ENSP00000359906:G183C;ENSP00000259782:G187C;ENSP00000359901:G169C	ENSP00000259782:G187C	G	+	1	0	TINAG	54299608	1.000000	0.71417	0.997000	0.53966	0.932000	0.56968	5.426000	0.66476	2.751000	0.94390	0.643000	0.83706	GGT	.	.		0.378	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
HDAC9	9734	hgsc.bcm.edu	37	7	18624963	18624963	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr7:18624963A>T	ENST00000432645.2	+	2	82	c.82A>T	c.(82-84)Aca>Tca	p.T28S	HDAC9_ENST00000406072.1_Missense_Mutation_p.T56S|HDAC9_ENST00000441542.2_Missense_Mutation_p.T28S|HDAC9_ENST00000456174.2_5'UTR|HDAC9_ENST00000417496.2_Missense_Mutation_p.T70S|HDAC9_ENST00000405010.3_Missense_Mutation_p.T28S|HDAC9_ENST00000401921.1_Missense_Mutation_p.T28S|HDAC9_ENST00000476135.1_3'UTR|HDAC9_ENST00000406451.4_Missense_Mutation_p.T28S|HDAC9_ENST00000524023.1_5'UTR|HDAC9_ENST00000428307.2_Missense_Mutation_p.T28S	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	28					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AGACCTAAGGACAGACCTCAG	0.502																																					p.T70S		Atlas-SNP	.											.	HDAC9	560	.	0			c.A208T						.						129.0	130.0	130.0					7																	18624963		1960	4171	6131	SO:0001583	missense	9734	exon5			CTAAGGACAGACC	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.82A>T	chr7.hg19:g.18624963A>T	ENSP00000410337:p.Thr28Ser	167.0	0.0		186.0	30.0	NM_001204144	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	hg19	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.578970	0.86645	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000413509;ENST00000413380;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T;T;T;T;T;T;T	0.59906	0.79;0.83;0.82;0.8;0.26;0.79;0.84;0.23;0.26;0.26	5.93	5.93	0.95920	.	0.199853	0.35207	N	0.003369	T	0.72495	0.3467	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.983;0.999;0.99;0.999;0.999;0.996;0.999;0.998;0.999	D;P;D;P;D;D;P;D;D;D	0.80764	0.962;0.791;0.957;0.86;0.962;0.962;0.874;0.962;0.994;0.918	T	0.70842	-0.4762	10	0.37606	T	0.19	-10.608	16.3766	0.83401	1.0:0.0:0.0:0.0	.	28;56;70;28;28;28;28;28;28;47	Q9UKV0-4;B5MCF1;B7Z917;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;HDAC9_HUMAN;.;.;.	S	70;73;28;28;28;28;28;56;28;28;28;28	ENSP00000401669:T70S;ENSP00000412497:T28S;ENSP00000392564:T28S;ENSP00000384382:T28S;ENSP00000384657:T28S;ENSP00000395655:T28S;ENSP00000384017:T56S;ENSP00000383912:T28S;ENSP00000410337:T28S;ENSP00000408617:T28S	ENSP00000262069:T73S	T	+	1	0	HDAC9	18591488	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.576000	0.82467	2.263000	0.75096	0.533000	0.62120	ACA	.	.		0.502	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
MAGI2	9863	hgsc.bcm.edu	37	7	77789511	77789511	+	Silent	SNP	G	G	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr7:77789511G>T	ENST00000354212.4	-	16	2929	c.2676C>A	c.(2674-2676)acC>acA	p.T892T	MAGI2_ENST00000419488.1_Silent_p.T878T|MAGI2_ENST00000522391.1_Silent_p.T892T	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	892					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGTTGGTGTAGGTTGCGTAGT	0.587																																					p.T892T		Atlas-SNP	.											.	MAGI2	246	.	0			c.C2676A						.						165.0	139.0	148.0					7																	77789511		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon16			GGTGTAGGTTGCG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2676C>A	chr7.hg19:g.77789511G>T		171.0	0.0		152.0	16.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	hg19	CCDS5594.1																																																																																			.	.		0.587	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
ZNF804B	219578	hgsc.bcm.edu	37	7	88964202	88964202	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr7:88964202A>G	ENST00000333190.4	+	4	2515	c.1906A>G	c.(1906-1908)Aag>Gag	p.K636E		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	636							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAGGTTTAAAAAGCATAAATT	0.423										HNSCC(36;0.09)																											p.K636E		Atlas-SNP	.											.	ZNF804B	322	.	0			c.A1906G						.						83.0	86.0	85.0					7																	88964202		2203	4300	6503	SO:0001583	missense	219578	exon4			TTTAAAAAGCATA	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1906A>G	chr7.hg19:g.88964202A>G	ENSP00000329638:p.Lys636Glu	228.0	0.0		192.0	55.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	hg19	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	A	9.035	0.988194	0.18966	.	.	ENSG00000182348	ENST00000333190	T	0.06933	3.24	5.48	4.33	0.51752	.	0.244896	0.35870	N	0.002926	T	0.06600	0.0169	L	0.29908	0.895	0.21897	N	0.99948	B	0.27498	0.18	B	0.23150	0.044	T	0.33650	-0.9860	10	0.24483	T	0.36	-2.6507	11.5151	0.50515	0.9302:0.0:0.0698:0.0	.	636	A4D1E1	Z804B_HUMAN	E	636	ENSP00000329638:K636E	ENSP00000329638:K636E	K	+	1	0	ZNF804B	88802138	1.000000	0.71417	0.539000	0.28077	0.018000	0.09664	4.919000	0.63383	1.093000	0.41377	0.528000	0.53228	AAG	.	.		0.423	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
KMT2E	55904	hgsc.bcm.edu	37	7	104753037	104753037	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr7:104753037T>G	ENST00000311117.3	+	27	5379	c.4834T>G	c.(4834-4836)Tct>Gct	p.S1612A	KMT2E_ENST00000334877.4_Missense_Mutation_p.S1570A|KMT2E_ENST00000257745.4_Missense_Mutation_p.S1612A|SRPK2_ENST00000493638.1_Intron	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1612	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTTTTTGCCCTCTCAGAACCC	0.542																																					p.S1612A		Atlas-SNP	.											.	MLL5	173	.	0			c.T4834G						.						165.0	141.0	149.0					7																	104753037		2203	4300	6503	SO:0001583	missense	55904	exon26			TTGCCCTCTCAGA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4834T>G	chr7.hg19:g.104753037T>G	ENSP00000312379:p.Ser1612Ala	122.0	0.0		109.0	7.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	hg19	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	T	5.361	0.251912	0.10185	.	.	ENSG00000005483	ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.92495	-3.05;-2.89;-3.05	3.63	2.33	0.28932	.	0.000000	0.37136	N	0.002238	T	0.81437	0.4822	N	0.19112	0.55	0.80722	D	1	P;B	0.41673	0.759;0.243	B;B	0.36335	0.222;0.066	T	0.77146	-0.2695	10	0.21540	T	0.41	.	8.5771	0.33605	0.1721:0.0:0.0:0.8279	.	1532;1612	F8W6H1;Q8IZD2	.;MLL5_HUMAN	A	1612;1570;1532;1612	ENSP00000312379:S1612A;ENSP00000335599:S1570A;ENSP00000257745:S1612A	ENSP00000257745:S1612A	S	+	1	0	MLL5	104540273	0.932000	0.31603	0.944000	0.38274	0.781000	0.44180	1.391000	0.34475	1.426000	0.47256	0.254000	0.18369	TCT	.	.		0.542	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
PPP1R3A	5506	hgsc.bcm.edu	37	7	113518594	113518594	+	Silent	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr7:113518594G>A	ENST00000284601.3	-	4	2621	c.2553C>T	c.(2551-2553)gtC>gtT	p.V851V		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	851					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTCTGTAATGACCCATGAGG	0.383																																					p.V851V		Atlas-SNP	.											.	PPP1R3A	317	.	0			c.C2553T						.						180.0	169.0	173.0					7																	113518594		2203	4300	6503	SO:0001819	synonymous_variant	5506	exon4			TGTAATGACCCAT	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2553C>T	chr7.hg19:g.113518594G>A		145.0	0.0		136.0	15.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	hg19	CCDS5759.1																																																																																			.	.		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PXDNL	137902	hgsc.bcm.edu	37	8	52287173	52287173	+	Silent	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr8:52287173G>A	ENST00000356297.4	-	18	3776	c.3676C>T	c.(3676-3678)Cta>Tta	p.L1226L	PXDNL_ENST00000543296.1_Silent_p.L1226L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1226					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCATCTCTTAGCCGCTGAAAC	0.388																																					p.L1226L		Atlas-SNP	.											.	PXDNL	414	.	0			c.C3676T						.						79.0	79.0	79.0					8																	52287173		1900	4123	6023	SO:0001819	synonymous_variant	137902	exon18			CTCTTAGCCGCTG		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3676C>T	chr8.hg19:g.52287173G>A		141.0	0.0		100.0	31.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	hg19	CCDS47855.1																																																																																			.	.		0.388	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
PTAR1	375743	hgsc.bcm.edu	37	9	72333569	72333569	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr9:72333569T>C	ENST00000340434.4	-	7	982	c.979A>G	c.(979-981)Aat>Gat	p.N327D	PTAR1_ENST00000377200.5_Missense_Mutation_p.N248D	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	327					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						AACCTACCATTTAAGTGATGC	0.473																																					p.N327D		Atlas-SNP	.											.	PTAR1	46	.	0			c.A979G						.						58.0	56.0	56.0					9																	72333569		1898	4115	6013	SO:0001583	missense	375743	exon7			TACCATTTAAGTG	BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.979A>G	chr9.hg19:g.72333569T>C	ENSP00000344299:p.Asn327Asp	93.0	0.0		53.0	23.0	NM_001099666	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	hg19	CCDS47978.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.774|8.774	0.926679|0.926679	0.18056|0.18056	.|.	.|.	ENSG00000188647|ENSG00000188647	ENST00000415701|ENST00000377200;ENST00000340434	.|T;T	.|0.42131	.|0.98;0.98	6.02|6.02	0.654|0.654	0.17833|0.17833	.|Protein prenyltransferase (1);	.|0.889113	.|0.10054	.|N	.|0.721815	T|T	0.25494|0.25494	0.0620|0.0620	N|N	0.08118|0.08118	0|0	0.26592|0.26592	N|N	0.973183|0.973183	.|B	.|0.10296	.|0.003	.|B	.|0.11329	.|0.006	T|T	0.19257|0.19257	-1.0311|-1.0311	5|10	.|0.31617	.|T	.|0.26	.|.	15.0691|15.0691	0.72021|0.72021	0.0:0.0:0.4969:0.5031|0.0:0.0:0.4969:0.5031	.|.	.|327	.|Q7Z6K3	.|PTAR1_HUMAN	R|D	93|248;327	.|ENSP00000366405:N248D;ENSP00000344299:N327D	.|ENSP00000344299:N327D	K|N	-|-	2|1	0|0	PTAR1|PTAR1	71523389|71523389	0.690000|0.690000	0.27699|0.27699	0.269000|0.269000	0.24586|0.24586	0.975000|0.975000	0.68041|0.68041	1.514000|1.514000	0.35834|0.35834	0.138000|0.138000	0.18790|0.18790	-0.331000|-0.331000	0.08364|0.08364	AAA|AAT	.	.		0.473	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666	
KAT6B	23522	hgsc.bcm.edu	37	10	76789169	76789169	+	Silent	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr10:76789169G>A	ENST00000287239.4	+	18	5076	c.4587G>A	c.(4585-4587)gaG>gaA	p.E1529E	KAT6B_ENST00000372711.1_Silent_p.E1346E|KAT6B_ENST00000372725.1_Silent_p.E1237E|KAT6B_ENST00000372724.1_Silent_p.E1237E|KAT6B_ENST00000372714.1_Silent_p.E1237E	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1529					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										AGTTCAAAGAGGGAAACCCAG	0.532																																					p.E1529E		Atlas-SNP	.											.	.	.	.	0			c.G4587A						.						115.0	114.0	114.0					10																	76789169		2203	4300	6503	SO:0001819	synonymous_variant	23522	exon18			CAAAGAGGGAAAC	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4587G>A	chr10.hg19:g.76789169G>A		161.0	0.0		140.0	50.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	hg19	CCDS7345.1																																																																																			.	.		0.532	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
LRIT1	26103	hgsc.bcm.edu	37	10	85992484	85992484	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr10:85992484G>C	ENST00000372105.3	-	4	1092	c.1071C>G	c.(1069-1071)agC>agG	p.S357R		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	357						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						GTGCTCCTGGGCTCCCACTGT	0.562																																					p.S357R		Atlas-SNP	.											.	LRIT1	73	.	0			c.C1071G						.						58.0	47.0	51.0					10																	85992484		2203	4300	6503	SO:0001583	missense	26103	exon4			TCCTGGGCTCCCA	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1071C>G	chr10.hg19:g.85992484G>C	ENSP00000361177:p.Ser357Arg	125.0	0.0		96.0	23.0	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	hg19	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	G	0.428	-0.904638	0.02453	.	.	ENSG00000148602	ENST00000372105	T	0.36157	1.27	5.8	0.683	0.17998	.	0.840007	0.11543	N	0.553565	T	0.20941	0.0504	N	0.24115	0.695	0.09310	N	1	B	0.27166	0.17	B	0.24269	0.052	T	0.26326	-1.0106	10	0.15499	T	0.54	.	9.1011	0.36669	0.4715:0.0:0.5285:0.0	.	357	Q9P2V4	LRIT1_HUMAN	R	357	ENSP00000361177:S357R	ENSP00000361177:S357R	S	-	3	2	LRIT1	85982464	0.000000	0.05858	0.055000	0.19348	0.185000	0.23345	0.549000	0.23329	0.094000	0.17404	0.655000	0.94253	AGC	.	.		0.562	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
IDE	3416	hgsc.bcm.edu	37	10	94250296	94250296	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr10:94250296T>C	ENST00000265986.6	-	12	1543	c.1487A>G	c.(1486-1488)tAt>tGt	p.Y496C	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_5'UTR	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	496					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	CTGGGTTCCATACCACTCTTC	0.378																																					p.Y496C		Atlas-SNP	.											.	IDE	77	.	0			c.A1487G						.						298.0	288.0	291.0					10																	94250296		2203	4300	6503	SO:0001583	missense	3416	exon12			GTTCCATACCACT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1487A>G	chr10.hg19:g.94250296T>C	ENSP00000265986:p.Tyr496Cys	99.0	0.0		107.0	12.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.402858	0.83230	.	.	ENSG00000119912	ENST00000265986	T	0.57107	0.42	5.41	5.41	0.78517	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.80003	0.4544	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85863	0.1411	10	0.87932	D	0	-12.534	14.9135	0.70776	0.0:0.0:0.0:1.0	.	496	P14735	IDE_HUMAN	C	496	ENSP00000265986:Y496C	ENSP00000265986:Y496C	Y	-	2	0	IDE	94240276	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.478000	0.81082	2.169000	0.68431	0.533000	0.62120	TAT	.	.		0.378	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
TLL2	7093	hgsc.bcm.edu	37	10	98133500	98133500	+	Missense_Mutation	SNP	C	C	T	rs141213956		TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr10:98133500C>T	ENST00000357947.3	-	19	2740	c.2515G>A	c.(2515-2517)Ggg>Agg	p.G839R		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	839	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CTGTCCGGCCCGTCATACATT	0.547																																					p.G839R		Atlas-SNP	.											.	TLL2	122	.	0			c.G2515A						.	C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	60.0	63.0	62.0		2515	4.8	0.2	10	dbSNP_134	62	0,8600		0,0,4300	no	missense	TLL2	NM_012465.3	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	839/1016	98133500	1,13005	2203	4300	6503	SO:0001583	missense	7093	exon19			CCGGCCCGTCATA	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2515G>A	chr10.hg19:g.98133500C>T	ENSP00000350630:p.Gly839Arg	90.0	0.0		69.0	23.0	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	hg19	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527215	0.85706	2.27E-4	0.0	ENSG00000095587	ENST00000357947	T	0.26957	1.7	4.85	4.85	0.62838	CUB (5);	0.000000	0.46442	D	0.000300	T	0.66713	0.2817	H	0.98218	4.175	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.80663	-0.1282	10	0.87932	D	0	.	17.4922	0.87707	0.0:1.0:0.0:0.0	.	839	Q9Y6L7	TLL2_HUMAN	R	839	ENSP00000350630:G839R	ENSP00000350630:G839R	G	-	1	0	TLL2	98123490	1.000000	0.71417	0.152000	0.22495	0.638000	0.38207	7.609000	0.82925	2.677000	0.91161	0.561000	0.74099	GGG	.	C|1.000;T|0.000		0.547	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
RNH1	6050	hgsc.bcm.edu	37	11	499113	499113	+	Silent	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr11:499113G>A	ENST00000534797.1	-	4	1923	c.516C>T	c.(514-516)ttC>ttT	p.F172F	RNH1_ENST00000356187.5_Silent_p.F172F|RNH1_ENST00000438658.2_Silent_p.F172F|RNH1_ENST00000533592.1_5'Flank|RNH1_ENST00000397615.2_Silent_p.F172F|RNH1_ENST00000397614.1_Silent_p.F172F|RNH1_ENST00000533410.1_Silent_p.F172F|RNH1_ENST00000397604.3_Silent_p.F172F|RNH1_ENST00000354420.2_Silent_p.F172F			O60930	RNH1_HUMAN	ribonuclease/angiogenin inhibitor 1	0	RNase H. {ECO:0000255|PROSITE- ProRule:PRU00408}.				mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGAGCTCCTTGAAGTCCGGCT	0.642																																					p.F172F		Atlas-SNP	.											.	RNH1	24	.	0			c.C516T						.						67.0	53.0	58.0					11																	499113		2203	4300	6503	SO:0001819	synonymous_variant	6050	exon5			CTCCTTGAAGTCC		CCDS7697.1	11p15.5	2008-02-05	2005-06-01	2005-06-01	ENSG00000023191	ENSG00000023191			10074	protein-coding gene	gene with protein product		173320	"""ribonuclease/angiogenin inhibitor"""	RNH			Standard	NM_203386		Approved	RAI	uc001lpo.1	P13489	OTTHUMG00000119086	ENST00000534797.1:c.516C>T	chr11.hg19:g.499113G>A		107.0	0.0		87.0	10.0	NM_203384	B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Silent	SNP	ENST00000534797.1	hg19	CCDS7697.1																																																																																			.	.		0.642	RNH1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384301.1	NM_203389	
TRIM34	53840	hgsc.bcm.edu	37	11	5653572	5653572	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr11:5653572A>G	ENST00000514226.1	+	2	348	c.11A>G	c.(10-12)aAa>aGa	p.K4R	TRIM34_ENST00000429814.2_Missense_Mutation_p.K4R|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.K358R|TRIM6-TRIM34_ENST00000457787.2_Missense_Mutation_p.K4R	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	4					positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.K4T(1)|p.K358T(1)		NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGGCTTCAAAAATCTTGCTT	0.527											OREG0003725	type=REGULATORY REGION|Gene=TRIM34|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.K358R		Atlas-SNP	.											TRIM6-TRIM34,NS,carcinoma,0,2	TRIM6-TRIM34	68	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1073G						.						124.0	111.0	116.0					11																	5653572		2201	4297	6498	SO:0001583	missense	445372	exon8			CTTCAAAAATCTT	AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.11A>G	chr11.hg19:g.5653572A>G	ENSP00000422947:p.Lys4Arg	135.0	0.0	628	128.0	16.0	NM_001003819	D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Missense_Mutation	SNP	ENST00000514226.1	hg19	CCDS31391.1	.	.	.	.	.	.	.	.	.	.	A	8.281	0.815570	0.16607	.	.	ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258588	ENST00000337072;ENST00000514226;ENST00000429814;ENST00000457787;ENST00000354852	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	3.07	-2.94	0.05581	Zinc finger, RING/FYVE/PHD-type (1);	1.851040	0.03314	N	0.190948	T	0.73860	0.3641	L	0.27975	0.815	0.09310	N	1	B;B;B	0.17465	0.002;0.022;0.012	B;B;B	0.20184	0.012;0.028;0.011	T	0.56372	-0.7990	10	0.40728	T	0.16	.	2.9257	0.05784	0.2305:0.5056:0.1085:0.1554	.	4;4;358	Q9BYJ4-2;Q9BYJ4;B2RNG4	.;TRI34_HUMAN;.	R	358;4;4;4;358	ENSP00000422947:K4R;ENSP00000402595:K4R;ENSP00000395982:K4R;ENSP00000346916:K358R	ENSP00000402595:K4R	K	+	2	0	TRIM34;TRIM6-TRIM34	5610148	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-1.430000	0.02434	-0.595000	0.05828	-0.501000	0.04562	AAA	.	.		0.527	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143357.2	NM_001003827	
ELP4	26610	hgsc.bcm.edu	37	11	31669307	31669307	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr11:31669307C>T	ENST00000350638.5	+	8	981	c.946C>T	c.(946-948)Cgt>Tgt	p.R316C	ELP4_ENST00000395934.2_Missense_Mutation_p.R316C|ELP4_ENST00000379163.5_Missense_Mutation_p.R317C|Z83001.1_ENST00000429821.1_RNA	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	316					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					CATTATTGCCCGTGTCACAAC	0.328																																					p.R316C		Atlas-SNP	.											.	ELP4	78	.	0			c.C946T						.						207.0	185.0	192.0					11																	31669307		1841	4084	5925	SO:0001583	missense	26610	exon8			ATTGCCCGTGTCA	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.946C>T	chr11.hg19:g.31669307C>T	ENSP00000298937:p.Arg316Cys	182.0	0.0		143.0	40.0	NM_019040	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	hg19	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325658	0.81580	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.46451	0.87;0.87;0.87	5.92	5.92	0.95590	.	0.170242	0.56097	D	0.000032	T	0.70631	0.3246	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.68943	0.937;0.961;0.913	T	0.72587	-0.4248	10	0.52906	T	0.07	-5.7156	20.3172	0.98658	0.0:1.0:0.0:0.0	.	317;316;316	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	C	316;317;316	ENSP00000298937:R316C;ENSP00000368461:R317C;ENSP00000379267:R316C	ENSP00000298937:R316C	R	+	1	0	ELP4	31625883	1.000000	0.71417	0.998000	0.56505	0.790000	0.44656	4.704000	0.61831	2.801000	0.96364	0.650000	0.86243	CGT	.	.		0.328	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040	
OR4A5	81318	hgsc.bcm.edu	37	11	51411980	51411980	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr11:51411980C>A	ENST00000319760.6	-	1	468	c.416G>T	c.(415-417)tGc>tTc	p.C139F		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CAGAAGGAAGCAAACCTGTCG	0.483																																					p.C139F		Atlas-SNP	.											.	OR4A5	116	.	0			c.G416T						.						83.0	78.0	80.0					11																	51411980		2201	4296	6497	SO:0001583	missense	81318	exon1			AGGAAGCAAACCT	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.416G>T	chr11.hg19:g.51411980C>A	ENSP00000367664:p.Cys139Phe	145.0	0.0		147.0	6.0	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	hg19	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	7.792	0.711705	0.15306	.	.	ENSG00000221840	ENST00000319760	T	0.00220	8.52	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.124345	0.36854	N	0.002373	T	0.00580	0.0019	M	0.93016	3.37	0.09310	N	1	P	0.48911	0.917	P	0.61132	0.884	T	0.11792	-1.0573	10	0.87932	D	0	.	9.9079	0.41388	0.0:1.0:0.0:0.0	.	139	Q8NH83	OR4A5_HUMAN	F	139	ENSP00000367664:C139F	ENSP00000367664:C139F	C	-	2	0	OR4A5	51268556	0.850000	0.29656	0.030000	0.17652	0.132000	0.20833	1.712000	0.37940	1.394000	0.46624	0.162000	0.16502	TGC	.	.		0.483	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
CCDC89	220388	hgsc.bcm.edu	37	11	85396947	85396947	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr11:85396947A>G	ENST00000316398.3	-	1	373	c.227T>C	c.(226-228)cTc>cCc	p.L76P	CREBZF_ENST00000534224.1_5'Flank	NM_152723.1	NP_689936.1	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	76						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	15		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				GATGCAGATGAGCTGGGACTG	0.592																																					p.L76P		Atlas-SNP	.											.	CCDC89	45	.	0			c.T227C						.						66.0	58.0	60.0					11																	85396947		2203	4299	6502	SO:0001583	missense	220388	exon1			CAGATGAGCTGGG	AK095478	CCDS8270.1	11q14.1	2006-03-16			ENSG00000179071	ENSG00000179071			26762	protein-coding gene	gene with protein product						12477932	Standard	NM_152723		Approved	FLJ38159	uc001pau.1	Q8N998	OTTHUMG00000166976	ENST00000316398.3:c.227T>C	chr11.hg19:g.85396947A>G	ENSP00000320649:p.Leu76Pro	57.0	0.0		62.0	19.0	NM_152723		Missense_Mutation	SNP	ENST00000316398.3	hg19	CCDS8270.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.352444	0.82132	.	.	ENSG00000179071	ENST00000316398	.	.	.	5.91	5.91	0.95273	.	0.000000	0.64402	U	0.000003	T	0.79782	0.4505	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80717	-0.1258	8	.	.	.	-5.6455	16.3436	0.83110	1.0:0.0:0.0:0.0	.	76	Q8N998	CCD89_HUMAN	P	76	.	.	L	-	2	0	CCDC89	85074595	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.345000	0.72995	2.269000	0.75478	0.533000	0.62120	CTC	.	.		0.592	CCDC89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392182.1	NM_152723	
GRIA4	2893	hgsc.bcm.edu	37	11	105775994	105775994	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr11:105775994T>G	ENST00000530497.1	+	8	1125	c.1125T>G	c.(1123-1125)gaT>gaG	p.D375E	GRIA4_ENST00000525187.1_Missense_Mutation_p.D375E|GRIA4_ENST00000428631.2_Missense_Mutation_p.D375E|GRIA4_ENST00000282499.5_Missense_Mutation_p.D375E|GRIA4_ENST00000393125.2_Missense_Mutation_p.D375E|GRIA4_ENST00000393127.2_Missense_Mutation_p.D375E			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	375					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACACAATGGATGTGTTTGAGC	0.393																																					p.D375E		Atlas-SNP	.											.	GRIA4	380	.	0			c.T1125G						.						134.0	124.0	127.0					11																	105775994		2202	4299	6501	SO:0001583	missense	2893	exon9			AATGGATGTGTTT	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1125T>G	chr11.hg19:g.105775994T>G	ENSP00000435775:p.Asp375Glu	96.0	0.0		90.0	32.0	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	t	20.9	4.069272	0.76301	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.75	5.75	0.90469	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.84374	0.5458	L	0.46157	1.445	0.58432	D	0.999993	B;B;B	0.34147	0.024;0.438;0.058	B;P;B	0.49140	0.101;0.601;0.197	D	0.85118	0.0967	10	0.87932	D	0	.	16.3663	0.83325	0.0:0.0:0.0:1.0	.	375;375;375	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	E	375	ENSP00000376833:D375E;ENSP00000282499:D375E;ENSP00000376835:D375E;ENSP00000415551:D375E;ENSP00000435775:D375E;ENSP00000432180:D375E	ENSP00000282499:D375E	D	+	3	2	GRIA4	105281204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.799000	0.27028	2.320000	0.78422	0.524000	0.50904	GAT	.	.		0.393	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
ATN1	1822	hgsc.bcm.edu	37	12	7045873	7045873	+	Silent	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr12:7045873T>C	ENST00000356654.4	+	5	1680	c.1443T>C	c.(1441-1443)caT>caC	p.H481H	ATN1_ENST00000396684.2_Silent_p.H481H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	481	Poly-His.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CACATCACCATCACCACcagc	0.627																																					p.H481H		Atlas-SNP	.											.	ATN1	95	.	0			c.T1443C						.						97.0	109.0	104.0					12																	7045873		2203	4300	6503	SO:0001819	synonymous_variant	1822	exon5			TCACCATCACCAC	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1443T>C	chr12.hg19:g.7045873T>C		99.0	0.0		100.0	7.0	NM_001007026	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	hg19	CCDS31734.1																																																																																			.	.		0.627	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
PDE3A	5139	hgsc.bcm.edu	37	12	20799827	20799827	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr12:20799827C>A	ENST00000359062.3	+	12	2548	c.2508C>A	c.(2506-2508)caC>caA	p.H836Q	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	836	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CAGCCATGCACGATTATGATC	0.413																																					p.H836Q		Atlas-SNP	.											PDE3A,NS,lymphoid_neoplasm,0,1	PDE3A	184	.	0			c.C2508A						.						165.0	154.0	158.0					12																	20799827		2203	4300	6503	SO:0001583	missense	5139	exon12			CATGCACGATTAT		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2508C>A	chr12.hg19:g.20799827C>A	ENSP00000351957:p.His836Gln	188.0	0.0		167.0	50.0	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	hg19	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689716	0.68271	.	.	ENSG00000172572	ENST00000359062	D	0.90732	-2.72	5.85	-4.11	0.03928	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.192308	0.56097	D	0.000033	D	0.96595	0.8889	H	0.99058	4.415	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95902	0.8916	10	0.87932	D	0	.	14.0685	0.64847	0.0:0.5746:0.0:0.4254	.	836	Q14432	PDE3A_HUMAN	Q	836	ENSP00000351957:H836Q	ENSP00000351957:H836Q	H	+	3	2	PDE3A	20691094	0.365000	0.25006	0.972000	0.41901	0.971000	0.66376	-0.348000	0.07740	-0.414000	0.07495	-1.552000	0.00895	CAC	.	.		0.413	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
ALG10B	144245	hgsc.bcm.edu	37	12	38714365	38714365	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr12:38714365A>G	ENST00000308742.4	+	3	1088	c.772A>G	c.(772-774)Atc>Gtc	p.I258V	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	258					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TTGGCCCTACATCCTTCTGGG	0.378																																					p.I258V		Atlas-SNP	.											.	ALG10B	58	.	0			c.A772G						.						248.0	249.0	249.0					12																	38714365		2203	4300	6503	SO:0001583	missense	144245	exon3			CCCTACATCCTTC	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.772A>G	chr12.hg19:g.38714365A>G	ENSP00000310120:p.Ile258Val	187.0	0.0		134.0	42.0	NM_001013620	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	hg19	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	a	0.048	-1.259056	0.01445	.	.	ENSG00000175548	ENST00000308742	T	0.56103	0.48	3.23	-2.39	0.06602	.	0.522394	0.21702	N	0.070419	T	0.28995	0.0720	L	0.28556	0.865	0.34075	D	0.658954	B	0.02656	0.0	B	0.09377	0.004	T	0.17440	-1.0369	10	0.14656	T	0.56	.	4.6475	0.12579	0.4902:0.1661:0.3438:0.0	.	258	Q5I7T1	AG10B_HUMAN	V	258	ENSP00000310120:I258V	ENSP00000310120:I258V	I	+	1	0	ALG10B	37000632	0.236000	0.23804	0.061000	0.19648	0.232000	0.25224	1.497000	0.35649	-0.481000	0.06792	-0.263000	0.10527	ATC	.	.		0.378	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
OR9K2	441639	hgsc.bcm.edu	37	12	55523606	55523606	+	Silent	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr12:55523606A>G	ENST00000305377.5	+	1	142	c.54A>G	c.(52-54)caA>caG	p.Q18Q		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q18Q(1)		NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						GTGCCTCTCAACAGGTTTCTA	0.413																																					p.Q18Q		Atlas-SNP	.											OR9K2,NS,carcinoma,0,1	OR9K2	63	.	1	Substitution - coding silent(1)	kidney(1)	c.A54G						.						144.0	144.0	144.0					12																	55523606		2203	4300	6503	SO:0001819	synonymous_variant	441639	exon1			CTCTCAACAGGTT	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.54A>G	chr12.hg19:g.55523606A>G		105.0	0.0		98.0	12.0	NM_001005243	B9EH19|Q6IFD6	Silent	SNP	ENST00000305377.5	hg19	CCDS31814.1																																																																																			.	.		0.413	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1		
STAT6	6778	hgsc.bcm.edu	37	12	57499293	57499293	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr12:57499293A>T	ENST00000300134.3	-	8	1095	c.770T>A	c.(769-771)cTg>cAg	p.L257Q	STAT6_ENST00000538913.2_Missense_Mutation_p.L147Q|STAT6_ENST00000537215.2_Missense_Mutation_p.L147Q|STAT6_ENST00000454075.3_Missense_Mutation_p.L257Q|STAT6_ENST00000543873.2_Missense_Mutation_p.L257Q|STAT6_ENST00000556155.1_Missense_Mutation_p.L257Q	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	257					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						CCGGCCAGTCAGCGATGCCCG	0.617																																					p.L257Q		Atlas-SNP	.											.	STAT6	69	.	0			c.T770A						.						49.0	53.0	52.0					12																	57499293		2203	4300	6503	SO:0001583	missense	6778	exon8			CCAGTCAGCGATG	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.770T>A	chr12.hg19:g.57499293A>T	ENSP00000300134:p.Leu257Gln	111.0	0.0		90.0	28.0	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	hg19	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.391459	0.42410	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516	T;T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43;-0.43	5.19	5.19	0.71726	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.256439	0.31495	N	0.007560	T	0.75391	0.3843	L	0.56199	1.76	0.58432	D	0.999995	P;P	0.51537	0.933;0.946	P;D	0.64042	0.853;0.921	T	0.77643	-0.2511	10	0.87932	D	0	-4.7184	11.355	0.49611	1.0:0.0:0.0:0.0	.	257;257	A8K4S9;P42226	.;STAT6_HUMAN	Q	257;147;147;257;257;147;257;147;257	ENSP00000300134:L257Q;ENSP00000445409:L147Q;ENSP00000438451:L257Q;ENSP00000451742:L257Q;ENSP00000444530:L147Q;ENSP00000401486:L257Q	ENSP00000300134:L257Q	L	-	2	0	STAT6	55785560	0.683000	0.27633	0.133000	0.22050	0.028000	0.11728	4.007000	0.57093	2.188000	0.69820	0.533000	0.62120	CTG	.	.		0.617	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
ANO4	121601	hgsc.bcm.edu	37	12	101381339	101381339	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr12:101381339T>C	ENST00000392977.3	+	8	835	c.625T>C	c.(625-627)Ttt>Ctt	p.F209L	ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.F174L			Q32M45	ANO4_HUMAN	anoctamin 4	209				F -> L (in Ref. 1; BAC03704). {ECO:0000305}.	chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AATAAGCAGGTTTCGGAGATG	0.512										HNSCC(74;0.22)	OREG0022059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F174L		Atlas-SNP	.											.	ANO4	183	.	0			c.T520C						.						303.0	295.0	298.0					12																	101381339		2203	4300	6503	SO:0001583	missense	121601	exon7			AGCAGGTTTCGGA	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.625T>C	chr12.hg19:g.101381339T>C	ENSP00000376703:p.Phe209Leu	108.0	0.0	1358	83.0	22.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	hg19		.	.	.	.	.	.	.	.	.	.	T	12.16	1.856062	0.32791	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.67865	-0.28;-0.29	5.2	5.2	0.72013	.	0.074651	0.56097	D	0.000036	T	0.36524	0.0970	N	0.01219	-0.95	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.37361	-0.9709	10	0.10111	T	0.7	.	15.0946	0.72223	0.0:0.0:0.0:1.0	.	209;174	Q32M45;Q32M45-2	ANO4_HUMAN;.	L	174;209	ENSP00000376705:F174L;ENSP00000376703:F209L	ENSP00000376703:F209L	F	+	1	0	ANO4	99905470	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.914000	0.48797	1.966000	0.57179	0.460000	0.39030	TTT	.	.		0.512	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
PPP1R36	145376	hgsc.bcm.edu	37	14	65053933	65053933	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr14:65053933T>G	ENST00000298705.1	+	10	829	c.733T>G	c.(733-735)Tat>Gat	p.Y245D	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	245					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TTTCTGTACATATGTGGCTTG	0.393																																					p.Y245D		Atlas-SNP	.											.	.	.	.	0			c.T733G						.						136.0	129.0	131.0					14																	65053933		2203	4300	6503	SO:0001583	missense	145376	exon10			TGTACATATGTGG		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.733T>G	chr14.hg19:g.65053933T>G	ENSP00000298705:p.Tyr245Asp	186.0	0.0		162.0	52.0	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	hg19	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.184110	0.38609	.	.	ENSG00000165807	ENST00000298705	T	0.29142	1.58	5.55	3.19	0.36642	.	0.309581	0.28301	N	0.015849	T	0.47691	0.1459	M	0.69823	2.125	0.09310	N	1	D	0.67145	0.996	D	0.65874	0.939	T	0.34576	-0.9823	10	0.66056	D	0.02	-3.5713	7.2838	0.26326	0.0:0.175:0.0:0.825	.	245	Q96LQ0	PPR36_HUMAN	D	245	ENSP00000298705:Y245D	ENSP00000298705:Y245D	Y	+	1	0	C14orf50	64123686	0.064000	0.20934	0.001000	0.08648	0.641000	0.38312	1.727000	0.38095	0.391000	0.25143	0.533000	0.62120	TAT	.	.		0.393	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
SPTB	6710	hgsc.bcm.edu	37	14	65252487	65252487	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr14:65252487C>G	ENST00000389721.5	-	16	3776	c.3744G>C	c.(3742-3744)aaG>aaC	p.K1248N	SPTB_ENST00000556626.1_Missense_Mutation_p.K1248N|SPTB_ENST00000542895.1_Missense_Mutation_p.K1248N|SPTB_ENST00000389720.3_Missense_Mutation_p.K1248N|SPTB_ENST00000389722.3_Missense_Mutation_p.K1248N	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1248					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TCAGCTGCACCTTCTCCTTGA	0.577																																					p.K1248N		Atlas-SNP	.											SPTB_ENST00000542895,caecum,carcinoma,0,2	SPTB	378	.	0			c.G3744C						.						170.0	172.0	171.0					14																	65252487		2203	4300	6503	SO:0001583	missense	6710	exon16			CTGCACCTTCTCC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3744G>C	chr14.hg19:g.65252487C>G	ENSP00000374371:p.Lys1248Asn	70.0	0.0		74.0	24.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	hg19	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412933	0.62511	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	4.94	2.07	0.26955	.	0.000000	0.85682	D	0.000000	T	0.69833	0.3155	M	0.82716	2.605	0.54753	D	0.999989	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.988	T	0.71013	-0.4715	10	0.87932	D	0	.	8.8825	0.35382	0.0:0.6701:0.0:0.3299	.	1248;1252	P11277;Q59FP5	SPTB1_HUMAN;.	N	1252;1248;32;1248;1248;1248;1248	ENSP00000374372:K1248N;ENSP00000451752:K1248N;ENSP00000374371:K1248N;ENSP00000443882:K1248N;ENSP00000374370:K1248N	ENSP00000334218:K32N	K	-	3	2	SPTB	64322240	0.014000	0.17966	1.000000	0.80357	0.990000	0.78478	-0.040000	0.12104	0.607000	0.29982	-0.284000	0.09977	AAG	.	.		0.577	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
UNC13C	440279	hgsc.bcm.edu	37	15	54307145	54307145	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr15:54307145G>C	ENST00000260323.11	+	1	2045	c.2045G>C	c.(2044-2046)aGt>aCt	p.S682T	UNC13C_ENST00000537900.1_Missense_Mutation_p.S682T|UNC13C_ENST00000545554.1_Missense_Mutation_p.S682T	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	682					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAAACAAACAGTCTTTTTGAC	0.398																																					p.S682T		Atlas-SNP	.											.	UNC13C	674	.	0			c.G2045C						.						78.0	74.0	75.0					15																	54307145		1855	4109	5964	SO:0001583	missense	440279	exon1			CAAACAGTCTTTT	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2045G>C	chr15.hg19:g.54307145G>C	ENSP00000260323:p.Ser682Thr	187.0	0.0		170.0	51.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	hg19	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	7.691	0.691012	0.15039	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;T;T	0.81499	-1.5;-1.49;-1.49	5.18	5.18	0.71444	.	.	.	.	.	T	0.69342	0.3100	N	0.19112	0.55	0.34691	D	0.725698	P	0.38922	0.651	B	0.32677	0.15	T	0.79640	-0.1719	9	0.66056	D	0.02	.	17.8526	0.88751	0.0:0.0:1.0:0.0	.	682	Q8NB66	UN13C_HUMAN	T	682	ENSP00000260323:S682T;ENSP00000438156:S682T;ENSP00000442569:S682T	ENSP00000260323:S682T	S	+	2	0	UNC13C	52094437	1.000000	0.71417	0.763000	0.31416	0.111000	0.19643	7.396000	0.79891	2.695000	0.91970	0.650000	0.86243	AGT	.	.		0.398	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
ICE2	79664	hgsc.bcm.edu	37	15	60715904	60715904	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr15:60715904T>C	ENST00000261520.4	-	16	3112	c.2878A>G	c.(2878-2880)Aaa>Gaa	p.K960E	NARG2_ENST00000439632.1_Missense_Mutation_p.K823E	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						CAACTGCTTTTGGTTTCCATG	0.408																																					p.K960E		Atlas-SNP	.											.	NARG2	82	.	0			c.A2878G						.						84.0	71.0	76.0					15																	60715904		2203	4300	6503	SO:0001583	missense	79664	exon16			TGCTTTTGGTTTC																												ENST00000261520.4:c.2878A>G	chr15.hg19:g.60715904T>C	ENSP00000261520:p.Lys960Glu	209.0	0.0		164.0	53.0	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	hg19	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.999380	0.54147	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.44	3.09	0.35607	.	0.356614	0.27253	N	0.020217	T	0.26521	0.0648	L	0.27053	0.805	0.27860	N	0.940436	B	0.26635	0.155	B	0.24155	0.051	T	0.17837	-1.0356	9	0.62326	D	0.03	-11.1147	6.0424	0.19742	0.1456:0.0777:0.0:0.7767	.	960	Q659A1	NARG2_HUMAN	E	960;823	.	ENSP00000261520:K960E	K	-	1	0	NARG2	58503196	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.664000	0.25068	1.011000	0.39340	-0.355000	0.07637	AAA	.	.		0.408	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
IL16	3603	hgsc.bcm.edu	37	15	81517759	81517759	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr15:81517759G>T	ENST00000302987.4	+	1	19	c.19G>T	c.(19-21)Gct>Tct	p.A7S	IL16_ENST00000394660.2_Missense_Mutation_p.A7S			Q14005	IL16_HUMAN	interleukin 16	7					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GCACAGCCGCGCTGGAAAGAG	0.532																																					p.A7S		Atlas-SNP	.											.	IL16	254	.	0			c.G19T						.						52.0	55.0	54.0					15																	81517759		2046	4196	6242	SO:0001583	missense	3603	exon2			AGCCGCGCTGGAA	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.19G>T	chr15.hg19:g.81517759G>T	ENSP00000302935:p.Ala7Ser	47.0	0.0		57.0	4.0	NM_001172128	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	hg19	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.362630	0.00016	.	.	ENSG00000172349	ENST00000394655;ENST00000360547;ENST00000394660;ENST00000302987	T;T	0.18174	2.24;2.23	4.18	-8.36	0.00980	.	1.169440	0.06778	N	0.784710	T	0.04543	0.0124	N	0.02539	-0.55	0.29514	N	0.853986	B;B	0.10296	0.002;0.003	B;B	0.09377	0.002;0.004	T	0.33343	-0.9872	10	0.15066	T	0.55	.	5.4671	0.16650	0.2005:0.1223:0.4968:0.1804	.	7;7	Q14005;Q14005-2	IL16_HUMAN;.	S	7;49;7;7	ENSP00000378155:A7S;ENSP00000302935:A7S	ENSP00000302935:A7S	A	+	1	0	IL16	79304814	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.107000	0.03316	-2.578000	0.00464	-2.737000	0.00128	GCT	.	.		0.532	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	
HBA1	3039	hgsc.bcm.edu	37	16	227353	227353	+	Silent	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr16:227353C>T	ENST00000320868.5	+	3	409	c.372C>T	c.(370-372)gcC>gcT	p.A124A	Y_RNA_ENST00000384514.1_RNA|HBA1_ENST00000397797.1_Silent_p.A92A	NM_000558.3	NP_000549.1	P69905	HBA_HUMAN	hemoglobin, alpha 1	124					bicarbonate transport (GO:0015701)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of cell death (GO:0010942)|protein heterooligomerization (GO:0051291)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			lung(1)	1		all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)			Iron Dextran(DB00893)|Mefloquine(DB00358)	CGGTGCACGCCTCCCTGGACA	0.652											OREG0003687	type=REGULATORY REGION|Gene=SERPINB9|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A124A		Atlas-SNP	.											.	HBA1	2	.	0			c.C372T						.						46.0	40.0	42.0					16																	227353		2202	4295	6497	SO:0001819	synonymous_variant	3039	exon3			GCACGCCTCCCTG	AF349571	CCDS10399.1	16p13.3	2014-05-19			ENSG00000206172	ENSG00000206172			4823	protein-coding gene	gene with protein product		141800				1975428, 2649166	Standard	NM_000558		Approved	HBA-T3	uc002cfx.1	P69905	OTTHUMG00000060138	ENST00000320868.5:c.372C>T	chr16.hg19:g.227353C>T		305.0	0.0	586	258.0	17.0	NM_000558	P01922|Q1HDT5|Q3MIF5|Q53F97|Q96KF1|Q9NYR7|Q9UCM0	Silent	SNP	ENST00000320868.5	hg19	CCDS10399.1																																																																																			.	.		0.652	HBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133459.1	NM_000558	
SRCAP	10847	hgsc.bcm.edu	37	16	30720956	30720956	+	Silent	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr16:30720956C>T	ENST00000262518.4	+	7	1141	c.756C>T	c.(754-756)aaC>aaT	p.N252N	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Silent_p.N252N|SRCAP_ENST00000344771.4_Silent_p.N252N	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	252					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGAGCCTCAACCAGCCATTAA	0.557																																					p.N252N		Atlas-SNP	.											.	SRCAP	298	.	0			c.C756T						.						105.0	96.0	99.0					16																	30720956		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon7			CCTCAACCAGCCA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.756C>T	chr16.hg19:g.30720956C>T		147.0	0.0		152.0	45.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.		0.557	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SNTB2	6645	hgsc.bcm.edu	37	16	69333647	69333647	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr16:69333647C>A	ENST00000336278.4	+	6	1538	c.1500C>A	c.(1498-1500)taC>taA	p.Y500*	RP11-343C2.11_ENST00000570054.2_Nonsense_Mutation_p.Y21*	NM_006750.3	NP_006741.1	Q13425	SNTB2_HUMAN	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	500	SU.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|microtubule (GO:0005874)|protein complex (GO:0043234)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)		GAAATCTATACTTGGATTTTG	0.438																																					p.Y500X	NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	Atlas-SNP	.											.	SNTB2	22	.	0			c.C1500A						.						88.0	82.0	84.0					16																	69333647		2198	4300	6498	SO:0001587	stop_gained	6645	exon6			TCTATACTTGGAT	U40572	CCDS10873.1	16q22.1	2008-05-14	2002-08-29		ENSG00000168807	ENSG00000168807			11169	protein-coding gene	gene with protein product		600027	"""syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2)"""	SNT2B2, SNTL, D16S2531E		8576247, 8183929	Standard	NM_006750		Approved	EST25263, SNT3	uc002ewu.3	Q13425	OTTHUMG00000137567	ENST00000336278.4:c.1500C>A	chr16.hg19:g.69333647C>A	ENSP00000338191:p.Tyr500*	190.0	0.0		128.0	56.0	NM_006750	Q9BY09	Nonsense_Mutation	SNP	ENST00000336278.4	hg19	CCDS10873.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997319	0.93167	.	.	ENSG00000168807	ENST00000336278;ENST00000467311	.	.	.	5.5	-2.74	0.05932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.2163	13.2277	0.59924	0.0:0.5131:0.0:0.4869	.	.	.	.	X	500;151	.	ENSP00000338191:Y500X	Y	+	3	2	SNTB2	67891148	0.959000	0.32827	0.633000	0.29310	0.798000	0.45092	0.558000	0.23469	-0.344000	0.08338	-0.251000	0.11542	TAC	.	.		0.438	SNTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268945.1		
ADAD2	161931	hgsc.bcm.edu	37	16	84228974	84228974	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr16:84228974G>A	ENST00000315906.5	+	5	858	c.806G>A	c.(805-807)tGt>tAt	p.C269Y	RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.C351Y|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	269	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGCAGCTGCTGTGCTGGCTGG	0.692																																					p.C351Y		Atlas-SNP	.											.	ADAD2	46	.	0			c.G1052A						.						11.0	13.0	13.0					16																	84228974		2113	4153	6266	SO:0001583	missense	161931	exon6			GCTGCTGTGCTGG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.806G>A	chr16.hg19:g.84228974G>A	ENSP00000325153:p.Cys269Tyr	102.0	0.0		63.0	32.0	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	hg19	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262808	0.23051	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.93189	-3.18;-3.18	5.05	3.85	0.44370	Adenosine deaminase/editase (2);	0.254378	0.39615	N	0.001317	D	0.86977	0.6063	L	0.29908	0.895	0.39603	D	0.969763	B;B	0.22851	0.076;0.043	B;B	0.25884	0.064;0.038	D	0.83693	0.0178	10	0.54805	T	0.06	-16.3644	6.3636	0.21443	0.1627:0.0:0.8373:0.0	.	269;351	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	Y	269;351	ENSP00000325153:C269Y;ENSP00000268624:C351Y	ENSP00000268624:C351Y	C	+	2	0	ADAD2	82786475	0.597000	0.26874	0.950000	0.38849	0.466000	0.32739	0.744000	0.26245	2.500000	0.84329	0.650000	0.86243	TGT	.	.		0.692	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
TP53	7157	hgsc.bcm.edu	37	17	7577126	7577126	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr17:7577126T>A	ENST00000269305.4	-	8	1001	c.812A>T	c.(811-813)gAg>gTg	p.E271V	TP53_ENST00000359597.4_Missense_Mutation_p.E271V|TP53_ENST00000455263.2_Missense_Mutation_p.E271V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.E271V|TP53_ENST00000445888.2_Missense_Mutation_p.E271V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	271	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.E271V(6)|p.E271G(3)|p.?(2)|p.E271fs*74(2)|p.G266_E271delGRNSFE(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.L265_K305del41(1)|p.E271P(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.E271del(1)|p.E271*(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.E271fs*34(1)|p.E271_R273delEVR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACACGCACCTCAAAGCTGTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E271V	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,-1,1	TP53	33396	.	35	Substitution - Missense(10)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(6)|Unknown(2)|Substitution - Nonsense(1)	breast(5)|central_nervous_system(4)|urinary_tract(4)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|stomach(3)|haematopoietic_and_lymphoid_tissue(3)|oesophagus(2)|liver(2)|salivary_gland(1)|skin(1)	c.A812T	GRCh37	CM942136	TP53	M		.						60.0	52.0	55.0					17																	7577126		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGCACCTCAAAGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.812A>T	chr17.hg19:g.7577126T>A	ENSP00000269305:p.Glu271Val	114.0	0.0		78.0	23.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.727540	0.89390	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.97110	0.999;0.992;0.999;1.0	D	0.96447	0.9331	10	0.87932	D	0	-38.0695	12.9367	0.58319	0.0:0.0:0.0:1.0	.	271;271;271;271	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	271;271;271;271;271;260;139	ENSP00000352610:E271V;ENSP00000269305:E271V;ENSP00000398846:E271V;ENSP00000391127:E271V;ENSP00000391478:E271V;ENSP00000425104:E139V	ENSP00000269305:E271V	E	-	2	0	TP53	7517851	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.802000	0.85969	2.154000	0.67381	0.379000	0.24179	GAG	.	.		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
BRIP1	83990	hgsc.bcm.edu	37	17	59857746	59857746	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr17:59857746T>C	ENST00000259008.2	-	13	2078	c.1811A>G	c.(1810-1812)aAt>aGt	p.N604S	BRIP1_ENST00000583837.1_5'Flank|BRIP1_ENST00000577598.1_Missense_Mutation_p.N604S	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	604					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AACTTTGCCATTAATATCTGA	0.373			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.N604S		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	BRIP1	237	.	0			c.A1811G						.						73.0	75.0	74.0					17																	59857746		2203	4300	6503	SO:0001583	missense	83990	exon13			TTGCCATTAATAT	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1811A>G	chr17.hg19:g.59857746T>C	ENSP00000259008:p.Asn604Ser	324.0	0.0		259.0	84.0	NM_032043	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	hg19	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	T	9.665	1.145222	0.21288	.	.	ENSG00000136492	ENST00000259008	T	0.21191	2.02	5.6	4.49	0.54785	.	0.282155	0.43110	D	0.000602	T	0.07458	0.0188	N	0.02830	-0.485	0.37215	D	0.904985	B	0.14438	0.01	B	0.13407	0.009	T	0.27872	-1.0061	9	.	.	.	-12.2823	6.602	0.22705	0.0:0.2019:0.0:0.7981	.	604	Q9BX63	FANCJ_HUMAN	S	604	ENSP00000259008:N604S	.	N	-	2	0	BRIP1	57212528	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	2.009000	0.40903	2.127000	0.65507	0.533000	0.62120	AAT	.	.		0.373	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
SALL3	27164	hgsc.bcm.edu	37	18	76753069	76753069	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr18:76753069A>G	ENST00000537592.2	+	2	1078	c.1078A>G	c.(1078-1080)Agt>Ggt	p.S360G	SALL3_ENST00000536229.3_Missense_Mutation_p.S227G|SALL3_ENST00000575389.2_Missense_Mutation_p.S360G	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	360					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGCCTGCCAAGTCCGCTTCT	0.736																																					p.S360G		Atlas-SNP	.											.	SALL3	162	.	0			c.A1078G						.						11.0	13.0	12.0					18																	76753069		2164	4253	6417	SO:0001583	missense	27164	exon2			CTGCCAAGTCCGC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1078A>G	chr18.hg19:g.76753069A>G	ENSP00000441823:p.Ser360Gly	91.0	0.0		60.0	22.0	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	hg19	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	A	9.948	1.219310	0.22373	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.11277	2.79	4.37	4.37	0.52481	.	0.399043	0.22848	N	0.054888	T	0.08802	0.0218	N	0.21373	0.66	0.29757	N	0.835837	B	0.20261	0.043	B	0.22601	0.04	T	0.08806	-1.0704	10	0.33141	T	0.24	-23.0361	13.755	0.62930	1.0:0.0:0.0:0.0	.	360	Q9BXA9	SALL3_HUMAN	G	360;360;92	ENSP00000441823:S360G	ENSP00000299466:S360G	S	+	1	0	SALL3	74854057	1.000000	0.71417	0.793000	0.32043	0.011000	0.07611	4.806000	0.62569	1.841000	0.53522	0.377000	0.23210	AGT	.	.		0.736	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ARHGEF1	9138	hgsc.bcm.edu	37	19	42409114	42409114	+	Silent	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr19:42409114C>T	ENST00000354532.3	+	23	2323	c.2175C>T	c.(2173-2175)ttC>ttT	p.F725F	ARHGEF1_ENST00000337665.4_Silent_p.F740F|ARHGEF1_ENST00000347545.4_Silent_p.F692F|ARHGEF1_ENST00000378152.4_Silent_p.F707F|ARHGEF1_ENST00000599846.1_Silent_p.F781F	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	725	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		ACAAAGCCTTCTACGTCCTTT	0.597																																					p.F740F		Atlas-SNP	.											.	ARHGEF1	95	.	0			c.C2220T						.						62.0	58.0	59.0					19																	42409114		2203	4300	6503	SO:0001819	synonymous_variant	9138	exon23			AGCCTTCTACGTC	U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2175C>T	chr19.hg19:g.42409114C>T		62.0	0.0		62.0	18.0	NM_199002	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Silent	SNP	ENST00000354532.3	hg19	CCDS12591.1																																																																																			.	.		0.597	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002	
ZSWIM1	90204	hgsc.bcm.edu	37	20	44511555	44511555	+	Silent	SNP	T	T	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr20:44511555T>A	ENST00000372523.1	+	2	419	c.324T>A	c.(322-324)ctT>ctA	p.L108L	ZSWIM1_ENST00000372520.1_Silent_p.L108L	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	108						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				AGGGTCATCTTGCCCGAGCAG	0.517																																					p.L108L		Atlas-SNP	.											.	ZSWIM1	35	.	0			c.T324A						.						79.0	75.0	77.0					20																	44511555		2203	4300	6503	SO:0001819	synonymous_variant	90204	exon2			TCATCTTGCCCGA	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.324T>A	chr20.hg19:g.44511555T>A		184.0	0.0		177.0	56.0	NM_080603	Q5JZH2|Q9BR12|Q9BV30	Silent	SNP	ENST00000372523.1	hg19	CCDS13382.2																																																																																			.	.		0.517	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
SLC7A4	6545	hgsc.bcm.edu	37	22	21384617	21384617	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr22:21384617G>A	ENST00000382932.2	-	3	1073	c.1006C>T	c.(1006-1008)Ctc>Ttc	p.L336F	AC002472.11_ENST00000450652.1_RNA|SLC7A4_ENST00000403586.1_Missense_Mutation_p.L336F	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	336					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GAGAAGAGGAGGCTGAGCAGG	0.642																																					p.L336F		Atlas-SNP	.											.	SLC7A4	50	.	0			c.C1006T						.						48.0	39.0	42.0					22																	21384617		2203	4300	6503	SO:0001583	missense	6545	exon3			AGAGGAGGCTGAG	AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.1006C>T	chr22.hg19:g.21384617G>A	ENSP00000372390:p.Leu336Phe	215.0	0.0		175.0	23.0	NM_004173	Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Missense_Mutation	SNP	ENST00000382932.2	hg19	CCDS33608.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.265229	0.23136	.	.	ENSG00000099960	ENST00000403586;ENST00000382932	D;D	0.90563	-2.69;-2.69	4.69	2.52	0.30459	Amino acid permease domain (1);	0.363759	0.32343	N	0.006224	T	0.78916	0.4359	N	0.12182	0.205	0.27664	N	0.946971	B	0.09022	0.002	B	0.12156	0.007	T	0.68368	-0.5427	10	0.52906	T	0.07	.	5.6062	0.17381	0.0:0.0985:0.1818:0.7197	.	336	O43246	CTR4_HUMAN	F	336	ENSP00000384278:L336F;ENSP00000372390:L336F	ENSP00000372390:L336F	L	-	1	0	SLC7A4	19714617	1.000000	0.71417	0.881000	0.34555	0.227000	0.25037	3.707000	0.54838	0.403000	0.25479	-0.410000	0.06199	CTC	.	.		0.642	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320467.1	NM_004173	
EP300	2033	hgsc.bcm.edu	37	22	41545769	41545769	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr22:41545769A>G	ENST00000263253.7	+	14	3603	c.2384A>G	c.(2383-2385)cAa>cGa	p.Q795R		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	795					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TAACAGGCACAAATGTCTAGT	0.408			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.Q795R		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.A2384G						.						41.0	40.0	41.0					22																	41545769		2203	4300	6503	SO:0001583	missense	2033	exon14	Familial Cancer Database	Broad Thumb-Hallux syndrome	AGGCACAAATGTC	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2384A>G	chr22.hg19:g.41545769A>G	ENSP00000263253:p.Gln795Arg	78.0	0.0		73.0	27.0	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	hg19	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444442	0.63178	.	.	ENSG00000100393	ENST00000263253	D	0.84223	-1.82	5.84	5.84	0.93424	.	0.000000	0.43919	D	0.000510	D	0.89608	0.6764	M	0.72118	2.19	0.38127	D	0.938043	D	0.58620	0.983	P	0.58130	0.833	D	0.91742	0.5405	10	0.87932	D	0	-8.2779	12.1193	0.53883	0.857:0.143:0.0:0.0	.	795	Q09472	EP300_HUMAN	R	795	ENSP00000263253:Q795R	ENSP00000263253:Q795R	Q	+	2	0	EP300	39875715	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.969000	0.63735	2.243000	0.73865	0.482000	0.46254	CAA	.	.		0.408	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
MAOB	4129	hgsc.bcm.edu	37	X	43698252	43698252	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chrX:43698252C>A	ENST00000378069.4	-	3	289		c.e3-1		MAOB_ENST00000487544.1_Splice_Site|MAOB_ENST00000536181.1_Splice_Site|MAOB_ENST00000538942.1_Splice_Site	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B						negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	CCTTTTGGTTCTGTTTTCCCA	0.343																																					.		Atlas-SNP	.											.	MAOB	52	.	0			c.142-1G>T						.						76.0	67.0	70.0					X																	43698252		2203	4300	6503	SO:0001630	splice_region_variant	4129	exon4			TTGGTTCTGTTTT		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.142-1G>T	chrX.hg19:g.43698252C>A		87.0	0.0		58.0	26.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Splice_Site	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758819	0.31137	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2696	0.90064	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAOB	43583196	1.000000	0.71417	0.998000	0.56505	0.080000	0.17528	6.996000	0.76263	2.339000	0.79563	0.513000	0.50165	.	.	.		0.343	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	Intron
MT-CO1	4512	hgsc.bcm.edu	37	M	6579	6579	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chrM:6579G>A	ENST00000361624.2	+	1	676	c.676G>A	c.(676-678)Gga>Aga	p.G226R	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	226					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCGCCGGAGGAGGAGACCCCA	0.473																																					p.G226X		Atlas-SNP	.											.	.	.	.	0			c.G676A						.																																			SO:0001583	missense	5742	exon1			GGAGGAGGAGACC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.676G>A	chrM.hg19:g.6579G>A	ENSP00000354499:p.Gly226Arg	20.0	0.0		22.0	17.0	ENST00000361624	Q34770	Nonsense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.473	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND5	4540	hgsc.bcm.edu	37	M	12360	12360	+	Silent	SNP	C	C	T			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chrM:12360C>T	ENST00000361567.2	+	1	24	c.24C>T	c.(22-24)acC>acT	p.T8T	MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	0					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACTACTATAACCACCCTAACC	0.398																																					p.T8T		Atlas-SNP	.											.	.	.	.	0			c.C24T						.																																			SO:0001819	synonymous_variant	0	exon1			TATAACCACCCTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.24C>T	chrM.hg19:g.12360C>T		28.0	0.0		19.0	13.0	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.398	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MYO9B	4650	hgsc.bcm.edu	37	19	17322910	17322911	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr19:17322910_17322911delGA	ENST00000594824.1	+	40	6412_6413	c.6265_6266delGA	c.(6265-6267)gagfs	p.E2089fs	MYO9B_ENST00000397274.2_3'UTR|MYO9B_ENST00000595618.1_3'UTR			Q13459	MYO9B_HUMAN	myosin IXB	2089	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GGGTGCCCGGGAGGCGGCTGCC	0.728																																					p.2088_2089del		Atlas-INDEL	.											.	MYO9B	264	.	0			c.6264_6265del						.																																			SO:0001589	frameshift_variant	4650	exon40			.		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.6265_6266delGA	chr19.hg19:g.17322910_17322911delGA	ENSP00000471367:p.Glu2089fs	162.0	0.0		170.0	50.0	NM_004145	O75314|Q9NUJ2|Q9UHN0	Frame_Shift_Del	DEL	ENST00000594824.1	hg19																																																																																				.	.		0.728	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
KCNN4	3783	hgsc.bcm.edu	37	19	44273601	44273601	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr19:44273601delT	ENST00000262888.3	-	6	1437	c.1042delA	c.(1042-1044)atcfs	p.I348fs		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	348					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CACGCGTTGATGGCGGCCAGC	0.587																																					p.I348fs		Atlas-INDEL	.											.	KCNN4	37	.	0			c.1043delT						.						74.0	67.0	69.0					19																	44273601		2203	4300	6503	SO:0001589	frameshift_variant	3783	exon6			.	AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.1042delA	chr19.hg19:g.44273601delT	ENSP00000262888:p.Ile348fs	70.0	0.0		38.0	11.0	NM_002250	Q53XR4	Frame_Shift_Del	DEL	ENST00000262888.3	hg19	CCDS12630.1																																																																																			.	.		0.587	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	
VPRBP	9730	hgsc.bcm.edu	37	3	51475613	51475613	+	Intron	DEL	G	G	-			TCGA-DD-AAD3-01A-11D-A40R-10	TCGA-DD-AAD3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de0a6b4c-0602-40a8-baa1-05b412f17031	ade9b5f7-213a-40a5-9ccd-45c50c735824	g.chr3:51475613delG	ENST00000335891.5	-	6	682							Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein						B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CTGTCACCCTGTTTTGCTGAC	0.428																																					p.Q272fs		Atlas-INDEL	.											.	VPRBP	107	.	0			c.815delA						.						275.0	260.0	265.0					3																	51475613		1906	4123	6029	SO:0001627	intron_variant	9730	exon8			.	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.672+141C>-	chr3.hg19:g.51475613delG		173.0	0.0		139.0	42.0	NM_014703	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Frame_Shift_Del	DEL	ENST00000335891.5	hg19																																																																																				.	.		0.428	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
