#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTLL10	254173	hgsc.bcm.edu	37	1	1119315	1119315	+	Silent	SNP	G	G	A	rs371622937		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:1119315G>A	ENST00000379290.1	+	12	1277	c.1104G>A	c.(1102-1104)ccG>ccA	p.P368P	TTLL10_ENST00000379289.1_Silent_p.P368P|TTLL10_ENST00000379288.3_Silent_p.P295P			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	368	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCCAGAACCCGCTGCTGGTGG	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17086	0.0		0.001	False		,,,				2504	0.0				p.P368P		Atlas-SNP	.											.	TTLL10	66	.	0			c.G1104A						.	G	,	0,4406		0,0,2203	266.0	221.0	237.0		1104,885	-7.4	0.4	1		237	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TTLL10	NM_001130045.1,NM_153254.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	368/674,295/405	1119315	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	254173	exon12			GAACCCGCTGCTG	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.1104G>A	chr1.hg19:g.1119315G>A		82.0	0.0		60.0	20.0	NM_001130045	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Silent	SNP	ENST00000379290.1	hg19	CCDS44036.1																																																																																			.	.		0.642	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002421.3	NM_153254	
ARID1A	8289	hgsc.bcm.edu	37	1	27089690	27089690	+	Silent	SNP	G	G	C	rs149901342		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:27089690G>C	ENST00000324856.7	+	8	3017	c.2646G>C	c.(2644-2646)ggG>ggC	p.G882G	ARID1A_ENST00000457599.2_Silent_p.G882G|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Silent_p.G499G	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	882					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTGGGTCAGGGATGTGTCCCC	0.567			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.G882G		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.G2646C						.	G	,	0,4406		0,0,2203	60.0	54.0	56.0		2646,2646	4.7	1.0	1	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ARID1A	NM_006015.4,NM_139135.2	,	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	,	882/2286,882/2069	27089690	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8289	exon8			GTCAGGGATGTGT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2646G>C	chr1.hg19:g.27089690G>C		201.0	0.0		146.0	52.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	G|1.000;C|0.000		0.567	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
RCC1	1104	hgsc.bcm.edu	37	1	28863259	28863259	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:28863259G>A	ENST00000373833.6	+	12	1223	c.938G>A	c.(937-939)gGa>gAa	p.G313E	RCC1_ENST00000398958.2_Splice_Site_p.G313E|RCC1_ENST00000373831.3_Splice_Site_p.G344E|RCC1_ENST00000373832.1_Splice_Site_p.G313E			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	313					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCCCATAGGAAAAGCATAC	0.602																																					p.G344E		Atlas-SNP	.											.	RCC1	61	.	0			c.G1031A						.						86.0	87.0	87.0					1																	28863259		2203	4300	6503	SO:0001630	splice_region_variant	1104	exon10			CCATAGGAAAAGC	X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.938-1G>A	chr1.hg19:g.28863259G>A		49.0	0.0		51.0	19.0	NM_001048194	Q16269|Q6NT97	Missense_Mutation	SNP	ENST00000373833.6	hg19	CCDS323.1	.	.	.	.	.	.	.	.	.	.	G	32	5.132352	0.94473	.	.	ENSG00000180198	ENST00000398958;ENST00000373833;ENST00000373832;ENST00000373831;ENST00000411533	D;D;D;D;D	0.98028	-4.67;-4.67;-4.67;-4.67;-4.67	5.8	5.8	0.92144	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.047701	0.85682	D	0.000000	D	0.99284	0.9750	H	0.97491	4.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98829	1.0750	9	.	.	.	.	18.6252	0.91334	0.0:0.0:1.0:0.0	.	344;330;313	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	E	313;313;313;344;330	ENSP00000381931:G313E;ENSP00000362939:G313E;ENSP00000362938:G313E;ENSP00000362937:G344E;ENSP00000413644:G330E	.	G	+	2	0	RCC1	28735846	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.824000	0.99380	2.741000	0.93983	0.655000	0.94253	GGA	.	.		0.602	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010323.3	NM_001269	Missense_Mutation
EPHA10	284656	hgsc.bcm.edu	37	1	38227675	38227675	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:38227675C>T	ENST00000373048.4	-	3	251	c.252G>A	c.(250-252)caG>caA	p.Q84Q	EPHA10_ENST00000427468.2_Silent_p.Q84Q|EPHA10_ENST00000319637.6_Silent_p.Q84Q	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	84	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCAGTTGTCCTGGTTGGGCT	0.612																																					p.Q84Q		Atlas-SNP	.											.	EPHA10	120	.	0			c.G252A						.						92.0	81.0	85.0					1																	38227675		2203	4300	6503	SO:0001819	synonymous_variant	284656	exon3			GTTGTCCTGGTTG	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.252G>A	chr1.hg19:g.38227675C>T		89.0	0.0		72.0	32.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	hg19	CCDS41305.1																																																																																			.	.		0.612	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
C8A	731	hgsc.bcm.edu	37	1	57320606	57320606	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:57320606T>A	ENST00000361249.3	+	1	128	c.32T>A	c.(31-33)tTg>tAg	p.L11*		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	11					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						ATCTTGTCTTTGATGACTTGT	0.448																																					p.L11X		Atlas-SNP	.											.	C8A	103	.	0			c.T32A						.						209.0	160.0	177.0					1																	57320606		2203	4300	6503	SO:0001587	stop_gained	731	exon1			TGTCTTTGATGAC	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.32T>A	chr1.hg19:g.57320606T>A	ENSP00000354458:p.Leu11*	145.0	0.0		115.0	36.0	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Nonsense_Mutation	SNP	ENST00000361249.3	hg19	CCDS606.1	.	.	.	.	.	.	.	.	.	.	T	37	6.419765	0.97550	.	.	ENSG00000157131	ENST00000361249	.	.	.	4.94	3.78	0.43462	.	0.363846	0.21860	N	0.068041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.4758	7.4091	0.27007	0.0:0.0992:0.0:0.9008	.	.	.	.	X	11	.	ENSP00000354458:L11X	L	+	2	0	C8A	57093194	0.912000	0.30974	0.953000	0.39169	0.996000	0.88848	1.457000	0.35212	2.073000	0.62155	0.533000	0.62120	TTG	.	.		0.448	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
JAK1	3716	hgsc.bcm.edu	37	1	65310503	65310503	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:65310503T>A	ENST00000342505.4	-	16	2433	c.2185A>T	c.(2185-2187)Agt>Tgt	p.S729C	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	729	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CCACACTCACTGTCGATGCCC	0.547			Mis		ALL																																p.S729C		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	JAK1,NS,carcinoma,0,2	JAK1	209	.	0			c.A2185T						.						96.0	113.0	107.0					1																	65310503		2115	4222	6337	SO:0001583	missense	3716	exon16			ACTCACTGTCGAT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2185A>T	chr1.hg19:g.65310503T>A	ENSP00000343204:p.Ser729Cys	158.0	0.0		135.0	59.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.814614	0.50527	.	.	ENSG00000162434	ENST00000342505	T	0.76839	-1.05	5.0	2.65	0.31530	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.65312	0.2679	L	0.54965	1.715	0.22552	N	0.998997	P	0.46142	0.873	P	0.46850	0.529	T	0.57177	-0.7856	9	0.72032	D	0.01	-5.9131	9.7115	0.40247	0.0:0.1625:0.0:0.8375	.	729	P23458	JAK1_HUMAN	C	729	ENSP00000343204:S729C	ENSP00000343204:S729C	S	-	1	0	JAK1	65083091	0.100000	0.21855	0.477000	0.27303	0.441000	0.31987	2.149000	0.42244	0.940000	0.37473	0.460000	0.39030	AGT	.	.		0.547	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
CLCA1	1179	hgsc.bcm.edu	37	1	86948018	86948018	+	Missense_Mutation	SNP	C	C	A	rs149585400		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:86948018C>A	ENST00000234701.3	+	6	1039	c.688C>A	c.(688-690)Cgc>Agc	p.R230S	CLCA1_ENST00000394711.1_Missense_Mutation_p.R230S			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	230					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TCTCCAATCCCGCCAGACGGA	0.428																																					p.R230S		Atlas-SNP	.											.	CLCA1	109	.	0			c.C688A						.						133.0	129.0	130.0					1																	86948018		2203	4300	6503	SO:0001583	missense	1179	exon5			CAATCCCGCCAGA		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.688C>A	chr1.hg19:g.86948018C>A	ENSP00000234701:p.Arg230Ser	165.0	0.0		119.0	45.0	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	hg19	CCDS709.1	.	.	.	.	.	.	.	.	.	.	C	1.086	-0.665490	0.03428	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.10668	2.85;2.85	5.49	-5.56	0.02529	Chloride channel calcium-activated (1);	3.186930	0.00678	N	0.000661	T	0.00784	0.0026	N	0.04260	-0.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35276	-0.9795	10	0.06757	T	0.87	18.9392	0.5096	0.00593	0.3297:0.271:0.1846:0.2146	.	230	A8K7I4	CLCA1_HUMAN	S	230	ENSP00000234701:R230S;ENSP00000378200:R230S	ENSP00000234701:R230S	R	+	1	0	CLCA1	86720606	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.815000	0.00359	-0.742000	0.04790	0.655000	0.94253	CGC	.	C|1.000;T|0.000		0.428	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
ABCA4	24	hgsc.bcm.edu	37	1	94522310	94522310	+	Silent	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:94522310G>A	ENST00000370225.3	-	15	2315	c.2229C>T	c.(2227-2229)gcC>gcT	p.A743A	ABCA4_ENST00000535735.1_Intron	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	743					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GCATGATGGTGGCAGTGGAGA	0.512																																					p.A743A		Atlas-SNP	.											.	ABCA4	275	.	0			c.C2229T						.						109.0	96.0	101.0					1																	94522310		2203	4300	6503	SO:0001819	synonymous_variant	24	exon15			GATGGTGGCAGTG	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2229C>T	chr1.hg19:g.94522310G>A		208.0	0.0		135.0	30.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	hg19	CCDS747.1																																																																																			.	.		0.512	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
STXBP3	6814	hgsc.bcm.edu	37	1	109351498	109351498	+	Nonstop_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:109351498A>G	ENST00000370008.3	+	19	1828	c.1778A>G	c.(1777-1779)tAg>tGg	p.*593W		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	0					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AAAGATGAATAGCATTTCTTT	0.294																																					p.X593W		Atlas-SNP	.											.	STXBP3	44	.	0			c.A1778G						.						92.0	101.0	98.0					1																	109351498		2203	4299	6502	SO:0001578	stop_lost	6814	exon19			ATGAATAGCATTT	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1778A>G	chr1.hg19:g.109351498A>G	ENSP00000359025:p.*593Trpext*16	103.0	0.0		88.0	37.0	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	hg19	CCDS790.1	.	.	.	.	.	.	.	.	.	.	A	4.174	0.030769	0.08101	.	.	ENSG00000116266	ENST00000370008	.	.	.	5.08	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4814	0.38902	0.9162:0.0:0.0838:0.0	.	.	.	.	W	593	.	.	X	+	2	0	STXBP3	109153021	0.998000	0.40836	0.964000	0.40570	0.045000	0.14185	2.905000	0.48727	1.913000	0.55393	0.482000	0.46254	TAG	.	.		0.294	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
KCNA10	3744	hgsc.bcm.edu	37	1	111059915	111059915	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:111059915T>C	ENST00000369771.2	-	1	1882	c.1495A>G	c.(1495-1497)Aag>Gag	p.K499E		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	499					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	CCATTGGTCTTATTAAGAGAG	0.473																																					p.K499E		Atlas-SNP	.											.	KCNA10	92	.	0			c.A1495G						.						167.0	161.0	163.0					1																	111059915		2203	4300	6503	SO:0001583	missense	3744	exon1			TGGTCTTATTAAG	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.1495A>G	chr1.hg19:g.111059915T>C	ENSP00000358786:p.Lys499Glu	112.0	0.0		74.0	15.0	NM_005549		Missense_Mutation	SNP	ENST00000369771.2	hg19	CCDS826.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.948675	0.34377	.	.	ENSG00000143105	ENST00000369771	D	0.97016	-4.21	5.78	4.59	0.56863	.	0.307811	0.29002	N	0.013450	D	0.90954	0.7156	M	0.66939	2.045	0.31947	N	0.610119	P	0.35745	0.518	B	0.27380	0.079	D	0.89599	0.3833	10	0.41790	T	0.15	.	11.6274	0.51153	0.0:0.0:0.1485:0.8515	.	499	Q16322	KCA10_HUMAN	E	499	ENSP00000358786:K499E	ENSP00000358786:K499E	K	-	1	0	KCNA10	110861438	1.000000	0.71417	0.925000	0.36789	0.975000	0.68041	4.132000	0.57977	2.211000	0.71520	0.459000	0.35465	AAG	.	.		0.473	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
GJA8	2703	hgsc.bcm.edu	37	1	147380358	147380358	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:147380358C>A	ENST00000369235.1	+	1	276	c.276C>A	c.(274-276)taC>taA	p.Y92*	GJA8_ENST00000240986.4_Nonsense_Mutation_p.Y92*			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	92					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					CCCTGATGTACGTGGGGCACG	0.657																																					p.Y92X	Melanoma(76;1255 1795 8195 52096)	Atlas-SNP	.											.	GJA8	108	.	0			c.C276A						.						116.0	92.0	100.0					1																	147380358		2203	4300	6503	SO:0001587	stop_gained	2703	exon2			GATGTACGTGGGG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.276C>A	chr1.hg19:g.147380358C>A	ENSP00000358238:p.Tyr92*	70.0	0.0		79.0	56.0	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Nonsense_Mutation	SNP	ENST00000369235.1	hg19	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	c	33	5.246641	0.95305	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	.	.	.	5.2	2.15	0.27550	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8237	0.29303	0.1299:0.7277:0.0:0.1424	.	.	.	.	X	92	.	ENSP00000240986:Y92X	Y	+	3	2	GJA8	145846982	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	2.125000	0.42016	0.517000	0.28361	0.491000	0.48974	TAC	.	.		0.657	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
RIIAD1	284485	hgsc.bcm.edu	37	1	151701300	151701300	+	Silent	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:151701300G>A	ENST00000479191.1	+	4	267	c.267G>A	c.(265-267)aaG>aaA	p.K89K	AL589765.1_ENST00000442233.2_3'UTR|RIIAD1_ENST00000326413.3_Silent_p.K99K|RIIAD1_ENST00000426175.1_3'UTR	NM_001144956.1	NP_001138428.1	A6NNX1	RIAD1_HUMAN	regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1	89										endometrium(1)	1						TTAAAGACAAGAAAGCGGCTT	0.443																																					p.K89K		Atlas-SNP	.											.	RIIAD1	6	.	0			c.G267A						.						172.0	128.0	141.0					1																	151701300		692	1591	2283	SO:0001819	synonymous_variant	284485	exon4			AGACAAGAAAGCG		CCDS53368.1	1q21.3	2011-01-11	2011-01-11	2011-01-11	ENSG00000178796	ENSG00000178796			26686	protein-coding gene	gene with protein product			"""non-protein coding RNA 166"", ""chromosome 1 open reading frame 230"""	NCRNA00166, C1orf230			Standard	NM_001144956		Approved	FLJ36032	uc010pdj.1	A6NNX1	OTTHUMG00000013055	ENST00000479191.1:c.267G>A	chr1.hg19:g.151701300G>A		55.0	0.0		73.0	47.0	NM_001144956		Silent	SNP	ENST00000479191.1	hg19	CCDS53368.1																																																																																			.	.		0.443	RIIAD1-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036631.2	NM_001144956	
TCHH	7062	hgsc.bcm.edu	37	1	152080637	152080637	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:152080637G>A	ENST00000368804.1	-	2	5055	c.5056C>T	c.(5056-5058)Cgc>Tgc	p.R1686C		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1686	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGCTCTTGGCGGCGCAGCTGC	0.607																																					p.R1686C		Atlas-SNP	.											.	TCHH	275	.	0			c.C5056T						.						93.0	92.0	93.0					1																	152080637		1901	4112	6013	SO:0001583	missense	7062	exon3			CTTGGCGGCGCAG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5056C>T	chr1.hg19:g.152080637G>A	ENSP00000357794:p.Arg1686Cys	118.0	0.0		144.0	105.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931220	0.52866	.	.	ENSG00000159450	ENST00000368804	T	0.05649	3.41	4.25	4.25	0.50352	.	.	.	.	.	T	0.12220	0.0297	M	0.72118	2.19	0.36811	D	0.88586	D	0.89917	1.0	D	0.68621	0.959	T	0.00664	-1.1620	9	0.52906	T	0.07	.	9.4177	0.38532	0.0:0.0:0.7877:0.2123	.	1686	Q07283	TRHY_HUMAN	C	1686	ENSP00000357794:R1686C	ENSP00000357794:R1686C	R	-	1	0	TCHH	150347261	.	.	0.965000	0.40720	0.879000	0.50718	.	.	2.193000	0.70182	0.467000	0.42956	CGC	.	.		0.607	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
CEP350	9857	hgsc.bcm.edu	37	1	179993651	179993651	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:179993651T>A	ENST00000367607.3	+	14	3902	c.3484T>A	c.(3484-3486)Tct>Act	p.S1162T		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1162	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AGGAGCCCAGTCTGCTGCATC	0.433																																					p.S1162T		Atlas-SNP	.											.	CEP350	418	.	0			c.T3484A						.						97.0	82.0	87.0					1																	179993651		2203	4300	6503	SO:0001583	missense	9857	exon14			GCCCAGTCTGCTG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3484T>A	chr1.hg19:g.179993651T>A	ENSP00000356579:p.Ser1162Thr	85.0	0.0		105.0	13.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	hg19	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433363	0.83776	.	.	ENSG00000135837	ENST00000367607	T	0.58940	0.3	5.61	5.61	0.85477	.	0.000000	0.44285	D	0.000461	T	0.64549	0.2608	L	0.32530	0.975	0.36378	D	0.86171	D;D	0.69078	0.982;0.997	D;D	0.73380	0.952;0.98	T	0.68884	-0.5291	9	.	.	.	.	13.1881	0.59693	0.0:0.0:0.0:1.0	.	1162;1162	E7EU22;Q5VT06	.;CE350_HUMAN	T	1162	ENSP00000356579:S1162T	.	S	+	1	0	CEP350	178260274	1.000000	0.71417	0.977000	0.42913	0.941000	0.58515	4.961000	0.63681	2.129000	0.65627	0.460000	0.39030	TCT	.	.		0.433	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
PIGR	5284	hgsc.bcm.edu	37	1	207106368	207106368	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:207106368G>A	ENST00000356495.4	-	7	2032	c.1849C>T	c.(1849-1851)Caa>Taa	p.Q617*	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	617					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCATCGGCTTGATCTCTTGTA	0.547																																					p.Q617X		Atlas-SNP	.											.	PIGR	98	.	0			c.C1849T						.						112.0	109.0	110.0					1																	207106368		2203	4300	6503	SO:0001587	stop_gained	5284	exon7			CGGCTTGATCTCT		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1849C>T	chr1.hg19:g.207106368G>A	ENSP00000348888:p.Gln617*	56.0	0.0		76.0	6.0	NM_002644	Q68D81|Q8IZY7	Nonsense_Mutation	SNP	ENST00000356495.4	hg19	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853304	0.91355	.	.	ENSG00000162896	ENST00000356495	.	.	.	4.29	-1.02	0.10135	.	1.531900	0.03497	N	0.217532	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-10.6851	6.1526	0.20320	0.181:0.4485:0.3705:0.0	.	.	.	.	X	617	.	ENSP00000348888:Q617X	Q	-	1	0	PIGR	205172991	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.038000	0.13862	-0.153000	0.11137	-0.305000	0.09177	CAA	.	.		0.547	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
CCDC185	164127	hgsc.bcm.edu	37	1	223568318	223568318	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:223568318A>T	ENST00000366875.3	+	1	1604	c.1501A>T	c.(1501-1503)Atg>Ttg	p.M501L		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		501										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		ACAGAGGAAGATGCGCAAAAG	0.607																																					p.M501L		Atlas-SNP	.											.	C1orf65	71	.	0			c.A1501T						.						86.0	102.0	97.0					1																	223568318		2203	4300	6503	SO:0001583	missense	164127	exon1			AGGAAGATGCGCA																												ENST00000366875.3:c.1501A>T	chr1.hg19:g.223568318A>T	ENSP00000355840:p.Met501Leu	122.0	0.0		184.0	18.0	NM_152610	Q8N746|Q8NA93	Missense_Mutation	SNP	ENST00000366875.3	hg19	CCDS1537.1	.	.	.	.	.	.	.	.	.	.	A	2.602	-0.292790	0.05568	.	.	ENSG00000178395	ENST00000366875	T	0.21031	2.03	5.48	0.268	0.15626	.	.	.	.	.	T	0.07683	0.0193	N	0.11427	0.14	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38457	-0.9660	9	0.13470	T	0.59	.	0.8626	0.01196	0.374:0.2223:0.2588:0.1449	.	501	Q8N715	CA065_HUMAN	L	501	ENSP00000355840:M501L	ENSP00000355840:M501L	M	+	1	0	C1orf65	221634941	0.000000	0.05858	0.001000	0.08648	0.084000	0.17831	-0.281000	0.08456	0.465000	0.27167	-0.408000	0.06270	ATG	.	.		0.607	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
OBSCN	84033	hgsc.bcm.edu	37	1	228467638	228467638	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:228467638G>A	ENST00000422127.1	+	28	7557	c.7513G>A	c.(7513-7515)Gac>Aac	p.D2505N	OBSCN_ENST00000284548.11_Missense_Mutation_p.D2505N|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.D2934N|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000359599.6_Missense_Mutation_p.D1352N	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2505	Ig-like 24.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTACAAGGATGACACGCCCCT	0.612																																					p.D2934N		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G8800A						.						23.0	29.0	27.0					1																	228467638		2123	4220	6343	SO:0001583	missense	84033	exon33			AAGGATGACACGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7513G>A	chr1.hg19:g.228467638G>A	ENSP00000409493:p.Asp2505Asn	148.0	0.0		150.0	10.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	g	15.20	2.763802	0.49574	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706	T;T;T	0.41065	1.01;1.01;1.01	5.01	4.09	0.47781	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.308279	0.30704	N	0.009060	T	0.43166	0.1235	L	0.33792	1.035	0.25845	N	0.984009	D;B;D	0.61697	0.99;0.019;0.981	D;B;P	0.64042	0.921;0.005;0.813	T	0.21655	-1.0239	10	0.19147	T	0.46	.	6.1594	0.20356	0.1757:0.2065:0.6178:0.0	.	2505;2505;2505	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	N	2505;2505;1352;204	ENSP00000284548:D2505N;ENSP00000409493:D2505N;ENSP00000352613:D1352N	ENSP00000284548:D2505N	D	+	1	0	OBSCN	226534261	0.161000	0.22892	0.023000	0.16930	0.856000	0.48823	2.010000	0.40913	1.123000	0.41961	0.550000	0.68814	GAC	.	.		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RYR2	6262	hgsc.bcm.edu	37	1	237608813	237608813	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr1:237608813G>T	ENST00000366574.2	+	14	1600	c.1283G>T	c.(1282-1284)aGa>aTa	p.R428I	RYR2_ENST00000542537.1_Missense_Mutation_p.R412I|RYR2_ENST00000360064.6_Missense_Mutation_p.R426I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	428					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTTTCAATAGATTTATAAGG	0.373																																					p.R428I		Atlas-SNP	.											.	RYR2	1273	.	0			c.G1283T						.						133.0	126.0	128.0					1																	237608813		1849	4095	5944	SO:0001583	missense	6262	exon14			TCAATAGATTTAT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1283G>T	chr1.hg19:g.237608813G>T	ENSP00000355533:p.Arg428Ile	133.0	0.0		167.0	8.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649181	0.29336	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96651	-4.08;-4.05;-4.08	5.6	5.6	0.85130	.	0.284406	0.29653	N	0.011552	D	0.92990	0.7769	L	0.31926	0.97	0.80722	D	1	B	0.23806	0.091	B	0.15870	0.014	D	0.90249	0.4292	10	0.62326	D	0.03	.	14.4541	0.67404	0.0:0.0:0.8528:0.1471	.	428	Q92736	RYR2_HUMAN	I	428;426;412	ENSP00000355533:R428I;ENSP00000353174:R426I;ENSP00000443798:R412I	ENSP00000353174:R426I	R	+	2	0	RYR2	235675436	0.993000	0.37304	1.000000	0.80357	0.364000	0.29643	1.981000	0.40628	2.636000	0.89361	0.591000	0.81541	AGA	.	.		0.373	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
APOB	338	hgsc.bcm.edu	37	2	21236085	21236085	+	Missense_Mutation	SNP	C	C	G	rs13306187	byFrequency	TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:21236085C>G	ENST00000233242.1	-	25	4290	c.4163G>C	c.(4162-4164)cGt>cCt	p.R1388P		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1388			R -> H (in dbSNP:rs13306187).		artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.R1388H(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGTGGTAACGAGCCCGAAG	0.532																																					p.R1388P		Atlas-SNP	.											APOB,NS,malignant_melanoma,-1,1	APOB	761	.	1	Substitution - Missense(1)	endometrium(1)	c.G4163C						.						164.0	153.0	156.0					2																	21236085		2203	4300	6503	SO:0001583	missense	338	exon25			TGGTAACGAGCCC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4163G>C	chr2.hg19:g.21236085C>G	ENSP00000233242:p.Arg1388Pro	128.0	0.0		121.0	44.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	8.202	0.798337	0.16397	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00730	5.77	5.31	-10.5	0.00291	.	1.591350	0.03452	N	0.210873	T	0.00695	0.0023	L	0.36672	1.1	0.09310	N	0.999999	B	0.31730	0.337	B	0.30105	0.111	T	0.34477	-0.9827	10	0.38643	T	0.18	.	6.8848	0.24193	0.081:0.4751:0.2625:0.1814	.	1388	P04114	APOB_HUMAN	P	1388	ENSP00000233242:R1388P	ENSP00000233242:R1388P	R	-	2	0	APOB	21089590	0.000000	0.05858	0.002000	0.10522	0.140000	0.21249	-0.446000	0.06837	-1.859000	0.01156	-1.368000	0.01194	CGT	.	C|0.997;T|0.003		0.532	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
GPR113	165082	hgsc.bcm.edu	37	2	26536264	26536264	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:26536264G>T	ENST00000311519.1	-	9	1453	c.1454C>A	c.(1453-1455)gCc>gAc	p.A485D	GPR113_ENST00000421160.2_Missense_Mutation_p.A416D|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Missense_Mutation_p.A286D|GPR113_ENST00000541401.1_Missense_Mutation_p.A88D	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	485					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTGAACAAGGCCAGGAGCCT	0.627																																					p.A485D		Atlas-SNP	.											.	GPR113	134	.	0			c.C1454A						.						23.0	24.0	23.0					2																	26536264		2202	4300	6502	SO:0001583	missense	165082	exon9			AACAAGGCCAGGA	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1454C>A	chr2.hg19:g.26536264G>T	ENSP00000307831:p.Ala485Asp	142.0	0.0		98.0	37.0	NM_001145168	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	hg19	CCDS46239.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927315	0.34002	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.27557	1.66;3.13;3.13;3.13	5.84	-0.543	0.11851	.	.	.	.	.	T	0.21801	0.0525	L	0.50919	1.6	0.09310	N	0.999999	B;B;B;B	0.15141	0.001;0.012;0.0;0.002	B;B;B;B	0.15052	0.001;0.012;0.001;0.007	T	0.34179	-0.9839	9	0.15066	T	0.55	-1.5879	5.3695	0.16132	0.0685:0.1138:0.3509:0.4668	.	416;286;485;88	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	D	88;286;416;485	ENSP00000445729:A88D;ENSP00000327396:A286D;ENSP00000388537:A416D;ENSP00000307831:A485D	ENSP00000307831:A485D	A	-	2	0	GPR113	26389768	0.001000	0.12720	0.024000	0.17045	0.362000	0.29581	-0.074000	0.11450	-0.164000	0.10927	0.561000	0.74099	GCC	.	.		0.627	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
NRXN1	9378	hgsc.bcm.edu	37	2	51255333	51255333	+	Silent	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:51255333G>A	ENST00000406316.2	-	2	1555	c.79C>T	c.(79-81)Ctg>Ttg	p.L27L	NRXN1_ENST00000404971.1_Silent_p.L27L|NRXN1_ENST00000406859.3_Silent_p.L27L|NRXN1_ENST00000405581.1_Silent_p.L27L|NRXN1_ENST00000402717.3_Silent_p.L27L|NRXN1_ENST00000405472.3_Silent_p.L27L|NRXN1_ENST00000401669.2_Silent_p.L27L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	27					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CCGCTGCCCAGCTCCGCCCAG	0.697																																					p.L27L		Atlas-SNP	.											.	NRXN1	1118	.	0			c.C79T						.						4.0	6.0	5.0					2																	51255333		1880	4057	5937	SO:0001819	synonymous_variant	9378	exon2			TGCCCAGCTCCGC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.79C>T	chr2.hg19:g.51255333G>A		40.0	0.0		54.0	21.0	NM_004801	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	hg19	CCDS54360.1																																																																																			.	.		0.697	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
EHBP1	23301	hgsc.bcm.edu	37	2	63206420	63206420	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:63206420A>G	ENST00000263991.5	+	16	3145	c.2663A>G	c.(2662-2664)tAt>tGt	p.Y888C	EHBP1_ENST00000405015.3_Missense_Mutation_p.Y853C|EHBP1_ENST00000405289.1_Missense_Mutation_p.Y853C|EHBP1_ENST00000431489.1_Missense_Mutation_p.Y853C|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000354487.3_Missense_Mutation_p.Y853C	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	888						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CTTCCCAGCTATGGTGAAATG	0.463																																					p.Y888C		Atlas-SNP	.											.	EHBP1	127	.	0			c.A2663G						.						82.0	86.0	84.0					2																	63206420		2203	4300	6503	SO:0001583	missense	23301	exon16			CCAGCTATGGTGA	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2663A>G	chr2.hg19:g.63206420A>G	ENSP00000263991:p.Tyr888Cys	130.0	0.0		114.0	42.0	NM_015252	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	hg19	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.941118	0.73557	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.75154	-0.85;-0.85;-0.91;-0.9;-0.9	5.69	5.69	0.88448	.	0.153463	0.45867	D	0.000332	D	0.83843	0.5342	L	0.56769	1.78	0.50171	D	0.999857	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.84087	0.0388	10	0.48119	T	0.1	.	15.9451	0.79787	1.0:0.0:0.0:0.0	.	853;853;888	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	C	853;853;888;853;853	ENSP00000384143:Y853C;ENSP00000403783:Y853C;ENSP00000263991:Y888C;ENSP00000346482:Y853C;ENSP00000385524:Y853C	ENSP00000263991:Y888C	Y	+	2	0	EHBP1	63059924	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.310000	0.59141	2.177000	0.69029	0.533000	0.62120	TAT	.	.		0.463	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252	
SNRNP27	11017	hgsc.bcm.edu	37	2	70123665	70123665	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:70123665G>C	ENST00000244227.3	+	3	678	c.253G>C	c.(253-255)Gaa>Caa	p.E85Q	SNRNP27_ENST00000488986.1_3'UTR|SNRNP27_ENST00000409116.1_Missense_Mutation_p.E85Q	NM_006857.2	NP_006848.1	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa (U4/U6.U5)	85					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	11						aaagaGCAAAGAACGGCAGAT	0.323																																					p.E85Q		Atlas-SNP	.											.	SNRNP27	18	.	0			c.G253C						.						44.0	46.0	45.0					2																	70123665		2199	4300	6499	SO:0001583	missense	11017	exon3			AGCAAAGAACGGC	X76302	CCDS33219.1	2p14	2011-10-11			ENSG00000124380	ENSG00000124380			30240	protein-coding gene	gene with protein product	"""nucleic acid binding protein RY 1"""					7931148	Standard	NM_006857		Approved	RY1	uc002sfw.3	Q8WVK2	OTTHUMG00000152689	ENST00000244227.3:c.253G>C	chr2.hg19:g.70123665G>C	ENSP00000244227:p.Glu85Gln	77.0	0.0		64.0	14.0	NM_006857	Q15410	Missense_Mutation	SNP	ENST00000244227.3	hg19	CCDS33219.1	.	.	.	.	.	.	.	.	.	.	g	14.22	2.471214	0.43942	.	.	ENSG00000124380	ENST00000244227;ENST00000409116	T;T	0.35605	1.3;1.3	5.28	5.28	0.74379	Domain of unknown function DUF1777 (1);	0.167950	0.52532	D	0.000061	T	0.53254	0.1785	L	0.56769	1.78	0.46416	D	0.999034	D;P	0.62365	0.991;0.807	D;P	0.74023	0.982;0.728	T	0.37267	-0.9713	10	0.23302	T	0.38	.	14.285	0.66240	0.0:0.0:1.0:0.0	.	85;85	B8ZZ98;Q8WVK2	.;SNR27_HUMAN	Q	85	ENSP00000244227:E85Q;ENSP00000386608:E85Q	ENSP00000244227:E85Q	E	+	1	0	SNRNP27	69977169	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.313000	0.65798	2.750000	0.94351	0.585000	0.79938	GAA	.	.		0.323	SNRNP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327369.1	NM_006857	
ZNF638	27332	hgsc.bcm.edu	37	2	71591128	71591128	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:71591128C>G	ENST00000409544.1	+	5	2093	c.1463C>G	c.(1462-1464)tCt>tGt	p.S488C	ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Missense_Mutation_p.S488C|ZNF638_ENST00000264447.4_Missense_Mutation_p.S488C|ZNF638_ENST00000355812.3_Missense_Mutation_p.S488C	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	488	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						CGAAGACGTTCTCATTCCCCC	0.438																																					p.S488C		Atlas-SNP	.											.	ZNF638	179	.	0			c.C1463G						.						113.0	107.0	109.0					2																	71591128		2203	4300	6503	SO:0001583	missense	27332	exon5			GACGTTCTCATTC	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1463C>G	chr2.hg19:g.71591128C>G	ENSP00000386433:p.Ser488Cys	141.0	0.0		132.0	51.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	hg19	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194738	0.58017	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000394137;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.74632	-0.27;-0.86;0.3;-0.26;1.3;1.3	5.61	5.61	0.85477	.	0.168609	0.42053	D	0.000770	T	0.77691	0.4168	N	0.19112	0.55	0.39194	D	0.963026	D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999;0.999	D;D;D;D;P;D	0.85130	0.993;0.994;0.994;0.997;0.887;0.994	T	0.81444	-0.0930	10	0.72032	D	0.01	-11.8497	15.1409	0.72609	0.0:1.0:0.0:0.0	.	488;594;488;488;488;488	A8K583;F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;.;ZN638_HUMAN;.	C	488;594;67;488;488;488;488	ENSP00000386669:S488C;ENSP00000438189:S594C;ENSP00000348066:S488C;ENSP00000367033:S488C;ENSP00000264447:S488C;ENSP00000386433:S488C	ENSP00000264447:S488C	S	+	2	0	ZNF638	71444636	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.949000	0.56668	2.658000	0.90341	0.585000	0.79938	TCT	.	.		0.438	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
TSGA10	80705	hgsc.bcm.edu	37	2	99767195	99767195	+	Intron	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:99767195A>G	ENST00000393483.3	-	1	225				C2ORF15_ENST00000302513.2_Silent_p.T92T|C2ORF15_ENST00000409684.1_Silent_p.T92T	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						AAAACTTTACAAGGATTGAAG	0.393																																					p.T92T		Atlas-SNP	.											.	C2orf15	11	.	0			c.A276G						.						86.0	89.0	88.0					2																	99767195		2203	4300	6503	SO:0001627	intron_variant	150590	exon4			CTTTACAAGGATT	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.619+3960T>C	chr2.hg19:g.99767195A>G		477.0	0.0		418.0	120.0	NM_144706	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Silent	SNP	ENST00000393483.3	hg19	CCDS2037.1																																																																																			.	.		0.393	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
EIF5B	9669	hgsc.bcm.edu	37	2	99976706	99976706	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:99976706G>A	ENST00000289371.6	+	2	245	c.43G>A	c.(43-45)Gat>Aat	p.D15N		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	15					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAGCACCAAGGATGACATTGA	0.333																																					p.D15N	Colon(162;2388 2567 2705 3444)	Atlas-SNP	.											.	EIF5B	95	.	0			c.G43A						.						77.0	70.0	72.0					2																	99976706		1839	4086	5925	SO:0001583	missense	9669	exon2			ACCAAGGATGACA	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.43G>A	chr2.hg19:g.99976706G>A	ENSP00000289371:p.Asp15Asn	506.0	0.0		462.0	146.0	NM_015904	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	hg19	CCDS42721.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415768	0.83449	.	.	ENSG00000158417	ENST00000289371	T	0.47528	0.84	5.32	5.32	0.75619	.	.	.	.	.	T	0.52240	0.1722	M	0.77103	2.36	0.80722	D	1	B	0.31383	0.321	B	0.29663	0.105	T	0.52571	-0.8558	8	.	.	.	-22.6289	19.3507	0.94384	0.0:0.0:1.0:0.0	.	15	O60841	IF2P_HUMAN	N	15	ENSP00000289371:D15N	.	D	+	1	0	EIF5B	99343138	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.942000	0.92970	2.633000	0.89246	0.655000	0.94253	GAT	.	.		0.333	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
SEPT10	151011	hgsc.bcm.edu	37	2	110332246	110332246	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:110332246C>A	ENST00000397712.2	-	5	890	c.512G>T	c.(511-513)cGc>cTc	p.R171L	SEPT10_ENST00000397714.2_Missense_Mutation_p.R148L|SEPT10_ENST00000334001.6_Missense_Mutation_p.R38L|SEPT10_ENST00000415095.1_Missense_Mutation_p.R171L|SEPT10_ENST00000437928.1_Missense_Mutation_p.R156L|SEPT10_ENST00000356688.4_Missense_Mutation_p.R171L|SEPT10_ENST00000545389.1_Intron	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10	171	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						CACATGGATGCGAGAATCATG	0.443																																					p.R171L		Atlas-SNP	.											SEPT10_ENST00000397712,NS,carcinoma,0,4	SEPT10	58	.	0			c.G512T						.						137.0	128.0	131.0					2																	110332246		1933	4142	6075	SO:0001583	missense	151011	exon5			TGGATGCGAGAAT	AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.512G>T	chr2.hg19:g.110332246C>A	ENSP00000380824:p.Arg171Leu	109.0	1.0		95.0	31.0	NM_144710	B3KRQ9|Q86VP5|Q9HAH6	Missense_Mutation	SNP	ENST00000397712.2	hg19	CCDS46383.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541402	0.65085	.	.	ENSG00000186522	ENST00000352314;ENST00000356688;ENST00000397712;ENST00000397714;ENST00000334001;ENST00000437928;ENST00000415095	T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	4.78	4.78	0.61160	.	0.000000	0.64402	D	0.000004	D	0.88618	0.6485	H	0.97214	3.96	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.982	D;D;D;P	0.97110	1.0;1.0;0.999;0.78	D	0.92620	0.6107	10	0.87932	D	0	.	18.3425	0.90311	0.0:1.0:0.0:0.0	.	38;171;148;171	B7Z371;B5ME97;Q9P0V9-3;Q9P0V9	.;.;.;SEP10_HUMAN	L	129;171;171;148;38;156;171	ENSP00000349116:R171L;ENSP00000380824:R171L;ENSP00000380826:R148L;ENSP00000334234:R38L;ENSP00000407790:R156L;ENSP00000396728:R171L	ENSP00000334234:R38L	R	-	2	0	SEPT10	109689535	1.000000	0.71417	0.971000	0.41717	0.077000	0.17291	7.171000	0.77595	2.634000	0.89283	0.491000	0.48974	CGC	.	.		0.443	SEPT10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337804.1	NM_144710	
FZD5	7855	hgsc.bcm.edu	37	2	208633107	208633107	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:208633107C>T	ENST00000295417.3	-	2	910	c.357G>A	c.(355-357)ctG>ctA	p.L119L		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	119	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		ACTGGCGCATCAGCGGCGAGC	0.687																																					p.L119L		Atlas-SNP	.											.	FZD5	22	.	0			c.G357A						.						12.0	13.0	13.0					2																	208633107		2190	4278	6468	SO:0001819	synonymous_variant	7855	exon2			GCGCATCAGCGGC	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.357G>A	chr2.hg19:g.208633107C>T		27.0	0.0		24.0	12.0	NM_003468	A8K2X1|B2RCZ1|Q53R22	Silent	SNP	ENST00000295417.3	hg19	CCDS33366.1																																																																																			.	.		0.687	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
AGFG1	3267	hgsc.bcm.edu	37	2	228401645	228401645	+	Silent	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:228401645T>A	ENST00000310078.8	+	10	1574	c.1314T>A	c.(1312-1314)gcT>gcA	p.A438A	AGFG1_ENST00000409315.1_Silent_p.A417A|AGFG1_ENST00000409979.2_Silent_p.A462A|AGFG1_ENST00000373671.3_Silent_p.A398A|AGFG1_ENST00000409171.1_Silent_p.A438A	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	438					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						CATTTGTTGCTGCTGCTGGTC	0.348																																					p.A462A		Atlas-SNP	.											.	AGFG1	80	.	0			c.T1386A						.						88.0	89.0	89.0					2																	228401645		2203	4300	6503	SO:0001819	synonymous_variant	3267	exon11			TGTTGCTGCTGCT		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1314T>A	chr2.hg19:g.228401645T>A		205.0	0.0		92.0	23.0	NM_001135187	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Silent	SNP	ENST00000310078.8	hg19	CCDS2467.1																																																																																			.	.		0.348	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	
AGFG1	3267	hgsc.bcm.edu	37	2	228401648	228401648	+	Silent	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:228401648T>A	ENST00000310078.8	+	10	1577	c.1317T>A	c.(1315-1317)gcT>gcA	p.A439A	AGFG1_ENST00000409315.1_Silent_p.A418A|AGFG1_ENST00000409979.2_Silent_p.A463A|AGFG1_ENST00000373671.3_Silent_p.A399A|AGFG1_ENST00000409171.1_Silent_p.A439A	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	439					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						TTGTTGCTGCTGCTGGTCCTT	0.353																																					p.A463A		Atlas-SNP	.											.	AGFG1	80	.	0			c.T1389A						.						91.0	92.0	92.0					2																	228401648		2203	4300	6503	SO:0001819	synonymous_variant	3267	exon11			TGCTGCTGCTGGT		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1317T>A	chr2.hg19:g.228401648T>A		208.0	0.0		94.0	24.0	NM_001135187	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Silent	SNP	ENST00000310078.8	hg19	CCDS2467.1																																																																																			.	.		0.353	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	
OXSM	54995	hgsc.bcm.edu	37	3	25835810	25835810	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:25835810G>C	ENST00000280701.3	+	3	1304	c.1205G>C	c.(1204-1206)tGt>tCt	p.C402S	OXSM_ENST00000420173.2_Missense_Mutation_p.C319S	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	402					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						ACATTAGCTTGTTATTATCAA	0.453																																					p.C402S		Atlas-SNP	.											.	OXSM	54	.	0			c.G1205C						.						109.0	111.0	111.0					3																	25835810		2203	4300	6503	SO:0001583	missense	54995	exon3			TAGCTTGTTATTA	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.1205G>C	chr3.hg19:g.25835810G>C	ENSP00000280701:p.Cys402Ser	176.0	0.0		172.0	62.0	NM_017897		Missense_Mutation	SNP	ENST00000280701.3	hg19	CCDS2643.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909715	0.92107	.	.	ENSG00000151093	ENST00000280701;ENST00000420173	.	.	.	5.52	5.52	0.82312	Beta-ketoacyl synthase, C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	T	0.63082	0.2481	N	0.12182	0.205	0.48975	D	0.999735	D;D	0.61697	0.99;0.969	D;D	0.76575	0.988;0.987	T	0.70601	-0.4827	9	0.87932	D	0	-16.0775	19.4602	0.94914	0.0:0.0:1.0:0.0	.	319;402	Q9NWU1-2;Q9NWU1	.;OXSM_HUMAN	S	402;319	.	ENSP00000280701:C402S	C	+	2	0	OXSM	25810814	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.803000	0.99136	2.590000	0.87494	0.655000	0.94253	TGT	.	.		0.453	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897	
PLCD1	5333	hgsc.bcm.edu	37	3	38049272	38049272	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:38049272G>A	ENST00000334661.4	-	15	2485	c.2263C>T	c.(2263-2265)Cag>Tag	p.Q755*	PLCD1_ENST00000463876.1_Nonsense_Mutation_p.Q776*	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	755					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GCCTAGTCCTGGAGGGAGATC	0.627																																					p.Q776X		Atlas-SNP	.											.	PLCD1	87	.	0			c.C2326T						.						76.0	69.0	71.0					3																	38049272		2203	4300	6503	SO:0001587	stop_gained	5333	exon15			AGTCCTGGAGGGA		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.2263C>T	chr3.hg19:g.38049272G>A	ENSP00000335600:p.Gln755*	95.0	0.0		88.0	36.0	NM_001130964	B3KR14|Q86VN8	Nonsense_Mutation	SNP	ENST00000334661.4	hg19	CCDS2671.1	.	.	.	.	.	.	.	.	.	.	G	41	8.576384	0.98870	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	.	.	.	4.9	2.9	0.33743	.	0.527083	0.20603	N	0.089116	.	.	.	.	.	.	0.34752	D	0.731866	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.0853	0.14678	0.0799:0.2572:0.5277:0.1352	.	.	.	.	X	776;755	.	ENSP00000335600:Q755X	Q	-	1	0	PLCD1	38024276	0.502000	0.26107	0.903000	0.35520	0.920000	0.55202	0.872000	0.28037	1.128000	0.42052	0.655000	0.94253	CAG	.	.		0.627	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
WDR5B	54554	hgsc.bcm.edu	37	3	122133743	122133743	+	Silent	SNP	A	A	G	rs559697273		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:122133743A>G	ENST00000330689.4	-	1	1139	c.633T>C	c.(631-633)ccT>ccC	p.P211P	RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	211										kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		AAGAGACAGGAGGGTTATCGT	0.433																																					p.P211P		Atlas-SNP	.											.	WDR5B	36	.	0			c.T633C						.						103.0	108.0	107.0					3																	122133743		2203	4300	6503	SO:0001819	synonymous_variant	54554	exon1			GACAGGAGGGTTA	AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.633T>C	chr3.hg19:g.122133743A>G		97.0	0.0		96.0	35.0	NM_019069	B2RCM9|Q9NUL4	Silent	SNP	ENST00000330689.4	hg19	CCDS3012.1																																																																																			.	.		0.433	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1	NM_019069	
SNX4	8723	hgsc.bcm.edu	37	3	125195601	125195601	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:125195601C>A	ENST00000251775.4	-	8	751		c.e8-1		SNX4_ENST00000536067.1_Splice_Site|SNX4_ENST00000473417.1_Splice_Site	NM_003794.2	NP_003785.1	O95219	SNX4_HUMAN	sorting nexin 4						endocytic recycling (GO:0032456)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|early endosome membrane (GO:0031901)|membrane (GO:0016020)|protein complex (GO:0043234)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(2)|central_nervous_system(1)|lung(6)|ovary(1)|skin(1)	11						CTGCTACTCTCTGAAATAAAT	0.279																																					.		Atlas-SNP	.											.	SNX4	29	.	0			c.727-1G>T						.						47.0	49.0	48.0					3																	125195601		2202	4292	6494	SO:0001630	splice_region_variant	8723	exon9			TACTCTCTGAAAT	AF065485	CCDS3032.1	3q21.2	2014-02-12			ENSG00000114520	ENSG00000114520		"""Sorting nexins"""	11175	protein-coding gene	gene with protein product		605931				9819414	Standard	NM_003794		Approved	ATG24B	uc003eib.4	O95219	OTTHUMG00000159575	ENST00000251775.4:c.727-1G>T	chr3.hg19:g.125195601C>A		483.0	0.0		445.0	136.0	NM_003794	B3KMH0|B4DQV4|D3DNA3	Splice_Site	SNP	ENST00000251775.4	hg19	CCDS3032.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383632	0.61845	.	.	ENSG00000114520	ENST00000251775;ENST00000536067	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6388	0.62237	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNX4	126678291	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.749000	0.62155	2.262000	0.75019	0.557000	0.71058	.	.	.		0.279	SNX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356299.1	NM_003794	Intron
PLXNA1	5361	hgsc.bcm.edu	37	3	126736619	126736619	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:126736619G>T	ENST00000393409.2	+	18	3544	c.3544G>T	c.(3544-3546)Ggc>Tgc	p.G1182C	PLXNA1_ENST00000251772.4_Missense_Mutation_p.G1159C	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1182	IPT/TIG 4.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		ACCTGCACCCGGCAACTCCCG	0.657																																					p.G1182C		Atlas-SNP	.											.	PLXNA1	185	.	0			c.G3544T						.						101.0	92.0	95.0					3																	126736619		2203	4300	6503	SO:0001583	missense	5361	exon18			GCACCCGGCAACT	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3544G>T	chr3.hg19:g.126736619G>T	ENSP00000377061:p.Gly1182Cys	94.0	0.0		93.0	37.0	NM_032242		Missense_Mutation	SNP	ENST00000393409.2	hg19	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488066	0.64074	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.79454	-1.27;-1.27	4.49	3.59	0.41128	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.393150	0.23904	N	0.043410	D	0.89396	0.6703	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91123	0.4931	10	0.87932	D	0	.	13.6307	0.62193	0.0:0.0:0.8438:0.1562	.	1182	Q9UIW2	PLXA1_HUMAN	C	1182;1159	ENSP00000377061:G1182C;ENSP00000251772:G1159C	ENSP00000251772:G1159C	G	+	1	0	PLXNA1	128219309	1.000000	0.71417	0.740000	0.30986	0.410000	0.31052	9.556000	0.98127	1.052000	0.40392	0.591000	0.81541	GGC	.	.		0.657	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
CEP63	80254	hgsc.bcm.edu	37	3	134278032	134278032	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:134278032G>A	ENST00000337090.3	+	14	1887	c.1714G>A	c.(1714-1716)Gag>Aag	p.E572K	CEP63_ENST00000606977.1_Missense_Mutation_p.E572K|CEP63_ENST00000513612.2_Missense_Mutation_p.E572K|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000383229.3_Intron|CEP63_ENST00000354446.3_Intron			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	572					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AATAAAGACTGAGCACTACAA	0.433																																					p.E572K		Atlas-SNP	.											CEP63,bladder,carcinoma,0,1	CEP63	56	.	0			c.G1714A						.						139.0	139.0	139.0					3																	134278032		2203	4300	6503	SO:0001583	missense	80254	exon15			AAGACTGAGCACT	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1714G>A	chr3.hg19:g.134278032G>A	ENSP00000336524:p.Glu572Lys	135.0	0.0		159.0	39.0	NM_025180	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	ENST00000337090.3	hg19	CCDS3086.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627300	0.28978	.	.	ENSG00000182923	ENST00000337090;ENST00000513612	T;T	0.17854	2.25;2.25	4.77	3.87	0.44632	.	0.502640	0.20145	N	0.098283	T	0.16214	0.0390	L	0.50333	1.59	0.30373	N	0.782667	B	0.30634	0.288	B	0.33690	0.168	T	0.10086	-1.0645	10	0.14252	T	0.57	-5.5258	10.9666	0.47416	0.0:0.189:0.811:0.0	.	572	Q96MT8	CEP63_HUMAN	K	572	ENSP00000336524:E572K;ENSP00000426129:E572K	ENSP00000336524:E572K	E	+	1	0	CEP63	135760722	1.000000	0.71417	0.584000	0.28653	0.821000	0.46438	4.444000	0.60001	1.305000	0.44909	0.650000	0.86243	GAG	.	.		0.433	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	NM_025180	
ESYT3	83850	hgsc.bcm.edu	37	3	138153695	138153695	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:138153695C>G	ENST00000389567.4	+	1	241	c.55C>G	c.(55-57)Cgc>Ggc	p.R19G	ESYT3_ENST00000289135.4_Missense_Mutation_p.R19G	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	19					lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGGAGCCCAGCGCACGCCGGG	0.706																																					p.R19G		Atlas-SNP	.											.	ESYT3	64	.	0			c.C55G						.						13.0	15.0	14.0					3																	138153695		1984	3860	5844	SO:0001583	missense	83850	exon1			GCCCAGCGCACGC	AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.55C>G	chr3.hg19:g.138153695C>G	ENSP00000374218:p.Arg19Gly	45.0	0.0		43.0	15.0	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	ENST00000389567.4	hg19	CCDS3101.2	.	.	.	.	.	.	.	.	.	.	C	9.358	1.067160	0.20067	.	.	ENSG00000158220	ENST00000389567;ENST00000289135	T;T	0.37752	1.18;1.46	3.92	1.98	0.26296	.	0.801478	0.11504	N	0.557351	T	0.21468	0.0517	N	0.22421	0.69	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.25467	-1.0131	10	0.22706	T	0.39	-9.8139	6.4832	0.22075	0.209:0.5885:0.2025:0.0	.	19	A0FGR9	ESYT3_HUMAN	G	19	ENSP00000374218:R19G;ENSP00000289135:R19G	ENSP00000289135:R19G	R	+	1	0	ESYT3	139636385	0.937000	0.31787	0.026000	0.17262	0.030000	0.12068	1.496000	0.35638	0.356000	0.24157	0.561000	0.74099	CGC	.	.		0.706	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
TRIM42	287015	hgsc.bcm.edu	37	3	140409822	140409822	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:140409822T>C	ENST00000286349.3	+	4	2064	c.1873T>C	c.(1873-1875)Tgt>Cgt	p.C625R		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	625	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TTACTGGACATGTCCAGCAGA	0.398																																					p.C625R		Atlas-SNP	.											.	TRIM42	143	.	0			c.T1873C						.						115.0	105.0	108.0					3																	140409822		2203	4300	6503	SO:0001583	missense	287015	exon4			TGGACATGTCCAG	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1873T>C	chr3.hg19:g.140409822T>C	ENSP00000286349:p.Cys625Arg	112.0	0.0		109.0	30.0	NM_152616	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	hg19	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	T	18.30	3.593379	0.66219	.	.	ENSG00000155890	ENST00000286349	T	0.55588	0.51	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.59059	0.2166	N	0.24115	0.695	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	T	0.63857	-0.6542	10	0.87932	D	0	-29.5266	12.5738	0.56352	0.0:0.0:0.0:1.0	.	625	Q8IWZ5	TRI42_HUMAN	R	625	ENSP00000286349:C625R	ENSP00000286349:C625R	C	+	1	0	TRIM42	141892512	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.279000	0.51670	2.222000	0.72286	0.528000	0.53228	TGT	.	.		0.398	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
IGSF10	285313	hgsc.bcm.edu	37	3	151160830	151160830	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:151160830G>A	ENST00000282466.3	-	5	5904	c.5905C>T	c.(5905-5907)Ccc>Tcc	p.P1969S	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1969	Ig-like C2-type 6.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGGGGTTTGGGCTCCCCAGTG	0.478																																					p.P1969S		Atlas-SNP	.											.	IGSF10	279	.	0			c.C5905T						.						112.0	109.0	110.0					3																	151160830		2203	4300	6503	SO:0001583	missense	285313	exon5			GTTTGGGCTCCCC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5905C>T	chr3.hg19:g.151160830G>A	ENSP00000282466:p.Pro1969Ser	94.0	0.0		73.0	16.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	hg19	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390620	0.82902	.	.	ENSG00000152580	ENST00000489791;ENST00000282466;ENST00000544042	T;T	0.73897	-0.79;-0.79	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000217	D	0.90469	0.7015	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92570	0.6065	10	0.62326	D	0.03	.	19.1316	0.93410	0.0:0.0:1.0:0.0	.	1969	Q6WRI0	IGS10_HUMAN	S	37;1969;596	ENSP00000417627:P37S;ENSP00000282466:P1969S	ENSP00000282466:P1969S	P	-	1	0	IGSF10	152643520	1.000000	0.71417	0.373000	0.26003	0.996000	0.88848	9.793000	0.99091	2.545000	0.85829	0.591000	0.81541	CCC	.	.		0.478	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
GFM1	85476	hgsc.bcm.edu	37	3	158407956	158407956	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:158407956G>C	ENST00000486715.1	+	16	2271	c.1914G>C	c.(1912-1914)ttG>ttC	p.L638F	GFM1_ENST00000264263.5_Missense_Mutation_p.L657F|RP11-379F4.7_ENST00000607624.1_lincRNA	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			ACCCAGCCTTGGCAAATGCAA	0.358																																					p.L638F		Atlas-SNP	.											.	GFM1	83	.	0			c.G1914C						.						94.0	99.0	97.0					3																	158407956		2203	4300	6503	SO:0001583	missense	85476	exon16			AGCCTTGGCAAAT	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.1914G>C	chr3.hg19:g.158407956G>C	ENSP00000419038:p.Leu638Phe	91.0	0.0		63.0	18.0	NM_024996		Missense_Mutation	SNP	ENST00000486715.1	hg19	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	G	6.970	0.548868	0.13312	.	.	ENSG00000168827	ENST00000486715;ENST00000264263	T;T	0.32753	1.44;1.44	5.9	5.03	0.67393	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.123048	0.52532	D	0.000073	T	0.11750	0.0286	N	0.01515	-0.825	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.12156	0.005;0.007	T	0.13202	-1.0518	10	0.07325	T	0.83	-0.6617	15.0639	0.71977	0.0677:0.0:0.9323:0.0	.	657;638	Q96RP9-2;Q96RP9	.;EFGM_HUMAN	F	638;657	ENSP00000419038:L638F;ENSP00000264263:L657F	ENSP00000264263:L657F	L	+	3	2	GFM1	159890650	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	6.298000	0.72763	1.496000	0.48567	0.650000	0.86243	TTG	.	.		0.358	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
HS3ST1	9957	hgsc.bcm.edu	37	4	11401299	11401299	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr4:11401299A>T	ENST00000002596.5	-	2	1505	c.331T>A	c.(331-333)Tgg>Agg	p.W111R		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	111					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						TGGTGTGGCCAGGAGAAGGGC	0.627																																					p.W111R		Atlas-SNP	.											.	HS3ST1	41	.	0			c.T331A						.						80.0	75.0	77.0					4																	11401299		2203	4300	6503	SO:0001583	missense	9957	exon2			GTGGCCAGGAGAA	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.331T>A	chr4.hg19:g.11401299A>T	ENSP00000002596:p.Trp111Arg	110.0	0.0		48.0	25.0	NM_005114	B3KUA6|Q6PEY8	Missense_Mutation	SNP	ENST00000002596.5	hg19	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.252423	0.22880	.	.	ENSG00000002587	ENST00000002596	T	0.81330	-1.48	5.61	-1.52	0.08637	Sulfotransferase domain (1);	0.882108	0.10028	N	0.725175	T	0.51856	0.1699	N	0.01352	-0.895	0.09310	N	1	B	0.20261	0.043	B	0.12156	0.007	T	0.39603	-0.9606	10	0.28530	T	0.3	.	9.9307	0.41521	0.4753:0.4606:0.0641:0.0	.	111	O14792	HS3S1_HUMAN	R	111	ENSP00000002596:W111R	ENSP00000002596:W111R	W	-	1	0	HS3ST1	11010397	0.000000	0.05858	0.005000	0.12908	0.952000	0.60782	0.048000	0.14078	-0.382000	0.07870	0.533000	0.62120	TGG	.	.		0.627	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114	
PCDH7	5099	hgsc.bcm.edu	37	4	30723995	30723995	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr4:30723995G>T	ENST00000361762.2	+	1	1959	c.951G>T	c.(949-951)ttG>ttT	p.L317F	PCDH7_ENST00000543491.1_Missense_Mutation_p.L317F	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	317	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGGCCGACTTGGCTGAGAACA	0.667																																					p.L317F		Atlas-SNP	.											.	PCDH7	215	.	0			c.G951T						.						15.0	19.0	18.0					4																	30723995		2192	4285	6477	SO:0001583	missense	5099	exon1			CGACTTGGCTGAG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.951G>T	chr4.hg19:g.30723995G>T	ENSP00000355243:p.Leu317Phe	197.0	0.0		123.0	52.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.15|14.15	2.449958|2.449958	0.43531|0.43531	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.54071	.|0.59;0.59	5.29|5.29	4.44|4.44	0.53790|0.53790	.|Cadherin (3);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.72740|0.72740	0.3498|0.3498	M|M	0.75085|0.75085	2.285|2.285	0.46774|0.46774	D|D	0.99919|0.99919	.|D;D;D	.|0.65815	.|0.994;0.994;0.995	.|D;D;D	.|0.74348	.|0.983;0.983;0.982	T|T	0.75777|0.75777	-0.3198|-0.3198	5|9	.|0.72032	.|D	.|0.01	.|.	17.0418|17.0418	0.86491|0.86491	0.0683:0.0:0.9317:0.0|0.0683:0.0:0.9317:0.0	.|.	.|317;270;317	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	C|F	7|317;317;270	.|ENSP00000355243:L317F;ENSP00000441802:L317F	.|ENSP00000330302:L270F	G|L	+|+	1|3	0|2	PCDH7|PCDH7	30333093|30333093	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.781000|0.781000	0.44180|0.44180	1.711000|1.711000	0.37930|0.37930	0.616000|0.616000	0.30141|0.30141	-1.134000|-1.134000	0.01955|0.01955	GGC|TTG	.	.		0.667	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
NUDT6	11162	hgsc.bcm.edu	37	4	123818824	123818824	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr4:123818824T>C	ENST00000304430.5	-	4	541	c.508A>G	c.(508-510)Atg>Gtg	p.M170V	FGF2_ENST00000264498.3_3'UTR|NUDT6_ENST00000502270.1_Start_Codon_SNP_p.M1V|NUDT6_ENST00000339154.2_Start_Codon_SNP_p.M1V	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	170	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)			endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						AACTTCCACATATTTTTCAAC	0.313																																					p.M170V		Atlas-SNP	.											.	NUDT6	50	.	0			c.A508G						.						52.0	57.0	55.0					4																	123818824		2203	4298	6501	SO:0001583	missense	11162	exon4			TCCACATATTTTT	AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.508A>G	chr4.hg19:g.123818824T>C	ENSP00000306070:p.Met170Val	652.0	1.0		542.0	215.0	NM_007083	A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	ENST00000304430.5	hg19	CCDS43268.1	.	.	.	.	.	.	.	.	.	.	T	11.19	1.565738	0.27915	.	.	ENSG00000170917	ENST00000304430;ENST00000339154;ENST00000510735;ENST00000502270	T;T;T	0.07567	3.18;3.18;3.18	5.08	3.91	0.45181	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.152108	0.56097	D	0.000022	T	0.04227	0.0117	N	0.13352	0.335	0.80722	D	1	B	0.23540	0.087	B	0.26770	0.073	T	0.41980	-0.9478	10	0.13108	T	0.6	1.6589	5.636	0.17536	0.0:0.2587:0.0:0.7413	.	170	P53370	NUDT6_HUMAN	V	170;1;40;1	ENSP00000306070:M170V;ENSP00000344011:M1V;ENSP00000424117:M1V	ENSP00000306070:M170V	M	-	1	0	NUDT6	124038274	1.000000	0.71417	0.976000	0.42696	0.984000	0.73092	3.242000	0.51384	2.130000	0.65690	0.477000	0.44152	ATG	.	.		0.313	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095331.3	NM_007083	
FAT1	2195	hgsc.bcm.edu	37	4	187541512	187541512	+	Silent	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr4:187541512A>G	ENST00000441802.2	-	10	6437	c.6228T>C	c.(6226-6228)gaT>gaC	p.D2076D		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2076	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CCGGCGCATTATCATTTTGGT	0.493										HNSCC(5;0.00058)																											p.D2076D	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.T6228C						.						164.0	158.0	160.0					4																	187541512		1973	4147	6120	SO:0001819	synonymous_variant	2195	exon10			CGCATTATCATTT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6228T>C	chr4.hg19:g.187541512A>G		131.0	0.0		90.0	45.0	NM_005245		Silent	SNP	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.		0.493	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
HAPLN1	1404	hgsc.bcm.edu	37	5	82940201	82940201	+	Silent	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:82940201A>G	ENST00000274341.4	-	4	1606	c.756T>C	c.(754-756)tgT>tgC	p.C252C		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	252	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	TGGATGTAAAACAGAAAACAT	0.403																																					p.C252C		Atlas-SNP	.											.	HAPLN1	79	.	0			c.T756C						.						58.0	62.0	61.0					5																	82940201		2203	4300	6503	SO:0001819	synonymous_variant	1404	exon4			TGTAAAACAGAAA		CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.756T>C	chr5.hg19:g.82940201A>G		198.0	0.0		146.0	18.0	NM_001884	B2R9A9	Silent	SNP	ENST00000274341.4	hg19	CCDS4061.1																																																																																			.	.		0.403	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
GPR98	84059	hgsc.bcm.edu	37	5	90002212	90002212	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:90002212G>A	ENST00000405460.2	+	38	8826		c.e38+1			NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98						detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CATTCTTGAGGTAAAACTCTT	0.338																																					.		Atlas-SNP	.											.	GPR98	605	.	0			c.8730+1G>A						.						34.0	33.0	33.0					5																	90002212		1806	4078	5884	SO:0001630	splice_region_variant	84059	exon38			CTTGAGGTAAAAC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8730+1G>A	chr5.hg19:g.90002212G>A		239.0	0.0		226.0	43.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Splice_Site	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980612	0.53827	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000509621	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6378	0.91384	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR98	90037968	1.000000	0.71417	1.000000	0.80357	0.410000	0.31052	9.110000	0.94302	2.403000	0.81681	0.460000	0.39030	.	.	.		0.338	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	Intron
EGR1	1958	hgsc.bcm.edu	37	5	137801456	137801456	+	Silent	SNP	C	C	G	rs200905400		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:137801456C>G	ENST00000239938.4	+	1	278	c.6C>G	c.(4-6)gcC>gcG	p.A2A		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	2					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CCAGGATGGCCGCGGCCAAGG	0.682																																					p.A2A		Atlas-SNP	.											.	EGR1	52	.	0			c.C6G						.						40.0	37.0	38.0					5																	137801456		2203	4300	6503	SO:0001819	synonymous_variant	1958	exon1			GATGGCCGCGGCC	M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.6C>G	chr5.hg19:g.137801456C>G		118.0	0.0		113.0	16.0	NM_001964		Silent	SNP	ENST00000239938.4	hg19	CCDS4206.1																																																																																			.	.		0.682	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964	
PCDHA13	56136	hgsc.bcm.edu	37	5	140262072	140262072	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:140262072C>A	ENST00000289272.2	+	1	219	c.219C>A	c.(217-219)gaC>gaA	p.D73E	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.D73E	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACACGGGGACCTTCTGGAGG	0.627																																					p.D73E	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.C219A						.						67.0	78.0	74.0					5																	140262072		2202	4293	6495	SO:0001583	missense	56136	exon1			CGGGGACCTTCTG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.219C>A	chr5.hg19:g.140262072C>A	ENSP00000289272:p.Asp73Glu	142.0	0.0		111.0	54.0	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	hg19	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.269838	0.23221	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.25912	1.77;1.77	5.54	2.72	0.32119	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.15652	0.0377	N	0.26042	0.785	0.19945	N	0.999944	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.17722	0.009;0.019;0.005	T	0.26503	-1.0101	9	0.56958	D	0.05	.	2.0063	0.03478	0.1259:0.4186:0.2452:0.2103	.	73;73;73	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	E	73	ENSP00000386821:D73E;ENSP00000289272:D73E	ENSP00000289272:D73E	D	+	3	2	PCDHA13	140242256	0.000000	0.05858	0.998000	0.56505	0.708000	0.40852	-0.445000	0.06845	0.682000	0.31407	0.556000	0.70494	GAC	.	.		0.627	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
STK10	6793	hgsc.bcm.edu	37	5	171533682	171533682	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:171533682G>A	ENST00000176763.5	-	6	1073	c.730C>T	c.(730-732)Cgg>Tgg	p.R244W		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGCAGGACCCGCATGGGGTTG	0.652											OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R244W		Atlas-SNP	.											.	STK10	100	.	0			c.C730T						.						117.0	107.0	110.0					5																	171533682		2203	4300	6503	SO:0001583	missense	6793	exon6			GGACCCGCATGGG	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.730C>T	chr5.hg19:g.171533682G>A	ENSP00000176763:p.Arg244Trp	106.0	0.0	1893	109.0	20.0	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	ENST00000176763.5	hg19	CCDS34290.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.133946	0.56828	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.26518	1.73	4.86	2.03	0.26663	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	L	0.39633	1.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.11470	-1.0586	10	0.87932	D	0	.	12.003	0.53241	0.0:0.0:0.5475:0.4525	.	244	O94804	STK10_HUMAN	W	244	ENSP00000176763:R244W	ENSP00000176763:R244W	R	-	1	2	STK10	171466287	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	0.946000	0.29069	0.238000	0.21222	-0.181000	0.13052	CGG	.	.		0.652	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
RNF44	22838	hgsc.bcm.edu	37	5	175959156	175959156	+	Missense_Mutation	SNP	C	C	A	rs545172577		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:175959156C>A	ENST00000274811.4	-	3	670	c.146G>T	c.(145-147)cGg>cTg	p.R49L	RNF44_ENST00000537487.1_Intron|RNF44_ENST00000509404.1_5'Flank	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	49	Pro-rich.						zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGCTCATCCCGGGCAGGCGG	0.731																																					p.R49L		Atlas-SNP	.											.	RNF44	33	.	0			c.G146T						.						9.0	12.0	11.0					5																	175959156		2168	4234	6402	SO:0001583	missense	22838	exon3			TCATCCCGGGCAG	AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.146G>T	chr5.hg19:g.175959156C>A	ENSP00000274811:p.Arg49Leu	243.0	0.0		206.0	27.0	NM_014901	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	ENST00000274811.4	hg19	CCDS4404.1	.	.	.	.	.	.	.	.	.	.	C	9.569	1.120613	0.20877	.	.	ENSG00000146083	ENST00000274811	T	0.32515	1.45	4.23	1.63	0.23807	.	0.353014	0.25291	N	0.031739	T	0.11836	0.0288	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10474	-1.0628	10	0.20046	T	0.44	-9.9867	4.2749	0.10804	0.175:0.0992:0.0:0.7258	.	49	Q7L0R7	RNF44_HUMAN	L	49	ENSP00000274811:R49L	ENSP00000274811:R49L	R	-	2	0	RNF44	175891762	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	2.359000	0.44142	0.623000	0.30267	-0.367000	0.07326	CGG	.	.		0.731	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253156.2		
SQSTM1	8878	hgsc.bcm.edu	37	5	179260608	179260608	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:179260608T>A	ENST00000389805.4	+	7	1169	c.991T>A	c.(991-993)Tgt>Agt	p.C331S	SQSTM1_ENST00000360718.5_Missense_Mutation_p.C247S|SQSTM1_ENST00000376929.3_Missense_Mutation_p.C247S|SQSTM1_ENST00000510187.1_Intron|SQSTM1_ENST00000402874.3_Missense_Mutation_p.C247S	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	331	Interaction with NTRK1. {ECO:0000250}.|MAP1LC3B-binding.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCGGATAACTGTTCAGGAGG	0.547																																					p.C331S		Atlas-SNP	.											.	SQSTM1	30	.	0			c.T991A						.						95.0	86.0	89.0					5																	179260608		2203	4300	6503	SO:0001583	missense	8878	exon7			GATAACTGTTCAG	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.991T>A	chr5.hg19:g.179260608T>A	ENSP00000374455:p.Cys331Ser	131.0	0.0		104.0	12.0	NM_003900	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	hg19	CCDS34317.1	.	.	.	.	.	.	.	.	.	.	T	5.646	0.303895	0.10678	.	.	ENSG00000161011	ENST00000376929;ENST00000389805;ENST00000454378;ENST00000402874;ENST00000360718	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.26	4.07	0.47477	.	0.298040	0.37095	N	0.002246	T	0.78773	0.4336	L	0.39633	1.23	0.36545	D	0.871496	B	0.10296	0.003	B	0.10450	0.005	T	0.69650	-0.5088	10	0.07644	T	0.81	-11.8632	10.4894	0.44741	0.0:0.0:0.3132:0.6868	.	331	Q13501	SQSTM_HUMAN	S	247;331;187;247;247	ENSP00000366128:C247S;ENSP00000374455:C331S;ENSP00000385553:C247S;ENSP00000353944:C247S	ENSP00000353944:C247S	C	+	1	0	SQSTM1	179193214	0.472000	0.25870	0.945000	0.38365	0.690000	0.40134	0.428000	0.21395	0.805000	0.34159	0.459000	0.35465	TGT	.	.		0.547	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1		
FOXC1	2296	hgsc.bcm.edu	37	6	1611582	1611582	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:1611582C>G	ENST00000380874.2	+	1	902	c.902C>G	c.(901-903)cCg>cGg	p.P301R		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	301					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		tccgccccgccgccgcACCAT	0.776																																					p.P301R	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.C902G						.						2.0	2.0	2.0					6																	1611582		887	2012	2899	SO:0001583	missense	2296	exon1			CCCCGCCGCCGCA	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.902C>G	chr6.hg19:g.1611582C>G	ENSP00000370256:p.Pro301Arg	89.0	0.0		62.0	34.0	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	hg19	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	C	2.840	-0.240608	0.05944	.	.	ENSG00000054598	ENST00000380874	D	0.92965	-3.14	2.82	-1.18	0.09617	.	0.278524	0.27362	N	0.019717	T	0.68054	0.2959	N	0.22421	0.69	0.25048	N	0.991153	B	0.06786	0.001	B	0.04013	0.001	T	0.61836	-0.6981	10	0.22706	T	0.39	.	6.8262	0.23885	0.3461:0.5029:0.1511:0.0	.	301	Q12948	FOXC1_HUMAN	R	301	ENSP00000370256:P301R	ENSP00000370256:P301R	P	+	2	0	FOXC1	1556581	0.000000	0.05858	0.672000	0.29872	0.084000	0.17831	0.685000	0.25378	-0.044000	0.13491	-0.802000	0.03209	CCG	.	.		0.776	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
SLC22A23	63027	hgsc.bcm.edu	37	6	3273355	3273355	+	Silent	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:3273355G>A	ENST00000406686.3	-	10	1994	c.1995C>T	c.(1993-1995)caC>caT	p.H665H	PSMG4_ENST00000451246.2_Intron|SLC22A23_ENST00000490273.1_Silent_p.H384H|SLC22A23_ENST00000380302.4_Silent_p.H384H|SLC22A23_ENST00000436008.2_Silent_p.H673H	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	665					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				CTGCGGCATCGTGGAGGCCCG	0.697																																					p.H665H		Atlas-SNP	.											.	SLC22A23	89	.	0			c.C1995T						.						44.0	50.0	48.0					6																	3273355		2203	4300	6503	SO:0001819	synonymous_variant	63027	exon10			GGCATCGTGGAGG	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1995C>T	chr6.hg19:g.3273355G>A		34.0	0.0		27.0	8.0	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Silent	SNP	ENST00000406686.3	hg19	CCDS47363.1																																																																																			.	.		0.697	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
SLC22A23	63027	hgsc.bcm.edu	37	6	3273357	3273357	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:3273357G>T	ENST00000406686.3	-	10	1992	c.1993C>A	c.(1993-1995)Cac>Aac	p.H665N	PSMG4_ENST00000451246.2_Intron|SLC22A23_ENST00000490273.1_Missense_Mutation_p.H384N|SLC22A23_ENST00000380302.4_Missense_Mutation_p.H384N|SLC22A23_ENST00000436008.2_Missense_Mutation_p.H673N	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	665					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				GCGGCATCGTGGAGGCCCGAG	0.687																																					p.H665N		Atlas-SNP	.											.	SLC22A23	89	.	0			c.C1993A						.						45.0	50.0	48.0					6																	3273357		2203	4300	6503	SO:0001583	missense	63027	exon10			CATCGTGGAGGCC	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1993C>A	chr6.hg19:g.3273357G>T	ENSP00000385028:p.His665Asn	33.0	0.0		27.0	8.0	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	hg19	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629267	0.67015	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273	T;T;T;T	0.72167	-0.57;-0.63;-0.47;-0.47	5.91	5.91	0.95273	.	0.105137	0.64402	D	0.000004	T	0.61540	0.2355	N	0.24115	0.695	0.80722	D	1	D	0.54207	0.965	P	0.50049	0.629	T	0.67086	-0.5759	10	0.66056	D	0.02	-27.2157	19.2867	0.94077	0.0:0.0:1.0:0.0	.	665	A1A5C7	S22AN_HUMAN	N	673;665;384;384	ENSP00000410245:H673N;ENSP00000385028:H665N;ENSP00000369657:H384N;ENSP00000419463:H384N	ENSP00000369657:H384N	H	-	1	0	SLC22A23	3218356	1.000000	0.71417	0.972000	0.41901	0.105000	0.19272	8.770000	0.91746	2.793000	0.96121	0.655000	0.94253	CAC	.	.		0.687	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
F13A1	2162	hgsc.bcm.edu	37	6	6145859	6145859	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:6145859G>A	ENST00000264870.3	-	15	2457	c.2192C>T	c.(2191-2193)tCc>tTc	p.S731F		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	731					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CATTCACATGGAAGGTCGTCT	0.498																																					p.S731F		Atlas-SNP	.											.	F13A1	135	.	0			c.C2192T						.						127.0	117.0	120.0					6																	6145859		2203	4300	6503	SO:0001583	missense	2162	exon15			CACATGGAAGGTC	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.2192C>T	chr6.hg19:g.6145859G>A	ENSP00000264870:p.Ser731Phe	114.0	0.0		97.0	24.0	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	hg19	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251741	0.22880	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.79845	-1.31	5.67	3.72	0.42706	.	0.802956	0.10904	N	0.621307	T	0.57784	0.2077	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.54159	-0.8335	10	0.87932	D	0	.	8.15	0.31134	0.0873:0.0:0.7442:0.1685	.	731	P00488	F13A_HUMAN	F	731;625	ENSP00000264870:S731F	ENSP00000264870:S731F	S	-	2	0	F13A1	6090858	0.017000	0.18338	0.294000	0.24946	0.371000	0.29859	1.510000	0.35790	2.677000	0.91161	0.655000	0.94253	TCC	.	.		0.498	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
ZNF318	24149	hgsc.bcm.edu	37	6	43307288	43307288	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:43307288G>A	ENST00000361428.2	-	10	4525	c.4448C>T	c.(4447-4449)tCt>tTt	p.S1483F	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1483	Pro-rich.				meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GAGAGTCTGAGATACAACTGG	0.537																																					p.S1483F		Atlas-SNP	.											.	ZNF318	175	.	0			c.C4448T						.						65.0	61.0	62.0					6																	43307288		2203	4300	6503	SO:0001583	missense	24149	exon10			GTCTGAGATACAA	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4448C>T	chr6.hg19:g.43307288G>A	ENSP00000354964:p.Ser1483Phe	97.0	0.0		92.0	31.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	hg19	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503126	0.44558	.	.	ENSG00000171467	ENST00000361428	T	0.18174	2.23	4.96	4.96	0.65561	.	0.181162	0.35870	N	0.002923	T	0.12433	0.0302	N	0.19112	0.55	0.80722	D	1	D	0.53885	0.963	P	0.53809	0.735	T	0.02983	-1.1086	10	0.49607	T	0.09	-8.2732	15.0645	0.71983	0.0:0.0:1.0:0.0	.	1483	Q5VUA4	ZN318_HUMAN	F	1483	ENSP00000354964:S1483F	ENSP00000354964:S1483F	S	-	2	0	ZNF318	43415266	1.000000	0.71417	0.994000	0.49952	0.832000	0.47134	6.308000	0.72820	2.585000	0.87301	0.655000	0.94253	TCT	.	.		0.537	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
POLR1C	9533	hgsc.bcm.edu	37	6	43487179	43487179	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:43487179G>T	ENST00000372389.3	+	3	337		c.e3+1		RP3-337H4.9_ENST00000607571.1_RNA|POLR1C_ENST00000304004.3_Splice_Site|YIPF3_ENST00000506469.1_5'Flank|POLR1C_ENST00000372344.2_Splice_Site|YIPF3_ENST00000372422.2_5'Flank	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa						gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GCTAGCTGAGGTATTGGCAGG	0.473																																					.		Atlas-SNP	.											.	POLR1C	52	.	0			c.249+1G>T						.						116.0	92.0	100.0					6																	43487179		2203	4300	6503	SO:0001630	splice_region_variant	9533	exon3			GCTGAGGTATTGG	AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.249+1G>T	chr6.hg19:g.43487179G>T		144.0	0.0		117.0	39.0	NM_203290	O75395|Q5JTE3	Splice_Site	SNP	ENST00000372389.3	hg19	CCDS4901.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819480	0.71028	.	.	ENSG00000171453	ENST00000428025;ENST00000372389;ENST00000372344;ENST00000304004;ENST00000423780	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5629	0.91107	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLR1C	43595157	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	9.311000	0.96282	2.446000	0.82766	0.557000	0.71058	.	.	.		0.473	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040652.3	NM_004875	Intron
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31139807	31139807	+	Intron	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr7:31139807A>G	ENST00000304166.4	+	14	1335				ADCYAP1R1_ENST00000409363.1_Intron|ADCYAP1R1_ENST00000409489.1_Silent_p.E399E|ADCYAP1R1_ENST00000396211.2_Silent_p.E371E	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I						activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						AGATGTCAGAACTGTCCACCA	0.592																																					p.E371E	Ovarian(44;225 1186 2158 11092)	Atlas-SNP	.											.	ADCYAP1R1	78	.	0			c.A1113G						.																																			SO:0001627	intron_variant	117	exon14			GTCAGAACTGTCC		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1047-3044A>G	chr7.hg19:g.31139807A>G		57.0	0.0		58.0	14.0	NM_001199635	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Silent	SNP	ENST00000304166.4	hg19	CCDS5433.1																																																																																			.	.		0.592	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
PTPN12	5782	hgsc.bcm.edu	37	7	77256222	77256222	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr7:77256222A>G	ENST00000248594.6	+	13	1498	c.1226A>G	c.(1225-1227)tAt>tGt	p.Y409C	PTPN12_ENST00000435495.2_Missense_Mutation_p.Y279C|PTPN12_ENST00000415482.2_Missense_Mutation_p.Y290C	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	409	Interaction with TGFB1I1. {ECO:0000250}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						AACAGAAACTATAGTAAATCA	0.363																																					p.Y409C		Atlas-SNP	.											.	PTPN12	83	.	0			c.A1226G						.						52.0	53.0	53.0					7																	77256222		2203	4300	6503	SO:0001583	missense	5782	exon13			GAAACTATAGTAA		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1226A>G	chr7.hg19:g.77256222A>G	ENSP00000248594:p.Tyr409Cys	140.0	0.0		132.0	39.0	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	hg19	CCDS5592.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.108653	0.56291	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;T;T	0.07908	3.73;3.15;3.15	6.17	6.17	0.99709	.	0.241477	0.42964	D	0.000634	T	0.30759	0.0775	M	0.81497	2.545	0.53005	D	0.999965	D	0.76494	0.999	D	0.68765	0.96	T	0.01508	-1.1337	10	0.35671	T	0.21	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	409	Q05209	PTN12_HUMAN	C	409;290;290;279	ENSP00000248594:Y409C;ENSP00000392429:Y290C;ENSP00000397991:Y279C	ENSP00000248594:Y409C	Y	+	2	0	PTPN12	77094158	0.999000	0.42202	0.966000	0.40874	0.958000	0.62258	3.891000	0.56227	2.371000	0.80710	0.533000	0.62120	TAT	.	.		0.363	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
PLXNA4	91584	hgsc.bcm.edu	37	7	131849014	131849014	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr7:131849014A>C	ENST00000359827.3	-	24	5349	c.4387T>G	c.(4387-4389)Tgt>Ggt	p.C1463G	PLXNA4_ENST00000321063.4_Missense_Mutation_p.C1463G			Q9HCM2	PLXA4_HUMAN	plexin A4	1463					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TTGATGGCACAGAACAGGGAG	0.592																																					p.C1463G		Atlas-SNP	.											.	PLXNA4	873	.	0			c.T4387G						.						58.0	58.0	58.0					7																	131849014		2203	4300	6503	SO:0001583	missense	91584	exon24			TGGCACAGAACAG	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4387T>G	chr7.hg19:g.131849014A>C	ENSP00000352882:p.Cys1463Gly	84.0	0.0		66.0	22.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.928349	0.73327	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.11495	2.77;2.77	5.45	5.45	0.79879	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.37839	0.1018	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.28170	-1.0052	10	0.48119	T	0.1	.	15.542	0.76057	1.0:0.0:0.0:0.0	.	1463	Q9HCM2	PLXA4_HUMAN	G	1463	ENSP00000323194:C1463G;ENSP00000352882:C1463G	ENSP00000323194:C1463G	C	-	1	0	PLXNA4	131499554	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.576000	0.82467	2.064000	0.61679	0.533000	0.62120	TGT	.	.		0.592	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
ADAM9	8754	hgsc.bcm.edu	37	8	38947598	38947598	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:38947598G>A	ENST00000487273.2	+	19	2179	c.2101G>A	c.(2101-2103)Gtc>Atc	p.V701I		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	701					activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			CGGACTTCTGGTCTTCTTCTT	0.373																																					p.V701I		Atlas-SNP	.											.	ADAM9	66	.	0			c.G2101A						.						261.0	236.0	245.0					8																	38947598		2203	4300	6503	SO:0001583	missense	8754	exon19			CTTCTGGTCTTCT	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.2101G>A	chr8.hg19:g.38947598G>A	ENSP00000419446:p.Val701Ile	143.0	0.0		67.0	35.0	NM_003816	B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	ENST00000487273.2	hg19	CCDS6112.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893542	0.33442	.	.	ENSG00000168615	ENST00000487273	D	0.87412	-2.25	5.55	3.76	0.43208	.	0.250218	0.39834	N	0.001248	T	0.73969	0.3655	N	0.20766	0.605	0.38465	D	0.947313	P	0.38922	0.651	B	0.35039	0.194	T	0.69964	-0.5002	10	0.11794	T	0.64	.	11.2857	0.49220	0.151:0.0:0.849:0.0	.	701	Q13443	ADAM9_HUMAN	I	701	ENSP00000419446:V701I	ENSP00000419446:V701I	V	+	1	0	ADAM9	39066755	1.000000	0.71417	0.924000	0.36721	0.841000	0.47740	4.010000	0.57117	0.823000	0.34589	0.563000	0.77884	GTC	.	.		0.373	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2		
VCPIP1	80124	hgsc.bcm.edu	37	8	67578049	67578049	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:67578049T>C	ENST00000310421.4	-	1	1403	c.1145A>G	c.(1144-1146)cAg>cGg	p.Q382R	C8orf44_ENST00000521889.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	382					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AATAAGGTCCTGAGGCACACC	0.423																																					p.Q382R	NSCLC(179;265 2915 6144 43644)	Atlas-SNP	.											.	VCPIP1	110	.	0			c.A1145G						.						122.0	119.0	120.0					8																	67578049		2203	4300	6503	SO:0001583	missense	80124	exon1			AGGTCCTGAGGCA	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1145A>G	chr8.hg19:g.67578049T>C	ENSP00000309031:p.Gln382Arg	105.0	0.0		105.0	35.0	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	hg19	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.418125	0.42918	.	.	ENSG00000175073	ENST00000310421	T	0.36340	1.26	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.57007	0.2024	M	0.64997	1.995	0.80722	D	1	D	0.54601	0.967	D	0.65140	0.932	T	0.59862	-0.7374	10	0.87932	D	0	-9.1665	16.0623	0.80847	0.0:0.0:0.0:1.0	.	382	Q96JH7	VCIP1_HUMAN	R	382	ENSP00000309031:Q382R	ENSP00000309031:Q382R	Q	-	2	0	VCPIP1	67740603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.195000	0.70347	0.533000	0.62120	CAG	.	.		0.423	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
C8orf34	116328	hgsc.bcm.edu	37	8	69552726	69552726	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:69552726C>T	ENST00000539993.1	+	8	1512	c.963C>T	c.(961-963)aaC>aaT	p.N321N	C8orf34_ENST00000518698.1_Silent_p.N407N|C8orf34_ENST00000325233.3_Silent_p.N65N|C8orf34_ENST00000337103.4_Silent_p.N296N			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	321										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TCACACTGAACATCTGTTCAA	0.393																																					p.N407N		Atlas-SNP	.											.	C8orf34	170	.	0			c.C1221T						.						85.0	78.0	81.0					8																	69552726		2203	4300	6503	SO:0001819	synonymous_variant	116328	exon8			ACTGAACATCTGT	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.963C>T	chr8.hg19:g.69552726C>T		138.0	0.0		144.0	72.0	NM_052958	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Silent	SNP	ENST00000539993.1	hg19																																																																																				.	.		0.393	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958	
ZFHX4	79776	hgsc.bcm.edu	37	8	77768445	77768445	+	Silent	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:77768445A>T	ENST00000521891.2	+	10	9736	c.9288A>T	c.(9286-9288)acA>acT	p.T3096T	ZFHX4_ENST00000455469.2_Silent_p.T3051T|ZFHX4_ENST00000050961.6_Silent_p.T3051T|ZFHX4_ENST00000518282.1_Silent_p.T3070T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3051	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCCTGCCAACAGCCTACCCCG	0.542										HNSCC(33;0.089)																											p.T3096T		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A9288T						.						62.0	65.0	64.0					8																	77768445		2039	4193	6232	SO:0001819	synonymous_variant	79776	exon10			GCCAACAGCCTAC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9288A>T	chr8.hg19:g.77768445A>T		97.0	0.0		135.0	51.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.		0.542	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
VPS13B	157680	hgsc.bcm.edu	37	8	100123343	100123343	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:100123343A>T	ENST00000358544.2	+	6	709	c.598A>T	c.(598-600)Aga>Tga	p.R200*	VPS13B_ENST00000395996.1_Nonsense_Mutation_p.R200*|VPS13B_ENST00000355155.1_Nonsense_Mutation_p.R200*|VPS13B_ENST00000441350.2_Nonsense_Mutation_p.R200*|VPS13B_ENST00000357162.2_Nonsense_Mutation_p.R200*	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	200					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTTGGTGCTGAGAAAGGTTAT	0.289																																					p.R200X	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.A598T						.						62.0	66.0	65.0					8																	100123343		2198	4299	6497	SO:0001587	stop_gained	157680	exon6			GTGCTGAGAAAGG	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.598A>T	chr8.hg19:g.100123343A>T	ENSP00000351346:p.Arg200*	176.0	0.0		399.0	98.0	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	32	5.163764	0.94727	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	.	.	.	5.32	4.11	0.48088	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5279	0.61605	0.8612:0.1388:0.0:0.0	.	.	.	.	X	200	.	ENSP00000347281:R200X	R	+	1	2	VPS13B	100192519	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.692000	0.61746	2.005000	0.58758	0.454000	0.30748	AGA	.	.		0.289	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
ZFPM2	23414	hgsc.bcm.edu	37	8	106811123	106811123	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:106811123C>G	ENST00000407775.2	+	7	1161	c.911C>G	c.(910-912)aCc>aGc	p.T304S	ZFPM2_ENST00000517361.1_Missense_Mutation_p.T172S|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000520492.1_Missense_Mutation_p.T172S|ZFPM2_ENST00000378472.4_Missense_Mutation_p.T35S|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	304					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CCACAGTGCACCAAGAGCTTT	0.483																																					p.T304S		Atlas-SNP	.											.	ZFPM2	219	.	0			c.C911G						.						119.0	121.0	121.0					8																	106811123		1988	4182	6170	SO:0001583	missense	23414	exon7			AGTGCACCAAGAG	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.911C>G	chr8.hg19:g.106811123C>G	ENSP00000384179:p.Thr304Ser	74.0	0.0		193.0	8.0	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	hg19	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799942	0.70567	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	6.06	6.06	0.98353	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.091944	0.85682	D	0.000000	T	0.45518	0.1346	N	0.02665	-0.54	0.45567	D	0.998515	P	0.44090	0.826	B	0.42462	0.388	T	0.50617	-0.8807	10	0.09084	T	0.74	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	304	Q8WW38	FOG2_HUMAN	S	304;172;172;35	ENSP00000384179:T304S;ENSP00000430757:T172S;ENSP00000428720:T172S;ENSP00000367733:T35S	ENSP00000367733:T35S	T	+	2	0	ZFPM2	106880299	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.914000	0.63348	2.880000	0.98712	0.650000	0.86243	ACC	.	.		0.483	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
ZNF250	58500	hgsc.bcm.edu	37	8	146107094	146107094	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:146107094G>T	ENST00000292579.7	-	6	1605	c.1489C>A	c.(1489-1491)Cac>Aac	p.H497N	ZNF250_ENST00000342660.6_Intron|ZNF250_ENST00000417550.2_Missense_Mutation_p.H492N|ZNF250_ENST00000543949.1_Intron	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		GTCCTCAGGTGCACAATCAGA	0.552																																					p.H497N	NSCLC(16;520 556 24096 40084 43446)	Atlas-SNP	.											.	ZNF250	37	.	0			c.C1489A						.						82.0	69.0	73.0					8																	146107094		2203	4300	6503	SO:0001583	missense	58500	exon6			TCAGGTGCACAAT	AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1489C>A	chr8.hg19:g.146107094G>T	ENSP00000292579:p.His497Asn	85.0	0.0		61.0	36.0	NM_021061	D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	ENST00000292579.7	hg19	CCDS34972.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709271	0.68615	.	.	ENSG00000196150	ENST00000292579;ENST00000417550;ENST00000394912	D;D	0.86865	-2.18;-2.18	3.95	3.95	0.45737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000127	D	0.94699	0.8290	H	0.95470	3.675	0.80722	D	1	P;P	0.51147	0.77;0.942	P;P	0.60236	0.65;0.871	D	0.96167	0.9120	10	0.87932	D	0	-31.1942	15.9595	0.79918	0.0:0.0:1.0:0.0	.	492;497	D3DWP1;P15622	.;ZN250_HUMAN	N	497;492;380	ENSP00000292579:H497N;ENSP00000393442:H492N	ENSP00000292579:H497N	H	-	1	0	ZNF250	146077898	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	6.442000	0.73443	2.512000	0.84698	0.484000	0.47621	CAC	.	.		0.552	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061	
CDKN2A	1029	hgsc.bcm.edu	37	9	21994138	21994138	+	Splice_Site	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr9:21994138C>G	ENST00000579755.1	-	1	485	c.193G>C	c.(193-195)Ggt>Cgt	p.G65R	CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000361570.3_Splice_Site_p.G106R|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000584351.1_RNA|RP11-149I2.4_ENST00000578935.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000577551.1_RNA|CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2A_ENST00000530628.2_Splice_Site_p.G65R|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000470819.2_Intron			P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	82					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(198)|p.0(1)|p.G106C(1)|p.?(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCTTTCCTACCTGGTCTTCTA	0.602		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.G65R		Atlas-SNP	.											CDKN2A_ENST00000361570,NS,carcinoma,0,1	CDKN2A	4810	.	201	Whole gene deletion(199)|Substitution - Missense(1)|Unknown(1)	haematopoietic_and_lymphoid_tissue(34)|lung(33)|central_nervous_system(31)|skin(16)|kidney(14)|oesophagus(11)|bone(10)|pancreas(10)|urinary_tract(7)|breast(6)|soft_tissue(5)|thyroid(4)|pleura(4)|large_intestine(3)|stomach(3)|liver(3)|ovary(3)|upper_aerodigestive_tract(1)|vulva(1)|biliary_tract(1)|autonomic_ganglia(1)	c.G193C						.						13.0	15.0	14.0					9																	21994138		2172	4254	6426	SO:0001630	splice_region_variant	1029	exon1			TCCTACCTGGTCT	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000579755.1:c.193+1G>C	chr9.hg19:g.21994138C>G		47.0	0.0		56.0	16.0	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000579755.1	hg19	CCDS6511.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346476	0.82022	.	.	ENSG00000147889	ENST00000361570;ENST00000530628	D;D	0.88818	-2.43;-2.34	4.23	4.23	0.50019	.	0.000000	0.40302	N	0.001140	D	0.90380	0.6989	L	0.36672	1.1	0.34024	D	0.653063	D	0.89917	1.0	D	0.87578	0.998	D	0.91461	0.5189	9	.	.	.	.	12.2937	0.54833	0.0:1.0:0.0:0.0	.	106	Q8N726	CD2A2_HUMAN	R	106;65	ENSP00000355153:G106R;ENSP00000432664:G65R	.	G	-	1	0	CDKN2A	21984138	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.177000	0.50871	2.367000	0.80283	0.555000	0.69702	GGT	.	.		0.602	CDKN2A-004	KNOWN	NMD_exception|upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051918.5	NM_000077	Missense_Mutation
TMC1	117531	hgsc.bcm.edu	37	9	75406907	75406907	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr9:75406907G>C	ENST00000297784.5	+	16	1870	c.1330G>C	c.(1330-1332)Gga>Cga	p.G444R	TMC1_ENST00000396237.3_Missense_Mutation_p.G444R|TMC1_ENST00000340019.3_Missense_Mutation_p.G444R	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	444					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						ATGGCTACTGGGACGCATTTT	0.383																																					p.G444R	Pancreas(75;173 1345 14232 34245 43413)	Atlas-SNP	.											.	TMC1	87	.	0			c.G1330C						.						253.0	235.0	241.0					9																	75406907		2203	4300	6503	SO:0001583	missense	117531	exon16			CTACTGGGACGCA	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1330G>C	chr9.hg19:g.75406907G>C	ENSP00000297784:p.Gly444Arg	188.0	0.0		142.0	49.0	NM_138691	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	hg19	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394911	0.83011	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.49720	0.77;0.77;0.77	5.93	5.04	0.67666	.	0.165138	0.53938	D	0.000052	T	0.66208	0.2766	M	0.76838	2.35	0.58432	D	0.999999	P;P;D	0.64830	0.875;0.875;0.994	P;P;D	0.64410	0.786;0.786;0.925	T	0.65635	-0.6120	10	0.25106	T	0.35	-10.6796	15.1374	0.72579	0.0676:0.0:0.9324:0.0	.	411;411;444	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	R	444;444;411;411;411;438;444	ENSP00000297784:G444R;ENSP00000341433:G444R;ENSP00000379538:G444R	ENSP00000297784:G444R	G	+	1	0	TMC1	74596727	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.939000	0.87685	1.519000	0.48950	0.650000	0.86243	GGA	.	.		0.383	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
RASEF	158158	hgsc.bcm.edu	37	9	85640772	85640772	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr9:85640772A>G	ENST00000376447.3	-	2	756	c.496T>C	c.(496-498)Tat>Cat	p.Y166H		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	166					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						ACATGTTCATATGGCTGAATT	0.353																																					p.Y166H		Atlas-SNP	.											.	RASEF	69	.	0			c.T496C						.						191.0	176.0	181.0					9																	85640772		2203	4300	6503	SO:0001583	missense	158158	exon2			GTTCATATGGCTG	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.496T>C	chr9.hg19:g.85640772A>G	ENSP00000365630:p.Tyr166His	146.0	0.0		94.0	4.0	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	hg19	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.281683	0.80692	.	.	ENSG00000165105	ENST00000376447	T	0.66460	-0.21	5.99	5.99	0.97316	.	0.203730	0.43747	D	0.000533	T	0.78886	0.4354	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.80589	-0.1315	10	0.87932	D	0	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	166	Q8IZ41	RASEF_HUMAN	H	166	ENSP00000365630:Y166H	ENSP00000365630:Y166H	Y	-	1	0	RASEF	84830592	1.000000	0.71417	0.904000	0.35570	0.988000	0.76386	6.606000	0.74159	2.291000	0.77112	0.533000	0.62120	TAT	.	.		0.353	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
DIRAS2	54769	hgsc.bcm.edu	37	9	93375592	93375592	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr9:93375592G>T	ENST00000375765.3	-	2	906	c.518C>A	c.(517-519)aCc>aAc	p.T173N		NM_017594.3	NP_060064.2	Q96HU8	DIRA2_HUMAN	DIRAS family, GTP-binding RAS-like 2	173					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			kidney(1)|large_intestine(6)|lung(3)|skin(2)	12						GAGACTCACGGTCCTGCGCTT	0.547																																					p.T173N		Atlas-SNP	.											.	DIRAS2	21	.	0			c.C518A						.						150.0	135.0	140.0					9																	93375592		2203	4300	6503	SO:0001583	missense	54769	exon2			CTCACGGTCCTGC	AB076889	CCDS6687.1	9q22.32	2014-05-09			ENSG00000165023	ENSG00000165023			19323	protein-coding gene	gene with protein product		607863				12194967	Standard	NM_017594		Approved	Di-Ras2, DKFZp761C07121	uc004aqx.1	Q96HU8	OTTHUMG00000020196	ENST00000375765.3:c.518C>A	chr9.hg19:g.93375592G>T	ENSP00000364919:p.Thr173Asn	102.0	0.0		89.0	4.0	NM_017594	B3KVM2	Missense_Mutation	SNP	ENST00000375765.3	hg19	CCDS6687.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487689	0.26686	.	.	ENSG00000165023	ENST00000375765	T	0.68903	-0.36	5.21	5.21	0.72293	.	0.118100	0.56097	D	0.000035	T	0.38719	0.1051	N	0.01431	-0.87	0.54753	D	0.999984	B	0.02656	0.0	B	0.04013	0.001	T	0.42103	-0.9471	10	0.07990	T	0.79	.	18.3183	0.90229	0.0:0.0:1.0:0.0	.	173	Q96HU8	DIRA2_HUMAN	N	173	ENSP00000364919:T173N	ENSP00000364919:T173N	T	-	2	0	DIRAS2	92415412	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.998000	0.57024	2.884000	0.98904	0.655000	0.94253	ACC	.	.		0.547	DIRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053012.1		
LHX6	26468	hgsc.bcm.edu	37	9	124989224	124989224	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr9:124989224A>G	ENST00000373755.2	-	2	263	c.155T>C	c.(154-156)gTc>gCc	p.V52A	LHX6_ENST00000340587.3_Missense_Mutation_p.V81A|LHX6_ENST00000394319.4_Missense_Mutation_p.V81A|LHX6_ENST00000373754.2_Missense_Mutation_p.V52A|LHX6_ENST00000541397.2_Missense_Mutation_p.V70A|LHX6_ENST00000559529.1_5'Flank	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	52					cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						CGGTGAGCAGACAGATGGCGT	0.662																																					p.V81A		Atlas-SNP	.											.	LHX6	73	.	0			c.T242C						.						72.0	53.0	60.0					9																	124989224		2189	4278	6467	SO:0001583	missense	26468	exon3			GAGCAGACAGATG	AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.155T>C	chr9.hg19:g.124989224A>G	ENSP00000362860:p.Val52Ala	49.0	0.0		27.0	11.0	NM_014368	A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Missense_Mutation	SNP	ENST00000373755.2	hg19	CCDS56583.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.952524	0.53293	.	.	ENSG00000106852	ENST00000373755;ENST00000373754;ENST00000394319;ENST00000340587;ENST00000541397	D;D;D;D;D	0.87103	-2.21;-2.17;-2.06;-2.01;-2.1	5.44	5.44	0.79542	.	0.192922	0.44097	D	0.000485	T	0.79076	0.4385	L	0.29908	0.895	0.80722	D	1	B;B;B	0.32918	0.39;0.005;0.004	B;B;B	0.29862	0.108;0.004;0.005	T	0.76121	-0.3075	10	0.16420	T	0.52	.	14.6748	0.68972	1.0:0.0:0.0:0.0	.	52;81;81	Q9UPM6;Q9UPM6-4;Q9UPM6-3	LHX6_HUMAN;.;.	A	52;52;81;81;70	ENSP00000362860:V52A;ENSP00000362859:V52A;ENSP00000377854:V81A;ENSP00000340137:V81A;ENSP00000441464:V70A	ENSP00000340137:V81A	V	-	2	0	LHX6	124029045	0.998000	0.40836	0.994000	0.49952	0.963000	0.63663	3.962000	0.56766	2.055000	0.61198	0.379000	0.24179	GTC	.	.		0.662	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053924.2	NM_014368	
AKR1C4	1109	hgsc.bcm.edu	37	10	5238850	5238850	+	Missense_Mutation	SNP	G	G	A	rs373855442		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr10:5238850G>A	ENST00000380448.1	+	3	273	c.20G>A	c.(19-21)cGt>cAt	p.R7H	AKR1CL1_ENST00000445191.1_Intron|AKR1C4_ENST00000263126.1_Missense_Mutation_p.R7H|U8_ENST00000516100.1_RNA			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	7					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						AAATATCAGCGTGTAGAGCTA	0.408																																					p.R7H		Atlas-SNP	.											.	AKR1C4	57	.	0			c.G20A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	253.0	205.0	221.0		20	-3.6	0.0	10		221	0,8600		0,0,4300	no	missense	AKR1C4	NM_001818.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	7/324	5238850	1,13005	2203	4300	6503	SO:0001583	missense	1109	exon1			ATCAGCGTGTAGA	M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.20G>A	chr10.hg19:g.5238850G>A	ENSP00000369814:p.Arg7His	129.0	0.0		190.0	116.0	NM_001818	Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	ENST00000380448.1	hg19	CCDS7064.1	.	.	.	.	.	.	.	.	.	.	G	5.139	0.211236	0.09757	2.27E-4	0.0	ENSG00000198610	ENST00000380448;ENST00000263126;ENST00000397357	T;T	0.55930	0.49;0.49	2.92	-3.61	0.04556	NADP-dependent oxidoreductase domain (2);	1.662580	0.03590	N	0.231684	T	0.31327	0.0793	N	0.25485	0.75	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.05784	-1.0864	10	0.14656	T	0.56	.	1.2306	0.01943	0.3178:0.15:0.3804:0.1518	.	7	P17516	AK1C4_HUMAN	H	7	ENSP00000369814:R7H;ENSP00000263126:R7H	ENSP00000263126:R7H	R	+	2	0	AKR1C4	5228850	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.805000	0.04530	-0.745000	0.04772	0.591000	0.81541	CGT	.	.		0.408	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046543.2	NM_001818	
FAM171A1	221061	hgsc.bcm.edu	37	10	15256432	15256432	+	Silent	SNP	G	G	C	rs143895945		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr10:15256432G>C	ENST00000378116.4	-	8	1161	c.1155C>G	c.(1153-1155)ccC>ccG	p.P385P	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	385						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CGGGGGCCTCGGGGCGGCCGT	0.602																																					p.P385P		Atlas-SNP	.											.	FAM171A1	252	.	0			c.C1155G						.						37.0	44.0	42.0					10																	15256432		2203	4300	6503	SO:0001819	synonymous_variant	221061	exon8			GGCCTCGGGGCGG	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1155C>G	chr10.hg19:g.15256432G>C		94.0	0.0		151.0	31.0	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	hg19	CCDS31154.1																																																																																			.	G|1.000;A|0.000		0.602	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
ZNF485	220992	hgsc.bcm.edu	37	10	44111881	44111881	+	Silent	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr10:44111881T>C	ENST00000361807.3	+	5	584	c.390T>C	c.(388-390)taT>taC	p.Y130Y	ZNF485_ENST00000374435.3_Silent_p.Y130Y|ZNF485_ENST00000374437.2_Silent_p.Y39Y	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						AGAAGAACTATAAGTGCAAGG	0.433																																					p.Y130Y		Atlas-SNP	.											.	ZNF485	102	.	0			c.T390C						.						92.0	94.0	93.0					10																	44111881		2203	4300	6503	SO:0001819	synonymous_variant	220992	exon5			GAACTATAAGTGC	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.390T>C	chr10.hg19:g.44111881T>C		243.0	0.0		203.0	101.0	NM_145312	B4DSE6|Q96CL0	Silent	SNP	ENST00000361807.3	hg19	CCDS7205.2																																																																																			.	.		0.433	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312	
STOX1	219736	hgsc.bcm.edu	37	10	70646233	70646233	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr10:70646233G>C	ENST00000298596.6	+	3	2764	c.2681G>C	c.(2680-2682)aGa>aCa	p.R894T	STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Missense_Mutation_p.R784T|STOX1_ENST00000399169.4_Missense_Mutation_p.R894T	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	894						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						CAGGAAATGAGAAAACATTTC	0.428																																					p.R894T		Atlas-SNP	.											.	STOX1	75	.	0			c.G2681C						.						65.0	68.0	67.0					10																	70646233		2096	4255	6351	SO:0001583	missense	219736	exon3			AAATGAGAAAACA	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.2681G>C	chr10.hg19:g.70646233G>C	ENSP00000298596:p.Arg894Thr	115.0	0.0		103.0	21.0	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	ENST00000298596.6	hg19	CCDS41535.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299947	0.40694	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	T;T;T	0.75821	-0.97;-0.97;-0.65	6.17	3.01	0.34805	.	0.297785	0.35772	N	0.002998	T	0.67534	0.2903	M	0.62723	1.935	0.09310	N	1	B	0.34372	0.451	B	0.30179	0.112	T	0.60541	-0.7243	10	0.72032	D	0.01	.	9.7037	0.40203	0.2483:0.0:0.7517:0.0	.	894	Q6ZVD7	STOX1_HUMAN	T	894;894;784	ENSP00000382121:R894T;ENSP00000298596:R894T;ENSP00000394509:R784T	ENSP00000298596:R894T	R	+	2	0	STOX1	70316239	0.018000	0.18449	0.354000	0.25760	0.892000	0.51952	1.008000	0.29872	0.328000	0.23435	0.655000	0.94253	AGA	.	.		0.428	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
SLC35G1	159371	hgsc.bcm.edu	37	10	95660950	95660950	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr10:95660950C>T	ENST00000427197.1	+	3	862	c.801C>T	c.(799-801)gtC>gtT	p.V267V	SLC35G1_ENST00000371408.3_Silent_p.V266V	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	267	EamA 2.				calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TTGAAAGTGTCATCATCCTCT	0.428																																					p.V267V		Atlas-SNP	.											.	.	.	.	0			c.C801T						.						121.0	121.0	121.0					10																	95660950		2203	4300	6503	SO:0001819	synonymous_variant	159371	exon3			AAGTGTCATCATC	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.801C>T	chr10.hg19:g.95660950C>T		168.0	0.0		161.0	28.0	NM_001134658	Q86YG5|Q8NBA5	Silent	SNP	ENST00000427197.1	hg19	CCDS44459.1																																																																																			.	.		0.428	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_153226	
SEC23IP	11196	hgsc.bcm.edu	37	10	121678006	121678006	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr10:121678006C>G	ENST00000369075.3	+	10	1927	c.1855C>G	c.(1855-1857)Cat>Gat	p.H619D	SEC23IP_ENST00000543134.1_Missense_Mutation_p.H408D	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	619					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		GAAGCAGCTACATTTTCAGGA	0.368																																					p.H619D		Atlas-SNP	.											.	SEC23IP	100	.	0			c.C1855G						.						111.0	105.0	107.0					10																	121678006		2203	4300	6503	SO:0001583	missense	11196	exon10			CAGCTACATTTTC	AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1855C>G	chr10.hg19:g.121678006C>G	ENSP00000358071:p.His619Asp	122.0	0.0		66.0	26.0	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	hg19	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	C	3.986	-0.005505	0.07773	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.43688	0.94;0.94	5.72	-0.446	0.12238	.	1.579740	0.02992	N	0.146968	T	0.22742	0.0549	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07121	-1.0789	10	0.10377	T	0.69	0.7776	1.0414	0.01559	0.3149:0.3034:0.2178:0.1639	.	408;619	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	D	619;408	ENSP00000358071:H619D;ENSP00000438773:H408D	ENSP00000358071:H619D	H	+	1	0	SEC23IP	121667996	0.000000	0.05858	0.011000	0.14972	0.990000	0.78478	0.689000	0.25437	0.087000	0.17167	0.655000	0.94253	CAT	.	.		0.368	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
PTPN5	84867	hgsc.bcm.edu	37	11	18787389	18787389	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:18787389C>T	ENST00000358540.2	-	3	492	c.62G>A	c.(61-63)gGg>gAg	p.G21E	PTPN5_ENST00000396171.4_Missense_Mutation_p.G21E|PTPN5_ENST00000396170.1_Missense_Mutation_p.G21E|PTPN5_ENST00000396168.1_5'UTR|PTPN5_ENST00000396167.2_Missense_Mutation_p.G21E	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	21					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GTCCAGGGCCCCTCCCTCGGA	0.562																																					p.G21E		Atlas-SNP	.											.	PTPN5	163	.	0			c.G62A						.						65.0	52.0	56.0					11																	18787389		2198	4293	6491	SO:0001583	missense	84867	exon3			AGGGCCCCTCCCT	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.62G>A	chr11.hg19:g.18787389C>T	ENSP00000351342:p.Gly21Glu	98.0	0.0		94.0	27.0	NM_032781	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	hg19	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120724	0.56613	.	.	ENSG00000110786	ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167	T;T;T;T	0.08634	3.57;3.07;3.57;3.07	5.41	5.41	0.78517	.	0.000000	0.49305	D	0.000149	T	0.13670	0.0331	N	0.19112	0.55	0.29891	N	0.82521	D;D	0.64830	0.994;0.987	P;P	0.58454	0.839;0.737	T	0.01290	-1.1394	10	0.87932	D	0	.	14.7073	0.69200	0.0:1.0:0.0:0.0	.	21;21	P54829;B3KXG7	PTN5_HUMAN;.	E	21	ENSP00000351342:G21E;ENSP00000379473:G21E;ENSP00000379474:G21E;ENSP00000379470:G21E	ENSP00000351342:G21E	G	-	2	0	PTPN5	18743965	0.988000	0.35896	0.991000	0.47740	0.191000	0.23601	3.549000	0.53681	2.520000	0.84964	0.563000	0.77884	GGG	.	.		0.562	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970	
CCDC88B	283234	hgsc.bcm.edu	37	11	64110657	64110657	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:64110657C>T	ENST00000356786.5	+	11	1113	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'Flank	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	357						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CCAGGAGGAGCGGGTGCTCTC	0.692																																					p.R357W		Atlas-SNP	.											.	CCDC88B	89	.	0			c.C1069T						.						9.0	7.0	8.0					11																	64110657		2079	4072	6151	SO:0001583	missense	283234	exon11			GAGGAGCGGGTGC	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1069C>T	chr11.hg19:g.64110657C>T	ENSP00000349238:p.Arg357Trp	36.0	0.0		29.0	12.0	NM_032251	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	hg19	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	.	20.4	3.986989	0.74589	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.17854	2.25	4.33	4.33	0.51752	.	.	.	.	.	T	0.37073	0.0990	M	0.74467	2.265	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.60886	0.88;0.88	T	0.26849	-1.0091	9	0.87932	D	0	.	12.7787	0.57464	0.0:1.0:0.0:0.0	.	357;357	B2RTU8;A6NC98	.;CC88B_HUMAN	W	357	ENSP00000349238:R357W	ENSP00000349238:R357W	R	+	1	2	CCDC88B	63867233	0.906000	0.30813	0.908000	0.35775	0.533000	0.34776	1.641000	0.37197	2.143000	0.66587	0.456000	0.33151	CGG	.	.		0.692	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
B3GNT1	11041	hgsc.bcm.edu	37	11	66114190	66114190	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:66114190A>T	ENST00000311181.4	-	1	973	c.827T>A	c.(826-828)gTg>gAg	p.V276E	BRMS1_ENST00000425825.2_5'Flank|BRMS1_ENST00000359957.3_5'Flank|RP11-867G23.8_ENST00000531602.1_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	276					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						GTAGAGCTGCACCAGCTCGTT	0.612																																					p.V276E		Atlas-SNP	.											.	B3GNT1	28	.	0			c.T827A						.						60.0	64.0	63.0					11																	66114190		2200	4295	6495	SO:0001583	missense	11041	exon1			AGCTGCACCAGCT	AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.827T>A	chr11.hg19:g.66114190A>T	ENSP00000309096:p.Val276Glu	74.0	0.0		45.0	15.0	NM_006876	Q4TTN0	Missense_Mutation	SNP	ENST00000311181.4	hg19	CCDS8136.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.263086	0.39995	.	.	ENSG00000174684	ENST00000311181;ENST00000538757	T	0.21932	1.98	5.59	4.47	0.54385	.	0.501380	0.19877	N	0.104075	T	0.13114	0.0318	N	0.19112	0.55	0.50813	D	0.999892	B	0.22146	0.065	B	0.23150	0.044	T	0.10497	-1.0627	10	0.22706	T	0.39	-5.0474	9.6143	0.39681	0.917:0.0:0.083:0.0	.	276	O43505	B3GN1_HUMAN	E	276;47	ENSP00000309096:V276E	ENSP00000309096:V276E	V	-	2	0	B3GNT1	65870766	1.000000	0.71417	0.990000	0.47175	0.869000	0.49853	5.734000	0.68580	0.967000	0.38186	0.460000	0.39030	GTG	.	.		0.612	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392959.1	NM_006876	
NUMA1	4926	hgsc.bcm.edu	37	11	71725431	71725431	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:71725431C>T	ENST00000393695.3	-	15	3449	c.3118G>A	c.(3118-3120)Gag>Aag	p.E1040K	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Missense_Mutation_p.E1040K|NUMA1_ENST00000351960.6_Intron	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						ACACGCTGCTCGTTGAGGGCG	0.647			T	RARA	APL																																p.E1040K		Atlas-SNP	.		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	NUMA1	142	.	0			c.G3118A						.						50.0	51.0	50.0					11																	71725431		2199	4293	6492	SO:0001583	missense	4926	exon15			GCTGCTCGTTGAG	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.3118G>A	chr11.hg19:g.71725431C>T	ENSP00000377298:p.Glu1040Lys	56.0	0.0		23.0	9.0	NM_006185		Missense_Mutation	SNP	ENST00000393695.3	hg19	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010106	0.54361	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T	0.15256	2.44;2.45	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000019	T	0.32763	0.0840	L	0.50333	1.59	0.31343	N	0.683423	D;D;D;D	0.89917	1.0;0.998;0.994;1.0	D;P;P;D	0.79108	0.992;0.805;0.777;0.992	T	0.14896	-1.0456	9	.	.	.	.	10.8901	0.46990	0.0:0.913:0.0:0.087	.	1046;524;1040;1040	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	K	1040;1040;603;9	ENSP00000351851:E1040K;ENSP00000377298:E1040K	.	E	-	1	0	NUMA1	71403079	0.983000	0.35010	0.999000	0.59377	0.922000	0.55478	2.749000	0.47492	2.644000	0.89710	0.655000	0.94253	GAG	.	.		0.647	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
PGM2L1	283209	hgsc.bcm.edu	37	11	74058249	74058249	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:74058249C>T	ENST00000298198.4	-	7	1194	c.883G>A	c.(883-885)Gat>Aat	p.D295N		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	295					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					AAGTCTGGATCAGGATCTTTT	0.348																																					p.D295N		Atlas-SNP	.											.	PGM2L1	59	.	0			c.G883A						.						74.0	75.0	75.0					11																	74058249		2200	4293	6493	SO:0001583	missense	283209	exon7			CTGGATCAGGATC	AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.883G>A	chr11.hg19:g.74058249C>T	ENSP00000298198:p.Asp295Asn	148.0	0.0		97.0	23.0	NM_173582	Q96MQ7|Q9UIK3	Missense_Mutation	SNP	ENST00000298198.4	hg19	CCDS8231.1	.	.	.	.	.	.	.	.	.	.	C	32	5.143109	0.94560	.	.	ENSG00000165434	ENST00000298198	T	0.69926	-0.44	5.45	5.45	0.79879	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (1);	0.000000	0.85682	D	0.000000	T	0.81083	0.4749	M	0.78456	2.415	0.80722	D	1	D	0.54397	0.966	D	0.64237	0.923	T	0.82137	-0.0606	10	0.52906	T	0.07	-21.9469	16.7933	0.85595	0.0:1.0:0.0:0.0	.	295	Q6PCE3	PGM2L_HUMAN	N	295	ENSP00000298198:D295N	ENSP00000298198:D295N	D	-	1	0	PGM2L1	73735897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.535000	0.85469	0.563000	0.77884	GAT	.	.		0.348	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398324.1	NM_173582	
KCNE3	10008	hgsc.bcm.edu	37	11	74168597	74168597	+	Silent	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:74168597G>A	ENST00000310128.4	-	3	431	c.12C>T	c.(10-12)acC>acT	p.T4T	RP11-702H23.4_ENST00000533008.1_RNA|RP11-702H23.6_ENST00000530510.1_RNA|KCNE3_ENST00000525550.1_Silent_p.T4T	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	4			T -> A (in dbSNP:rs200856070). {ECO:0000269|PubMed:19306396}.		regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					CCGTTCCATTGGTAGTCTCCA	0.562																																					p.T4T		Atlas-SNP	.											.	KCNE3	7	.	0			c.C12T						.						67.0	65.0	65.0					11																	74168597		2200	4293	6493	SO:0001819	synonymous_variant	10008	exon3			TCCATTGGTAGTC	AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.12C>T	chr11.hg19:g.74168597G>A		138.0	0.0		88.0	26.0	NM_005472		Silent	SNP	ENST00000310128.4	hg19	CCDS8232.1																																																																																			.	.		0.562	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385531.1	NM_005472	
TRPC6	7225	hgsc.bcm.edu	37	11	101344488	101344488	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:101344488G>T	ENST00000344327.3	-	7	2185	c.1761C>A	c.(1759-1761)gaC>gaA	p.D587E	TRPC6_ENST00000532133.1_Missense_Mutation_p.D509E|TRPC6_ENST00000348423.4_Missense_Mutation_p.D471E|TRPC6_ENST00000360497.4_Missense_Mutation_p.D532E	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	587					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GATCAGAGGGGTCCCACTTTA	0.338																																					p.D587E	Colon(166;1315 1927 11094 12848 34731)	Atlas-SNP	.											.	TRPC6	132	.	0			c.C1761A						.						67.0	70.0	69.0					11																	101344488		2203	4294	6497	SO:0001583	missense	7225	exon7			AGAGGGGTCCCAC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1761C>A	chr11.hg19:g.101344488G>T	ENSP00000340913:p.Asp587Glu	137.0	0.0		66.0	23.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	hg19	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	3.969	-0.008849	0.07727	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;D;D;D	0.99270	-1.13;-4.93;-5.66;-5.66	5.91	4.99	0.66335	Ion transport (1);	0.167845	0.50627	D	0.000113	D	0.96620	0.8897	N	0.25485	0.75	0.37480	D	0.915969	P;P;P	0.40066	0.652;0.481;0.701	B;B;P	0.45276	0.344;0.146;0.475	D	0.94292	0.7529	10	0.06494	T	0.89	-4.5201	4.8129	0.13353	0.1547:0.2084:0.6369:0.0	.	532;471;587	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	E	587;509;471;532	ENSP00000340913:D587E;ENSP00000435574:D509E;ENSP00000343672:D471E;ENSP00000353687:D532E	ENSP00000340913:D587E	D	-	3	2	TRPC6	100849698	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.723000	0.38053	2.793000	0.96121	0.655000	0.94253	GAC	.	.		0.338	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
NEUROD4	58158	hgsc.bcm.edu	37	12	55420588	55420588	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr12:55420588A>G	ENST00000242994.3	+	2	743	c.365A>G	c.(364-366)aAa>aGa	p.K122R		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	122	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						AAAACCCAAAAACTTTCCAAG	0.498																																					p.K122R		Atlas-SNP	.											.	NEUROD4	87	.	0			c.A365G						.						81.0	86.0	85.0					12																	55420588		2203	4300	6503	SO:0001583	missense	58158	exon2			CCCAAAAACTTTC	AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.365A>G	chr12.hg19:g.55420588A>G	ENSP00000242994:p.Lys122Arg	119.0	0.0		129.0	34.0	NM_021191	B2RAC9	Missense_Mutation	SNP	ENST00000242994.3	hg19	CCDS8886.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.115044	0.77210	.	.	ENSG00000123307	ENST00000242994	D	0.99098	-5.42	5.49	5.49	0.81192	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98548	0.9515	L	0.37800	1.135	0.58432	D	0.999999	P	0.52061	0.95	D	0.64687	0.928	D	0.99694	1.1002	10	0.66056	D	0.02	-27.3093	13.8561	0.63527	1.0:0.0:0.0:0.0	.	122	Q9HD90	NDF4_HUMAN	R	122	ENSP00000242994:K122R	ENSP00000242994:K122R	K	+	2	0	NEUROD4	53706855	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.339000	0.96797	2.222000	0.72286	0.533000	0.62120	AAA	.	.		0.498	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1		
PTPRB	5787	hgsc.bcm.edu	37	12	71016198	71016198	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr12:71016198G>C	ENST00000550358.1	-	3	705	c.680C>G	c.(679-681)aCt>aGt	p.T227S	PTPRB_ENST00000334414.6_Missense_Mutation_p.T227S|PTPRB_ENST00000551525.1_Missense_Mutation_p.T226S|PTPRB_ENST00000538174.2_5'UTR			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GAAGGGCTGAGTAGTCGACAA	0.498																																					p.T227S		Atlas-SNP	.											.	PTPRB	676	.	0			c.C680G						.						162.0	174.0	170.0					12																	71016198		2049	4198	6247	SO:0001583	missense	5787	exon3			GGCTGAGTAGTCG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.680C>G	chr12.hg19:g.71016198G>C	ENSP00000448058:p.Thr227Ser	88.0	0.0		78.0	19.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000550358.1	hg19		.	.	.	.	.	.	.	.	.	.	G	19.90	3.912715	0.72983	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525;ENST00000548122	T;T;T;T	0.05081	4.12;4.02;3.58;3.5	5.71	4.82	0.62117	.	.	.	.	.	T	0.09818	0.0241	L	0.51422	1.61	0.43531	D	0.99581	P;P;B;P;D	0.56521	0.682;0.952;0.149;0.675;0.976	B;P;B;B;P	0.49085	0.156;0.536;0.051;0.347;0.6	T	0.14952	-1.0454	9	0.06891	T	0.86	.	14.7664	0.69642	0.0:0.1442:0.8558:0.0	.	106;227;226;227;227	Q6ZR19;Q6ZTX7;F8VSD5;P23467-3;F8VU56	.;.;.;.;.	S	227;227;227;226;106	ENSP00000334928:T227S;ENSP00000448058:T227S;ENSP00000448349:T226S;ENSP00000446982:T106S	ENSP00000334928:T227S	T	-	2	0	PTPRB	69302465	0.414000	0.25408	0.014000	0.15608	0.806000	0.45545	2.026000	0.41069	1.399000	0.46721	0.650000	0.86243	ACT	.	.		0.498	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404436.1		
HAL	3034	hgsc.bcm.edu	37	12	96384225	96384225	+	Silent	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr12:96384225T>C	ENST00000261208.3	-	10	1169	c.801A>G	c.(799-801)ctA>ctG	p.L267L	HAL_ENST00000551562.1_5'UTR|HAL_ENST00000541929.1_Silent_p.L59L|HAL_ENST00000538703.1_Silent_p.L267L	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	267					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	CTTCTCCAACTAGCCCAAGAG	0.547																																					p.L267L	NSCLC(169;943 2815 23563 30031)	Atlas-SNP	.											.	HAL	73	.	0			c.A801G						.						165.0	136.0	146.0					12																	96384225		2203	4300	6503	SO:0001819	synonymous_variant	3034	exon10			TCCAACTAGCCCA		CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.801A>G	chr12.hg19:g.96384225T>C		125.0	0.0		112.0	36.0	NM_001258334	B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	ENST00000261208.3	hg19	CCDS9058.1																																																																																			.	.		0.547	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408644.1		
SETD1B	23067	hgsc.bcm.edu	37	12	122260499	122260499	+	Silent	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr12:122260499G>T	ENST00000604567.1	+	12	4082	c.4014G>T	c.(4012-4014)ccG>ccT	p.P1338P	SETD1B_ENST00000267197.5_Silent_p.P1295P|SETD1B_ENST00000542440.1_Silent_p.P1295P			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1338	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GCCCACCGCCGGAGCCTGAGA	0.687																																					p.P1295P		Atlas-SNP	.											.	SETD1B	105	.	0			c.G3885T						.						53.0	74.0	68.0					12																	122260499		692	1591	2283	SO:0001819	synonymous_variant	23067	exon12			ACCGCCGGAGCCT	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.4014G>T	chr12.hg19:g.122260499G>T		86.0	0.0		73.0	22.0	NM_015048	F6MFW1	Silent	SNP	ENST00000604567.1	hg19																																																																																				.	.		0.687	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
KL	9365	hgsc.bcm.edu	37	13	33629230	33629230	+	Silent	SNP	C	C	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr13:33629230C>G	ENST00000380099.3	+	3	1385	c.1377C>G	c.(1375-1377)tcC>tcG	p.S459S	KL_ENST00000426690.2_Silent_p.S152S|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	459	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.S459S(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CCGCATGGTCCCTCATGGATG	0.517																																					p.S459S		Atlas-SNP	.											KL,trunk,malignant_melanoma,0,1	KL	106	.	1	Substitution - coding silent(1)	skin(1)	c.C1377G						.						178.0	142.0	154.0					13																	33629230		2203	4300	6503	SO:0001819	synonymous_variant	9365	exon3			ATGGTCCCTCATG	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1377C>G	chr13.hg19:g.33629230C>G		162.0	0.0		147.0	31.0	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Silent	SNP	ENST00000380099.3	hg19	CCDS9347.1																																																																																			.	.		0.517	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
PCID2	55795	hgsc.bcm.edu	37	13	113835450	113835450	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr13:113835450C>T	ENST00000337344.4	-	10	856	c.780G>A	c.(778-780)atG>atA	p.M260I	PCID2_ENST00000375459.1_Missense_Mutation_p.M258I|PCID2_ENST00000375457.2_Missense_Mutation_p.M258I|PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375479.2_Missense_Mutation_p.M260I|PCID2_ENST00000375477.1_Missense_Mutation_p.M260I|PCID2_ENST00000246505.5_Missense_Mutation_p.M314I	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	260					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			TCACCAATAGCATTTTTACTG	0.388																																					p.M314I		Atlas-SNP	.											.	PCID2	30	.	0			c.G942A						.						139.0	122.0	128.0					13																	113835450		2203	4300	6503	SO:0001583	missense	55795	exon10			CAATAGCATTTTT	AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.780G>A	chr13.hg19:g.113835450C>T	ENSP00000337405:p.Met260Ile	116.0	0.0		122.0	47.0	NM_001258212	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	ENST00000337344.4	hg19	CCDS9532.2	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338430	0.60963	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	.	.	.	5.25	5.25	0.73442	PCI/PINT associated module (1);	0.000000	0.85682	D	0.000000	T	0.71178	0.3309	L	0.51853	1.615	0.80722	D	1	D;D	0.64830	0.963;0.994	P;P	0.60173	0.827;0.87	T	0.65602	-0.6128	9	0.19590	T	0.45	-45.057	18.867	0.92296	0.0:1.0:0.0:0.0	.	314;260	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	I	260;260;260;314;258;258;237;260;237	.	ENSP00000246505:M314I	M	-	3	0	PCID2	112883451	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	7.662000	0.83803	2.445000	0.82738	0.563000	0.77884	ATG	.	.		0.388	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1	NM_018386	
LAMP1	3916	hgsc.bcm.edu	37	13	113975881	113975881	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr13:113975881T>G	ENST00000332556.4	+	8	1147	c.953T>G	c.(952-954)tTt>tGt	p.F318C	LAMP1_ENST00000397181.3_Missense_Mutation_p.F265C	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	318	Second lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GACCCTGCCTTTAAAGCTGCC	0.622																																					p.F318C		Atlas-SNP	.											.	LAMP1	41	.	0			c.T953G						.						75.0	83.0	81.0					13																	113975881		1979	4152	6131	SO:0001583	missense	3916	exon8			CTGCCTTTAAAGC	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.953T>G	chr13.hg19:g.113975881T>G	ENSP00000333298:p.Phe318Cys	127.0	0.0		161.0	16.0	NM_005561	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	ENST00000332556.4	hg19	CCDS41909.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.912682	0.72983	.	.	ENSG00000185896	ENST00000332556;ENST00000397181	T;T	0.39406	1.08;1.08	5.27	5.27	0.74061	.	0.052087	0.85682	D	0.000000	T	0.70133	0.3189	M	0.89601	3.045	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.77004	0.983;0.989	T	0.77403	-0.2601	10	0.72032	D	0.01	-36.6196	14.376	0.66879	0.0:0.0:0.0:1.0	.	265;318	B4DWL3;P11279	.;LAMP1_HUMAN	C	318;265	ENSP00000333298:F318C;ENSP00000415354:F265C	ENSP00000333298:F318C	F	+	2	0	LAMP1	113023882	0.995000	0.38212	0.025000	0.17156	0.003000	0.03518	2.875000	0.48491	2.000000	0.58554	0.448000	0.29417	TTT	.	.		0.622	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2		
MDGA2	161357	hgsc.bcm.edu	37	14	48143777	48143777	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr14:48143777C>A	ENST00000399232.2	-	1	380	c.16G>T	c.(16-18)Ggt>Tgt	p.G6C	MDGA2_ENST00000439988.3_Missense_Mutation_p.G75C	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	6					pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CACACGAGACCGTACAGTAAA	0.587																																					p.G75C		Atlas-SNP	.											.	MDGA2	470	.	0			c.G223T						.						204.0	187.0	192.0					14																	48143777		692	1591	2283	SO:0001583	missense	161357	exon1			CGAGACCGTACAG	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.16G>T	chr14.hg19:g.48143777C>A	ENSP00000382178:p.Gly6Cys	159.0	0.0		102.0	26.0	NM_001113498	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	hg19		.	.	.	.	.	.	.	.	.	.	C	13.67	2.305657	0.40795	.	.	ENSG00000139915	ENST00000439988;ENST00000399232	T;T	0.64438	0.13;-0.1	5.07	4.17	0.49024	.	.	.	.	.	T	0.39036	0.1063	N	0.08118	0	0.80722	D	1	B	0.18461	0.028	B	0.16289	0.015	T	0.22277	-1.0221	8	.	.	.	.	12.2041	0.54342	0.0:0.9109:0.0:0.0891	.	6	Q7Z553	MDGA2_HUMAN	C	6;75	ENSP00000400011:G6C;ENSP00000382178:G75C	.	G	-	1	0	MDGA2	47213527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.834000	0.39171	2.530000	0.85305	0.650000	0.86243	GGT	.	.		0.587	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
ATL1	51062	hgsc.bcm.edu	37	14	51079994	51079994	+	Silent	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr14:51079994T>C	ENST00000358385.6	+	7	889	c.648T>C	c.(646-648)gtT>gtC	p.V216V	ATL1_ENST00000441560.2_Silent_p.V216V|ATL1_ENST00000354525.4_Silent_p.V216V|ATL1_ENST00000357032.3_Silent_p.V216V	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	216	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						TATTTCTTGTTCGAGACTGGA	0.368																																					p.V216V		Atlas-SNP	.											.	ATL1	46	.	0			c.T648C						.						101.0	102.0	102.0					14																	51079994		2203	4300	6503	SO:0001819	synonymous_variant	51062	exon7			TCTTGTTCGAGAC	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.648T>C	chr14.hg19:g.51079994T>C		112.0	0.0		109.0	16.0	NM_015915	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Silent	SNP	ENST00000358385.6	hg19	CCDS9700.1																																																																																			.	.		0.368	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2		
PCNX	22990	hgsc.bcm.edu	37	14	71479802	71479802	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr14:71479802A>G	ENST00000304743.2	+	11	3325	c.2879A>G	c.(2878-2880)tAc>tGc	p.Y960C	PCNX_ENST00000439984.3_Missense_Mutation_p.Y849C|PCNX_ENST00000238570.5_Missense_Mutation_p.Y960C	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	960						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GCAGCTACTTACGGCCCAACA	0.443																																					p.Y960C		Atlas-SNP	.											.	PCNX	198	.	0			c.A2879G						.						136.0	132.0	133.0					14																	71479802		2203	4300	6503	SO:0001583	missense	22990	exon11			CTACTTACGGCCC	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.2879A>G	chr14.hg19:g.71479802A>G	ENSP00000304192:p.Tyr960Cys	108.0	0.0		70.0	29.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	hg19	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.70|14.70	2.614360|2.614360	0.46631|0.46631	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.21734	.|1.99;1.99;1.99	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	.|0.632079	.|0.16087	.|N	.|0.230254	T|T	0.10551|0.10551	0.0258|0.0258	N|N	0.08118|0.08118	0|0	0.20403|0.20403	N|N	0.999901|0.999901	.|P;B	.|0.45078	.|0.85;0.001	.|B;B	.|0.37780	.|0.258;0.001	T|T	0.10660|0.10660	-1.0620|-1.0620	5|10	.|0.37606	.|T	.|0.19	.|.	10.2511|10.2511	0.43370|0.43370	0.9155:0.0:0.0844:0.0|0.9155:0.0:0.0844:0.0	.|.	.|849;960	.|B2RTR6;Q96RV3	.|.;PCX1_HUMAN	A|C	19|960;960;849	.|ENSP00000304192:Y960C;ENSP00000238570:Y960C;ENSP00000396617:Y849C	.|ENSP00000238570:Y960C	T|Y	+|+	1|2	0|0	PCNX|PCNX	70549555|70549555	0.999000|0.999000	0.42202|0.42202	0.993000|0.993000	0.49108|0.49108	0.738000|0.738000	0.42128|0.42128	4.640000|4.640000	0.61368|0.61368	2.122000|2.122000	0.65172|0.65172	0.455000|0.455000	0.32223|0.32223	ACG|TAC	.	.		0.443	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
PCNX	22990	hgsc.bcm.edu	37	14	71479827	71479827	+	Silent	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr14:71479827A>G	ENST00000304743.2	+	11	3350	c.2904A>G	c.(2902-2904)caA>caG	p.Q968Q	PCNX_ENST00000439984.3_Silent_p.Q857Q|PCNX_ENST00000238570.5_Silent_p.Q968Q	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	968						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AAGCTGCCCAAAAGGTTAAAC	0.438																																					p.Q968Q		Atlas-SNP	.											.	PCNX	198	.	0			c.A2904G						.						143.0	140.0	141.0					14																	71479827		2203	4300	6503	SO:0001819	synonymous_variant	22990	exon11			TGCCCAAAAGGTT	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.2904A>G	chr14.hg19:g.71479827A>G		100.0	0.0		71.0	30.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	hg19	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	A	7.884	0.730929	0.15507	.	.	ENSG00000100731	ENST00000554691	.	.	.	5.35	1.64	0.23874	.	.	.	.	.	T	0.53449	0.1797	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42999	-0.9418	4	.	.	.	.	5.9775	0.19389	0.7097:0.1385:0.1518:0.0	.	.	.	.	R	27	.	.	K	+	2	0	PCNX	70549580	0.978000	0.34361	0.996000	0.52242	0.758000	0.43043	0.230000	0.17852	0.409000	0.25649	0.455000	0.32223	AAA	.	.		0.438	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
LRRC74A	145497	hgsc.bcm.edu	37	14	77297607	77297607	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr14:77297607G>A	ENST00000393774.3	+	3	403	c.279G>A	c.(277-279)atG>atA	p.M93I	C14orf166B_ENST00000460005.1_3'UTR|C14orf166B_ENST00000450042.2_Missense_Mutation_p.M76I	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		GCAAGCTGATGGGTGTAGTGC	0.517																																					p.M93I	Ovarian(165;1056 1958 32571 36789 48728)	Atlas-SNP	.											.	C14orf166B	52	.	0			c.G279A						.						132.0	110.0	117.0					14																	77297607		2203	4300	6503	SO:0001583	missense	145497	exon3			GCTGATGGGTGTA																												ENST00000393774.3:c.279G>A	chr14.hg19:g.77297607G>A	ENSP00000377369:p.Met93Ile	144.0	0.0		99.0	47.0	NM_194287		Missense_Mutation	SNP	ENST00000393774.3	hg19	CCDS9853.2	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487686	0.26686	.	.	ENSG00000100565	ENST00000393774;ENST00000450042	T;T	0.52295	0.67;2.65	5.66	3.45	0.39498	.	0.649523	0.16225	N	0.223879	T	0.18800	0.0451	N	0.01576	-0.805	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06409	-1.0828	10	0.15499	T	0.54	.	9.7627	0.40541	0.0836:0.0:0.7741:0.1423	.	93	Q0VAA2	CN16B_HUMAN	I	93;76	ENSP00000377369:M93I;ENSP00000396260:M76I	ENSP00000216450:M93I	M	+	3	0	C14orf166B	76367360	1.000000	0.71417	0.848000	0.33437	0.421000	0.31385	1.796000	0.38794	1.361000	0.45981	0.555000	0.69702	ATG	.	.		0.517	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316592.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105417141	105417141	+	Missense_Mutation	SNP	G	G	T	rs372521162	byFrequency	TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr14:105417141G>T	ENST00000333244.5	-	7	4766	c.4647C>A	c.(4645-4647)gaC>gaA	p.D1549E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1549						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGACCTCCAGGTCAGCAGAAG	0.647																																					p.D1549E		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C4647A						.						104.0	102.0	103.0					14																	105417141		1909	4082	5991	SO:0001583	missense	113146	exon7			CTCCAGGTCAGCA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4647C>A	chr14.hg19:g.105417141G>T	ENSP00000353114:p.Asp1549Glu	217.0	0.0		175.0	7.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	13.60	2.286532	0.40494	.	.	ENSG00000185567	ENST00000333244	T	0.00856	5.61	4.16	-4.72	0.03269	.	.	.	.	.	T	0.00754	0.0025	L	0.45137	1.4	0.09310	N	1	B	0.18166	0.026	B	0.18871	0.023	T	0.48670	-0.9015	9	0.14252	T	0.57	-16.612	0.8937	0.01259	0.282:0.2045:0.3261:0.1874	.	1549	Q8IVF2	AHNK2_HUMAN	E	1549	ENSP00000353114:D1549E	ENSP00000353114:D1549E	D	-	3	2	AHNAK2	104488186	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.723000	0.00810	-0.739000	0.04809	-0.333000	0.08304	GAC	.	.		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NIPA1	123606	hgsc.bcm.edu	37	15	23086388	23086388	+	Silent	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr15:23086388C>A	ENST00000337435.4	-	1	48	c.24G>T	c.(22-24)gcG>gcT	p.A8A	NIPA1_ENST00000561183.1_Intron|NIPA1_ENST00000437912.2_Intron|NIPA1_ENST00000538684.1_5'Flank	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	8					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		ccgccgccgccgctgccgcAG	0.836																																					p.A8A		Atlas-SNP	.											NIPA1,NS,carcinoma,0,1	NIPA1	26	.	0			c.G24T						.						1.0	1.0	1.0					15																	23086388		42	63	105	SO:0001819	synonymous_variant	123606	exon1			CGCCGCCGCTGCC	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.24G>T	chr15.hg19:g.23086388C>A		130.0	0.0		42.0	2.0	NM_144599	B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Silent	SNP	ENST00000337435.4	hg19	CCDS10011.1																																																																																			.	.		0.836	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	NM_144599	
HS3ST6	64711	hgsc.bcm.edu	37	16	1961878	1961878	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr16:1961878T>C	ENST00000293937.3	-	2	741	c.742A>G	c.(742-744)Agc>Ggc	p.S248G	HS3ST6_ENST00000454677.2_Missense_Mutation_p.S265G|HS3ST6_ENST00000443547.1_Missense_Mutation_p.S217G			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	248					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						CGCTCCCCGCTGACGAACAGG	0.667																																					p.S217G		Atlas-SNP	.											.	HS3ST6	26	.	0			c.A649G						.						43.0	53.0	50.0					16																	1961878		2191	4295	6486	SO:0001583	missense	64711	exon2			CCCCGCTGACGAA			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.742A>G	chr16.hg19:g.1961878T>C	ENSP00000293937:p.Ser248Gly	115.0	0.0		105.0	44.0	NM_001009606	Q96RX7	Missense_Mutation	SNP	ENST00000293937.3	hg19		.	.	.	.	.	.	.	.	.	.	T	18.16	3.563213	0.65538	.	.	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	D;D	0.83335	-1.71;-1.71	4.84	4.84	0.62591	Sulfotransferase domain (1);	0.039671	0.85682	D	0.000000	D	0.92606	0.7651	M	0.93375	3.41	0.80722	D	1	D	0.69078	0.997	D	0.69654	0.965	D	0.94242	0.7486	10	0.72032	D	0.01	.	13.641	0.62251	0.0:0.0:0.0:1.0	.	248	Q96QI5	HS3S6_HUMAN	G	248;217;287	ENSP00000293937:S248G;ENSP00000390354:S217G	ENSP00000293937:S248G	S	-	1	0	HS3ST6	1901879	1.000000	0.71417	0.990000	0.47175	0.325000	0.28411	7.831000	0.86748	1.826000	0.53198	0.414000	0.27820	AGC	.	.		0.667	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001009606	
LAT	27040	hgsc.bcm.edu	37	16	29001280	29001280	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr16:29001280G>T	ENST00000360872.5	+	10	814	c.736G>T	c.(736-738)Gaa>Taa	p.E246*	RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000354453.4_Nonsense_Mutation_p.E236*|LAT_ENST00000395461.3_Nonsense_Mutation_p.E253*|LAT_ENST00000566177.1_Nonsense_Mutation_p.E245*|LAT_ENST00000454369.2_Nonsense_Mutation_p.E216*|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000395456.2_Nonsense_Mutation_p.E217*|LAT_ENST00000564277.1_Nonsense_Mutation_p.E216*			O43561	LAT_HUMAN	linker for activation of T cells	246					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				GGAGGCAGAGGAAGTGGAGGA	0.637																																					p.E253X		Atlas-SNP	.											.	LAT	22	.	0			c.G757T						.						79.0	74.0	76.0					16																	29001280		2197	4300	6497	SO:0001587	stop_gained	27040	exon12			GCAGAGGAAGTGG	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.736G>T	chr16.hg19:g.29001280G>T	ENSP00000354119:p.Glu246*	78.0	0.0		65.0	14.0	NM_001014989	B7WPI0|C7C5T6|G5E9K3|O43919	Nonsense_Mutation	SNP	ENST00000360872.5	hg19	CCDS10647.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333166	0.81801	.	.	ENSG00000213658	ENST00000395461;ENST00000395456;ENST00000454369;ENST00000360872;ENST00000354453	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.51482	D	0.999926	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	0.5174	14.2681	0.66135	0.0:0.0:1.0:0.0	.	.	.	.	X	253;217;216;246;236	.	ENSP00000346441:E236X	E	+	1	0	LAT	28908781	0.961000	0.32948	0.335000	0.25508	0.402000	0.30811	1.889000	0.39718	2.515000	0.84797	0.462000	0.41574	GAA	.	.		0.637	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
TAOK2	9344	hgsc.bcm.edu	37	16	29998697	29998697	+	Missense_Mutation	SNP	G	G	T	rs144609126		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr16:29998697G>T	ENST00000308893.4	+	16	4147	c.3104G>T	c.(3103-3105)cGc>cTc	p.R1035L	TAOK2_ENST00000543033.1_Missense_Mutation_p.R922L|TAOK2_ENST00000416441.2_Missense_Mutation_p.R862L|TAOK2_ENST00000279394.3_Intron	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	1035	Leu-rich.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						CTGAGCTGGCGCCGAGGCCTC	0.657																																					p.R1035L		Atlas-SNP	.											.	TAOK2	142	.	0			c.G3104T						.						20.0	21.0	20.0					16																	29998697		2190	4285	6475	SO:0001583	missense	9344	exon16			GCTGGCGCCGAGG	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.3104G>T	chr16.hg19:g.29998697G>T	ENSP00000310094:p.Arg1035Leu	75.0	0.0		71.0	24.0	NM_016151	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	ENST00000308893.4	hg19	CCDS10663.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068437	0.36470	.	.	ENSG00000149930	ENST00000308893;ENST00000543033	T;T	0.72505	-0.62;-0.66	4.8	3.85	0.44370	.	0.284001	0.29956	N	0.010777	T	0.50120	0.1597	N	0.14661	0.345	0.30449	N	0.775408	B;B;B	0.23185	0.02;0.081;0.02	B;B;B	0.23275	0.008;0.045;0.008	T	0.46748	-0.9169	9	.	.	.	.	10.1636	0.42866	0.0943:0.0:0.9057:0.0	.	1226;862;1035	Q86V37;Q9UL54-3;Q9UL54	.;.;TAOK2_HUMAN	L	1035;922	ENSP00000310094:R1035L;ENSP00000440336:R922L	.	R	+	2	0	TAOK2	29906198	0.988000	0.35896	1.000000	0.80357	0.996000	0.88848	2.946000	0.49050	1.260000	0.44134	0.563000	0.77884	CGC	.	G|1.000;A|0.000		0.657	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151	
BRD7	29117	hgsc.bcm.edu	37	16	50357578	50357578	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr16:50357578A>T	ENST00000394688.3	-	12	1522	c.1363T>A	c.(1363-1365)Tat>Aat	p.Y455N	BRD7_ENST00000394689.2_Missense_Mutation_p.Y455N			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	455					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				ACATACGGATAATCTTGGCAC	0.443																																					p.Y455N		Atlas-SNP	.											.	BRD7	61	.	0			c.T1363A						.						106.0	90.0	95.0					16																	50357578		2198	4300	6498	SO:0001583	missense	29117	exon12			ACGGATAATCTTG	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1363T>A	chr16.hg19:g.50357578A>T	ENSP00000378180:p.Tyr455Asn	92.0	0.0		80.0	25.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	ENST00000394688.3	hg19	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831090	0.71258	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	T;T	0.51574	0.7;0.7	5.53	5.53	0.82687	.	0.187371	0.48767	D	0.000165	T	0.64843	0.2635	M	0.73217	2.22	0.58432	D	0.999995	D;D	0.65815	0.995;0.994	D;D	0.68621	0.959;0.931	T	0.68352	-0.5431	10	0.72032	D	0.01	-35.8448	10.828	0.46645	0.859:0.0:0.0:0.141	.	455;455	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	N	455	ENSP00000378180:Y455N;ENSP00000378181:Y455N	ENSP00000378180:Y455N	Y	-	1	0	BRD7	48915079	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.637000	0.61346	2.096000	0.63516	0.533000	0.62120	TAT	.	.		0.443	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
CHD9	80205	hgsc.bcm.edu	37	16	53307551	53307551	+	Silent	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr16:53307551T>A	ENST00000398510.3	+	22	4818	c.4731T>A	c.(4729-4731)ccT>ccA	p.P1577P	CHD9_ENST00000447540.1_Silent_p.P1577P|CHD9_ENST00000564845.1_Silent_p.P1577P|CHD9_ENST00000566029.1_Silent_p.P1577P			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1577					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TATCAGCTCCTGTACCCAGGG	0.348																																					p.P1577P		Atlas-SNP	.											.	CHD9	203	.	0			c.T4731A						.						30.0	28.0	28.0					16																	53307551		1793	4061	5854	SO:0001819	synonymous_variant	80205	exon23			AGCTCCTGTACCC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4731T>A	chr16.hg19:g.53307551T>A		405.0	0.0		362.0	120.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	hg19																																																																																				.	.		0.348	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
TCF25	22980	hgsc.bcm.edu	37	16	89977033	89977033	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr16:89977033C>T	ENST00000263346.8	+	17	1890	c.1834C>T	c.(1834-1836)Ctc>Ttc	p.L612F	TCF25_ENST00000263347.7_Missense_Mutation_p.S416F|MC1R_ENST00000555427.1_5'Flank|RP11-566K11.7_ENST00000570217.1_RNA	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	612					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CACCATTGCTCTCTTCTTCCG	0.537											OREG0024057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L612F		Atlas-SNP	.											.	TCF25	61	.	0			c.C1834T						.						219.0	178.0	192.0					16																	89977033		2198	4300	6498	SO:0001583	missense	22980	exon17			ATTGCTCTCTTCT	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1834C>T	chr16.hg19:g.89977033C>T	ENSP00000263346:p.Leu612Phe	64.0	0.0	1271	51.0	12.0	NM_014972	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	hg19	CCDS10987.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.186|9.186	1.024790|1.024790	0.19433|0.19433	.|.	.|.	ENSG00000141002|ENSG00000141002	ENST00000263346|ENST00000263347	.|.	.|.	.|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.203280|.	0.41396|.	D|.	0.000889|.	T|T	0.40694|0.40694	0.1127|0.1127	L|L	0.47016|0.47016	1.485|1.485	0.28276|0.28276	N|N	0.924218|0.924218	B|B	0.23937|0.06786	0.094|0.001	B|B	0.23716|0.04013	0.048|0.001	T|T	0.15636|0.15636	-1.0430|-1.0430	9|7	0.48119|.	T|.	0.1|.	.|.	11.3502|11.3502	0.49583|0.49583	0.0:0.9182:0.0:0.0818|0.0:0.9182:0.0:0.0818	.|.	612|416	Q9BQ70|Q9H384	TCF25_HUMAN|.	F|F	612|416	.|.	ENSP00000263346:L612F|.	L|S	+|+	1|2	0|0	TCF25|TCF25	88504534|88504534	1.000000|1.000000	0.71417|0.71417	0.944000|0.944000	0.38274|0.38274	0.026000|0.026000	0.11368|0.11368	4.768000|4.768000	0.62293|0.62293	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	CTC|TCT	.	.		0.537	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	
TP53	7157	hgsc.bcm.edu	37	17	7574006	7574006	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:7574006A>C	ENST00000269305.4	-	10	1210	c.1021T>G	c.(1021-1023)Ttc>Gtc	p.F341V	TP53_ENST00000455263.2_3'UTR|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.F341V|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	341	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		F -> C (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGCTCTCGGAACATCTCGAAG	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.F341V	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000269305,colon,carcinoma,0,2	TP53	33396	.	10	Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|large_intestine(1)|stomach(1)	c.T1021G						.						62.0	48.0	53.0					17																	7574006		2203	4300	6503	SO:0001583	missense	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CTCGGAACATCTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1021T>G	chr17.hg19:g.7574006A>C	ENSP00000269305:p.Phe341Val	147.0	0.0		109.0	74.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370394	0.61624	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.93811	-3.29;-3.29	5.43	1.57	0.23409	p53, tetramerisation domain (3);	0.151595	0.47455	D	0.000237	D	0.92100	0.7496	M	0.73598	2.24	0.41275	D	0.986879	B	0.24043	0.096	B	0.37833	0.259	D	0.87444	0.2397	10	0.72032	D	0.01	-19.1541	4.0815	0.09929	0.5724:0.0:0.2749:0.1527	.	341	P04637	P53_HUMAN	V	341;341;330	ENSP00000269305:F341V;ENSP00000391478:F341V	ENSP00000269305:F341V	F	-	1	0	TP53	7514731	0.997000	0.39634	0.991000	0.47740	0.799000	0.45148	0.604000	0.24164	0.381000	0.24851	0.459000	0.35465	TTC	.	.		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SLFN11	91607	hgsc.bcm.edu	37	17	33679852	33679852	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:33679852T>A	ENST00000394566.1	-	7	2501	c.2229A>T	c.(2227-2229)aaA>aaT	p.K743N	SLFN11_ENST00000308377.4_Missense_Mutation_p.K743N	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	743					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTTGCATTTCTTTTTGTAAGT	0.463																																					p.K743N		Atlas-SNP	.											.	SLFN11	112	.	0			c.A2229T						.						116.0	111.0	113.0					17																	33679852		2203	4300	6503	SO:0001583	missense	91607	exon5			CATTTCTTTTTGT	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2229A>T	chr17.hg19:g.33679852T>A	ENSP00000378067:p.Lys743Asn	91.0	0.0		130.0	35.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	ENST00000394566.1	hg19	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	t	9.782	1.175594	0.21704	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	D;D	0.86562	-2.14;-2.14	4.0	-3.4	0.04853	.	2.687990	0.01357	N	0.012105	T	0.79446	0.4447	L	0.46157	1.445	0.09310	N	1	B	0.19935	0.04	B	0.15870	0.014	T	0.56492	-0.7970	10	0.33940	T	0.23	.	0.1963	0.00140	0.3548:0.1993:0.1465:0.2994	.	743	Q7Z7L1	SLN11_HUMAN	N	743	ENSP00000312402:K743N;ENSP00000378067:K743N	ENSP00000312402:K743N	K	-	3	2	SLFN11	30703965	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.372000	0.01073	-0.894000	0.03925	0.533000	0.62120	AAA	.	.		0.463	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
SPATA20	64847	hgsc.bcm.edu	37	17	48632950	48632950	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:48632950A>G	ENST00000356488.4	+	16	2371	c.2288A>G	c.(2287-2289)tAt>tGt	p.Y763C	SPATA20_ENST00000006658.6_Missense_Mutation_p.Y779C|CACNA1G-AS1_ENST00000508920.1_RNA|CACNA1G-AS1_ENST00000505495.1_RNA|SPATA20_ENST00000511937.1_3'UTR|CACNA1G-AS1_ENST00000505793.1_RNA|SPATA20_ENST00000393244.3_Missense_Mutation_p.Y719C	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	763					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GCCACTGCATATGTGTGTGAG	0.572																																					p.Y779C		Atlas-SNP	.											.	SPATA20	59	.	0			c.A2336G						.						101.0	90.0	93.0					17																	48632950		2203	4300	6503	SO:0001583	missense	64847	exon17			CTGCATATGTGTG		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.2288A>G	chr17.hg19:g.48632950A>G	ENSP00000348878:p.Tyr763Cys	79.0	0.0		77.0	15.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	hg19	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	a	15.49	2.849179	0.51270	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244;ENST00000544362	T;T;T	0.31247	1.5;1.5;1.53	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	T	0.58032	0.2094	M	0.84948	2.725	0.51233	D	0.999919	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	T	0.64483	-0.6397	10	0.87932	D	0	-19.2086	10.9401	0.47268	0.9245:0.0:0.0755:0.0	.	763;779	Q8TB22;Q8TB22-2	SPT20_HUMAN;.	C	779;763;719;52	ENSP00000006658:Y779C;ENSP00000348878:Y763C;ENSP00000376935:Y719C	ENSP00000006658:Y779C	Y	+	2	0	SPATA20	45987949	1.000000	0.71417	0.098000	0.21074	0.669000	0.39330	5.097000	0.64542	2.118000	0.64928	0.459000	0.35465	TAT	.	.		0.572	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
CACNA1G	8913	hgsc.bcm.edu	37	17	48653617	48653617	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:48653617C>T	ENST00000359106.5	+	8	1854	c.1854C>T	c.(1852-1854)acC>acT	p.T618T	CACNA1G_ENST00000514717.1_Silent_p.T618T|CACNA1G_ENST00000514079.1_Silent_p.T618T|CACNA1G_ENST00000503485.1_Silent_p.T618T|CACNA1G_ENST00000513964.1_Silent_p.T618T|CACNA1G_ENST00000510115.1_Silent_p.T618T|CACNA1G_ENST00000507609.1_Silent_p.T618T|CACNA1G_ENST00000513689.2_Silent_p.T618T|CACNA1G_ENST00000507336.1_Silent_p.T618T|CACNA1G_ENST00000429973.2_Silent_p.T618T|CACNA1G_ENST00000502264.1_Silent_p.T618T|CACNA1G_ENST00000515165.1_Silent_p.T618T|CACNA1G_ENST00000360761.4_Silent_p.T618T|CACNA1G_ENST00000507896.1_Silent_p.T618T|CACNA1G_ENST00000358244.5_Silent_p.T618T|CACNA1G_ENST00000352832.5_Silent_p.T618T|CACNA1G_ENST00000510366.1_Silent_p.T618T|CACNA1G_ENST00000505165.1_Silent_p.T618T|CACNA1G_ENST00000416767.4_Silent_p.T618T|CACNA1G_ENST00000514181.1_Silent_p.T618T|CACNA1G_ENST00000512389.1_Silent_p.T618T|CACNA1G_ENST00000515765.1_Silent_p.T618T|CACNA1G_ENST00000515411.1_Silent_p.T618T|CACNA1G_ENST00000507510.2_Silent_p.T618T|CACNA1G_ENST00000354983.4_Silent_p.T618T|CACNA1G_ENST00000442258.2_Silent_p.T618T	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	618					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGCCCCCAACCCTCACCAGCC	0.627																																					p.T618T		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C1854T						.						11.0	15.0	13.0					17																	48653617		2032	4174	6206	SO:0001819	synonymous_variant	8913	exon8			CCCAACCCTCACC	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.1854C>T	chr17.hg19:g.48653617C>T		306.0	0.0		351.0	105.0	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.		0.627	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
CACNA1G	8913	hgsc.bcm.edu	37	17	48696133	48696133	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:48696133G>A	ENST00000359106.5	+	33	5545	c.5545G>A	c.(5545-5547)Gtg>Atg	p.V1849M	CACNA1G_ENST00000514717.1_Missense_Mutation_p.V1792M|CACNA1G_ENST00000514079.1_Missense_Mutation_p.V1856M|CACNA1G_ENST00000503485.1_Missense_Mutation_p.V1815M|CACNA1G_ENST00000513964.1_Missense_Mutation_p.V1804M|CACNA1G_ENST00000510115.1_Missense_Mutation_p.V1815M|CACNA1G_ENST00000507609.1_Missense_Mutation_p.V1842M|CACNA1G_ENST00000513689.2_Missense_Mutation_p.V1804M|CACNA1G_ENST00000507336.1_Missense_Mutation_p.V1838M|CACNA1G_ENST00000429973.2_Missense_Mutation_p.V1831M|CACNA1G_ENST00000502264.1_Missense_Mutation_p.V1826M|CACNA1G_ENST00000515165.1_Missense_Mutation_p.V1849M|CACNA1G_ENST00000360761.4_Missense_Mutation_p.V1826M|CACNA1G_ENST00000507896.1_Missense_Mutation_p.V1838M|CACNA1G_ENST00000358244.5_Missense_Mutation_p.V1815M|CACNA1G_ENST00000352832.5_Missense_Mutation_p.V1815M|CACNA1G_ENST00000510366.1_Missense_Mutation_p.V1797M|CACNA1G_ENST00000505165.1_Missense_Mutation_p.V1849M|CACNA1G_ENST00000514181.1_Missense_Mutation_p.V1824M|CACNA1G_ENST00000512389.1_Missense_Mutation_p.V1838M|CACNA1G_ENST00000515765.1_Missense_Mutation_p.V1838M|CACNA1G_ENST00000515411.1_Missense_Mutation_p.V1831M|CACNA1G_ENST00000507510.2_Missense_Mutation_p.V1849M|CACNA1G_ENST00000354983.4_Missense_Mutation_p.V1815M|CACNA1G_ENST00000442258.2_Missense_Mutation_p.V1808M	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1849					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGTGATCGCCGTGCTGATGAA	0.592																																					p.V1856M		Atlas-SNP	.											.	CACNA1G	659	.	0			c.G5566A						.						59.0	63.0	62.0					17																	48696133		2162	4253	6415	SO:0001583	missense	8913	exon33			ATCGCCGTGCTGA	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.5545G>A	chr17.hg19:g.48696133G>A	ENSP00000352011:p.Val1849Met	151.0	0.0		133.0	25.0	NM_001256325	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	hg19	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	g	23.8	4.454168	0.84209	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98987	-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3	4.9	4.9	0.64082	Ion transport (1);	0.142026	0.47093	D	0.000254	D	0.99507	0.9824	H	0.95004	3.61	0.80722	D	1	P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D	0.89917	0.932;1.0;0.982;1.0;1.0;0.962;0.962;0.981;0.962;0.999;0.997;1.0;1.0;1.0;0.982;1.0;0.997;1.0;1.0;0.999;0.942;1.0;0.99;1.0;1.0	P;D;P;D;D;P;P;D;P;D;D;D;D;D;P;D;D;D;D;D;P;D;D;D;D	0.97110	0.787;0.987;0.881;0.999;1.0;0.81;0.81;0.952;0.81;0.977;0.937;0.948;0.987;1.0;0.881;1.0;0.952;0.999;1.0;0.977;0.664;1.0;0.937;0.998;0.999	D	0.98149	1.0440	10	0.87932	D	0	.	18.1463	0.89656	0.0:0.0:1.0:0.0	.	1792;1804;1797;1831;1804;1824;1856;1815;1842;1838;1849;1826;1838;1838;1831;1838;1849;1826;1849;1815;1808;1815;1826;1849;1815	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	M	1826;1815;1815;1808;1826;1838;1804;1792;1797;1815;1849;1838;1804;1842;1815;1849;1824;1838;1856;1815;1849;1831;1831;1849;1838	ENSP00000353990:V1826M;ENSP00000339302:V1815M;ENSP00000347078:V1815M;ENSP00000409759:V1808M;ENSP00000425522:V1826M;ENSP00000426261:V1838M;ENSP00000425451:V1804M;ENSP00000422407:V1792M;ENSP00000426814:V1797M;ENSP00000427238:V1815M;ENSP00000423112:V1849M;ENSP00000420918:V1838M;ENSP00000426172:V1804M;ENSP00000423045:V1842M;ENSP00000427173:V1815M;ENSP00000426098:V1849M;ENSP00000425698:V1824M;ENSP00000426232:V1838M;ENSP00000423317:V1856M;ENSP00000350979:V1815M;ENSP00000352011:V1849M;ENSP00000414388:V1831M;ENSP00000423155:V1831M;ENSP00000422268:V1849M;ENSP00000421518:V1838M	ENSP00000339302:V1815M	V	+	1	0	CACNA1G	46051132	1.000000	0.71417	0.930000	0.37139	0.974000	0.67602	9.866000	0.99616	2.286000	0.76751	0.552000	0.68991	GTG	.	.		0.592	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
PGS1	9489	hgsc.bcm.edu	37	17	76411090	76411090	+	Silent	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:76411090G>A	ENST00000262764.6	+	8	1559	c.1533G>A	c.(1531-1533)ctG>ctA	p.L511L	PGS1_ENST00000588281.1_3'UTR|PGS1_ENST00000329897.7_Silent_p.L376L	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	511					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			ACCAGGCCCTGCAGCAGCAGC	0.632																																					p.L511L	Esophageal Squamous(45;182 1126 10685 43198)	Atlas-SNP	.											.	PGS1	30	.	0			c.G1533A						.						44.0	47.0	46.0					17																	76411090		2045	4198	6243	SO:0001819	synonymous_variant	9489	exon8			GGCCCTGCAGCAG		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.1533G>A	chr17.hg19:g.76411090G>A		99.0	0.0		104.0	46.0	NM_024419	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Silent	SNP	ENST00000262764.6	hg19	CCDS42391.1																																																																																			.	.		0.632	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
CDH2	1000	hgsc.bcm.edu	37	18	25589824	25589824	+	Silent	SNP	T	T	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr18:25589824T>G	ENST00000269141.3	-	5	982	c.559A>C	c.(559-561)Aga>Cga	p.R187R	CDH2_ENST00000399380.3_Silent_p.R156R	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	187	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTTTTATCTCTATCAGACCTG	0.453																																					p.R187R		Atlas-SNP	.											.	CDH2	194	.	0			c.A559C						.						75.0	68.0	70.0					18																	25589824		2203	4300	6503	SO:0001819	synonymous_variant	1000	exon5			TATCTCTATCAGA	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.559A>C	chr18.hg19:g.25589824T>G		47.0	0.0		62.0	19.0	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	ENST00000269141.3	hg19	CCDS11891.1																																																																																			.	.		0.453	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
ZNF430	80264	hgsc.bcm.edu	37	19	21216318	21216318	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr19:21216318C>T	ENST00000261560.5	+	3	334	c.153C>T	c.(151-153)tgC>tgT	p.C51C	ZNF430_ENST00000599548.1_Silent_p.C51C|ZNF430_ENST00000595401.1_Silent_p.C51C	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						AGTGGCAATGCCTGGACACTG	0.418																																					p.C51C		Atlas-SNP	.											.	ZNF430	59	.	0			c.C153T						.						120.0	124.0	123.0					19																	21216318		2203	4300	6503	SO:0001819	synonymous_variant	80264	exon3			GCAATGCCTGGAC	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.153C>T	chr19.hg19:g.21216318C>T		166.0	0.0		126.0	48.0	NM_025189	Q86V70	Silent	SNP	ENST00000261560.5	hg19	CCDS32978.1																																																																																			.	.		0.418	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
ZNF568	374900	hgsc.bcm.edu	37	19	37440949	37440949	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr19:37440949A>T	ENST00000333987.7	+	7	1400	c.894A>T	c.(892-894)agA>agT	p.R298S	ZNF568_ENST00000415168.1_Missense_Mutation_p.R234S|ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	298					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GACACCACAGAATTCATACTG	0.368																																					p.R298S		Atlas-SNP	.											.	ZNF568	106	.	0			c.A894T						.						36.0	40.0	38.0					19																	37440949		2159	4272	6431	SO:0001583	missense	374900	exon7			CCACAGAATTCAT	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.894A>T	chr19.hg19:g.37440949A>T	ENSP00000334685:p.Arg298Ser	122.0	0.0		115.0	15.0	NM_198539	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	hg19	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	A	15.25	2.777907	0.49786	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.24151	1.87;1.87	3.95	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40385	N	0.001115	T	0.40862	0.1134	L	0.55743	1.74	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.15954	-1.0419	10	0.66056	D	0.02	.	7.4256	0.27096	0.8924:0.0:0.1076:0.0	.	298	Q3ZCX4	ZN568_HUMAN	S	298;234	ENSP00000334685:R298S;ENSP00000394514:R234S	ENSP00000334685:R298S	R	+	3	2	ZNF568	42132789	0.000000	0.05858	0.633000	0.29310	0.838000	0.47535	-0.097000	0.11042	0.680000	0.31366	0.533000	0.62120	AGA	.	.		0.368	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
CYP2A6	1548	hgsc.bcm.edu	37	19	41355743	41355743	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr19:41355743T>C	ENST00000301141.5	-	2	343	c.323A>G	c.(322-324)gAc>gGc	p.D108G	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	108					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GAAGACCCAGTCGAAGGTGGC	0.642																																					p.D108G		Atlas-SNP	.											.	CYP2A6	69	.	0			c.A323G						.						69.0	66.0	67.0					19																	41355743		2203	4297	6500	SO:0001583	missense	1548	exon2			ACCCAGTCGAAGG	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.323A>G	chr19.hg19:g.41355743T>C	ENSP00000301141:p.Asp108Gly	228.0	0.0		200.0	46.0	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	hg19	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	15.15	2.748722	0.49257	.	.	ENSG00000255974	ENST00000301141	T	0.69306	-0.39	2.72	1.66	0.24008	.	0.796800	0.11430	U	0.564895	T	0.65852	0.2731	L	0.41710	1.295	0.09310	N	1	P	0.39094	0.659	P	0.50270	0.636	T	0.57148	-0.7861	10	0.66056	D	0.02	.	6.6893	0.23161	0.2373:0.0:0.0:0.7627	.	108	P11509	CP2A6_HUMAN	G	108	ENSP00000301141:D108G	ENSP00000301141:D108G	D	-	2	0	CYP2A6	46047583	0.000000	0.05858	0.001000	0.08648	0.359000	0.29487	-0.036000	0.12185	0.153000	0.19213	0.155000	0.16302	GAC	.	.		0.642	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
ZNF845	91664	hgsc.bcm.edu	37	19	53856625	53856625	+	Silent	SNP	A	A	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr19:53856625A>G	ENST00000595091.1	+	5	2916	c.2697A>G	c.(2695-2697)caA>caG	p.Q899Q	ZNF845_ENST00000458035.1_Silent_p.Q899Q			Q96IR2	ZN845_HUMAN	zinc finger protein 845	899					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TTAATCAACAAGCACACCTTG	0.363																																					p.Q899Q		Atlas-SNP	.											.	ZNF845	101	.	0			c.A2697G						.						38.0	34.0	35.0					19																	53856625		692	1591	2283	SO:0001819	synonymous_variant	91664	exon4			TCAACAAGCACAC	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2697A>G	chr19.hg19:g.53856625A>G		149.0	0.0		160.0	55.0	NM_138374		Silent	SNP	ENST00000595091.1	hg19	CCDS46170.1																																																																																			.	.		0.363	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
CSRP2BP	57325	hgsc.bcm.edu	37	20	18143146	18143146	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr20:18143146A>T	ENST00000435364.3	+	6	1569	c.1228A>T	c.(1228-1230)Ata>Tta	p.I410L	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.I409L|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.I282L	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	410					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						CCCTGAACAGATAAAGCAGGA	0.512																																					p.I410L		Atlas-SNP	.											.	CSRP2BP	80	.	0			c.A1228T						.						69.0	72.0	71.0					20																	18143146		2203	4300	6503	SO:0001583	missense	57325	exon6			GAACAGATAAAGC	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1228A>T	chr20.hg19:g.18143146A>T	ENSP00000392318:p.Ile410Leu	190.0	0.0		152.0	8.0	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	hg19	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638887	0.87760	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.16743	2.32;2.32;2.32;2.35	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.28896	0.0717	N	0.24115	0.695	0.80722	D	1	P;P	0.51147	0.942;0.904	D;P	0.64595	0.927;0.847	T	0.03121	-1.1070	10	0.62326	D	0.03	-14.0864	16.5655	0.84588	1.0:0.0:0.0:0.0	.	282;410	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	L	410;409;410;282	ENSP00000278816:I410L;ENSP00000366909:I409L;ENSP00000392318:I410L;ENSP00000425909:I282L	ENSP00000278816:I410L	I	+	1	0	CSRP2BP	18091146	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.450000	0.73477	2.302000	0.77476	0.533000	0.62120	ATA	.	.		0.512	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
CSE1L	1434	hgsc.bcm.edu	37	20	47682737	47682737	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr20:47682737T>G	ENST00000262982.2	+	4	360	c.237T>G	c.(235-237)gaT>gaG	p.D79E	CSE1L_ENST00000396192.3_Missense_Mutation_p.D79E|CSE1L_ENST00000542325.1_Intron	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	79	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AGGTTGAAGATGAACCAAACA	0.373																																					p.D79E		Atlas-SNP	.											.	CSE1L	83	.	0			c.T237G						.						81.0	76.0	78.0					20																	47682737		2203	4300	6503	SO:0001583	missense	1434	exon4			TGAAGATGAACCA	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.237T>G	chr20.hg19:g.47682737T>G	ENSP00000262982:p.Asp79Glu	135.0	0.0		114.0	37.0	NM_001256135	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	hg19	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.305859	0.60305	.	.	ENSG00000124207	ENST00000262982;ENST00000396192	T;T	0.68181	-0.31;-0.31	5.62	4.52	0.55395	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.69851	0.3157	L	0.46670	1.46	0.80722	D	1	P;D	0.59767	0.864;0.986	B;D	0.65573	0.393;0.936	T	0.66642	-0.5872	10	0.06365	T	0.9	-22.4861	11.5842	0.50908	0.0:0.0701:0.0:0.9299	.	79;79	F8W904;P55060	.;XPO2_HUMAN	E	79	ENSP00000262982:D79E;ENSP00000379495:D79E	ENSP00000262982:D79E	D	+	3	2	CSE1L	47116144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.304000	0.72800	0.947000	0.37659	0.533000	0.62120	GAT	.	.		0.373	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
ZFP64	55734	hgsc.bcm.edu	37	20	50803417	50803417	+	Silent	SNP	A	A	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr20:50803417A>C	ENST00000216923.4	-	2	589	c.240T>G	c.(238-240)acT>acG	p.T80T	ZFP64_ENST00000371515.4_Silent_p.T78T|ZFP64_ENST00000346617.4_Silent_p.T80T|ZFP64_ENST00000361387.2_Silent_p.T80T|ZFP64_ENST00000371518.2_Silent_p.T80T	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	80					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						TGGTGGTCTGAGTCTGGGTGG	0.587																																					p.T80T		Atlas-SNP	.											.	ZFP64	240	.	0			c.T240G						.						150.0	133.0	139.0					20																	50803417		2203	4300	6503	SO:0001819	synonymous_variant	55734	exon2			GGTCTGAGTCTGG	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.240T>G	chr20.hg19:g.50803417A>C		150.0	0.0		119.0	39.0	NM_018197	Q9NTS7|Q9NVH4	Silent	SNP	ENST00000216923.4	hg19	CCDS13440.1																																																																																			.	.		0.587	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
PCK1	5105	hgsc.bcm.edu	37	20	56138179	56138179	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr20:56138179G>A	ENST00000319441.4	+	5	870	c.706G>A	c.(706-708)Ggc>Agc	p.G236S	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_Missense_Mutation_p.G104S	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	236					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CAGTGGGTACGGCGGGAACTC	0.622																																					p.G236S		Atlas-SNP	.											.	PCK1	95	.	0			c.G706A						.						73.0	79.0	77.0					20																	56138179		2203	4300	6503	SO:0001583	missense	5105	exon5			GGGTACGGCGGGA		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.706G>A	chr20.hg19:g.56138179G>A	ENSP00000319814:p.Gly236Ser	92.0	0.0		85.0	33.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	hg19	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	G	35	5.540586	0.96474	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.34859	1.34;1.34	5.06	5.06	0.68205	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	H	0.98426	4.23	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.86489	0.1796	10	0.87932	D	0	-34.8333	18.8029	0.92025	0.0:0.0:1.0:0.0	.	236	P35558	PCKGC_HUMAN	S	236;104	ENSP00000319814:G236S;ENSP00000444342:G104S	ENSP00000319814:G236S	G	+	1	0	PCK1	55571585	1.000000	0.71417	0.995000	0.50966	0.862000	0.49288	9.282000	0.95840	2.520000	0.84964	0.655000	0.94253	GGC	.	.		0.622	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
ZNF831	128611	hgsc.bcm.edu	37	20	57766466	57766466	+	Missense_Mutation	SNP	C	C	A	rs143620250		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr20:57766466C>A	ENST00000371030.2	+	1	392	c.392C>A	c.(391-393)aCg>aAg	p.T131K		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	131							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CTGGGCCCCACGCTGGGCAGC	0.682																																					p.T131K		Atlas-SNP	.											.	ZNF831	287	.	0			c.C392A						.						25.0	29.0	28.0					20																	57766466		2045	4156	6201	SO:0001583	missense	128611	exon1			GCCCCACGCTGGG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.392C>A	chr20.hg19:g.57766466C>A	ENSP00000360069:p.Thr131Lys	116.0	0.0		134.0	43.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	9.754	1.168210	0.21621	.	.	ENSG00000124203	ENST00000371030	T	0.04970	3.52	5.41	4.47	0.54385	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B	0.30914	0.3	B	0.25884	0.064	T	0.39313	-0.9620	9	0.66056	D	0.02	0.0013	9.9438	0.41596	0.1371:0.7891:0.0:0.0738	.	131	Q5JPB2	ZN831_HUMAN	K	131	ENSP00000360069:T131K	ENSP00000360069:T131K	T	+	2	0	ZNF831	57199861	0.000000	0.05858	0.014000	0.15608	0.386000	0.30323	0.285000	0.18883	1.287000	0.44583	0.561000	0.74099	ACG	.	C|0.999;T|0.001		0.682	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
IFNGR2	3460	hgsc.bcm.edu	37	21	34805131	34805131	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr21:34805131A>C	ENST00000290219.6	+	6	1480	c.832A>C	c.(832-834)Aaa>Caa	p.K278Q	IFNGR2_ENST00000381995.1_Missense_Mutation_p.K297Q|IFNGR2_ENST00000405436.1_Missense_Mutation_p.K199Q	NM_005534.3	NP_005525.2	P38484	INGR2_HUMAN	interferon gamma receptor 2 (interferon gamma transducer 1)	278					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	interferon-gamma receptor activity (GO:0004906)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	13					Interferon gamma-1b(DB00033)	AGGCCTGATTAAATACTGGTT	0.458																																					p.K278Q		Atlas-SNP	.											.	IFNGR2	30	.	0			c.A832C						.						97.0	95.0	96.0					21																	34805131		2203	4300	6503	SO:0001583	missense	3460	exon6			CTGATTAAATACT		CCDS33544.1	21q22.1	2014-09-17			ENSG00000159128	ENSG00000159128		"""Interferons"", ""Fibronectin type III domain containing"""	5440	protein-coding gene	gene with protein product		147569		IFNGT1		3136170	Standard	NM_005534		Approved	AF-1	uc002yrp.4	P38484	OTTHUMG00000065188	ENST00000290219.6:c.832A>C	chr21.hg19:g.34805131A>C	ENSP00000290219:p.Lys278Gln	102.0	0.0		106.0	19.0	NM_005534	Q9BTL5	Missense_Mutation	SNP	ENST00000290219.6	hg19	CCDS33544.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.53|18.53	3.644284|3.644284	0.67244|0.67244	.|.	.|.	ENSG00000159128|ENSG00000159128	ENST00000290219;ENST00000381995;ENST00000405436|ENST00000421802	T;T;T|.	0.75477|.	0.2;0.26;-0.94|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.71533|0.71533	0.3351|0.3351	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.71873|0.71873	-0.4461|-0.4461	10|5	0.54805|.	T|.	0.06|.	-15.5322|-15.5322	12.35|12.35	0.55143|0.55143	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	297;278|.	E7EUY1;P38484|.	.;INGR2_HUMAN|.	Q|F	278;297;199|43	ENSP00000290219:K278Q;ENSP00000371425:K297Q;ENSP00000385044:K199Q|.	ENSP00000290219:K278Q|.	K|L	+|+	1|3	0|2	IFNGR2|IFNGR2	33727001|33727001	0.869000|0.869000	0.29996|0.29996	0.094000|0.094000	0.20943|0.20943	0.670000|0.670000	0.39368|0.39368	4.108000|4.108000	0.57817|0.57817	2.231000|2.231000	0.72958|0.72958	0.460000|0.460000	0.39030|0.39030	AAA|TTA	.	.		0.458	IFNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139916.1		
DOPEY2	9980	hgsc.bcm.edu	37	21	37617605	37617605	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr21:37617605C>T	ENST00000399151.3	+	19	3412	c.3327C>T	c.(3325-3327)caC>caT	p.H1109H		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1109					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCAGCGAGCACACCGAGTCTG	0.632																																					p.H1109H		Atlas-SNP	.											.	DOPEY2	184	.	0			c.C3327T						.						132.0	93.0	106.0					21																	37617605		2203	4300	6503	SO:0001819	synonymous_variant	9980	exon19			CGAGCACACCGAG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3327C>T	chr21.hg19:g.37617605C>T		85.0	0.0		76.0	15.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	hg19	CCDS13643.1																																																																																			.	.		0.632	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
MICAL3	57553	hgsc.bcm.edu	37	22	18324653	18324653	+	Silent	SNP	C	C	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr22:18324653C>T	ENST00000441493.2	-	20	3088	c.2736G>A	c.(2734-2736)gaG>gaA	p.E912E	MICAL3_ENST00000400561.2_Silent_p.E912E|MICAL3_ENST00000383094.3_Silent_p.E912E|MICAL3_ENST00000207726.7_Silent_p.E940E|MICAL3_ENST00000414725.2_Silent_p.E940E|MICAL3_ENST00000444520.1_Silent_p.E912E	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	912	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CGGCCTGAGTCTCCTCCGGTA	0.692																																					p.E912E		Atlas-SNP	.											.	MICAL3	53	.	0			c.G2736A						.						17.0	18.0	18.0					22																	18324653		1567	3577	5144	SO:0001819	synonymous_variant	57553	exon20			CTGAGTCTCCTCC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2736G>A	chr22.hg19:g.18324653C>T		56.0	0.0		27.0	12.0	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	hg19	CCDS46659.1																																																																																			.	.		0.692	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
ATF4	468	hgsc.bcm.edu	37	22	39918368	39918368	+	Missense_Mutation	SNP	G	G	A	rs372679887		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr22:39918368G>A	ENST00000337304.2	+	2	1699	c.817G>A	c.(817-819)Gta>Ata	p.V273I	ATF4_ENST00000404241.2_Missense_Mutation_p.V273I|ATF4_ENST00000396680.1_Missense_Mutation_p.V273I	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	273					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	AGCAGCAAAAGTAAAGGGTGA	0.522																																					p.V273I		Atlas-SNP	.											.	ATF4	27	.	0			c.G817A						.						21.0	22.0	21.0					22																	39918368		2203	4296	6499	SO:0001583	missense	468	exon2			GCAAAAGTAAAGG	D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.817G>A	chr22.hg19:g.39918368G>A	ENSP00000336790:p.Val273Ile	388.0	0.0		359.0	104.0	NM_001675	Q9UH31	Missense_Mutation	SNP	ENST00000337304.2	hg19	CCDS13996.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842304	0.32513	.	.	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	T;T;T	0.25579	1.79;1.79;1.79	4.51	3.49	0.39957	.	1.006730	0.07979	N	0.985289	T	0.29256	0.0728	M	0.68952	2.095	0.09310	N	1	B	0.34372	0.451	B	0.30179	0.112	T	0.25916	-1.0118	10	0.87932	D	0	-19.7905	10.4544	0.44542	0.1621:0.0:0.8379:0.0	.	273	P18848	ATF4_HUMAN	I	273	ENSP00000384587:V273I;ENSP00000336790:V273I;ENSP00000379912:V273I	ENSP00000336790:V273I	V	+	1	0	ATF4	38248314	0.876000	0.30132	0.006000	0.13384	0.909000	0.53808	1.646000	0.37249	1.197000	0.43143	0.462000	0.41574	GTA	.	.		0.522	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321305.1	NM_001675	
CENPM	79019	hgsc.bcm.edu	37	22	42341233	42341233	+	Silent	SNP	T	T	C			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr22:42341233T>C	ENST00000215980.5	-	4	393	c.306A>G	c.(304-306)acA>acG	p.T102T	CENPM_ENST00000404067.1_Silent_p.T68T|CENPM_ENST00000407253.3_Silent_p.T102T|CENPM_ENST00000402338.1_Silent_p.T68T|CENPM_ENST00000402420.1_Missense_Mutation_p.R97G	NM_024053.3	NP_076958.1	Q9NSP4	CENPM_HUMAN	centromere protein M	102					mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|prostate(1)	3						ACTTACCACCTGTGGCGAGGA	0.612																																					p.T102T		Atlas-SNP	.											.	CENPM	8	.	0			c.A306G						.						100.0	77.0	85.0					22																	42341233		2203	4300	6503	SO:0001819	synonymous_variant	79019	exon4			ACCACCTGTGGCG	BC000705	CCDS14025.1, CCDS46719.1, CCDS46720.1	22q13.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000100162	ENSG00000100162			18352	protein-coding gene	gene with protein product		610152	"""chromosome 22 open reading frame 18"""	C22orf18		16622420, 16622419	Standard	NM_001110215		Approved	Pane1, CENP-M, MGC861	uc003bbn.3	Q9NSP4	OTTHUMG00000151277	ENST00000215980.5:c.306A>G	chr22.hg19:g.42341233T>C		161.0	0.0		167.0	37.0	NM_024053	A7LM22|B1AHQ9|Q6I9W3	Silent	SNP	ENST00000215980.5	hg19	CCDS14025.1	.	.	.	.	.	.	.	.	.	.	T	10.70	1.425331	0.25639	.	.	ENSG00000100162	ENST00000402420	.	.	.	5.71	-11.4	0.00090	.	.	.	.	.	T	0.28366	0.0701	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.44483	-0.9325	5	0.87932	D	0	-12.0161	2.6801	0.05091	0.3111:0.3296:0.2685:0.0908	.	.	.	.	G	97	.	ENSP00000384132:R97G	R	-	1	2	CENPM	40671179	0.000000	0.05858	0.001000	0.08648	0.393000	0.30537	-5.462000	0.00120	-4.081000	0.00075	-0.263000	0.10527	AGG	.	.		0.612	CENPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322058.1	NM_024053	
ZBED1	9189	hgsc.bcm.edu	37	X	2408700	2408700	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chrX:2408700C>A	ENST00000381223.4	-	2	264	c.61G>T	c.(61-63)Gcc>Tcc	p.A21S	DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000381218.3_Missense_Mutation_p.A21S|ZBED1_ENST00000381222.2_Missense_Mutation_p.A21S|ZBED1_ENST00000515319.1_5'Flank	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	21					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTGCTCTTGGCGCGGGGGTGG	0.582																																					p.A21S		Atlas-SNP	.											.	ZBED1	64	.	0			c.G61T						.						138.0	141.0	140.0					X																	2408700		2203	4296	6499	SO:0001583	missense	9189	exon2			TCTTGGCGCGGGG	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.61G>T	chrX.hg19:g.2408700C>A	ENSP00000370621:p.Ala21Ser	111.0	0.0		114.0	25.0	NM_001171135	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	hg19	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724762	0.30593	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218;ENST00000461691	.	.	.	2.46	2.46	0.29980	Zinc finger, BED-type predicted (2);	0.115187	0.31290	U	0.007920	T	0.49490	0.1560	.	.	.	0.09310	N	1	D	0.71674	0.998	D	0.77557	0.99	T	0.43360	-0.9396	8	0.10111	T	0.7	-18.4507	12.7367	0.57228	0.0:1.0:0.0:0.0	.	21	O96006	ZBED1_HUMAN	S	21	.	ENSP00000370616:A21S	A	-	1	0	ZBED1	2418700	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	5.061000	0.64319	0.995000	0.38917	0.425000	0.28330	GCC	.	.		0.582	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729	
MED12	9968	hgsc.bcm.edu	37	X	70346907	70346907	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chrX:70346907G>T	ENST00000374080.3	+	20	2806	c.2774G>T	c.(2773-2775)tGc>tTc	p.C925F	MED12_ENST00000462984.1_3'UTR|MED12_ENST00000333646.6_Missense_Mutation_p.C925F|MED12_ENST00000374102.1_Missense_Mutation_p.C925F			Q93074	MED12_HUMAN	mediator complex subunit 12	925					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CTGTGCCTGTGCATCGTGGCT	0.532			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.C925F		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.G2774T						.						87.0	79.0	81.0					X																	70346907		2120	4218	6338	SO:0001583	missense	9968	exon20			GCCTGTGCATCGT	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2774G>T	chrX.hg19:g.70346907G>T	ENSP00000363193:p.Cys925Phe	52.0	0.0		45.0	30.0	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	hg19	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	21.7	4.193658	0.78902	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.85283	0.5661	L	0.54323	1.7	0.80722	D	1	D;P;P;D	0.65815	0.99;0.645;0.93;0.995	D;B;P;D	0.71414	0.942;0.204;0.787;0.973	D	0.86194	0.1614	10	0.54805	T	0.06	-14.4721	17.2458	0.87027	0.0:0.0:1.0:0.0	.	925;772;925;925	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	F	925;925;925;925;893	ENSP00000333125:C925F;ENSP00000363215:C925F;ENSP00000363193:C925F;ENSP00000414203:C893F	ENSP00000333125:C925F	C	+	2	0	MED12	70263632	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.964000	0.93389	2.252000	0.74401	0.436000	0.28706	TGC	.	.		0.532	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
PPFIBP2	8495	hgsc.bcm.edu	37	11	7647047	7647070	+	In_Frame_Del	DEL	GATGCAGAAATTGAGCGTCTGCAC	GATGCAGAAATTGAGCGTCTGCAC	-	rs144468110|rs148281709|rs376707389		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	GATGCAGAAATTGAGCGTCTGCAC	GATGCAGAAATTGAGCGTCTGCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:7647047_7647070delGATGCAGAAATTGAGCGTCTGCAC	ENST00000299492.4	+	8	1139_1162	c.751_774delGATGCAGAAATTGAGCGTCTGCAC	c.(751-774)gatgcagaaattgagcgtctgcacdel	p.DAEIERLH251del	PPFIBP2_ENST00000528883.1_In_Frame_Del_p.DAEIERLH139del|PPFIBP2_ENST00000530181.1_In_Frame_Del_p.DAEIERLH108del|PPFIBP2_ENST00000533792.1_In_Frame_Del_p.DAEIERLH93del	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	251					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGCCCTGAAAGATGCAGAAATTGAGCGTCTGCACAGCCAGCTCT	0.545																																					p.250_258del		Atlas-INDEL	.											.	PPFIBP2	87	.	0			c.750_773del						.																																			SO:0001651	inframe_deletion	8495	exon8			.	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.751_774delGATGCAGAAATTGAGCGTCTGCAC	chr11.hg19:g.7647047_7647070delGATGCAGAAATTGAGCGTCTGCAC	ENSP00000299492:p.Asp251_His258del	200.0	0.0		115.0	23.0	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	In_Frame_Del	DEL	ENST00000299492.4	hg19	CCDS31419.1																																																																																			.	.		0.545	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
LAMP1	3916	hgsc.bcm.edu	37	13	113975888	113975888	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr13:113975888delT	ENST00000332556.4	+	8	1154	c.960delT	c.(958-960)gctfs	p.A321fs	LAMP1_ENST00000397181.3_Frame_Shift_Del_p.A268fs	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	321	Second lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			CCTTTAAAGCTGCCAACGGCT	0.612																																					p.A320fs		Atlas-INDEL	.											.	LAMP1	41	.	0			c.959delC						.						73.0	82.0	79.0					13																	113975888		1981	4159	6140	SO:0001589	frameshift_variant	3916	exon8			.	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.960delT	chr13.hg19:g.113975888delT	ENSP00000333298:p.Ala321fs	120.0	0.0		158.0	15.0	NM_005561	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Frame_Shift_Del	DEL	ENST00000332556.4	hg19	CCDS41909.1																																																																																			.	.		0.612	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2		
TTC28	23331	hgsc.bcm.edu	37	22	28693650	28693654	+	Frame_Shift_Del	DEL	CAGGG	CAGGG	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	CAGGG	CAGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr22:28693650_28693654delCAGGG	ENST00000397906.2	-	4	857_861	c.716_720delCCCTG	c.(715-720)gccctgfs	p.AL239fs	TTC28_ENST00000490475.1_5'UTR	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	239					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						AAGCACTGCTCAGGGCAGAGAAAAC	0.512																																					p.239_241del		Atlas-INDEL	.											.	TTC28	84	.	0			c.717_721del						.																																			SO:0001589	frameshift_variant	23331	exon4			.	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.716_720delCCCTG	chr22.hg19:g.28693650_28693654delCAGGG	ENSP00000381003:p.Ala239fs	76.0	0.0		34.0	15.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Frame_Shift_Del	DEL	ENST00000397906.2	hg19	CCDS46678.1																																																																																			.	.		0.512	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
KDM3A	55818	hgsc.bcm.edu	37	2	86718396	86718408	+	Splice_Site	DEL	CAGGTAAAAATAG	CAGGTAAAAATAG	-	rs367630615		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	CAGGTAAAAATAG	CAGGTAAAAATAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:86718396_86718408delCAGGTAAAAATAG	ENST00000409556.1	+	26	4248_4250	c.3883_3885delCAGGTAAAAATAG	c.(3883-3885)cagdel	p.Q1295fs	KDM3A_ENST00000542128.1_Splice_Site_p.Q1243fs|KDM3A_ENST00000409064.1_Splice_Site_p.Q1295fs|KDM3A_ENST00000312912.5_Splice_Site_p.Q1295fs			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	1295					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AGATAAATTACAGGTAAAAATAGCACCAATTCC	0.399																																					p.1294_1295del	NSCLC(96;1150 1523 6936 46253 49736)	Atlas-INDEL	.											.	KDM3A	179	.	0			c.3882_3885del						.																																			SO:0001630	splice_region_variant	55818	exon25			.	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.3885+1CAGGTAAAAATAG>-	chr2.hg19:g.86718396_86718408delCAGGTAAAAATAG		90.0	0.0		96.0	16.0	NM_018433	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Frame_Shift_Del	DEL	ENST00000409556.1	hg19	CCDS1990.1																																																																																			.	.		0.399	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	Frame_Shift_Del
POP1	10940	hgsc.bcm.edu	37	8	99142204	99142214	+	Splice_Site	DEL	TGAAACTATAG	TGAAACTATAG	-	rs148946525|rs371691417|rs143675510	byFrequency	TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	TGAAACTATAG	TGAAACTATAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr8:99142204_99142214delTGAAACTATAG	ENST00000401707.2	+	5	567_576	c.486_495delTGAAACTATAG	c.(484-495)gatgaaactata>ga	p.DETI162fs	POP1_ENST00000349693.3_Splice_Site_p.DETI162fs	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	162					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			TTGAAACTATAGGCGGAGAAAGCCGTACATC	0.36																																					.		Atlas-INDEL	.											.	POP1	85	.	0			.						.																																			SO:0001630	splice_region_variant	10940	.			.	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.487-1TGAAACTATAG>-	chr8.hg19:g.99142204_99142214delTGAAACTATAG		132.0	0.0		219.0	20.0	.	A8K5W9|Q15037	Splice_Site	DEL	ENST00000401707.2	hg19	CCDS6277.1																																																																																			.	.		0.360	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	Frame_Shift_Del
MYO15A	51168	hgsc.bcm.edu	37	17	18022452	18022473	+	Frame_Shift_Del	DEL	GCCGCCGTGGCTACGGCCGCCT	GCCGCCGTGGCTACGGCCGCCT	-	rs536413670		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	GCCGCCGTGGCTACGGCCGCCT	GCCGCCGTGGCTACGGCCGCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr17:18022452_18022473delGCCGCCGTGGCTACGGCCGCCT	ENST00000205890.5	+	2	676_697	c.338_359delGCCGCCGTGGCTACGGCCGCCT	c.(337-360)ggccgccgtggctacggccgcctgfs	p.GRRGYGRL113fs		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	113					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGCTTCCCAGGCCGCCGTGGCTACGGCCGCCTGCGGCCGCGC	0.622																																					p.113_120del		Atlas-INDEL	.											.	MYO15A	268	.	0			c.337_358del						.																																			SO:0001589	frameshift_variant	51168	exon2			.	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.338_359delGCCGCCGTGGCTACGGCCGCCT	chr17.hg19:g.18022452_18022473delGCCGCCGTGGCTACGGCCGCCT	ENSP00000205890:p.Gly113fs	198.0	0.0		112.0	55.0	NM_016239	B4DFC7	Frame_Shift_Del	DEL	ENST00000205890.5	hg19	CCDS42271.1																																																																																			.	.		0.622	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
GCDH	2639	hgsc.bcm.edu	37	19	13006809	13006810	+	Frame_Shift_Ins	INS	-	-	G	rs200785120		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr19:13006809_13006810insG	ENST00000222214.5	+	7	720_721	c.509_510insG	c.(508-513)aaggggfs	p.KG170fs	GCDH_ENST00000422947.2_Frame_Shift_Ins_p.KG126fs|GCDH_ENST00000457854.1_Frame_Shift_Ins_p.KG170fs|GCDH_ENST00000591470.1_Frame_Shift_Ins_p.KG170fs			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	170					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	CCTGCAGCCAAGGGGGAGCTCC	0.584																																					p.Q170fs	GBM(123;875 1636 7726 16444 26754)	Atlas-INDEL	.											.	GCDH	76	.	0			c.509_510insG						.																																			SO:0001589	frameshift_variant	2639	exon7			.	AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.514dupG	chr19.hg19:g.13006814_13006814dupG	ENSP00000222214:p.Lys170fs	72.0	0.0		73.0	20.0	NM_013976	A8K2Z2|O14719	Frame_Shift_Ins	INS	ENST00000222214.5	hg19	CCDS12286.1																																																																																			.	.		0.584	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451897.1		
SYNJ1	8867	hgsc.bcm.edu	37	21	34053835	34053837	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr21:34053835_34053837delCTG	ENST00000322229.7	-	10	1321_1323	c.1322_1324delCAG	c.(1321-1326)gcagga>gga	p.A441del	SYNJ1_ENST00000357345.3_In_Frame_Del_p.A441del|SYNJ1_ENST00000382491.3_In_Frame_Del_p.A441del|SYNJ1_ENST00000382499.2_In_Frame_Del_p.A480del|SYNJ1_ENST00000433931.2_In_Frame_Del_p.A480del			O43426	SYNJ1_HUMAN	synaptojanin 1	441	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GCTCCAGTTCCTGCATATATCTT	0.399																																					p.480_481del		Atlas-INDEL	.											.	SYNJ1	253	.	0			c.1440_1442del						.																																			SO:0001651	inframe_deletion	8867	exon11			.	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1322_1324delCAG	chr21.hg19:g.34053835_34053837delCTG	ENSP00000322234:p.Ala441del	128.0	0.0		110.0	16.0	NM_203446	O43425|O94984|Q4KMR1	In_Frame_Del	DEL	ENST00000322229.7	hg19	CCDS54484.1																																																																																			.	.		0.399	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
MAPK9	5601	hgsc.bcm.edu	37	5	179696379	179696380	+	Frame_Shift_Del	DEL	AT	AT	-	rs1043993		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:179696379_179696380delAT	ENST00000452135.2	-	3	450_451	c.152_153delAT	c.(151-153)aatfs	p.N51fs	MAPK9_ENST00000393360.3_Frame_Shift_Del_p.N51fs|MAPK9_ENST00000455781.1_Frame_Shift_Del_p.N51fs|MAPK9_ENST00000425491.2_Frame_Shift_Del_p.N51fs|MAPK9_ENST00000397072.3_3'UTR|MAPK9_ENST00000347470.4_Frame_Shift_Del_p.N51fs|MAPK9_ENST00000343111.6_Frame_Shift_Del_p.N51fs|MAPK9_ENST00000539014.1_Frame_Shift_Del_p.N51fs			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			N -> S (in Ref. 1; AAA56831 and 3; AAC50606/AAC50608/AAC50609). {ECO:0000305}.	cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGACTGCAACATTTATCCCAAG	0.356																																					p.51_52del		Atlas-INDEL	.											.	MAPK9	173	.	0			c.153_154del						.																																			SO:0001589	frameshift_variant	5601	exon3			.	U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.152_153delAT	chr5.hg19:g.179696379_179696380delAT	ENSP00000394560:p.Asn51fs	149.0	0.0		171.0	34.0	NM_139068	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Frame_Shift_Del	DEL	ENST00000452135.2	hg19	CCDS4453.1																																																																																			.	.		0.356	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253530.3		
TTC28	23331	hgsc.bcm.edu	37	22	28693694	28693697	+	Frame_Shift_Del	DEL	CAAT	CAAT	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	CAAT	CAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr22:28693694_28693697delCAAT	ENST00000397906.2	-	4	814_817	c.673_676delATTG	c.(673-678)attggcfs	p.IG225fs	TTC28_ENST00000490475.1_5'UTR	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	225					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CTGCAGGTGCCAATCTTCAGTGCG	0.529																																					p.225_226del		Atlas-INDEL	.											.	TTC28	84	.	0			c.674_677del						.																																			SO:0001589	frameshift_variant	23331	exon4			.	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.673_676delATTG	chr22.hg19:g.28693694_28693697delCAAT	ENSP00000381003:p.Ile225fs	78.0	0.0		51.0	22.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Frame_Shift_Del	DEL	ENST00000397906.2	hg19	CCDS46678.1																																																																																			.	.		0.529	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
HCFC2	29915	hgsc.bcm.edu	37	12	104474581	104474581	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr12:104474581delT	ENST00000229330.4	+	5	844	c.740delT	c.(739-741)cttfs	p.L247fs		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	247					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						CCACGAAGCCTTCATACAGCC	0.318																																					p.L247fs	Esophageal Squamous(184;1814 2036 4771 6974 15702)	Atlas-INDEL	.											.	HCFC2	94	.	0			c.739delC						.						108.0	108.0	108.0					12																	104474581		2202	4300	6502	SO:0001589	frameshift_variant	29915	exon5			.	AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.740delT	chr12.hg19:g.104474581delT	ENSP00000229330:p.Leu247fs	131.0	0.0		124.0	38.0	NM_013320	B2R8Q5|C0H5X3	Frame_Shift_Del	DEL	ENST00000229330.4	hg19	CCDS9097.1																																																																																			.	.		0.318	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320	
GBA2	57704	hgsc.bcm.edu	37	9	35738529	35738530	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr9:35738529_35738530insG	ENST00000378103.3	-	13	2570_2571	c.2047_2048insC	c.(2047-2049)ggcfs	p.G683fs	GBA2_ENST00000378094.4_Frame_Shift_Ins_p.G683fs|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Frame_Shift_Ins_p.G689fs|GBA2_ENST00000378088.1_5'UTR	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	683					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TAACCTGGGGCCTGTGGTCACC	0.49																																					p.G683fs		Atlas-INDEL	.											.	GBA2	77	.	0			c.2048_2049insC						.																																			SO:0001589	frameshift_variant	57704	exon13			.	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.2047_2048insC	chr9.hg19:g.35738529_35738530insG	ENSP00000367343:p.Gly683fs	81.0	0.0		64.0	27.0	NM_020944	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Frame_Shift_Ins	INS	ENST00000378103.3	hg19	CCDS6589.1																																																																																			.	.		0.490	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
ANKRD13A	88455	hgsc.bcm.edu	37	12	110463610	110463611	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr12:110463610_110463611insA	ENST00000261739.4	+	8	1031_1032	c.865_866insA	c.(865-867)gaafs	p.E289fs		NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	289						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						GACCGAGGAGGAAAAAAAGAGA	0.411																																					p.E289fs		Atlas-INDEL	.											.	ANKRD13A	39	.	0			c.865_866insA						.																																			SO:0001589	frameshift_variant	88455	exon8			.	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.872dupA	chr12.hg19:g.110463617_110463617dupA	ENSP00000261739:p.Glu289fs	193.0	0.0		194.0	64.0	NM_033121	O60736	Frame_Shift_Ins	INS	ENST00000261739.4	hg19	CCDS9140.1																																																																																			.	.		0.411	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
ICE1	23379	hgsc.bcm.edu	37	5	5462837	5462838	+	Frame_Shift_Ins	INS	-	-	A	rs202082834	byFrequency	TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr5:5462837_5462838insA	ENST00000296564.7	+	13	3612_3613	c.3390_3391insA	c.(3391-3393)aaafs	p.K1131fs		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1131					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ATGACTCACAGAAAAATTTAGG	0.48																																					p.Q1130fs		Atlas-INDEL	.											KIAA0947_ENST00000296564,NS,carcinoma,0,1	KIAA0947	301	.	0			c.3390_3391insA						.																																			SO:0001589	frameshift_variant	23379	exon13			.																												ENST00000296564.7:c.3395dupA	chr5.hg19:g.5462842_5462842dupA	ENSP00000296564:p.Lys1131fs	71.0	0.0		91.0	14.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Frame_Shift_Ins	INS	ENST00000296564.7	hg19	CCDS47187.1																																																																																			.	.		0.480	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
SYNJ1	8867	hgsc.bcm.edu	37	21	34053840	34053864	+	Frame_Shift_Del	DEL	TATATCTTACTGATTGAATCACCAT	TATATCTTACTGATTGAATCACCAT	-	rs369372843|rs540825481		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	TATATCTTACTGATTGAATCACCAT	TATATCTTACTGATTGAATCACCAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr21:34053840_34053864delTATATCTTACTGATTGAATCACCAT	ENST00000322229.7	-	10	1294_1318	c.1295_1319delATGGTGATTCAATCAGTAAGATATA	c.(1294-1320)aatggtgattcaatcagtaagatatatfs	p.NGDSISKIY432fs	SYNJ1_ENST00000357345.3_Frame_Shift_Del_p.NGDSISKIY432fs|SYNJ1_ENST00000382491.3_Frame_Shift_Del_p.NGDSISKIY432fs|SYNJ1_ENST00000382499.2_Frame_Shift_Del_p.NGDSISKIY471fs|SYNJ1_ENST00000433931.2_Frame_Shift_Del_p.NGDSISKIY471fs			O43426	SYNJ1_HUMAN	synaptojanin 1	432	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						AGTTCCTGCATATATCTTACTGATTGAATCACCATTCACGGACCA	0.382																																					p.471_479del		Atlas-INDEL	.											.	SYNJ1	253	.	0			c.1413_1437del						.																																			SO:0001589	frameshift_variant	8867	exon11			.	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1295_1319delATGGTGATTCAATCAGTAAGATATA	chr21.hg19:g.34053840_34053864delTATATCTTACTGATTGAATCACCAT	ENSP00000322234:p.Asn432fs	132.0	0.0		98.0	16.0	NM_203446	O43425|O94984|Q4KMR1	Frame_Shift_Del	DEL	ENST00000322229.7	hg19	CCDS54484.1																																																																																			.	.		0.382	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
PKHD1	5314	hgsc.bcm.edu	37	6	51524083	51524087	+	Frame_Shift_Del	DEL	CTGTC	CTGTC	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	CTGTC	CTGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr6:51524083_51524087delCTGTC	ENST00000371117.3	-	61	11112_11116	c.10837_10841delGACAG	c.(10837-10842)gacagtfs	p.DS3613fs		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3613					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTTTGCTCTACTGTCAGCAATGGCC	0.42																																					p.3613_3614del		Atlas-INDEL	.											.	PKHD1	927	.	0			c.10838_10842del						.																																			SO:0001589	frameshift_variant	5314	exon61			.	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10837_10841delGACAG	chr6.hg19:g.51524083_51524087delCTGTC	ENSP00000360158:p.Asp3613fs	92.0	0.0		87.0	26.0	NM_138694	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Frame_Shift_Del	DEL	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.		0.420	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
TMEM62	80021	hgsc.bcm.edu	37	15	43446911	43446911	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr15:43446911delT	ENST00000260403.2	+	9	1343	c.1064delT	c.(1063-1065)gttfs	p.V355fs		NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	355						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		TCTGTCACAGTTAAGATTGAT	0.398																																					p.V355fs		Atlas-INDEL	.											.	TMEM62	47	.	0			c.1063delG						.						174.0	149.0	158.0					15																	43446911		2203	4299	6502	SO:0001589	frameshift_variant	80021	exon9			.	BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.1064delT	chr15.hg19:g.43446911delT	ENSP00000260403:p.Val355fs	68.0	0.0		73.0	24.0	NM_024956	Q6I9Y5|Q9H5J6	Frame_Shift_Del	DEL	ENST00000260403.2	hg19	CCDS32210.1																																																																																			.	.		0.398	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432227.1	NM_024956	
AGFG1	3267	hgsc.bcm.edu	37	2	228401650	228401679	+	In_Frame_Del	DEL	CTGGTCCTTCTGTGGCATCTTCTACAAACC	CTGGTCCTTCTGTGGCATCTTCTACAAACC	-	rs576713176|rs144069697	byFrequency	TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	CTGGTCCTTCTGTGGCATCTTCTACAAACC	CTGGTCCTTCTGTGGCATCTTCTACAAACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr2:228401650_228401679delCTGGTCCTTCTGTGGCATCTTCTACAAACC	ENST00000310078.8	+	10	1579_1608	c.1319_1348delCTGGTCCTTCTGTGGCATCTTCTACAAACC	c.(1318-1350)gctggtccttctgtggcatcttctacaaaccca>gca	p.GPSVASSTNP441del	AGFG1_ENST00000409315.1_In_Frame_Del_p.GPSVASSTNP420del|AGFG1_ENST00000409979.2_In_Frame_Del_p.GPSVASSTNP465del|AGFG1_ENST00000373671.3_In_Frame_Del_p.GPSVASSTNP401del|AGFG1_ENST00000409171.1_In_Frame_Del_p.GPSVASSTNP441del	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	441					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						GTTGCTGCTGCTGGTCCTTCTGTGGCATCTTCTACAAACCCATTTCAGAC	0.352																																					p.464_473del		Atlas-INDEL	.											.	AGFG1	80	.	0			c.1390_1419del						.																																			SO:0001651	inframe_deletion	3267	exon11			.		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1319_1348delCTGGTCCTTCTGTGGCATCTTCTACAAACC	chr2.hg19:g.228401650_228401679delCTGGTCCTTCTGTGGCATCTTCTACAAACC	ENSP00000312059:p.Gly441_Pro450del	205.0	0.0		93.0	12.0	NM_001135187	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	In_Frame_Del	DEL	ENST00000310078.8	hg19	CCDS2467.1																																																																																			.	.		0.352	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	
ECT2	1894	hgsc.bcm.edu	37	3	172479465	172479468	+	Frame_Shift_Del	DEL	GAAT	GAAT	-	rs531984277		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	GAAT	GAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr3:172479465_172479468delGAAT	ENST00000392692.3	+	8	926_929	c.750_753delGAAT	c.(748-753)cggaatfs	p.RN250fs	ECT2_ENST00000417960.1_Frame_Shift_Del_p.RN218fs|ECT2_ENST00000441497.2_Frame_Shift_Del_p.RN219fs|ECT2_ENST00000540509.1_Frame_Shift_Del_p.RN250fs|ECT2_ENST00000427830.1_Frame_Shift_Del_p.RN219fs|ECT2_ENST00000232458.5_Frame_Shift_Del_p.RN219fs	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	250	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			GGGAAAGGCGGAATGAACAGTAAG	0.309																																					p.250_251del		Atlas-INDEL	.											.	ECT2	79	.	0			c.749_752del						.																																			SO:0001589	frameshift_variant	1894	exon8			.	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.750_753delGAAT	chr3.hg19:g.172479465_172479468delGAAT	ENSP00000376457:p.Arg250fs	130.0	0.0		165.0	74.0	NM_001258315	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Frame_Shift_Del	DEL	ENST00000392692.3	hg19	CCDS58860.1																																																																																			.	.		0.309	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	
C2CD4A	145741	hgsc.bcm.edu	37	15	62360051	62360051	+	Frame_Shift_Del	DEL	G	G	-	rs376974409		TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr15:62360051delG	ENST00000355522.5	+	2	380	c.239delG	c.(238-240)cgcfs	p.R80fs		NM_207322.2	NP_997205.2	Q8NCU7	C2C4A_HUMAN	C2 calcium-dependent domain containing 4A	80						nucleus (GO:0005634)											GGCGCCGGCCGCACAGACTGG	0.711																																					p.R80fs		Atlas-INDEL	.											.	C2CD4A	3	.	0			c.238delC						.						10.0	12.0	12.0					15																	62360051		2179	4278	6457	SO:0001589	frameshift_variant	145741	exon2			.	AF504646	CCDS32258.1	15q22.2	2009-09-28	2009-09-28	2009-09-28		ENSG00000198535			33627	protein-coding gene	gene with protein product	"""nuclear localized factor 1"""	610343	"""family with sequence similarity 148, member A"""	FAM148A			Standard	NM_207322		Approved	NLF1	uc002ahf.4	Q8NCU7		ENST00000355522.5:c.239delG	chr15.hg19:g.62360051delG	ENSP00000347712:p.Arg80fs	69.0	0.0		54.0	34.0	NM_207322		Frame_Shift_Del	DEL	ENST00000355522.5	hg19	CCDS32258.1																																																																																			.	.		0.711	C2CD4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416008.2	NM_207322	
CKAP5	9793	hgsc.bcm.edu	37	11	46765632	46765633	+	In_Frame_Ins	INS	-	-	GGA			TCGA-DD-AAD5-01A-11D-A40R-10	TCGA-DD-AAD5-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2984bd1-84c5-4dd0-9156-fec653c55146	a7e8434c-a3c4-4216-a700-809a6c5e6383	g.chr11:46765632_46765633insGGA	ENST00000529230.1	-	44	6085_6086	c.6039_6040insTCC	c.(6037-6042)tccaca>tccTCCaca	p.2013_2014insS	CKAP5_ENST00000415402.1_In_Frame_Ins_p.2020_2021insS|CKAP5_ENST00000312055.5_In_Frame_Ins_p.1953_1954insS|CKAP5_ENST00000354558.3_In_Frame_Ins_p.1953_1954insS			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	2013					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						ATGTTAGCTGTGGAGGAGGAGG	0.52																																					p.T2014delinsST	Ovarian(4;85 273 2202 4844 13323)	Atlas-INDEL	.											.	CKAP5	134	.	0			c.6040_6041insTCC						.																																			SO:0001652	inframe_insertion	9793	exon44			.		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.6037_6039dupTCC	chr11.hg19:g.46765639_46765641dupGGA	ENSP00000432768:p.Ser2013_Ser2013dup	163.0	0.0		96.0	34.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	In_Frame_Ins	INS	ENST00000529230.1	hg19	CCDS31477.1																																																																																			.	.		0.520	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
