#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHA10	284656	hgsc.bcm.edu	37	1	38197219	38197219	+	Silent	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:38197219T>C	ENST00000373048.4	-	7	1526	c.1527A>G	c.(1525-1527)acA>acG	p.T509T	EPHA10_ENST00000540011.1_Silent_p.T4T|EPHA10_ENST00000330210.7_Silent_p.T4T|EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000427468.2_Silent_p.T509T	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	509	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGGGCGCCCCTGTCTTCACCA	0.597																																					p.T509T		Atlas-SNP	.											.	EPHA10	120	.	0			c.A1527G						.						106.0	106.0	106.0					1																	38197219		1961	4150	6111	SO:0001819	synonymous_variant	284656	exon7			CGCCCCTGTCTTC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.1527A>G	chr1.hg19:g.38197219T>C		74.0	0.0		78.0	19.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	hg19	CCDS41305.1																																																																																			.	.		0.597	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
LRRC7	57554	hgsc.bcm.edu	37	1	70541979	70541979	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:70541979C>G	ENST00000035383.5	+	22	4366	c.4336C>G	c.(4336-4338)Cag>Gag	p.Q1446E	LRRC7_ENST00000310961.5_Missense_Mutation_p.Q1404E|LRRC7_ENST00000415775.2_Missense_Mutation_p.Q730E	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1446	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ATATCCAGAGCAGGTGAGAAG	0.463																																					p.Q1446E		Atlas-SNP	.											.	LRRC7	400	.	0			c.C4336G						.						53.0	54.0	54.0					1																	70541979		2203	4300	6503	SO:0001583	missense	57554	exon22			CCAGAGCAGGTGA		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4336C>G	chr1.hg19:g.70541979C>G	ENSP00000035383:p.Gln1446Glu	161.0	0.0		187.0	118.0	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	hg19	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331052	0.41297	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.35421	1.31;1.38;2.48	6.16	6.16	0.99307	PDZ/DHR/GLGF (1);	0.061229	0.64402	D	0.000002	T	0.30916	0.0780	N	0.25890	0.77	0.48040	D	0.999574	D;P;P	0.57257	0.979;0.954;0.924	P;D;P	0.67900	0.801;0.954;0.9	T	0.02081	-1.1217	10	0.02654	T	1	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	730;1399;1446	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	E	1404;1446;730;1222	ENSP00000309245:Q1404E;ENSP00000035383:Q1446E;ENSP00000394867:Q730E	ENSP00000035383:Q1446E	Q	+	1	0	LRRC7	70314567	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.176000	0.71955	2.937000	0.99478	0.650000	0.86243	CAG	.	.		0.463	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
FNBP1L	54874	hgsc.bcm.edu	37	1	94012443	94012443	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:94012443A>T	ENST00000271234.7	+	13	1470	c.1319A>T	c.(1318-1320)cAa>cTa	p.Q440L	FNBP1L_ENST00000370256.4_Missense_Mutation_p.Q435L|FNBP1L_ENST00000260506.8_Missense_Mutation_p.Q382L|FNBP1L_ENST00000604705.1_Missense_Mutation_p.Q440L|FNBP1L_ENST00000370253.2_Missense_Mutation_p.Q382L	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	440	Interaction with CDC42.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		AAGAATCCACAAATGGGGGAT	0.368																																					p.Q440L		Atlas-SNP	.											.	FNBP1L	56	.	0			c.A1319T						.						52.0	51.0	51.0					1																	94012443		1832	4077	5909	SO:0001583	missense	54874	exon13			ATCCACAAATGGG		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.1319A>T	chr1.hg19:g.94012443A>T	ENSP00000271234:p.Gln440Leu	252.0	1.0		272.0	177.0	NM_001164473	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	ENST00000271234.7	hg19	CCDS53343.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.892818	0.91889	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253;ENST00000424449;ENST00000541733	T;T;T	0.76578	-1.03;-1.03;-1.03	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.81669	0.4871	L	0.52126	1.63	0.80722	D	1	D;B;B;B	0.63046	0.992;0.02;0.02;0.176	D;B;B;B	0.72982	0.979;0.01;0.034;0.185	T	0.83117	-0.0120	10	0.52906	T	0.07	-17.5721	15.9763	0.80066	1.0:0.0:0.0:0.0	.	10;260;382;382	B4DKY5;B4DSI7;Q5T0N5-4;Q5T0N5-3	.;.;.;.	L	435;440;382;435;249;132	ENSP00000359278:Q435L;ENSP00000271234:Q440L;ENSP00000260506:Q382L	ENSP00000260506:Q382L	Q	+	2	0	FNBP1L	93785031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.950000	0.93019	2.151000	0.67156	0.533000	0.62120	CAA	.	.		0.368	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737	
HIPK1	204851	hgsc.bcm.edu	37	1	114498222	114498222	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:114498222C>T	ENST00000369558.1	+	5	1590	c.1358C>T	c.(1357-1359)tCa>tTa	p.S453L	HIPK1_ENST00000369561.4_Missense_Mutation_p.S453L|HIPK1_ENST00000426820.2_Missense_Mutation_p.S453L|HIPK1_ENST00000369555.2_Missense_Mutation_p.S453L|HIPK1_ENST00000406344.1_Missense_Mutation_p.S59L|HIPK1_ENST00000369559.4_Missense_Mutation_p.S453L|HIPK1_ENST00000369554.2_Missense_Mutation_p.S453L|HIPK1_ENST00000369553.1_Missense_Mutation_p.S59L|HIPK1_ENST00000340480.4_Missense_Mutation_p.S79L			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	453	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGAATAAAATCAAAAGAAGCT	0.318																																					p.S453L		Atlas-SNP	.											.	HIPK1	195	.	0			c.C1358T						.						105.0	121.0	115.0					1																	114498222		2203	4300	6503	SO:0001583	missense	204851	exon5			TAAAATCAAAAGA	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1358C>T	chr1.hg19:g.114498222C>T	ENSP00000358571:p.Ser453Leu	351.0	1.0		464.0	176.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	hg19	CCDS867.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312162	0.95655	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T;T	0.56444	0.47;0.48;0.52;0.46;0.46;0.52;0.53;3.55;2.54;2.54	5.1	5.1	0.69264	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000077	T	0.54319	0.1851	N	0.25094	0.71	0.80722	D	1	D;D;D	0.89917	1.0;0.991;0.981	D;D;D	0.91635	0.999;0.987;0.962	T	0.60464	-0.7258	10	0.62326	D	0.03	.	18.7116	0.91659	0.0:1.0:0.0:0.0	.	59;453;453	Q86Z02-4;Q86Z02;Q86Z02-2	.;HIPK1_HUMAN;.	L	524;453;453;453;453;453;453;79;59;59	ENSP00000407442:S524L;ENSP00000358572:S453L;ENSP00000409673:S453L;ENSP00000358567:S453L;ENSP00000358568:S453L;ENSP00000358571:S453L;ENSP00000358574:S453L;ENSP00000340956:S79L;ENSP00000358566:S59L;ENSP00000384960:S59L	ENSP00000340956:S79L	S	+	2	0	HIPK1	114299745	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.634000	0.89283	0.655000	0.94253	TCA	.	.		0.318	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
ENSA	2029	hgsc.bcm.edu	37	1	150598960	150598960	+	Intron	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:150598960C>A	ENST00000369014.5	-	3	309				ENSA_ENST00000503241.1_Nonsense_Mutation_p.E76*|ENSA_ENST00000513281.1_Intron|ENSA_ENST00000369009.3_Intron|ENSA_ENST00000271690.8_Intron|ENSA_ENST00000339643.5_Nonsense_Mutation_p.E76*|ENSA_ENST00000361532.5_Intron|ENSA_ENST00000354702.3_Intron|ENSA_ENST00000356527.5_Intron|ENSA_ENST00000361631.5_Nonsense_Mutation_p.E72*|ENSA_ENST00000503345.1_Intron|ENSA_ENST00000369016.4_Nonsense_Mutation_p.E76*			O43768	ENSA_HUMAN	endosulfine alpha						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|regulation of catalytic activity (GO:0050790)|regulation of insulin secretion (GO:0050796)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|transport (GO:0006810)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ion channel inhibitor activity (GO:0008200)|phosphatase inhibitor activity (GO:0019212)|potassium channel inhibitor activity (GO:0019870)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)	4	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;9.85e-23)|all cancers(9;5.06e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.67e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000701)|LUSC - Lung squamous cell carcinoma(543;0.171)			CCCACCATTTCATCCGCACAG	0.398																																					p.E76X	Esophageal Squamous(188;763 2078 3002 3411 26027)	Atlas-SNP	.											.	ENSA	41	.	0			c.G226T						.						139.0	124.0	129.0					1																	150598960		2203	4300	6503	SO:0001627	intron_variant	2029	exon3			CCATTTCATCCGC	X99906	CCDS958.1, CCDS959.1, CCDS960.1, CCDS961.1, CCDS962.1, CCDS963.1, CCDS964.1, CCDS965.1	1q21.3	2010-03-11			ENSG00000143420	ENSG00000143420			3360	protein-coding gene	gene with protein product		603061				9653196	Standard	NM_004436		Approved	MGC4319, MGC8394, MGC78563, ARPP-19e	uc001eve.3	O43768	OTTHUMG00000035004	ENST00000369014.5:c.184-676G>T	chr1.hg19:g.150598960C>A		73.0	0.0		77.0	33.0	NM_207043	A8K1Z9|E9PB69|Q5T5H2|Q68D48|Q6FHW0|Q6IAM4|Q6NUL2|Q6VUC6|Q6VUC7|Q6VUC8|Q6VUC9|Q6VUD0|Q6VUD1|Q9NRZ0	Nonsense_Mutation	SNP	ENST00000369014.5	hg19	CCDS958.1	.	.	.	.	.	.	.	.	.	.	C	8.670	0.902535	0.17760	.	.	ENSG00000143420	ENST00000369016;ENST00000361631;ENST00000339643;ENST00000502246;ENST00000503241	.	.	.	3.15	2.22	0.28083	.	1.881870	0.03411	U	0.204734	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.291	0.37786	0.0:0.8807:0.0:0.1193	.	.	.	.	X	76;72;76;76;76	.	ENSP00000341743:E76X	E	-	1	0	ENSA	148865584	0.000000	0.05858	0.011000	0.14972	0.001000	0.01503	-0.028000	0.12350	0.361000	0.24292	-1.119000	0.02030	GAA	.	.		0.398	ENSA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000084720.2	NM_207042	
SMCP	4184	hgsc.bcm.edu	37	1	152856963	152856963	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:152856963A>T	ENST00000368765.3	+	2	215	c.65A>T	c.(64-66)cAg>cTg	p.Q22L		NM_030663.2	NP_109588.2	P49901	MCSP_HUMAN	sperm mitochondria-associated cysteine-rich protein	22	7 X 7 (OR 8) AA approximate repeats.				penetration of zona pellucida (GO:0007341)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(1)|lung(4)|urinary_tract(1)	8	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCCCACCACAGCAGAACCAG	0.478																																					p.Q22L		Atlas-SNP	.											.	SMCP	13	.	0			c.A65T						.						102.0	92.0	95.0					1																	152856963		2203	4300	6503	SO:0001583	missense	4184	exon2			CACCACAGCAGAA	BC014593	CCDS1029.1	1q21.3	2009-03-19	2005-10-06	2005-10-06	ENSG00000163206	ENSG00000163206			6962	protein-coding gene	gene with protein product		601148	"""mitochondrial capsule selenoprotein"""	MCSP		8833144	Standard	NM_030663		Approved		uc001fat.3	P49901	OTTHUMG00000012452	ENST00000368765.3:c.65A>T	chr1.hg19:g.152856963A>T	ENSP00000357754:p.Gln22Leu	219.0	0.0		292.0	116.0	NM_030663	Q96A42	Missense_Mutation	SNP	ENST00000368765.3	hg19	CCDS1029.1	.	.	.	.	.	.	.	.	.	.	A	5.185	0.219675	0.09863	.	.	ENSG00000163206	ENST00000368765	T	0.56941	0.43	3.44	1.09	0.20402	.	0.442567	0.16719	N	0.202329	T	0.11750	0.0286	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29150	-1.0021	10	0.38643	T	0.18	-2.2026	8.0194	0.30400	0.4495:0.5504:0.0:0.0	.	22	P49901	MCSP_HUMAN	L	22	ENSP00000357754:Q22L	ENSP00000357754:Q22L	Q	+	2	0	SMCP	151123587	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	0.482000	0.22276	0.224000	0.20940	0.533000	0.62120	CAG	.	.		0.478	SMCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034665.1	NM_030663	
MEF2D	4209	hgsc.bcm.edu	37	1	156452269	156452269	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:156452269T>C	ENST00000348159.4	-	3	698	c.218A>G	c.(217-219)aAt>aGt	p.N73S	Y_RNA_ENST00000383924.1_RNA|MEF2D_ENST00000353795.3_Missense_Mutation_p.N73S|MEF2D_ENST00000360595.3_Missense_Mutation_p.N73S|MEF2D_ENST00000368240.2_Missense_Mutation_p.N73S|MEF2D_ENST00000340875.5_Missense_Mutation_p.N73S|MEF2D_ENST00000464356.2_Missense_Mutation_p.N73S	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	73					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGTGGCTCATTGTACTCCGT	0.572																																					p.N73S		Atlas-SNP	.											.	MEF2D	43	.	0			c.A218G						.						390.0	310.0	337.0					1																	156452269		2203	4300	6503	SO:0001583	missense	4209	exon3			GGCTCATTGTACT	BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.218A>G	chr1.hg19:g.156452269T>C	ENSP00000271555:p.Asn73Ser	81.0	0.0		106.0	59.0	NM_005920	D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	ENST00000348159.4	hg19	CCDS1143.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.809937	0.90707	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000541336;ENST00000454816	T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	5.05	5.05	0.67936	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	L	0.41356	1.27	0.80722	D	1	P;P;B	0.47762	0.727;0.9;0.336	B;B;B	0.43950	0.37;0.417;0.437	T	0.74084	-0.3779	10	0.56958	D	0.05	-22.345	13.6292	0.62186	0.0:0.0:0.0:1.0	.	78;73;73	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	S	73	ENSP00000271555:N73S;ENSP00000343159:N73S;ENSP00000357223:N73S;ENSP00000344705:N73S;ENSP00000353803:N73S;ENSP00000388505:N73S	ENSP00000343159:N73S	N	-	2	0	MEF2D	154718893	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.170000	0.64990	1.912000	0.55364	0.459000	0.35465	AAT	.	.		0.572	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080562.2	NM_005920	
TTC24	164118	hgsc.bcm.edu	37	1	156555548	156555548	+	Silent	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:156555548T>A	ENST00000368237.3	+	8	1500	c.1500T>A	c.(1498-1500)gcT>gcA	p.A500A	TTC24_ENST00000368236.3_Silent_p.A500A|AL365181.1_ENST00000581084.1_RNA|TTC24_ENST00000478081.1_3'UTR			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	500										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACCATCTAGCTTCTAGTTGCC	0.522																																					p.A500A		Atlas-SNP	.											.	TTC24	46	.	0			c.T1500A						.						130.0	130.0	130.0					1																	156555548		2111	4230	6341	SO:0001819	synonymous_variant	164118	exon9			TCTAGCTTCTAGT		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1500T>A	chr1.hg19:g.156555548T>A		75.0	0.0		103.0	52.0	NM_001105669	Q5T3H7	Silent	SNP	ENST00000368237.3	hg19	CCDS53379.1	.	.	.	.	.	.	.	.	.	.	T	9.494	1.101438	0.20632	.	.	ENSG00000187862	ENST00000340086	.	.	.	2.22	-0.411	0.12370	.	.	.	.	.	T	0.09686	0.0238	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35450	-0.9788	4	.	.	.	.	5.0069	0.14293	0.0:0.6453:0.0:0.3547	.	.	.	.	H	273	.	.	L	+	2	0	TTC24	154822172	0.000000	0.05858	0.000000	0.03702	0.518000	0.34316	-0.026000	0.12392	-0.082000	0.12640	0.379000	0.24179	CTT	.	.		0.522	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
FCRL1	115350	hgsc.bcm.edu	37	1	157765954	157765954	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:157765954A>T	ENST00000368176.3	-	11	1292	c.1225T>A	c.(1225-1227)Tta>Ata	p.L409I	FCRL1_ENST00000358292.3_Silent_p.P366P|FCRL1_ENST00000491942.1_Missense_Mutation_p.L408I|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	409						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TAGATGTCTAAGGAAACCTGG	0.443																																					p.L409I	GBM(54;482 1003 11223 30131 35730)	Atlas-SNP	.											.	FCRL1	164	.	0			c.T1225A						.						127.0	109.0	115.0					1																	157765954		2203	4300	6503	SO:0001583	missense	115350	exon11			TGTCTAAGGAAAC	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.1225T>A	chr1.hg19:g.157765954A>T	ENSP00000357158:p.Leu409Ile	71.0	0.0		122.0	56.0	NM_052938	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	hg19	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	A	8.633	0.894208	0.17613	.	.	ENSG00000163534	ENST00000368176;ENST00000491942	T;T	0.37235	1.21;1.22	4.37	-1.1	0.09872	.	2.291920	0.01966	N	0.043668	T	0.11793	0.0287	.	.	.	0.09310	N	1	B;B	0.32160	0.358;0.244	B;B	0.35971	0.215;0.107	T	0.20174	-1.0283	9	0.39692	T	0.17	.	6.3206	0.21215	0.3954:0.5081:0.0965:0.0	.	408;409	Q96LA6-2;Q96LA6	.;FCRL1_HUMAN	I	409;408	ENSP00000357158:L409I;ENSP00000418130:L408I	ENSP00000357158:L409I	L	-	1	2	FCRL1	156032578	0.001000	0.12720	0.000000	0.03702	0.050000	0.14768	0.354000	0.20146	-0.286000	0.09076	0.454000	0.30748	TTA	.	.		0.443	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
IGSF8	93185	hgsc.bcm.edu	37	1	160063091	160063091	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:160063091C>T	ENST00000368086.1	-	4	1151	c.935G>A	c.(934-936)gGt>gAt	p.G312D	IGSF8_ENST00000314485.7_Missense_Mutation_p.G312D|IGSF8_ENST00000460351.1_5'Flank			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	312	Ig-like C2-type 3.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCGACGTTCACCAGGCCCCAC	0.617																																					p.G312D		Atlas-SNP	.											.	IGSF8	59	.	0			c.G935A						.						41.0	40.0	40.0					1																	160063091		2202	4299	6501	SO:0001583	missense	93185	exon4			CGTTCACCAGGCC	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.935G>A	chr1.hg19:g.160063091C>T	ENSP00000357065:p.Gly312Asp	120.0	0.0		150.0	33.0	NM_052868	Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	hg19	CCDS1195.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787841	0.49997	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475	T;T	0.27402	1.67;1.67	3.65	3.65	0.41850	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.161058	0.40728	N	0.001031	T	0.22166	0.0534	L	0.34521	1.04	0.41634	D	0.989038	D	0.76494	0.999	D	0.66716	0.946	T	0.03453	-1.1035	10	0.08599	T	0.76	-10.0174	10.9917	0.47553	0.0:0.8085:0.1915:0.0	.	312	Q969P0	IGSF8_HUMAN	D	312	ENSP00000316664:G312D;ENSP00000357065:G312D	ENSP00000316664:G312D	G	-	2	0	IGSF8	158329715	0.116000	0.22171	0.929000	0.37066	0.843000	0.47879	1.092000	0.30927	1.870000	0.54199	0.313000	0.20887	GGT	.	.		0.617	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868	
RASAL2	9462	hgsc.bcm.edu	37	1	178427017	178427017	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:178427017G>T	ENST00000462775.1	+	12	2292	c.2167G>T	c.(2167-2169)Gca>Tca	p.A723S	RASAL2_ENST00000448150.3_Missense_Mutation_p.A853S|RASAL2_ENST00000367649.3_Missense_Mutation_p.A864S	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	723					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						AGTGGAGCATGCATCTGTCAT	0.527																																					p.A864S		Atlas-SNP	.											.	RASAL2	334	.	0			c.G2590T						.						88.0	82.0	84.0					1																	178427017		2203	4300	6503	SO:0001583	missense	9462	exon14			GAGCATGCATCTG	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.2167G>T	chr1.hg19:g.178427017G>T	ENSP00000420558:p.Ala723Ser	120.0	0.0		130.0	9.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	hg19	CCDS1322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.163|0.163	-1.079048|-1.079048	0.01903|0.01903	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	T;T;T|.	0.10668|.	2.85;2.85;2.85|.	5.42|5.42	1.16|1.16	0.20824|0.20824	.|.	0.590474|.	0.16941|.	N|.	0.193284|.	T|T	0.18215|0.18215	0.0437|0.0437	N|N	0.17379|0.17379	0.485|0.485	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.06405|.	0.001;0.002;0.001|.	T|T	0.21109|0.21109	-1.0255|-1.0255	10|5	0.02654|.	T|.	1|.	.|.	2.2437|2.2437	0.04026|0.04026	0.1345:0.239:0.3808:0.2457|0.1345:0.239:0.3808:0.2457	.|.	853;723;864|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	S|F	853;864;723|273	ENSP00000407768:A853S;ENSP00000356621:A864S;ENSP00000420558:A723S|.	ENSP00000356621:A864S|.	A|C	+|+	1|2	0|0	RASAL2|RASAL2	176693640|176693640	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.908000|0.908000	0.53690|0.53690	0.169000|0.169000	0.16641|0.16641	0.244000|0.244000	0.21351|0.21351	0.655000|0.655000	0.94253|0.94253	GCA|TGC	.	.		0.527	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
AXDND1	126859	hgsc.bcm.edu	37	1	179347779	179347779	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:179347779T>C	ENST00000367618.3	+	5	769	c.382T>C	c.(382-384)Tct>Cct	p.S128P	AXDND1_ENST00000461179.2_3'UTR|AXDND1_ENST00000457238.2_Missense_Mutation_p.S128P	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	128										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						TAGGGATATTTCTTTTCTGTA	0.383																																					p.S128P		Atlas-SNP	.											.	AXDND1	142	.	0			c.T382C						.						76.0	69.0	72.0					1																	179347779		2203	4300	6503	SO:0001583	missense	126859	exon5			GATATTTCTTTTC	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.382T>C	chr1.hg19:g.179347779T>C	ENSP00000356590:p.Ser128Pro	68.0	0.0		79.0	45.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098948	0.76870	.	.	ENSG00000162779	ENST00000509175;ENST00000367618;ENST00000360322;ENST00000457238;ENST00000511889;ENST00000434088	T;T;T	0.62941	1.09;-0.01;1.26	4.81	4.81	0.61882	.	0.150426	0.45606	D	0.000358	T	0.72574	0.3477	M	0.63843	1.955	0.36779	D	0.884213	D;D	0.71674	0.998;0.998	P;P	0.62649	0.905;0.905	T	0.79713	-0.1688	10	0.87932	D	0	0.1187	11.043	0.47842	0.0:0.0:0.0:1.0	.	86;128	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	P	86;128;86;128;86;62	ENSP00000356590:S128P;ENSP00000416712:S128P;ENSP00000391716:S62P	ENSP00000353471:S86P	S	+	1	0	AXDND1	177614402	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.617000	0.46385	1.916000	0.55485	0.482000	0.46254	TCT	.	.		0.383	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
XPR1	9213	hgsc.bcm.edu	37	1	180804015	180804015	+	Silent	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:180804015A>T	ENST00000367590.4	+	10	1338	c.1140A>T	c.(1138-1140)cgA>cgT	p.R380R	XPR1_ENST00000367589.3_Silent_p.R380R	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	380					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						TTCAGTTTCGAGTATTTACAG	0.393																																					p.R380R		Atlas-SNP	.											.	XPR1	76	.	0			c.A1140T						.						54.0	55.0	55.0					1																	180804015		2203	4300	6503	SO:0001819	synonymous_variant	9213	exon10			GTTTCGAGTATTT	AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1140A>T	chr1.hg19:g.180804015A>T		57.0	0.0		69.0	38.0	NM_004736	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Silent	SNP	ENST00000367590.4	hg19	CCDS1340.1																																																																																			.	.		0.393	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	NM_004736	
CAPN9	10753	hgsc.bcm.edu	37	1	230883256	230883256	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:230883256A>T	ENST00000271971.2	+	1	127	c.14A>T	c.(13-15)tAc>tTc	p.Y5F	CAPN9_ENST00000366666.2_Missense_Mutation_p.Y5F|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Missense_Mutation_p.Y5F	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	5					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CCTTACCTCTACCGGGCCCCA	0.612																																					p.Y5F		Atlas-SNP	.											.	CAPN9	116	.	0			c.A14T						.						55.0	62.0	60.0					1																	230883256		2203	4300	6503	SO:0001583	missense	10753	exon1			ACCTCTACCGGGC	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.14A>T	chr1.hg19:g.230883256A>T	ENSP00000271971:p.Tyr5Phe	157.0	0.0		244.0	125.0	NM_006615	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	hg19	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	A	7.553	0.663136	0.14710	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.46819	0.86;0.86;0.86	5.29	2.95	0.34219	.	1.271780	0.04835	N	0.439406	T	0.28566	0.0707	N	0.19112	0.55	0.09310	N	1	B;B;B	0.28552	0.09;0.178;0.215	B;B;B	0.24155	0.024;0.049;0.051	T	0.23547	-1.0185	10	0.09590	T	0.72	.	3.9452	0.09346	0.6662:0.1339:0.0716:0.1283	.	5;5;5	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	F	5	ENSP00000271971:Y5F;ENSP00000346538:Y5F;ENSP00000355626:Y5F	ENSP00000271971:Y5F	Y	+	2	0	CAPN9	228949879	0.178000	0.23122	0.019000	0.16419	0.104000	0.19210	2.439000	0.44846	0.814000	0.34374	0.533000	0.62120	TAC	.	.		0.612	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
PCNXL2	80003	hgsc.bcm.edu	37	1	233297033	233297033	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:233297033A>T	ENST00000258229.9	-	18	3584	c.3350T>A	c.(3349-3351)gTa>gAa	p.V1117E	PCNXL2_ENST00000520463.1_5'Flank|PCNXL2_ENST00000488780.2_Missense_Mutation_p.V250E	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1117						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGACAGGAATACAGTGCTGGC	0.468																																					p.V1117E		Atlas-SNP	.											.	PCNXL2	204	.	0			c.T3350A						.						74.0	77.0	76.0					1																	233297033		2086	4210	6296	SO:0001583	missense	80003	exon18			AGGAATACAGTGC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.3350T>A	chr1.hg19:g.233297033A>T	ENSP00000258229:p.Val1117Glu	218.0	0.0		278.0	99.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.654648	0.67472	.	.	ENSG00000135749	ENST00000258229;ENST00000488780	T	0.12672	2.66	5.02	5.02	0.67125	.	.	.	.	.	T	0.42017	0.1184	M	0.84585	2.705	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.48328	-0.9045	9	0.87932	D	0	.	14.9104	0.70752	1.0:0.0:0.0:0.0	.	1117	A6NKB5	PCX2_HUMAN	E	1117;250	ENSP00000258229:V1117E	ENSP00000258229:V1117E	V	-	2	0	PCNXL2	231363656	1.000000	0.71417	0.988000	0.46212	0.972000	0.66771	6.375000	0.73137	2.098000	0.63641	0.482000	0.46254	GTA	.	.		0.468	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
GNG4	2786	hgsc.bcm.edu	37	1	235747052	235747052	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr1:235747052C>T	ENST00000366598.4	-	2	302	c.87G>A	c.(85-87)atG>atA	p.M29I	GNG4_ENST00000484517.1_5'UTR|GNG4_ENST00000450593.1_Missense_Mutation_p.M29I|GNG4_ENST00000391854.2_Missense_Mutation_p.M29I|GNG4_ENST00000366597.1_Missense_Mutation_p.M29I			P50150	GBG4_HUMAN	guanine nucleotide binding protein (G protein), gamma 4	29					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell growth (GO:0030308)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)			TGACCCTGTCCATACAGGCTT	0.517																																					p.M29I		Atlas-SNP	.											.	GNG4	18	.	0			c.G87A						.						186.0	169.0	175.0					1																	235747052		2203	4300	6503	SO:0001583	missense	2786	exon2			CCTGTCCATACAG	BC022485	CCDS1607.1	1q42.3	2008-02-05			ENSG00000168243	ENSG00000168243			4407	protein-coding gene	gene with protein product		604388				7665596	Standard	NM_001098721		Approved		uc001hxh.4	P50150	OTTHUMG00000040740	ENST00000366598.4:c.87G>A	chr1.hg19:g.235747052C>T	ENSP00000355557:p.Met29Ile	71.0	0.0		80.0	35.0	NM_004485		Missense_Mutation	SNP	ENST00000366598.4	hg19	CCDS1607.1	.	.	.	.	.	.	.	.	.	.	C	6.739	0.505111	0.12822	.	.	ENSG00000168243	ENST00000450593;ENST00000391854;ENST00000366598;ENST00000366597	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	5.52	4.61	0.57282	G-protein gamma domain (5);	0.000000	0.85682	D	0.000000	T	0.09598	0.0236	.	.	.	0.39713	D	0.971364	B	0.02656	0.0	B	0.04013	0.001	T	0.11348	-1.0591	9	0.02654	T	1	-13.032	11.514	0.50509	0.0:0.9154:0.0:0.0846	.	29	P50150	GBG4_HUMAN	I	29	ENSP00000398629:M29I;ENSP00000375727:M29I;ENSP00000355557:M29I;ENSP00000355556:M29I	ENSP00000355556:M29I	M	-	3	0	GNG4	233813675	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.922000	0.56462	1.325000	0.45301	0.655000	0.94253	ATG	.	.		0.517	GNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097906.1	NM_004485	
RTN4	57142	hgsc.bcm.edu	37	2	55253108	55253108	+	Silent	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr2:55253108A>T	ENST00000337526.6	-	3	2370	c.2127T>A	c.(2125-2127)gcT>gcA	p.A709A	RTN4_ENST00000357376.3_Silent_p.A503A|RTN4_ENST00000354474.6_Silent_p.A477A|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000405240.1_Silent_p.A503A|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000404909.1_Silent_p.A503A|RTN4_ENST00000394611.2_Silent_p.A503A	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	709					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GAGCTGGTTCAGCAGAAAGCT	0.368																																					p.A709A		Atlas-SNP	.											.	RTN4	189	.	0			c.T2127A						.						57.0	63.0	61.0					2																	55253108		2201	4295	6496	SO:0001819	synonymous_variant	57142	exon3			TGGTTCAGCAGAA	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.2127T>A	chr2.hg19:g.55253108A>T		27.0	0.0		34.0	20.0	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Silent	SNP	ENST00000337526.6	hg19	CCDS42684.1																																																																																			.	.		0.368	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
ERCC3	2071	hgsc.bcm.edu	37	2	128044277	128044277	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr2:128044277A>G	ENST00000285398.2	-	8	1437		c.e8+1		ERCC3_ENST00000493187.2_Splice_Site	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3						7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CAGCCTGCTTACCTGGTATGG	0.552			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												.		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3	73	.	0			c.1342+2T>C						.						79.0	77.0	78.0					2																	128044277		2203	4300	6503	SO:0001630	splice_region_variant	2071	exon9	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTGCTTACCTGGT	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.1342+1T>C	chr2.hg19:g.128044277A>G		30.0	0.0		54.0	26.0	NM_000122	Q53QM0	Splice_Site	SNP	ENST00000285398.2	hg19	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.936950	0.73557	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2146	0.73254	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERCC3	127760747	1.000000	0.71417	0.987000	0.45799	0.813000	0.45954	9.287000	0.95975	2.050000	0.60909	0.459000	0.35465	.	.	.		0.552	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	Intron
AGPS	8540	hgsc.bcm.edu	37	2	178370292	178370292	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr2:178370292G>A	ENST00000264167.4	+	15	1680	c.1534G>A	c.(1534-1536)Gca>Aca	p.A512T	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	512					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			CTATGTTATTGCATACATTCG	0.313																																					p.A512T		Atlas-SNP	.											.	AGPS	56	.	0			c.G1534A						.						152.0	147.0	148.0					2																	178370292		2203	4298	6501	SO:0001583	missense	8540	exon15			GTTATTGCATACA	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.1534G>A	chr2.hg19:g.178370292G>A	ENSP00000264167:p.Ala512Thr	43.0	0.0		64.0	23.0	NM_003659	A5D8U9|Q2TU35	Missense_Mutation	SNP	ENST00000264167.4	hg19	CCDS2275.1	.	.	.	.	.	.	.	.	.	.	G	32	5.153665	0.94645	.	.	ENSG00000018510	ENST00000264167	D	0.84223	-1.82	5.11	5.11	0.69529	FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93693	0.7985	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94626	0.7817	10	0.66056	D	0.02	.	18.5216	0.90954	0.0:0.0:1.0:0.0	.	512	O00116	ADAS_HUMAN	T	512	ENSP00000264167:A512T	ENSP00000264167:A512T	A	+	1	0	AGPS	178078538	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.784000	0.91818	2.378000	0.81104	0.555000	0.69702	GCA	.	.		0.313	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
TTN	7273	hgsc.bcm.edu	37	2	179407205	179407205	+	Silent	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr2:179407205C>T	ENST00000591111.1	-	299	92579	c.92355G>A	c.(92353-92355)ttG>ttA	p.L30785L	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.L32426L|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Silent_p.L23361L|TTN_ENST00000342992.6_Silent_p.L29858L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000342175.6_Silent_p.L23553L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.L23486L|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30785	Fibronectin type-III 124. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCACCGTCCAATTCAGGTG	0.468																																					p.L32426L		Atlas-SNP	.											.	TTN	18412	.	0			c.G97278A						.						60.0	60.0	60.0					2																	179407205		1947	4143	6090	SO:0001819	synonymous_variant	7273	exon349			ACCGTCCAATTCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92355G>A	chr2.hg19:g.179407205C>T		79.0	0.0		124.0	52.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179465992	179465992	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr2:179465992A>T	ENST00000591111.1	-	237	51033	c.50809T>A	c.(50809-50811)Tat>Aat	p.Y16937N	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Splice_Site_p.Y18578N|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Splice_Site_p.Y9513N|TTN_ENST00000342992.6_Splice_Site_p.Y16010N|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Splice_Site_p.Y9705N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Splice_Site_p.Y9638N|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16937					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAAGCTTACATATCGGATCT	0.353																																					p.Y18578N		Atlas-SNP	.											.	TTN	18412	.	0			c.T55732A						.						57.0	53.0	54.0					2																	179465992		1819	4084	5903	SO:0001630	splice_region_variant	7273	exon287			GCTTACATATCGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50809+1T>A	chr2.hg19:g.179465992A>T		133.0	0.0		206.0	106.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.818	1.184896	0.21870	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.28	5.28	0.74379	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.27419	0.0673	N	0.17564	0.495	0.40822	D	0.983512	B;B;B;B	0.21606	0.058;0.058;0.058;0.058	B;B;B;B	0.20577	0.03;0.03;0.03;0.03	T	0.16482	-1.0401	8	.	.	.	.	5.9236	0.19096	0.7916:0.0:0.2084:0.0	.	9513;9638;9705;16937	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	16010;9513;9705;9638;9513	ENSP00000343764:Y16010N;ENSP00000434586:Y9513N;ENSP00000340554:Y9705N;ENSP00000352154:Y9638N	.	Y	-	1	0	TTN	179174237	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.879000	0.48522	2.118000	0.64928	0.460000	0.39030	TAT	.	.		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Missense_Mutation
DPPA4	55211	hgsc.bcm.edu	37	3	109050838	109050838	+	Silent	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr3:109050838G>A	ENST00000335658.6	-	3	273	c.219C>T	c.(217-219)ccC>ccT	p.P73P	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	73					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						TCTGAGGTCTGGGGTTGTCAG	0.443																																					p.P73P		Atlas-SNP	.											.	DPPA4	56	.	0			c.C219T						.						179.0	176.0	177.0					3																	109050838		2203	4300	6503	SO:0001819	synonymous_variant	55211	exon3			AGGTCTGGGGTTG	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.219C>T	chr3.hg19:g.109050838G>A		85.0	0.0		76.0	28.0	NM_018189	A8K4M7|Q9H9N5|Q9NVI6	Silent	SNP	ENST00000335658.6	hg19	CCDS33814.1																																																																																			.	.		0.443	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353897.1	NM_018189	
ITGB5	3693	hgsc.bcm.edu	37	3	124540273	124540273	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr3:124540273T>C	ENST00000296181.4	-	6	1125	c.829A>G	c.(829-831)Aca>Gca	p.T277A		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	277	VWFA.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		ACATCATCTGTTGTGAACACC	0.557																																					p.T277A		Atlas-SNP	.											.	ITGB5	66	.	0			c.A829G						.						156.0	123.0	134.0					3																	124540273		2203	4300	6503	SO:0001583	missense	3693	exon6			CATCTGTTGTGAA	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.829A>G	chr3.hg19:g.124540273T>C	ENSP00000296181:p.Thr277Ala	75.0	0.0		71.0	42.0	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	hg19	CCDS3030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.11|19.11	3.762991|3.762991	0.69763|0.69763	.|.	.|.	ENSG00000082781|ENSG00000082781	ENST00000496703|ENST00000296181	.|D	.|0.99369	.|-5.78	5.52|5.52	3.0|3.0	0.34707|0.34707	.|Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	.|0.111989	.|0.64402	.|D	.|0.000010	D|D	0.99074|0.99074	0.9682|0.9682	M|M	0.93594|0.93594	3.435|3.435	0.80722|0.80722	D|D	1|1	.|P	.|0.51653	.|0.947	.|P	.|0.49752	.|0.621	D|D	0.98971|0.98971	1.0801|1.0801	5|10	.|0.87932	.|D	.|0	.|.	8.5722|8.5722	0.33576|0.33576	0.1245:0.0695:0.0:0.806|0.1245:0.0695:0.0:0.806	.|.	.|277	.|P18084	.|ITB5_HUMAN	S|A	73|277	.|ENSP00000296181:T277A	.|ENSP00000296181:T277A	N|T	-|-	2|1	0|0	ITGB5|ITGB5	126022963|126022963	1.000000|1.000000	0.71417|0.71417	0.021000|0.021000	0.16686|0.16686	0.793000|0.793000	0.44817|0.44817	6.073000|6.073000	0.71245|0.71245	1.107000|1.107000	0.41642|0.41642	0.460000|0.460000	0.39030|0.39030	AAC|ACA	.	.		0.557	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
ATP8A1	10396	hgsc.bcm.edu	37	4	42576682	42576682	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:42576682T>A	ENST00000381668.5	-	14	1480	c.1249A>T	c.(1249-1251)Aat>Tat	p.N417Y	ATP8A1_ENST00000264449.10_Missense_Mutation_p.N417Y	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	417					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TGCATTACATTGCATGTCAGA	0.308																																					p.N417Y		Atlas-SNP	.											.	ATP8A1	206	.	0			c.A1249T						.						60.0	61.0	61.0					4																	42576682		2203	4299	6502	SO:0001583	missense	10396	exon14			TTACATTGCATGT	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1249A>T	chr4.hg19:g.42576682T>A	ENSP00000371084:p.Asn417Tyr	212.0	0.0		161.0	102.0	NM_001105529	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	hg19	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.542847	0.86022	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.91631	-2.88;-2.88	5.53	5.53	0.82687	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.97776	0.9270	H	0.98682	4.3	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.97110	0.979;1.0;1.0	D	0.99453	1.0941	10	0.87932	D	0	.	15.6709	0.77274	0.0:0.0:0.0:1.0	.	417;417;417	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	Y	417	ENSP00000371084:N417Y;ENSP00000264449:N417Y	ENSP00000264449:N417Y	N	-	1	0	ATP8A1	42271439	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.972000	0.88022	2.099000	0.63709	0.482000	0.46254	AAT	.	.		0.308	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
FGF5	2250	hgsc.bcm.edu	37	4	81188186	81188186	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:81188186C>A	ENST00000312465.7	+	1	434	c.208C>A	c.(208-210)Caa>Aaa	p.Q70K	FGF5_ENST00000456523.3_Missense_Mutation_p.Q70K	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	70					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						TCTGGGCAGCCAAGGAAGTGG	0.612																																					p.Q70K		Atlas-SNP	.											.	FGF5	49	.	0			c.C208A						.						61.0	66.0	65.0					4																	81188186		2203	4300	6503	SO:0001583	missense	2250	exon1			GGCAGCCAAGGAA	M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.208C>A	chr4.hg19:g.81188186C>A	ENSP00000311697:p.Gln70Lys	180.0	0.0		145.0	12.0	NM_004464	B2R554|O75846|Q3Y8M3|Q8NF90	Missense_Mutation	SNP	ENST00000312465.7	hg19	CCDS34021.1	.	.	.	.	.	.	.	.	.	.	C	4.126	0.021564	0.08006	.	.	ENSG00000138675	ENST00000312465;ENST00000456523	T;T	0.07114	3.22;3.22	5.41	4.51	0.55191	.	6.705490	0.00166	N	0.000003	T	0.06142	0.0159	N	0.17082	0.46	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.46303	-0.9201	10	0.05959	T	0.93	.	8.2031	0.31436	0.1648:0.6244:0.2108:0.0	.	70;70	P12034-2;P12034	.;FGF5_HUMAN	K	70	ENSP00000311697:Q70K;ENSP00000398353:Q70K	ENSP00000311697:Q70K	Q	+	1	0	FGF5	81407210	0.000000	0.05858	0.117000	0.21633	0.757000	0.42996	0.237000	0.17985	2.816000	0.96949	0.561000	0.74099	CAA	.	.		0.612	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252627.2		
THAP9	79725	hgsc.bcm.edu	37	4	83829016	83829016	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:83829016A>C	ENST00000302236.5	+	4	710	c.659A>C	c.(658-660)tAc>tCc	p.Y220S	LIN54_ENST00000505905.1_5'Flank	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	220					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				TGTACACTCTACTTGTGCAGT	0.299																																					p.Y220S		Atlas-SNP	.											.	THAP9	65	.	0			c.A659C						.						86.0	92.0	90.0					4																	83829016		2203	4298	6501	SO:0001583	missense	79725	exon4			CACTCTACTTGTG	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.659A>C	chr4.hg19:g.83829016A>C	ENSP00000305533:p.Tyr220Ser	329.0	0.0		242.0	131.0	NM_024672	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	hg19	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.497672	0.44455	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	T	0.38077	1.16	3.71	3.71	0.42584	.	0.481828	0.15578	N	0.255065	T	0.43523	0.1251	L	0.43152	1.355	0.28441	N	0.916816	D	0.65815	0.995	P	0.57911	0.829	T	0.18461	-1.0336	10	0.30078	T	0.28	-12.0798	11.0757	0.48030	1.0:0.0:0.0:0.0	.	220	Q9H5L6	THAP9_HUMAN	S	220	ENSP00000305533:Y220S	ENSP00000305533:Y220S	Y	+	2	0	THAP9	84048040	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.164000	0.64954	1.915000	0.55452	0.533000	0.62120	TAC	.	.		0.299	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
MRPS18C	51023	hgsc.bcm.edu	37	4	84382321	84382321	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:84382321A>G	ENST00000295491.4	+	6	513	c.400A>G	c.(400-402)Aaa>Gaa	p.K134E	FAM175A_ENST00000321945.7_3'UTR|MRPS18C_ENST00000507019.1_Missense_Mutation_p.K106E|MRPS18C_ENST00000507349.1_3'UTR	NM_016067.2	NP_057151.1	Q9Y3D5	RT18C_HUMAN	mitochondrial ribosomal protein S18C	134					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5		Hepatocellular(203;0.114)				CAAGGACCCTAAAGTTTGTAA	0.338																																					p.K134E		Atlas-SNP	.											.	MRPS18C	11	.	0			c.A400G						.						100.0	101.0	100.0					4																	84382321		2203	4299	6502	SO:0001583	missense	51023	exon6			GACCCTAAAGTTT		CCDS3604.1, CCDS75159.1	4q21.21-q21.23	2012-09-13			ENSG00000163319	ENSG00000163319		"""Mitochondrial ribosomal proteins / small subunits"""	16633	protein-coding gene	gene with protein product		611983				11279123, 10810093	Standard	XM_005263043		Approved	MRPS18-1, CGI-134, FLJ11146, FLJ22967	uc003hor.4	Q9Y3D5	OTTHUMG00000130430	ENST00000295491.4:c.400A>G	chr4.hg19:g.84382321A>G	ENSP00000295491:p.Lys134Glu	85.0	0.0		85.0	27.0	NM_016067		Missense_Mutation	SNP	ENST00000295491.4	hg19	CCDS3604.1	.	.	.	.	.	.	.	.	.	.	A	19.75	3.886374	0.72410	.	.	ENSG00000163319	ENST00000295491;ENST00000507019	.	.	.	5.03	5.03	0.67393	.	0.158699	0.56097	D	0.000039	T	0.55497	0.1924	M	0.71036	2.16	0.80722	D	1	P	0.42871	0.792	B	0.35182	0.197	T	0.65352	-0.6189	9	0.72032	D	0.01	-8.2836	14.9268	0.70884	1.0:0.0:0.0:0.0	.	134	Q9Y3D5	RT18C_HUMAN	E	134;106	.	ENSP00000295491:K134E	K	+	1	0	MRPS18C	84601345	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.648000	0.83479	2.108000	0.64289	0.482000	0.46254	AAA	.	.		0.338	MRPS18C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252820.2		
KIAA1109	84162	hgsc.bcm.edu	37	4	123184690	123184690	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:123184690G>A	ENST00000264501.4	+	44	7449	c.7076G>A	c.(7075-7077)gGt>gAt	p.G2359D	KIAA1109_ENST00000455637.1_Missense_Mutation_p.G2359D|KIAA1109_ENST00000388738.3_Missense_Mutation_p.G2359D			Q2LD37	K1109_HUMAN	KIAA1109	2359					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AATGCTGTGGGTAATCGAGGA	0.378																																					p.G2359D		Atlas-SNP	.											.	KIAA1109	424	.	0			c.G7076A						.						145.0	132.0	136.0					4																	123184690		1898	4112	6010	SO:0001583	missense	84162	exon42			CTGTGGGTAATCG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.7076G>A	chr4.hg19:g.123184690G>A	ENSP00000264501:p.Gly2359Asp	135.0	0.0		113.0	36.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.111431|5.111431	0.94339|0.94339	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	T;T;T|.	0.24151|.	2.47;2.47;1.87|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.000000|.	0.48767|.	U|.	0.000163|.	T|T	0.54775|0.54775	0.1879|0.1879	N|N	0.19112|0.19112	0.55|0.55	0.58432|0.58432	D|D	0.999995|0.999995	P;D;P|.	0.89917|.	0.846;1.0;0.761|.	P;D;B|.	0.91635|.	0.461;0.999;0.338|.	T|T	0.48692|0.48692	-0.9013|-0.9013	10|5	0.34782|.	T|.	0.22|.	.|.	19.59|19.59	0.95506|0.95506	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2359;2358;2359|.	Q2LD37-6;Q2LD37-2;Q2LD37|.	.;.;K1109_HUMAN|.	D|I	2359|932	ENSP00000264501:G2359D;ENSP00000373390:G2359D;ENSP00000389925:G2359D|.	ENSP00000264501:G2359D|.	G|V	+|+	2|1	0|0	KIAA1109|KIAA1109	123404140|123404140	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.787000|9.787000	0.99055|0.99055	2.639000|2.639000	0.89480|0.89480	0.655000|0.655000	0.94253|0.94253	GGT|GTA	.	.		0.378	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
UCP1	7350	hgsc.bcm.edu	37	4	141481162	141481162	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:141481162A>T	ENST00000262999.3	-	6	887	c.812T>A	c.(811-813)tTg>tAg	p.L271*		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	271					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					GGAAGGTACCAACCTAGAAAA	0.413																																					p.L271X		Atlas-SNP	.											.	UCP1	33	.	0			c.T812A						.						150.0	118.0	129.0					4																	141481162		2203	4300	6503	SO:0001587	stop_gained	7350	exon6			GGTACCAACCTAG	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.812T>A	chr4.hg19:g.141481162A>T	ENSP00000262999:p.Leu271*	63.0	0.0		47.0	15.0	NM_021833	Q13218|Q4KMZ3|Q68G66	Nonsense_Mutation	SNP	ENST00000262999.3	hg19	CCDS3753.1	.	.	.	.	.	.	.	.	.	.	A	32	5.146499	0.94603	.	.	ENSG00000109424	ENST00000262999	.	.	.	5.06	3.79	0.43588	.	0.294817	0.37857	N	0.001916	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	9.9714	0.41757	0.83:0.17:0.0:0.0	.	.	.	.	X	271	.	ENSP00000262999:L271X	L	-	2	0	UCP1	141700612	1.000000	0.71417	0.049000	0.19019	0.514000	0.34195	6.823000	0.75282	2.032000	0.59987	0.482000	0.46254	TTG	.	.		0.413	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		
AGA	175	hgsc.bcm.edu	37	4	178358643	178358643	+	Missense_Mutation	SNP	C	C	T	rs373865451		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr4:178358643C>T	ENST00000264595.2	-	5	665	c.538G>A	c.(538-540)Gga>Aga	p.G180R	AGA_ENST00000506853.1_5'UTR	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	180					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)			endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		TTGTAGGGTCCGCAGTATTTT	0.338																																					p.G180R		Atlas-SNP	.											.	AGA	39	.	0			c.G538A						.	C	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	129.0	128.0	128.0		538,538	5.5	1.0	4		128	0,8600		0,0,4300	no	missense,missense	AGA	NM_000027.3,NM_001171988.1	125,125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	180/347,180/337	178358643	1,13005	2203	4300	6503	SO:0001583	missense	175	exon5			AGGGTCCGCAGTA	X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.538G>A	chr4.hg19:g.178358643C>T	ENSP00000264595:p.Gly180Arg	153.0	0.0		122.0	33.0	NM_000027	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Missense_Mutation	SNP	ENST00000264595.2	hg19	CCDS3829.1	.	.	.	.	.	.	.	.	.	.	C	32	5.161932	0.94727	2.27E-4	0.0	ENSG00000038002	ENST00000264595;ENST00000502310	D;D	0.87103	-2.21;-2.21	5.53	5.53	0.82687	.	0.048090	0.85682	D	0.000000	D	0.94781	0.8315	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94963	0.8110	10	0.66056	D	0.02	-25.1685	19.4321	0.94775	0.0:1.0:0.0:0.0	.	180	P20933	ASPG_HUMAN	R	180;65	ENSP00000264595:G180R;ENSP00000423798:G65R	ENSP00000264595:G180R	G	-	1	0	AGA	178595637	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.108000	0.77055	2.770000	0.95276	0.655000	0.94253	GGA	.	.		0.338	AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027	
RICTOR	253260	hgsc.bcm.edu	37	5	38978734	38978734	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:38978734T>A	ENST00000357387.3	-	9	802	c.772A>T	c.(772-774)Act>Tct	p.T258S	RICTOR_ENST00000296782.5_Missense_Mutation_p.T258S	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TGAAAATCAGTATAGGGTGCT	0.294																																					p.T258S		Atlas-SNP	.											.	RICTOR	182	.	0			c.A772T						.						53.0	57.0	55.0					5																	38978734		2203	4296	6499	SO:0001583	missense	253260	exon9			AATCAGTATAGGG		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.772A>T	chr5.hg19:g.38978734T>A	ENSP00000349959:p.Thr258Ser	27.0	0.0		46.0	19.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	hg19	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.854145	0.91355	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.54866	0.55;0.56	5.69	5.69	0.88448	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	M	0.63843	1.955	0.80722	D	1	D;P;D	0.76494	0.999;0.918;0.996	D;P;D	0.83275	0.996;0.65;0.98	T	0.73493	-0.3965	10	0.87932	D	0	-18.9658	15.6101	0.76710	0.0:0.0:0.0:1.0	.	258;258;258	E7ETT0;Q6R327;Q6R327-3	.;RICTR_HUMAN;.	S	258	ENSP00000349959:T258S;ENSP00000296782:T258S	ENSP00000296782:T258S	T	-	1	0	RICTOR	39014491	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.439000	0.80444	2.171000	0.68590	0.377000	0.23210	ACT	.	.		0.294	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
MAN2A1	4124	hgsc.bcm.edu	37	5	109181594	109181594	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:109181594T>G	ENST00000261483.4	+	18	3781	c.2729T>G	c.(2728-2730)tTg>tGg	p.L910W		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	910					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		CTGAGCAAATTGCCTCTTCAA	0.388																																					p.L910W		Atlas-SNP	.											.	MAN2A1	136	.	0			c.T2729G						.						197.0	184.0	189.0					5																	109181594		2202	4300	6502	SO:0001583	missense	4124	exon18			GCAAATTGCCTCT		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.2729T>G	chr5.hg19:g.109181594T>G	ENSP00000261483:p.Leu910Trp	69.0	0.0		66.0	18.0	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	hg19	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.668825	0.88348	.	.	ENSG00000112893	ENST00000261483	T	0.79033	-1.23	5.33	5.33	0.75918	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.64402	D	0.000001	D	0.90335	0.6976	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92550	0.6049	10	0.87932	D	0	-16.048	15.5882	0.76502	0.0:0.0:0.0:1.0	.	910	Q16706	MA2A1_HUMAN	W	910	ENSP00000261483:L910W	ENSP00000261483:L910W	L	+	2	0	MAN2A1	109209493	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.301000	0.78850	2.144000	0.66660	0.533000	0.62120	TTG	.	.		0.388	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
WDR36	134430	hgsc.bcm.edu	37	5	110462533	110462533	+	Missense_Mutation	SNP	C	C	A	rs79307023		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:110462533C>A	ENST00000513710.2	+	23	2812	c.2808C>A	c.(2806-2808)ttC>ttA	p.F936L	WDR36_ENST00000506538.2_Missense_Mutation_p.F936L			Q8NI36	WDR36_HUMAN	WD repeat domain 36	936					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AATCACTCTTCAATCAAAGCA	0.323																																					p.F936L		Atlas-SNP	.											WDR36,bladder,carcinoma,0,1	WDR36	111	.	0			c.C2808A						.						59.0	62.0	61.0					5																	110462533		2202	4300	6502	SO:0001583	missense	134430	exon23			ACTCTTCAATCAA	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2808C>A	chr5.hg19:g.110462533C>A	ENSP00000424628:p.Phe936Leu	457.0	0.0		398.0	107.0	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	hg19	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	C	8.606	0.888102	0.17540	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.74632	-0.86;-0.86	5.93	3.22	0.36961	Small-subunit processome, Utp21 (1);	0.043594	0.85682	D	0.000000	T	0.60117	0.2244	N	0.21282	0.65	0.80722	D	1	B	0.26445	0.149	B	0.28709	0.093	T	0.56306	-0.8001	10	0.87932	D	0	-14.6538	9.1618	0.37028	0.0:0.726:0.0:0.274	.	936	Q8NI36	WDR36_HUMAN	L	936	ENSP00000423067:F936L;ENSP00000424628:F936L	ENSP00000423067:F936L	F	+	3	2	WDR36	110490432	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.403000	0.34612	0.416000	0.25844	-0.225000	0.12378	TTC	.	C|1.000;T|0.000		0.323	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
TMEM173	340061	hgsc.bcm.edu	37	5	138857039	138857039	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:138857039T>C	ENST00000330794.4	-	7	1154	c.821A>G	c.(820-822)tAc>tGc	p.Y274C	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	274	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGCTTGACTGTATTGTGACAT	0.567																																					p.Y274C		Atlas-SNP	.											.	TMEM173	19	.	0			c.A821G						.						87.0	85.0	86.0					5																	138857039		2203	4300	6503	SO:0001583	missense	340061	exon7			TGACTGTATTGTG		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.821A>G	chr5.hg19:g.138857039T>C	ENSP00000331288:p.Tyr274Cys	90.0	0.0		71.0	18.0	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	hg19	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	T	10.52	1.371832	0.24857	.	.	ENSG00000184584	ENST00000330794	T	0.22134	1.97	5.6	4.43	0.53597	.	0.319937	0.32987	N	0.005401	T	0.15305	0.0369	N	0.22421	0.69	0.20926	N	0.999824	P	0.47409	0.895	B	0.44163	0.443	T	0.07501	-1.0769	10	0.54805	T	0.06	-6.4461	7.4088	0.27006	0.0:0.0731:0.1431:0.7838	.	274	Q86WV6	TM173_HUMAN	C	274	ENSP00000331288:Y274C	ENSP00000331288:Y274C	Y	-	2	0	TMEM173	138837223	0.998000	0.40836	0.571000	0.28486	0.015000	0.08874	3.523000	0.53488	0.970000	0.38263	-0.361000	0.07541	TAC	.	.		0.567	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
ARHGAP26	23092	hgsc.bcm.edu	37	5	142253059	142253059	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:142253059A>T	ENST00000274498.4	+	2	627	c.249A>T	c.(247-249)atA>atT	p.I83I	ARHGAP26_ENST00000378004.3_Splice_Site_p.I83I	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	83					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGATGTGTATAGGTAAGTCAT	0.393																																					p.I83I		Atlas-SNP	.											.	ARHGAP26	57	.	0			c.A249T						.						63.0	63.0	63.0					5																	142253059		2203	4300	6503	SO:0001630	splice_region_variant	23092	exon2			GTGTATAGGTAAG	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.250+1A>T	chr5.hg19:g.142253059A>T		54.0	0.0		45.0	17.0	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Silent	SNP	ENST00000274498.4	hg19	CCDS4277.1																																																																																			.	.		0.393	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	Silent
DOCK2	1794	hgsc.bcm.edu	37	5	169505977	169505977	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:169505977A>G	ENST00000256935.8	+	49	5074		c.e49-1		DOCK2_ENST00000540750.1_Splice_Site|DOCK2_ENST00000520908.1_Splice_Site|DOCK2_ENST00000523351.1_Splice_Site	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGCCTTTCAGCTTTGACCT	0.582																																					.		Atlas-SNP	.											.	DOCK2	389	.	0			c.4995-2A>G						.						93.0	101.0	98.0					5																	169505977		2203	4300	6503	SO:0001630	splice_region_variant	1794	exon49			CCTTTCAGCTTTG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4995-1A>G	chr5.hg19:g.169505977A>G		73.0	0.0		60.0	11.0	NM_004946	Q2M3I0|Q96AK7	Splice_Site	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.104891	0.37145	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	.	.	.	4.92	3.74	0.42951	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2343	0.48931	0.8462:0.1538:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK2	169438555	1.000000	0.71417	0.931000	0.37212	0.512000	0.34134	4.609000	0.61148	0.819000	0.34492	0.529000	0.55759	.	.	.		0.582	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	Intron
RANBP17	64901	hgsc.bcm.edu	37	5	170720952	170720952	+	Silent	SNP	G	G	A	rs374592064		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:170720952G>A	ENST00000523189.1	+	26	3173	c.3009G>A	c.(3007-3009)agG>agA	p.R1003R	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1003					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGTATCCAGGCCTCTCCTGG	0.493			T	TRD@	ALL																																p.R1003R		Atlas-SNP	.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	108	.	0			c.G3009A						.						190.0	184.0	186.0					5																	170720952		2203	4300	6503	SO:0001819	synonymous_variant	64901	exon26			ATCCAGGCCTCTC	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.3009G>A	chr5.hg19:g.170720952G>A		90.0	0.0		65.0	17.0	NM_022897	Q8IU74	Silent	SNP	ENST00000523189.1	hg19	CCDS34287.1																																																																																			.	.		0.493	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
ZKSCAN8	7745	hgsc.bcm.edu	37	6	28117277	28117277	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr6:28117277A>G	ENST00000330236.6	+	3	618	c.434A>G	c.(433-435)cAt>cGt	p.H145R	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.H145R	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	145					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCTCGCGTACATGGACATAGG	0.458																																					p.H145R		Atlas-SNP	.											.	.	.	.	0			c.A434G						.						162.0	147.0	152.0					6																	28117277		2203	4300	6503	SO:0001583	missense	7745	exon3			GCGTACATGGACA		CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.434A>G	chr6.hg19:g.28117277A>G	ENSP00000332750:p.His145Arg	108.0	0.0		114.0	50.0	NM_006298	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	ENST00000330236.6	hg19	CCDS4645.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.426|2.426	-0.331918|-0.331918	0.05314|0.05314	.|.	.|.	ENSG00000198315|ENSG00000198315	ENST00000330236;ENST00000457389|ENST00000536028	T;T|T	0.05925|0.03152	3.37;3.37|4.03	4.68|4.68	-0.504|-0.504	0.11997|0.11997	Transcription regulator SCAN (1);|.	0.000000|.	0.51477|.	D|.	0.000090|.	T|T	0.00784|0.00784	0.0026|0.0026	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.47315|0.47315	-0.9127|-0.9127	10|7	0.41790|0.41790	T|T	0.15|0.15	.|.	4.1552|4.1552	0.10258|0.10258	0.5935:0.0:0.2602:0.1463|0.5935:0.0:0.2602:0.1463	.|.	145|.	Q15776|.	ZN192_HUMAN|.	R|V	145|150	ENSP00000332750:H145R;ENSP00000402948:H145R|ENSP00000439117:M150V	ENSP00000332750:H145R|ENSP00000439117:M150V	H|M	+|+	2|1	0|0	ZNF192|ZNF192	28225256|28225256	0.184000|0.184000	0.23200|0.23200	0.194000|0.194000	0.23346|0.23346	0.340000|0.340000	0.28889|0.28889	-0.098000|-0.098000	0.11024|0.11024	0.026000|0.026000	0.15269|0.15269	-0.400000|-0.400000	0.06385|0.06385	CAT|ATG	.	.		0.458	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2		
IP6K3	117283	hgsc.bcm.edu	37	6	33690512	33690512	+	Silent	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr6:33690512G>A	ENST00000293756.4	-	6	1544	c.1218C>T	c.(1216-1218)atC>atT	p.I406I	IP6K3_ENST00000451316.1_Silent_p.I406I	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	406					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						CTCCCTCTTGGATATCCTGCA	0.488																																					p.I406I		Atlas-SNP	.											.	IP6K3	52	.	0			c.C1218T						.						95.0	103.0	100.0					6																	33690512		2203	4300	6503	SO:0001819	synonymous_variant	117283	exon7			CTCTTGGATATCC	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.1218C>T	chr6.hg19:g.33690512G>A		115.0	0.0		130.0	26.0	NM_001142883	Q96MQ9	Silent	SNP	ENST00000293756.4	hg19	CCDS34435.1																																																																																			.	.		0.488	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
EEF1A1	1915	hgsc.bcm.edu	37	6	74228551	74228551	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr6:74228551C>G	ENST00000316292.9	-	4	1633	c.642G>C	c.(640-642)tgG>tgC	p.W214C	EEF1A1_ENST00000309268.6_Missense_Mutation_p.W214C|EEF1A1_ENST00000331523.2_Missense_Mutation_p.W214C|EEF1A1_ENST00000491404.1_Intron	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	214	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GGGTGACTTTCCATCCCTTGA	0.502											OREG0003891|OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=EEF1A1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.W214C		Atlas-SNP	.											.	EEF1A1	56	.	0			c.G642C						.						91.0	84.0	86.0					6																	74228551		2203	4300	6503	SO:0001583	missense	1915	exon5			GACTTTCCATCCC	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.642G>C	chr6.hg19:g.74228551C>G	ENSP00000339063:p.Trp214Cys	86.0	0.0	1151	80.0	25.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727703	0.69074	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.47177	0.85;0.85;0.85	4.31	4.31	0.51392	Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	U	0.000000	T	0.61311	0.2337	M	0.67625	2.065	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67715	-0.5599	10	0.87932	D	0	.	17.2248	0.86966	0.0:1.0:0.0:0.0	.	214;214;214;214	P68104;Q53HR5;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;.;EF1A3_HUMAN	C	214;214;214;214;193	ENSP00000339063:W214C;ENSP00000339053:W214C;ENSP00000330054:W214C	ENSP00000339053:W214C	W	-	3	0	EEF1A1	74285272	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.442000	0.80503	2.115000	0.64714	0.549000	0.68633	TGG	.	.		0.502	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
HBS1L	10767	hgsc.bcm.edu	37	6	135358397	135358397	+	Intron	SNP	G	G	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr6:135358397G>C	ENST00000367837.5	-	4	637				HBS1L_ENST00000314674.3_Intron|HBS1L_ENST00000415177.2_Intron|HBS1L_ENST00000367820.2_Intron|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000367824.4_Intron|HBS1L_ENST00000367822.5_Missense_Mutation_p.Q400E|HBS1L_ENST00000367826.2_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		GCAGATGACTGGTTACAAAGG	0.413																																					p.Q400E		Atlas-SNP	.											.	HBS1L	75	.	0			c.C1198G						.						137.0	113.0	120.0					6																	135358397		692	1591	2283	SO:0001627	intron_variant	10767	exon5			ATGACTGGTTACA	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.430+2313C>G	chr6.hg19:g.135358397G>C		89.0	0.0		79.0	23.0	NM_001145207	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	hg19	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686466	0.47991	.	.	ENSG00000112339	ENST00000367822	.	.	.	5.53	4.65	0.58169	.	.	.	.	.	T	0.37999	0.1024	.	.	.	0.80722	D	1	B	0.18166	0.026	B	0.16289	0.015	T	0.46162	-0.9211	7	0.72032	D	0.01	.	10.0568	0.42250	0.0717:0.1388:0.7895:0.0	.	400	Q9Y450-2	.	E	400	.	ENSP00000356796:Q400E	Q	-	1	0	HBS1L	135400090	1.000000	0.71417	0.479000	0.27329	0.871000	0.50021	1.940000	0.40223	1.445000	0.47624	0.655000	0.94253	CAG	.	.		0.413	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2		
MAP3K4	4216	hgsc.bcm.edu	37	6	161470546	161470546	+	Silent	SNP	G	G	A	rs529204751		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr6:161470546G>A	ENST00000392142.4	+	3	1390	c.1242G>A	c.(1240-1242)ttG>ttA	p.L414L	MAP3K4_ENST00000366919.2_Silent_p.L414L|MAP3K4_ENST00000348824.7_Silent_p.L414L|MAP3K4_ENST00000366920.2_Silent_p.L414L	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	414					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GCACTGTTTTGGGCATCAAGA	0.448																																					p.L414L		Atlas-SNP	.											.	MAP3K4	364	.	0			c.G1242A						.						76.0	79.0	78.0					6																	161470546		2203	4300	6503	SO:0001819	synonymous_variant	4216	exon3			TGTTTTGGGCATC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1242G>A	chr6.hg19:g.161470546G>A		93.0	0.0		90.0	24.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	ENST00000392142.4	hg19	CCDS34565.1																																																																																			.	.		0.448	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
MAP3K4	4216	hgsc.bcm.edu	37	6	161523752	161523752	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr6:161523752A>T	ENST00000392142.4	+	19	3945	c.3797A>T	c.(3796-3798)gAt>gTt	p.D1266V	MAP3K4_ENST00000366919.2_Missense_Mutation_p.D1216V|MAP3K4_ENST00000348824.7_Missense_Mutation_p.D1212V|MAP3K4_ENST00000366920.2_Missense_Mutation_p.D1262V	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1266					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CCAAGAGGAGATTCAAGTGGG	0.328																																					p.D1266V		Atlas-SNP	.											.	MAP3K4	364	.	0			c.A3797T						.						43.0	43.0	43.0					6																	161523752		2203	4300	6503	SO:0001583	missense	4216	exon19			GAGGAGATTCAAG	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3797A>T	chr6.hg19:g.161523752A>T	ENSP00000375986:p.Asp1266Val	472.0	0.0		408.0	246.0	NM_005922	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.645768	0.87958	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.72051	-0.57;-0.62;-0.61;-0.59	5.31	5.31	0.75309	.	0.068133	0.56097	D	0.000029	T	0.58779	0.2146	N	0.24115	0.695	0.80722	D	1	P;D;P;P	0.63880	0.835;0.993;0.928;0.947	P;P;P;P	0.52758	0.549;0.708;0.626;0.599	T	0.64668	-0.6353	10	0.46703	T	0.11	-35.5538	15.2821	0.73794	1.0:0.0:0.0:0.0	.	1262;202;1216;1266	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	V	1216;1266;1216;1262;1212	ENSP00000355886:D1216V;ENSP00000375986:D1266V;ENSP00000355887:D1262V;ENSP00000297332:D1212V	ENSP00000297332:D1212V	D	+	2	0	MAP3K4	161443742	1.000000	0.71417	0.977000	0.42913	0.960000	0.62799	8.317000	0.89987	2.013000	0.59113	0.533000	0.62120	GAT	.	.		0.328	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
MAGI2	9863	hgsc.bcm.edu	37	7	77973184	77973184	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr7:77973184A>C	ENST00000354212.4	-	9	1572	c.1319T>G	c.(1318-1320)aTc>aGc	p.I440S	MAGI2_ENST00000535697.1_Missense_Mutation_p.I277S|MAGI2_ENST00000419488.1_Missense_Mutation_p.I440S|MAGI2_ENST00000522391.1_Missense_Mutation_p.I440S|MAGI2_ENST00000536571.1_Missense_Mutation_p.I272S	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	440	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCCACCAATGATGGTAAATCC	0.478																																					p.I440S		Atlas-SNP	.											.	MAGI2	246	.	0			c.T1319G						.						121.0	105.0	110.0					7																	77973184		2203	4300	6503	SO:0001583	missense	9863	exon9			CCAATGATGGTAA	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1319T>G	chr7.hg19:g.77973184A>C	ENSP00000346151:p.Ile440Ser	185.0	0.0		229.0	48.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	hg19	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.582002	0.86748	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	5.81	5.81	0.92471	PDZ/DHR/GLGF (4);	0.000000	0.37095	U	0.002250	T	0.81898	0.4920	H	0.97051	3.93	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0;0.999	D	0.88026	0.2772	10	0.87932	D	0	.	15.3584	0.74448	1.0:0.0:0.0:0.0	.	277;272;440;440;440;440	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	S	440;440;440;440;272;277	ENSP00000405766:I440S;ENSP00000346151:I440S;ENSP00000428389:I440S;ENSP00000441584:I272S;ENSP00000441603:I277S	ENSP00000346151:I440S	I	-	2	0	MAGI2	77811120	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.217000	0.71921	0.482000	0.46254	ATC	.	.		0.478	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
NYAP1	222950	hgsc.bcm.edu	37	7	100088252	100088252	+	Silent	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr7:100088252A>G	ENST00000300179.2	+	5	2217	c.2058A>G	c.(2056-2058)gcA>gcG	p.A686A	NYAP1_ENST00000454988.1_Silent_p.A630A|NYAP1_ENST00000496985.1_3'UTR|NYAP1_ENST00000423930.1_Silent_p.A687A	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	686					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCCAGGGGGCAGAGGGACTGC	0.692																																					p.A686A		Atlas-SNP	.											.	.	.	.	0			c.A2058G						.						35.0	27.0	30.0					7																	100088252		2179	4279	6458	SO:0001819	synonymous_variant	222950	exon5			GGGGGCAGAGGGA	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.2058A>G	chr7.hg19:g.100088252A>G		203.0	0.0		223.0	100.0	NM_173564	Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	hg19	CCDS5696.1																																																																																			.	.		0.692	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
C7orf66	154907	hgsc.bcm.edu	37	7	108524539	108524539	+	Silent	SNP	A	A	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr7:108524539A>C	ENST00000379007.2	-	1	105	c.51T>G	c.(49-51)ccT>ccG	p.P17P		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	17						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						GAGTGAGATGAGGTACAGAGA	0.388																																					p.P17P		Atlas-SNP	.											.	C7orf66	29	.	0			c.T51G						.						153.0	127.0	136.0					7																	108524539		2203	4300	6503	SO:0001819	synonymous_variant	154907	exon1			GAGATGAGGTACA	AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.51T>G	chr7.hg19:g.108524539A>C		123.0	0.0		133.0	49.0	NM_001024607		Silent	SNP	ENST00000379007.2	hg19	CCDS34735.1																																																																																			.	.		0.388	C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337420.1	NM_001024607	
ADAM2	2515	hgsc.bcm.edu	37	8	39645736	39645736	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr8:39645736G>A	ENST00000265708.4	-	9	780	c.677C>T	c.(676-678)tCt>tTt	p.S226F	ADAM2_ENST00000379853.2_Intron|ADAM2_ENST00000521880.1_Missense_Mutation_p.S226F|ADAM2_ENST00000347580.4_Missense_Mutation_p.S207F	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	226	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CTCCAATGAAGACAGAATAAT	0.259																																					p.S226F		Atlas-SNP	.											.	ADAM2	124	.	0			c.C677T						.						60.0	63.0	62.0					8																	39645736		2201	4288	6489	SO:0001583	missense	2515	exon9			AATGAAGACAGAA	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.677C>T	chr8.hg19:g.39645736G>A	ENSP00000265708:p.Ser226Phe	54.0	0.0		33.0	19.0	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	hg19	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090825	0.36855	.	.	ENSG00000104755	ENST00000347580;ENST00000265708;ENST00000521880	T;T;T	0.09538	2.97;2.97;2.97	4.71	4.71	0.59529	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.37320	0.0999	M	0.87381	2.88	0.35830	D	0.825248	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.994;0.99;0.996	T	0.53858	-0.8379	8	.	.	.	.	13.5268	0.61599	0.0:0.0:1.0:0.0	.	226;207;226	B4DWY7;Q99965-2;Q99965	.;.;ADAM2_HUMAN	F	207;226;226	ENSP00000343854:S207F;ENSP00000265708:S226F;ENSP00000429352:S226F	.	S	-	2	0	ADAM2	39764893	1.000000	0.71417	0.966000	0.40874	0.017000	0.09413	5.479000	0.66813	2.332000	0.79248	0.460000	0.39030	TCT	.	.		0.259	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
TRPS1	7227	hgsc.bcm.edu	37	8	116616870	116616870	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr8:116616870C>A	ENST00000220888.5	-	3	1446	c.1287G>T	c.(1285-1287)gaG>gaT	p.E429D	TRPS1_ENST00000395715.3_Missense_Mutation_p.E442D|TRPS1_ENST00000519674.1_Missense_Mutation_p.E429D|TRPS1_ENST00000520276.1_Missense_Mutation_p.E433D|TRPS1_ENST00000519076.1_Intron			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	429					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AACTGGTGGCCTCTGTACCAT	0.463									Langer-Giedion syndrome																												p.E442D		Atlas-SNP	.											.	TRPS1	516	.	0			c.G1326T						.						69.0	68.0	68.0					8																	116616870		1897	4124	6021	SO:0001583	missense	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	GGTGGCCTCTGTA	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1287G>T	chr8.hg19:g.116616870C>A	ENSP00000220888:p.Glu429Asp	85.0	0.0		65.0	21.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	C	3.978	-0.007091	0.07773	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	5.69	3.73	0.42828	.	0.248028	0.39544	N	0.001326	T	0.51193	0.1660	N	0.02539	-0.55	0.31363	N	0.681095	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.47598	-0.9105	10	0.08179	T	0.78	.	7.0789	0.25219	0.5079:0.3973:0.0:0.0948	.	433;429;442	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	D	442;429;433;429	ENSP00000379065:E442D;ENSP00000220888:E429D;ENSP00000428680:E433D;ENSP00000429174:E429D	ENSP00000220888:E429D	E	-	3	2	TRPS1	116686045	0.989000	0.36119	1.000000	0.80357	0.996000	0.88848	0.336000	0.19823	0.798000	0.33994	0.655000	0.94253	GAG	.	.		0.463	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
CER1	9350	hgsc.bcm.edu	37	9	14722569	14722569	+	Silent	SNP	G	G	C	rs376786967		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr9:14722569G>C	ENST00000380911.3	-	1	146	c.102C>G	c.(100-102)ctC>ctG	p.L34L		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	34					anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		TCCTTGGCAGGAGTACGGGGG	0.547																																					p.L34L		Atlas-SNP	.											.	CER1	41	.	0			c.C102G						.						111.0	111.0	111.0					9																	14722569		2203	4300	6503	SO:0001819	synonymous_variant	9350	exon1			TGGCAGGAGTACG	AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.102C>G	chr9.hg19:g.14722569G>C		48.0	0.0		45.0	18.0	NM_005454	Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Silent	SNP	ENST00000380911.3	hg19	CCDS6476.1																																																																																			.	.		0.547	CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055453.1	NM_005454	
VCP	7415	hgsc.bcm.edu	37	9	35063004	35063004	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr9:35063004T>A	ENST00000358901.6	-	7	1677	c.782A>T	c.(781-783)gAg>gTg	p.E261V		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	261					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GGCTCCAGTCTCATTTGCTAC	0.463																																					p.E261V		Atlas-SNP	.											.	VCP	64	.	0			c.A782T						.						212.0	207.0	208.0					9																	35063004		2203	4300	6503	SO:0001583	missense	7415	exon7			CCAGTCTCATTTG	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.782A>T	chr9.hg19:g.35063004T>A	ENSP00000351777:p.Glu261Val	107.0	0.0		127.0	54.0	NM_007126	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	hg19	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	T	33	5.263091	0.95399	.	.	ENSG00000165280	ENST00000358901	D	0.94417	-3.42	5.9	5.9	0.94986	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98150	1.0441	10	0.87932	D	0	-20.8164	16.3317	0.83023	0.0:0.0:0.0:1.0	.	261	P55072	TERA_HUMAN	V	261	ENSP00000351777:E261V	ENSP00000351777:E261V	E	-	2	0	VCP	35053004	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.296000	0.72751	2.264000	0.75181	0.533000	0.62120	GAG	.	.		0.463	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	
PAPPA	5069	hgsc.bcm.edu	37	9	119116067	119116067	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr9:119116067T>A	ENST00000328252.3	+	17	4711	c.4342T>A	c.(4342-4344)Tcc>Acc	p.S1448T	PAPPA_ENST00000534838.1_Missense_Mutation_p.S486T	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1448	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CAGTGATGCCTCCCAGGTAAG	0.473																																					p.S1448T		Atlas-SNP	.											.	PAPPA	243	.	0			c.T4342A						.						155.0	133.0	140.0					9																	119116067		2203	4300	6503	SO:0001583	missense	5069	exon17			GATGCCTCCCAGG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4342T>A	chr9.hg19:g.119116067T>A	ENSP00000330658:p.Ser1448Thr	82.0	0.0		77.0	18.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	hg19	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	T	8.954	0.968821	0.18659	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.62498	0.02;0.02	5.8	0.393	0.16294	Complement control module (2);Sushi/SCR/CCP (3);	0.903421	0.09681	N	0.769787	T	0.41282	0.1152	L	0.36672	1.1	0.22226	N	0.999279	B;B	0.06786	0.0;0.001	B;B	0.09377	0.001;0.004	T	0.21381	-1.0247	10	0.12103	T	0.63	-8.1269	0.2218	0.00169	0.3898:0.1687:0.2023:0.2392	.	486;1448	F5GZ19;Q13219	.;PAPP1_HUMAN	T	1448;486	ENSP00000330658:S1448T;ENSP00000441461:S486T	ENSP00000330658:S1448T	S	+	1	0	PAPPA	118155888	0.000000	0.05858	0.907000	0.35723	0.389000	0.30415	0.218000	0.17622	0.035000	0.15519	0.533000	0.62120	TCC	.	.		0.473	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
EXD3	54932	hgsc.bcm.edu	37	9	140247240	140247240	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr9:140247240T>A	ENST00000340951.4	-	11	1066		c.e11-2		EXD3_ENST00000342129.4_Splice_Site	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CACCAGGCCCTGTGAGGAGGG	0.662																																					.		Atlas-SNP	.											.	EXD3	86	.	0			c.871-2A>T						.						9.0	12.0	11.0					9																	140247240		2035	4157	6192	SO:0001630	splice_region_variant	54932	exon12			AGGCCCTGTGAGG		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.871-2A>T	chr9.hg19:g.140247240T>A		147.0	0.0		86.0	22.0	NM_017820	Q6P1M1|Q8IXT8	Splice_Site	SNP	ENST00000340951.4	hg19	CCDS48066.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.450679	0.26074	.	.	ENSG00000187609	ENST00000340951	.	.	.	3.3	2.12	0.27331	.	.	.	.	.	.	.	.	.	.	.	0.35974	D	0.835537	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7647	0.18219	0.0:0.1375:0.0:0.8625	.	.	.	.	.	-1	.	.	.	-	.	.	EXD3	139367061	0.876000	0.30132	0.040000	0.18447	0.296000	0.27459	1.908000	0.39907	0.420000	0.25954	0.402000	0.26972	.	.	.		0.662	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	Intron
CAMK2G	818	hgsc.bcm.edu	37	10	75620639	75620639	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr10:75620639T>C	ENST00000351293.3	-	3	226	c.169A>G	c.(169-171)Aaa>Gaa	p.K57E	CAMK2G_ENST00000322635.3_Missense_Mutation_p.K57E|CAMK2G_ENST00000394762.2_Missense_Mutation_p.K57E|CAMK2G_ENST00000423381.1_Missense_Mutation_p.K57E|CAMK2G_ENST00000444854.2_Missense_Mutation_p.K57E|CAMK2G_ENST00000305762.7_Missense_Mutation_p.K57E|CAMK2G_ENST00000472912.1_5'UTR|CAMK2G_ENST00000372765.1_Missense_Mutation_p.K57E|CAMK2G_ENST00000322680.3_Missense_Mutation_p.K57E	NM_001222.3|NM_172173.2	NP_001213.2|NP_751913.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	57	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	CGTTCTAGTTTCTGGTGATCT	0.433																																					p.K57E		Atlas-SNP	.											.	CAMK2G	79	.	0			c.A169G						.						138.0	132.0	134.0					10																	75620639		2203	4300	6503	SO:0001583	missense	818	exon3			CTAGTTTCTGGTG	U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000351293.3:c.169A>G	chr10.hg19:g.75620639T>C	ENSP00000277853:p.Lys57Glu	150.0	0.0		82.0	67.0	NM_172170	O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Missense_Mutation	SNP	ENST00000351293.3	hg19	CCDS7336.1	.	.	.	.	.	.	.	.	.	.	T	31	5.077357	0.94000	.	.	ENSG00000148660	ENST00000351293;ENST00000322635;ENST00000423381;ENST00000394763;ENST00000322680;ENST00000394762;ENST00000305762;ENST00000372765;ENST00000444854	T;T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64940	0.2644	N	0.12887	0.27	0.80722	D	1	D;P;D;D;D;P;D;D	0.89917	0.998;0.837;0.993;0.98;0.997;0.753;0.994;1.0	D;P;D;P;D;P;D;D	0.77557	0.974;0.724;0.926;0.852;0.936;0.749;0.91;0.99	T	0.71738	-0.4502	10	0.87932	D	0	.	14.8736	0.70478	0.0:0.0:0.0:1.0	.	49;57;57;57;57;57;57;57	B3KY86;Q13555-4;Q13555-6;Q13555-10;A8K6N9;Q13555;Q13555-5;Q13555-8	.;.;.;.;.;KCC2G_HUMAN;.;.	E	57	ENSP00000277853:K57E;ENSP00000315599:K57E;ENSP00000410298:K57E;ENSP00000319060:K57E;ENSP00000378243:K57E;ENSP00000307082:K57E;ENSP00000361851:K57E;ENSP00000399680:K57E	ENSP00000307082:K57E	K	-	1	0	CAMK2G	75290645	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.593000	0.74100	2.333000	0.79357	0.533000	0.62120	AAA	.	.		0.433	CAMK2G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048715.1	NM_172169	
OR8J1	219477	hgsc.bcm.edu	37	11	56128125	56128125	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr11:56128125G>T	ENST00000303039.3	+	1	435	c.403G>T	c.(403-405)Gtg>Ttg	p.V135L		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					GTACATGGTGGTGGTGTCTCG	0.478																																					p.V135L		Atlas-SNP	.											.	OR8J1	87	.	0			c.G403T						.						133.0	126.0	128.0					11																	56128125		2201	4296	6497	SO:0001583	missense	219477	exon1			ATGGTGGTGGTGT	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.403G>T	chr11.hg19:g.56128125G>T	ENSP00000304060:p.Val135Leu	121.0	0.0		78.0	46.0	NM_001005205	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	hg19	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	G	9.926	1.213454	0.22289	.	.	ENSG00000172487	ENST00000303039	T	0.11712	2.75	4.05	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	0.119777	0.38663	N	0.001609	T	0.07279	0.0184	N	0.10782	0.045	0.24340	N	0.994966	D	0.53462	0.96	P	0.49140	0.601	T	0.29427	-1.0012	10	0.23302	T	0.38	.	7.3413	0.26637	0.0:0.1822:0.63:0.1878	.	135	Q8NGP2	OR8J1_HUMAN	L	135	ENSP00000304060:V135L	ENSP00000304060:V135L	V	+	1	0	OR8J1	55884701	0.010000	0.17322	1.000000	0.80357	0.093000	0.18481	0.521000	0.22893	2.255000	0.74692	0.643000	0.83706	GTG	.	.		0.478	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205	
YIF1A	10897	hgsc.bcm.edu	37	11	66053219	66053219	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr11:66053219G>T	ENST00000376901.4	-	5	622	c.438C>A	c.(436-438)ttC>ttA	p.F146L	YIF1A_ENST00000526497.1_5'UTR|YIF1A_ENST00000496746.1_5'Flank|YIF1A_ENST00000359461.6_Missense_Mutation_p.F146L|YIF1A_ENST00000471387.2_Missense_Mutation_p.F3L	NM_020470.2	NP_065203.2	O95070	YIF1A_HUMAN	Yip1 interacting factor homolog A (S. cerevisiae)	146					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	9						CGTAAGTAATGAAGGCCATCG	0.562																																					p.F146L		Atlas-SNP	.											.	YIF1A	29	.	0			c.C438A						.						96.0	74.0	82.0					11																	66053219		2200	4295	6495	SO:0001583	missense	10897	exon5			AGTAATGAAGGCC	AF004876	CCDS8132.1, CCDS73325.1	11q13	2009-01-05	2005-06-07	2005-06-07	ENSG00000174851	ENSG00000174851			16688	protein-coding gene	gene with protein product		611484	"""Yip1 interacting factor homolog (S. cerevisiae)"""	YIF1		8824393, 10970842, 18718466	Standard	NM_020470		Approved	YIF1P, 54TM, FinGER7	uc001ohk.4	O95070	OTTHUMG00000102079	ENST00000376901.4:c.438C>A	chr11.hg19:g.66053219G>T	ENSP00000366098:p.Phe146Leu	62.0	0.0		52.0	16.0	NM_020470	A6NM00|Q96G83|Q9BVD0	Missense_Mutation	SNP	ENST00000376901.4	hg19	CCDS8132.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.841727	0.51057	.	.	ENSG00000174851	ENST00000471387;ENST00000359461;ENST00000376901;ENST00000376904;ENST00000431556	T;T;T	0.42513	0.97;1.05;0.98	4.1	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	L	0.54323	1.7	0.58432	D	0.999991	P	0.35700	0.516	B	0.38194	0.267	T	0.06463	-1.0825	10	0.22109	T	0.4	-3.5029	4.7289	0.12955	0.2894:0.0:0.7106:0.0	.	146	O95070	YIF1A_HUMAN	L	3;146;146;150;146	ENSP00000352437:F146L;ENSP00000366098:F146L;ENSP00000401953:F146L	ENSP00000352437:F146L	F	-	3	2	YIF1A	65809795	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.664000	0.37439	2.289000	0.77006	0.462000	0.41574	TTC	.	.		0.562	YIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219903.3	NM_020470	
A2M	2	hgsc.bcm.edu	37	12	9230420	9230420	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr12:9230420T>G	ENST00000318602.7	-	26	3460	c.3153A>C	c.(3151-3153)caA>caC	p.Q1051H	A2M_ENST00000542567.1_5'UTR	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1051					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.Q1051H(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AGGCTCGAGCTTGGGCAAAAG	0.473																																					p.Q1051H		Atlas-SNP	.											A2M,NS,carcinoma,0,1	A2M	180	.	1	Substitution - Missense(1)	ovary(1)	c.A3153C						.						110.0	115.0	113.0					12																	9230420		2202	4300	6502	SO:0001583	missense	2	exon26			TCGAGCTTGGGCA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3153A>C	chr12.hg19:g.9230420T>G	ENSP00000323929:p.Gln1051His	119.0	0.0		94.0	28.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	hg19	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	T	18.23	3.578091	0.65878	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.35605	1.3	5.54	3.71	0.42584	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.353602	0.28088	N	0.016653	T	0.65428	0.2690	M	0.94021	3.485	0.31240	N	0.695256	D	0.76494	0.999	D	0.76071	0.987	T	0.71537	-0.4563	10	0.87932	D	0	.	8.5507	0.33449	0.0:0.7015:0.0:0.2985	.	1051	P01023	A2MG_HUMAN	H	1051;1066	ENSP00000323929:Q1051H	ENSP00000323929:Q1051H	Q	-	3	2	A2M	9121687	0.980000	0.34600	1.000000	0.80357	0.983000	0.72400	0.213000	0.17521	0.692000	0.31613	-0.472000	0.04984	CAA	.	.		0.473	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
OR10A7	121364	hgsc.bcm.edu	37	12	55615504	55615504	+	Silent	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr12:55615504T>A	ENST00000326258.1	+	1	696	c.696T>A	c.(694-696)acT>acA	p.T232T		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						CCTCTGCCACTGGCCGCCAGA	0.488																																					p.T232T		Atlas-SNP	.											.	OR10A7	53	.	0			c.T696A						.						121.0	100.0	107.0					12																	55615504		2203	4300	6503	SO:0001819	synonymous_variant	121364	exon1			TGCCACTGGCCGC	BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.696T>A	chr12.hg19:g.55615504T>A		75.0	0.0		71.0	24.0	NM_001005280	Q6IFD5|Q96R19	Silent	SNP	ENST00000326258.1	hg19	CCDS31815.1																																																																																			.	.		0.488	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1		
PTPRQ	374462	hgsc.bcm.edu	37	12	80935405	80935405	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr12:80935405C>T	ENST00000266688.5	+	26	3214	c.3214C>T	c.(3214-3216)Cca>Tca	p.P1072S				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1118	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						AAGCTGGGTCCCACCGGCTCA	0.433																																					p.P904S		Atlas-SNP	.											.	PTPRQ	119	.	0			c.C2710T						.						118.0	100.0	106.0					12																	80935405		692	1591	2283	SO:0001583	missense	374462	exon18			TGGGTCCCACCGG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.3214C>T	chr12.hg19:g.80935405C>T	ENSP00000266688:p.Pro1072Ser	53.0	0.0		65.0	9.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.	.	.	.	.	.	.	.	.	.	C	16.76	3.213646	0.58452	.	.	ENSG00000139304	ENST00000266688	T	0.58506	0.33	5.89	5.0	0.66597	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76219	0.3957	.	.	.	0.46044	D	0.998835	D	0.89917	1.0	D	0.87578	0.998	T	0.79680	-0.1702	8	0.72032	D	0.01	.	13.2079	0.59807	0.0:0.9263:0.0:0.0737	.	1118	Q9UMZ3	PTPRQ_HUMAN	S	1072	ENSP00000266688:P1072S	ENSP00000266688:P1072S	P	+	1	0	PTPRQ	79459536	0.999000	0.42202	0.792000	0.32020	0.907000	0.53573	3.709000	0.54853	1.491000	0.48482	0.655000	0.94253	CCA	.	.		0.433	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
RASSF9	9182	hgsc.bcm.edu	37	12	86199277	86199277	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr12:86199277T>C	ENST00000361228.3	-	2	879	c.511A>G	c.(511-513)Att>Gtt	p.I171V		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	171					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCCTGCTTAATTTTAGCCAGT	0.383																																					p.I171V		Atlas-SNP	.											.	RASSF9	100	.	0			c.A511G						.						162.0	156.0	157.0					12																	86199277		1838	4090	5928	SO:0001583	missense	9182	exon2			GCTTAATTTTAGC		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.511A>G	chr12.hg19:g.86199277T>C	ENSP00000354884:p.Ile171Val	71.0	0.0		71.0	22.0	NM_005447	B3KMQ4|Q8N5U8	Missense_Mutation	SNP	ENST00000361228.3	hg19	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.454438	0.26161	.	.	ENSG00000198774	ENST00000361228	T	0.46819	0.86	4.91	4.91	0.64330	.	0.072502	0.53938	D	0.000043	T	0.43567	0.1253	L	0.61218	1.895	0.34664	D	0.722959	P	0.37207	0.587	B	0.36464	0.225	T	0.57493	-0.7802	10	0.30078	T	0.28	-9.4901	10.6704	0.45755	0.0:0.0:0.2983:0.7017	.	171	O75901	RASF9_HUMAN	V	171	ENSP00000354884:I171V	ENSP00000354884:I171V	I	-	1	0	RASSF9	84723408	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	1.734000	0.38166	1.979000	0.57680	0.533000	0.62120	ATT	.	.		0.383	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
SELPLG	6404	hgsc.bcm.edu	37	12	109017058	109017058	+	Silent	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr12:109017058C>T	ENST00000550948.1	-	2	1250	c.1026G>A	c.(1024-1026)gcG>gcA	p.A342A	SELPLG_ENST00000388962.3_Silent_p.A332A|SELPLG_ENST00000228463.6_Silent_p.A358A			Q14242	SELPL_HUMAN	selectin P ligand	342					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						AGAGGCGGACCGCCAGCACCA	0.617																																					p.A358A		Atlas-SNP	.											.	SELPLG	138	.	0			c.G1074A						.						49.0	46.0	47.0					12																	109017058		2203	4300	6503	SO:0001819	synonymous_variant	6404	exon2			GCGGACCGCCAGC		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.1026G>A	chr12.hg19:g.109017058C>T		170.0	0.0		160.0	69.0	NM_001206609	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Silent	SNP	ENST00000550948.1	hg19	CCDS31895.2																																																																																			.	.		0.617	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403904.1		
PDS5B	23047	hgsc.bcm.edu	37	13	33338652	33338652	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr13:33338652A>T	ENST00000315596.10	+	31	3730	c.3544A>T	c.(3544-3546)Agt>Tgt	p.S1182C	RNY1P4_ENST00000384595.1_RNA	NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1182					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AATGGATCACAGTGAAAATGA	0.348																																					p.S1182C		Atlas-SNP	.											.	PDS5B	141	.	0			c.A3544T						.						106.0	103.0	104.0					13																	33338652		1847	4089	5936	SO:0001583	missense	23047	exon31			GATCACAGTGAAA	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3544A>T	chr13.hg19:g.33338652A>T	ENSP00000313851:p.Ser1182Cys	253.0	1.0		214.0	115.0	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	hg19	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322661	0.81580	.	.	ENSG00000083642	ENST00000315596;ENST00000421084;ENST00000447833	.	.	.	5.39	5.39	0.77823	.	0.074919	0.85682	D	0.000000	T	0.60650	0.2285	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	P	0.61940	0.896	T	0.64175	-0.6469	9	0.49607	T	0.09	-17.2789	15.6785	0.77349	1.0:0.0:0.0:0.0	.	1182	Q9NTI5	PDS5B_HUMAN	C	1182;1182;136	.	ENSP00000313851:S1182C	S	+	1	0	PDS5B	32236652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.942000	0.87708	2.149000	0.67028	0.528000	0.53228	AGT	.	.		0.348	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
MYCBP2	23077	hgsc.bcm.edu	37	13	77671529	77671529	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr13:77671529A>C	ENST00000544440.2	-	56	9663	c.9646T>G	c.(9646-9648)Tat>Gat	p.Y3216D	MYCBP2_ENST00000357337.6_Missense_Mutation_p.Y3216D|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000407578.2_Missense_Mutation_p.Y3254D|MYCBP2-AS1_ENST00000593933.1_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTCATGTGATAGGTCACCGGG	0.438																																					p.Y3254D		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.T9760G						.						113.0	103.0	107.0					13																	77671529		2203	4300	6503	SO:0001583	missense	23077	exon56			TGTGATAGGTCAC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9646T>G	chr13.hg19:g.77671529A>C	ENSP00000444596:p.Tyr3216Asp	67.0	0.0		67.0	20.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.68	3.448518	0.63178	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.32023	1.47;1.47;1.47	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.83275	0.996;0.986	T	0.54840	-0.8233	10	0.72032	D	0.01	.	16.0539	0.80782	1.0:0.0:0.0:0.0	.	3216;3216	O75592-2;O75592	.;MYCB2_HUMAN	D	3216;3254;3216	ENSP00000349892:Y3216D;ENSP00000384288:Y3254D;ENSP00000444596:Y3216D	ENSP00000349892:Y3216D	Y	-	1	0	MYCBP2	76569530	1.000000	0.71417	0.983000	0.44433	0.973000	0.67179	9.339000	0.96797	2.193000	0.70182	0.533000	0.62120	TAT	.	.		0.438	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
SCEL	8796	hgsc.bcm.edu	37	13	78133957	78133957	+	Silent	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr13:78133957G>A	ENST00000349847.3	+	4	264	c.180G>A	c.(178-180)agG>agA	p.R60R	SCEL_ENST00000535157.1_Silent_p.R60R|SCEL_ENST00000377246.3_Silent_p.R60R	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	60					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		ATTACGGTAGGGTGGTGCTCA	0.418																																					p.R60R		Atlas-SNP	.											.	SCEL	85	.	0			c.G180A						.						249.0	220.0	230.0					13																	78133957		2203	4300	6503	SO:0001819	synonymous_variant	8796	exon4			CGGTAGGGTGGTG	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.180G>A	chr13.hg19:g.78133957G>A		124.0	0.0		86.0	49.0	NM_003843	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Silent	SNP	ENST00000349847.3	hg19	CCDS9459.1																																																																																			.	.		0.418	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
VIPAS39	63894	hgsc.bcm.edu	37	14	77895375	77895375	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr14:77895375A>C	ENST00000553888.1	-	18	1840	c.1330T>G	c.(1330-1332)Ttc>Gtc	p.F444V	VIPAS39_ENST00000557658.1_Missense_Mutation_p.F444V|VIPAS39_ENST00000327028.4_Missense_Mutation_p.F431V|VIPAS39_ENST00000343765.2_Missense_Mutation_p.F444V|VIPAS39_ENST00000448935.2_Missense_Mutation_p.F395V|VIPAS39_ENST00000556412.1_Missense_Mutation_p.F470V	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	444					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											TGGCACTTGAACTTAGTGGCT	0.443																																					p.F444V		Atlas-SNP	.											.	.	.	.	0			c.T1330G						.						151.0	119.0	130.0					14																	77895375		2203	4300	6503	SO:0001583	missense	63894	exon18			ACTTGAACTTAGT	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.1330T>G	chr14.hg19:g.77895375A>C	ENSP00000452181:p.Phe444Val	53.0	0.0		58.0	29.0	NM_001193314	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	ENST00000553888.1	hg19	CCDS9862.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.869021	0.51588	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	5.54	5.54	0.83059	.	0.158102	0.64402	D	0.000017	T	0.28366	0.0701	N	0.16368	0.405	0.41505	D	0.988301	B;B	0.16802	0.011;0.019	B;B	0.19666	0.014;0.026	T	0.10154	-1.0642	10	0.18276	T	0.48	-16.723	14.6448	0.68754	1.0:0.0:0.0:0.0	.	395;444	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	V	444;444;431;444;395;470	ENSP00000339122:F444V;ENSP00000452181:F444V;ENSP00000313098:F431V;ENSP00000452191:F444V;ENSP00000404815:F395V;ENSP00000451857:F470V	ENSP00000313098:F431V	F	-	1	0	VIPAR	76965128	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.723000	0.61965	2.094000	0.63399	0.533000	0.62120	TTC	.	.		0.443	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414008.1	NM_022067	
CLMN	79789	hgsc.bcm.edu	37	14	95677210	95677210	+	Silent	SNP	G	G	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr14:95677210G>C	ENST00000298912.4	-	7	728	c.615C>G	c.(613-615)ggC>ggG	p.G205G		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	205	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GCACCGCCACGCCATACCTGA	0.582																																					p.G205G		Atlas-SNP	.											.	CLMN	103	.	0			c.C615G						.						73.0	79.0	77.0					14																	95677210		2203	4300	6503	SO:0001819	synonymous_variant	79789	exon7			CGCCACGCCATAC	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.615C>G	chr14.hg19:g.95677210G>C		61.0	0.0		84.0	23.0	NM_024734	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Silent	SNP	ENST00000298912.4	hg19	CCDS9933.1																																																																																			.	.		0.582	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
BAHD1	22893	hgsc.bcm.edu	37	15	40757560	40757560	+	Silent	SNP	G	G	A	rs151097414		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr15:40757560G>A	ENST00000416165.1	+	6	2150	c.2079G>A	c.(2077-2079)tcG>tcA	p.S693S	BAHD1_ENST00000561234.1_Silent_p.S692S|RP11-64K12.8_ENST00000559730.1_RNA|BAHD1_ENST00000560846.1_Silent_p.S690S	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	693	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		TGTTTGCATCGCGACATCAGG	0.537																																					p.S693S		Atlas-SNP	.											.	BAHD1	68	.	0			c.G2079A						.	G		0,4406		0,0,2203	214.0	151.0	173.0		2079	-5.4	0.4	15	dbSNP_134	173	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BAHD1	NM_014952.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		693/781	40757560	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22893	exon6			TGCATCGCGACAT	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.2079G>A	chr15.hg19:g.40757560G>A		64.0	0.0		77.0	17.0	NM_014952	Q8NDF7|Q9Y2F4	Silent	SNP	ENST00000416165.1	hg19	CCDS10058.1																																																																																			.	G|1.000;A|0.000		0.537	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952	
SPATA5L1	79029	hgsc.bcm.edu	37	15	45695491	45695491	+	Silent	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr15:45695491C>T	ENST00000305560.6	+	1	963	c.864C>T	c.(862-864)cgC>cgT	p.R288R	GATM_ENST00000458245.5_5'Flank|SPATA5L1_ENST00000559860.1_Silent_p.R288R	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	288						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		TCTTCCAGCGCGCCCGGGAAC	0.741																																					p.R288R		Atlas-SNP	.											.	SPATA5L1	40	.	0			c.C864T						.						4.0	6.0	5.0					15																	45695491		1991	3974	5965	SO:0001819	synonymous_variant	79029	exon1			CCAGCGCGCCCGG	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.864C>T	chr15.hg19:g.45695491C>T		118.0	0.0		122.0	61.0	NM_024063	C9JHR5|Q9H8W7|Q9HA41	Silent	SNP	ENST00000305560.6	hg19	CCDS10123.1																																																																																			.	.		0.741	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
VPS13C	54832	hgsc.bcm.edu	37	15	62155676	62155676	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr15:62155676G>A	ENST00000261517.5	-	82	10988	c.10915C>T	c.(10915-10917)Cct>Tct	p.P3639S	VPS13C_ENST00000249837.3_Missense_Mutation_p.P3596S	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTGCTTCCAGGAATAGCACAG	0.368																																					p.P3639S		Atlas-SNP	.											.	VPS13C	506	.	0			c.C10915T						.						168.0	146.0	153.0					15																	62155676		2203	4300	6503	SO:0001583	missense	54832	exon82			TTCCAGGAATAGC	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10915C>T	chr15.hg19:g.62155676G>A	ENSP00000261517:p.Pro3639Ser	120.0	0.0		105.0	6.0	NM_020821		Missense_Mutation	SNP	ENST00000261517.5	hg19	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	6.397	0.441296	0.12164	.	.	ENSG00000129003	ENST00000249837;ENST00000261517	T;T	0.47177	0.86;0.85	5.68	1.42	0.22433	.	0.546215	0.19185	N	0.120573	T	0.32496	0.0831	L	0.42245	1.32	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.19910	-1.0291	10	0.18710	T	0.47	.	5.8851	0.18876	0.2662:0.1263:0.6075:0.0	.	3596;3639	Q709C8-3;Q709C8	.;VP13C_HUMAN	S	3596;3639	ENSP00000249837:P3596S;ENSP00000261517:P3639S	ENSP00000249837:P3596S	P	-	1	0	VPS13C	59942968	1.000000	0.71417	0.005000	0.12908	0.815000	0.46073	1.361000	0.34136	0.061000	0.16311	0.591000	0.81541	CCT	.	.		0.368	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
LARP6	55323	hgsc.bcm.edu	37	15	71124687	71124687	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr15:71124687T>A	ENST00000299213.8	-	3	1250	c.1180A>T	c.(1180-1182)Aga>Tga	p.R394*	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	394					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						GGGGACTTTCTGGAAACGCCT	0.572																																					p.R394X		Atlas-SNP	.											.	LARP6	43	.	0			c.A1180T						.						48.0	44.0	46.0					15																	71124687		2199	4297	6496	SO:0001587	stop_gained	55323	exon3			ACTTTCTGGAAAC	BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.1180A>T	chr15.hg19:g.71124687T>A	ENSP00000299213:p.Arg394*	84.0	0.0		87.0	51.0	NM_018357	Q5XKE4|Q8N3N2|Q9NUR0	Nonsense_Mutation	SNP	ENST00000299213.8	hg19	CCDS32281.1	.	.	.	.	.	.	.	.	.	.	T	32	5.177942	0.94846	.	.	ENSG00000166173	ENST00000299213	.	.	.	4.68	0.9	0.19278	.	0.319263	0.37623	N	0.002019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-10.2496	6.0294	0.19671	0.0:0.0867:0.313:0.6004	.	.	.	.	X	394	.	ENSP00000299213:R394X	R	-	1	2	LARP6	68911741	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	1.971000	0.40530	0.042000	0.15717	0.454000	0.30748	AGA	.	.		0.572	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357	
CEMIP	57214	hgsc.bcm.edu	37	15	81225586	81225586	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr15:81225586A>G	ENST00000394685.3	+	23	3213	c.2794A>G	c.(2794-2796)Att>Gtt	p.I932V	KIAA1199_ENST00000220244.3_Splice_Site_p.I932V|KIAA1199_ENST00000356249.5_Splice_Site_p.I932V|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		932					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CTCTGTTTAGATTACTTCCAG	0.542																																					p.I932V		Atlas-SNP	.											.	KIAA1199	118	.	0			c.A2794G						.						67.0	65.0	66.0					15																	81225586		2203	4300	6503	SO:0001630	splice_region_variant	57214	exon22			GTTTAGATTACTT																												ENST00000394685.3:c.2794-1A>G	chr15.hg19:g.81225586A>G		82.0	0.0		135.0	73.0	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	hg19	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	A	2.055	-0.416742	0.04766	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.54675	0.56;0.56;0.56	4.37	4.37	0.52481	Pectin lyase fold/virulence factor (1);	0.127324	0.50627	D	0.000105	T	0.34978	0.0916	N	0.16478	0.41	0.41303	D	0.987053	B	0.06786	0.001	B	0.06405	0.002	T	0.14392	-1.0474	9	.	.	.	-10.6591	13.7257	0.62756	1.0:0.0:0.0:0.0	.	932	Q8WUJ3	K1199_HUMAN	V	932	ENSP00000220244:I932V;ENSP00000378177:I932V;ENSP00000348583:I932V	.	I	+	1	0	KIAA1199	79012641	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	6.292000	0.72725	1.832000	0.53329	0.460000	0.39030	ATT	.	.		0.542	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		Missense_Mutation
CASKIN1	57524	hgsc.bcm.edu	37	16	2231253	2231253	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:2231253A>G	ENST00000343516.6	-	18	2208	c.2116T>C	c.(2116-2118)Tcg>Ccg	p.S706P	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	706					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						AGCTCCTGCGAGCTGCTCATG	0.726																																					p.S706P		Atlas-SNP	.											.	CASKIN1	130	.	0			c.T2116C						.						10.0	12.0	11.0					16																	2231253		1863	4071	5934	SO:0001583	missense	57524	exon18			CCTGCGAGCTGCT	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.2116T>C	chr16.hg19:g.2231253A>G	ENSP00000345436:p.Ser706Pro	65.0	0.0		64.0	10.0	NM_020764	Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	hg19	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.171977	0.38315	.	.	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.74842	-0.88	4.36	4.36	0.52297	.	.	.	.	.	T	0.80138	0.4568	L	0.54323	1.7	0.36837	D	0.887177	D	0.71674	0.998	P	0.60682	0.878	D	0.83886	0.0282	9	0.52906	T	0.07	-17.1702	12.504	0.55972	1.0:0.0:0.0:0.0	.	706	Q8WXD9	CSKI1_HUMAN	P	706;535	ENSP00000345436:S706P	ENSP00000345436:S706P	S	-	1	0	CASKIN1	2171254	1.000000	0.71417	0.996000	0.52242	0.954000	0.61252	3.136000	0.50554	1.828000	0.53243	0.454000	0.30748	TCG	.	.		0.726	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
ABCA3	21	hgsc.bcm.edu	37	16	2339511	2339511	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:2339511C>A	ENST00000301732.5	-	20	3324	c.2624G>T	c.(2623-2625)tGt>tTt	p.C875F	ABCA3_ENST00000382381.3_Missense_Mutation_p.C817F	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	875					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CATGGCCCCACAGAGGTTGCT	0.662																																					p.C875F		Atlas-SNP	.											.	ABCA3	176	.	0			c.G2624T						.						32.0	29.0	30.0					16																	2339511		2194	4293	6487	SO:0001583	missense	21	exon20			GCCCCACAGAGGT	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2624G>T	chr16.hg19:g.2339511C>A	ENSP00000301732:p.Cys875Phe	62.0	0.0		56.0	28.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	hg19	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	1.499	-0.552440	0.03996	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.93076	-3.16	4.68	3.72	0.42706	.	0.097592	0.64402	D	0.000002	D	0.85792	0.5779	N	0.19112	0.55	0.80722	D	1	B;B;B	0.27732	0.0;0.003;0.187	B;B;B	0.26693	0.0;0.001;0.072	T	0.80353	-0.1418	10	0.10111	T	0.7	.	13.7678	0.63006	0.0:0.8453:0.1547:0.0	.	875;879;875	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	F	875;879	ENSP00000301732:C875F	ENSP00000301732:C875F	C	-	2	0	ABCA3	2279512	1.000000	0.71417	0.280000	0.24747	0.137000	0.21094	5.333000	0.65917	1.180000	0.42898	0.561000	0.74099	TGT	.	.		0.662	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
ABCC11	85320	hgsc.bcm.edu	37	16	48239436	48239436	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:48239436C>G	ENST00000394747.1	-	12	2042	c.1693G>C	c.(1693-1695)Gag>Cag	p.E565Q	ABCC11_ENST00000394748.1_Missense_Mutation_p.E565Q|ABCC11_ENST00000356608.2_Missense_Mutation_p.E565Q|ABCC11_ENST00000353782.5_Missense_Mutation_p.E565Q|ABCC11_ENST00000537808.1_Missense_Mutation_p.E565Q	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	565	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	ACCGAGCCCTCGAGCAAGTGC	0.642																																					p.E565Q		Atlas-SNP	.											.	ABCC11	177	.	0			c.G1693C						.						88.0	77.0	81.0					16																	48239436		2201	4300	6501	SO:0001583	missense	85320	exon12			AGCCCTCGAGCAA	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1693G>C	chr16.hg19:g.48239436C>G	ENSP00000378230:p.Glu565Gln	58.0	0.0		76.0	31.0	NM_033151	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	hg19	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.688199	0.29962	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	D;D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45;-3.45	5.6	-1.05	0.10036	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.625745	0.16821	N	0.198149	D	0.83732	0.5318	N	0.13043	0.29	0.09310	N	1	B;B	0.18310	0.013;0.027	B;B	0.20384	0.002;0.029	T	0.71484	-0.4579	10	0.30078	T	0.28	-8.7067	1.8037	0.03076	0.1365:0.3873:0.2643:0.2119	.	565;565	Q96J66-2;Q96J66	.;ABCCB_HUMAN	Q	565	ENSP00000311326:E565Q;ENSP00000349017:E565Q;ENSP00000378231:E565Q;ENSP00000378230:E565Q;ENSP00000438530:E565Q	ENSP00000311326:E565Q	E	-	1	0	ABCC11	46796937	0.000000	0.05858	0.011000	0.14972	0.026000	0.11368	0.046000	0.14035	0.123000	0.18342	0.563000	0.77884	GAG	.	.		0.642	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
ZNF423	23090	hgsc.bcm.edu	37	16	49559304	49559304	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:49559304C>T	ENST00000561648.1	-	6	3732	c.3679G>A	c.(3679-3681)Ggc>Agc	p.G1227S	ZNF423_ENST00000262383.2_Missense_Mutation_p.G1227S|ZNF423_ENST00000562871.1_Missense_Mutation_p.G1167S|ZNF423_ENST00000563137.2_Missense_Mutation_p.G1167S|ZNF423_ENST00000562520.1_Missense_Mutation_p.G1167S|ZNF423_ENST00000535559.1_Missense_Mutation_p.G1110S|ZNF423_ENST00000567169.1_Missense_Mutation_p.G1110S	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1227					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TTGAAGGTGCCGCCCATGCCC	0.577																																					p.G1227S		Atlas-SNP	.											ZNF423_ENST00000262383,NS,carcinoma,0,2	ZNF423	463	.	0			c.G3679A						.						108.0	87.0	94.0					16																	49559304		2199	4300	6499	SO:0001583	missense	23090	exon6			AGGTGCCGCCCAT	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3679G>A	chr16.hg19:g.49559304C>T	ENSP00000455426:p.Gly1227Ser	144.0	0.0		104.0	27.0	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	hg19	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325683	0.81580	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.08896	3.04;3.1	5.38	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.13157	0.0319	N	0.10837	0.055	0.45946	D	0.998779	D	0.89917	1.0	D	0.91635	0.999	T	0.37663	-0.9696	9	.	.	.	-28.7483	15.5465	0.76104	0.139:0.861:0.0:0.0	.	1227	Q2M1K9	ZN423_HUMAN	S	1227;1110	ENSP00000262383:G1227S;ENSP00000442321:G1110S	.	G	-	1	0	ZNF423	48116805	1.000000	0.71417	0.928000	0.36995	0.987000	0.75469	5.766000	0.68843	1.248000	0.43934	0.462000	0.41574	GGC	.	.		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
RBL2	5934	hgsc.bcm.edu	37	16	53488597	53488597	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:53488597A>T	ENST00000262133.6	+	8	1159	c.1022A>T	c.(1021-1023)tAt>tTt	p.Y341F	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Missense_Mutation_p.Y125F	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	341					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TATGAGGAGTATGTTTTATCT	0.383																																					p.Y341F		Atlas-SNP	.											.	RBL2	115	.	0			c.A1022T						.						132.0	130.0	130.0					16																	53488597		2198	4300	6498	SO:0001583	missense	5934	exon8			AGGAGTATGTTTT	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1022A>T	chr16.hg19:g.53488597A>T	ENSP00000262133:p.Tyr341Phe	119.0	0.0		117.0	52.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	hg19	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137519	0.56936	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000379935;ENST00000544545	D;D;D	0.91068	-2.78;-2.32;-1.98	5.5	5.5	0.81552	.	0.117769	0.64402	D	0.000018	D	0.89853	0.6835	L	0.58583	1.82	0.39473	D	0.967755	B;P;P;D	0.53151	0.0;0.564;0.723;0.958	B;B;B;P	0.45276	0.002;0.168;0.321;0.475	D	0.90315	0.4340	10	0.41790	T	0.15	-9.5506	15.6062	0.76672	1.0:0.0:0.0:0.0	.	125;341;51;341	B7Z913;Q8NE70;E9PG04;Q08999	.;.;.;RBL2_HUMAN	F	341;267;51;125	ENSP00000262133:Y341F;ENSP00000443744:Y267F;ENSP00000444685:Y125F	ENSP00000262133:Y341F	Y	+	2	0	RBL2	52046098	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.144000	0.77357	2.090000	0.63153	0.454000	0.30748	TAT	.	.		0.383	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
PLCG2	5336	hgsc.bcm.edu	37	16	81891876	81891876	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:81891876A>G	ENST00000359376.3	+	4	560	c.346A>G	c.(346-348)Aaa>Gaa	p.K116E	PLCG2_ENST00000565400.1_3'UTR	NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	116	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						AGCTGACTCTAAAGAGGATGC	0.493																																					p.K116E		Atlas-SNP	.											.	PLCG2	276	.	0			c.A346G						.						147.0	148.0	148.0					16																	81891876		2034	4191	6225	SO:0001583	missense	5336	exon4			GACTCTAAAGAGG		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.346A>G	chr16.hg19:g.81891876A>G	ENSP00000352336:p.Lys116Glu	93.0	0.0		118.0	58.0	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	hg19	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	A	2.819	-0.245300	0.05906	.	.	ENSG00000197943	ENST00000359376	T	0.61510	0.1	5.57	5.57	0.84162	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.345864	0.30676	N	0.009103	T	0.27798	0.0684	N	0.03948	-0.315	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.22487	-1.0215	10	0.02654	T	1	.	9.2745	0.37692	0.9188:0.0:0.0812:0.0	.	116	P16885	PLCG2_HUMAN	E	116	ENSP00000352336:K116E	ENSP00000352336:K116E	K	+	1	0	PLCG2	80449377	0.948000	0.32251	0.030000	0.17652	0.752000	0.42762	4.720000	0.61944	2.126000	0.65437	0.482000	0.46254	AAA	.	.		0.493	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
NLGN2	57555	hgsc.bcm.edu	37	17	7318992	7318992	+	Silent	SNP	T	T	G			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:7318992T>G	ENST00000302926.2	+	6	1273	c.1200T>G	c.(1198-1200)ggT>ggG	p.G400G	NLGN2_ENST00000575301.1_Silent_p.G400G	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	400					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GCGAGGACGGTGTGTCTGCCA	0.547																																					p.G400G		Atlas-SNP	.											.	NLGN2	61	.	0			c.T1200G						.						208.0	170.0	183.0					17																	7318992		2203	4300	6503	SO:0001819	synonymous_variant	57555	exon6			GGACGGTGTGTCT	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1200T>G	chr17.hg19:g.7318992T>G		101.0	0.0		79.0	65.0	NM_020795	Q9P2I1	Silent	SNP	ENST00000302926.2	hg19	CCDS11103.1																																																																																			.	.		0.547	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	
TP53	7157	hgsc.bcm.edu	37	17	7577610	7577610	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:7577610T>A	ENST00000269305.4	-	7	862		c.e7-2		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(43)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAGCCAACCTAGGAGATAAC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,63	TP53	33396	.	53	Unknown(43)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	lung(16)|liver(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|ovary(5)|breast(4)|bone(4)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|urinary_tract(1)|oesophagus(1)	c.673-2A>T						.						88.0	74.0	79.0					17																	7577610		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCAACCTAGGAGA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.673-2A>T	chr17.hg19:g.7577610T>A		57.0	0.0		48.0	44.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.583355	0.65992	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3302	0.43818	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518335	1.000000	0.71417	0.324000	0.25361	0.557000	0.35523	7.634000	0.83273	1.750000	0.51863	0.379000	0.24179	.	.	.		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
DNAH9	1770	hgsc.bcm.edu	37	17	11757663	11757663	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:11757663C>A	ENST00000262442.4	+	50	9919	c.9851C>A	c.(9850-9852)cCc>cAc	p.P3284H	DNAH9_ENST00000454412.2_Missense_Mutation_p.P3284H	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3284	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GATGTGGAACCCAAGCGCCAG	0.552																																					p.P3284H		Atlas-SNP	.											.	DNAH9	695	.	0			c.C9851A						.						81.0	83.0	82.0					17																	11757663		2203	4300	6503	SO:0001583	missense	1770	exon50			TGGAACCCAAGCG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9851C>A	chr17.hg19:g.11757663C>A	ENSP00000262442:p.Pro3284His	199.0	0.0		93.0	77.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242406	0.58995	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	D;D	0.82255	-1.59;-1.59	5.44	4.47	0.54385	Dynein heavy chain, coiled coil stalk (1);	0.324267	0.33691	N	0.004659	D	0.95149	0.8428	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97610	1.0129	10	0.87932	D	0	.	16.3754	0.83383	0.0:0.8681:0.1319:0.0	.	3284	Q9NYC9	DYH9_HUMAN	H	3284;3284;1866	ENSP00000262442:P3284H;ENSP00000414874:P3284H	ENSP00000262442:P3284H	P	+	2	0	DNAH9	11698388	1.000000	0.71417	1.000000	0.80357	0.549000	0.35272	4.470000	0.60175	1.510000	0.48803	-0.176000	0.13171	CCC	.	.		0.552	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SLC46A1	113235	hgsc.bcm.edu	37	17	26732441	26732441	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:26732441C>T	ENST00000440501.1	-	2	369	c.274G>A	c.(274-276)Ggc>Agc	p.G92S	CTD-2350C19.2_ENST00000580714.1_RNA|SLC46A1_ENST00000584729.1_5'UTR|SLC46A1_ENST00000321666.5_Missense_Mutation_p.G92S|CTD-2350C19.1_ENST00000583956.1_RNA	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1	92					cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	AGGAAGCCGCCCACGTTCATG	0.647																																					p.G92S		Atlas-SNP	.											.	SLC46A1	17	.	0			c.G274A						.						12.0	14.0	13.0					17																	26732441		1976	4161	6137	SO:0001583	missense	113235	exon2			AGCCGCCCACGTT	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.274G>A	chr17.hg19:g.26732441C>T	ENSP00000395653:p.Gly92Ser	115.0	0.0		124.0	60.0	NM_001242366	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Missense_Mutation	SNP	ENST00000440501.1	hg19		.	.	.	.	.	.	.	.	.	.	c	15.09	2.729042	0.48833	.	.	ENSG00000076351	ENST00000440501;ENST00000321666	T;T	0.58060	0.36;0.36	5.38	2.99	0.34606	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.185960	0.56097	D	0.000023	T	0.32315	0.0825	.	.	.	0.49915	D	0.999838	B;B;B	0.25809	0.008;0.019;0.135	B;B;B	0.31495	0.014;0.051;0.131	T	0.05289	-1.0894	9	0.10377	T	0.69	-8.7901	7.4857	0.27432	0.2796:0.6164:0.0:0.104	.	92;92;92	B4DJ17;Q96NT5-2;Q96NT5	.;.;PCFT_HUMAN	S	92	ENSP00000395653:G92S;ENSP00000318828:G92S	ENSP00000318828:G92S	G	-	1	0	SLC46A1	23756568	0.097000	0.21791	0.997000	0.53966	0.995000	0.86356	1.439000	0.35013	1.394000	0.46624	0.556000	0.70494	GGC	.	.		0.647	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
NF1	4763	hgsc.bcm.edu	37	17	29560090	29560090	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:29560090A>T	ENST00000358273.4	+	27	3950	c.3567A>T	c.(3565-3567)caA>caT	p.Q1189H	NF1_ENST00000356175.3_Missense_Mutation_p.Q1189H	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1189			Q -> R (in NF1). {ECO:0000269|PubMed:23758643}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCCTTCAACAAGGCACAGAAT	0.418			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.Q1189H		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.A3567T						.						124.0	107.0	113.0					17																	29560090		2203	4300	6503	SO:0001583	missense	4763	exon27	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TCAACAAGGCACA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3567A>T	chr17.hg19:g.29560090A>T	ENSP00000351015:p.Gln1189His	134.0	0.0		148.0	68.0	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880710	0.72294	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.64803	-0.12;2.95;2.63	5.73	4.66	0.58398	Armadillo-type fold (1);Ras GTPase-activating protein (1);	0.000000	0.85682	D	0.000000	T	0.78381	0.4274	M	0.87180	2.865	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;0.988;0.629	D;D;D;P	0.91635	0.999;0.987;0.984;0.54	T	0.80703	-0.1264	10	0.87932	D	0	.	6.9699	0.24642	0.8329:0.0:0.1671:0.0	.	1189;239;1189;1189	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	H	1189;1189;855	ENSP00000351015:Q1189H;ENSP00000348498:Q1189H;ENSP00000389907:Q855H	ENSP00000348498:Q1189H	Q	+	3	2	NF1	26584216	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.478000	0.45189	2.185000	0.69588	0.454000	0.30748	CAA	.	.		0.418	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
UNC45B	146862	hgsc.bcm.edu	37	17	33504057	33504057	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:33504057G>A	ENST00000268876.5	+	16	2150	c.2053G>A	c.(2053-2055)Gag>Aag	p.E685K	UNC45B_ENST00000433649.1_Missense_Mutation_p.E683K|UNC45B_ENST00000591048.1_Missense_Mutation_p.E604K|UNC45B_ENST00000378449.1_Missense_Mutation_p.E604K|UNC45B_ENST00000394570.2_Missense_Mutation_p.E683K	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	685					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CCTGGCTTTGGAGGGCACAGA	0.577																																					p.E685K		Atlas-SNP	.											.	UNC45B	133	.	0			c.G2053A						.						137.0	110.0	119.0					17																	33504057		2203	4300	6503	SO:0001583	missense	146862	exon16			GCTTTGGAGGGCA	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.2053G>A	chr17.hg19:g.33504057G>A	ENSP00000268876:p.Glu685Lys	75.0	0.0		76.0	20.0	NM_173167	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	hg19	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	G	35	5.463154	0.96257	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T	0.51817	0.69;3.17;0.69	5.08	5.08	0.68730	Armadillo-like helical (1);Armadillo-type fold (1);	0.113820	0.64402	D	0.000009	T	0.65698	0.2716	L	0.59436	1.845	0.80722	D	1	D;P;D	0.67145	0.996;0.853;0.97	D;P;P	0.76071	0.987;0.628;0.662	T	0.63532	-0.6616	10	0.45353	T	0.12	-47.432	18.0106	0.89222	0.0:0.0:1.0:0.0	.	604;683;685	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	K	685;685;683;604	ENSP00000268876:E685K;ENSP00000412840:E683K;ENSP00000367710:E604K	ENSP00000268876:E685K	E	+	1	0	UNC45B	30528170	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.612000	0.98347	2.814000	0.96858	0.563000	0.77884	GAG	.	.		0.577	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
SLFN13	146857	hgsc.bcm.edu	37	17	33768135	33768135	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:33768135C>T	ENST00000285013.6	-	6	2448	c.2173G>A	c.(2173-2175)Gaa>Aaa	p.E725K	SLFN13_ENST00000542635.1_Missense_Mutation_p.E725K|SLFN13_ENST00000526861.1_Missense_Mutation_p.E725K|SLFN13_ENST00000534689.1_Missense_Mutation_p.E407K|SLFN13_ENST00000360502.2_Missense_Mutation_p.E407K|SLFN13_ENST00000533791.1_Missense_Mutation_p.E725K	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	725						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GTGAGCTCTTCTCTTGGATAC	0.443																																					p.E725K		Atlas-SNP	.											.	SLFN13	79	.	0			c.G2173A						.						140.0	149.0	146.0					17																	33768135		2203	4300	6503	SO:0001583	missense	146857	exon6			GCTCTTCTCTTGG	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2173G>A	chr17.hg19:g.33768135C>T	ENSP00000285013:p.Glu725Lys	58.0	0.0		77.0	34.0	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	hg19	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	c	12.73	2.026272	0.35701	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	3.27	2.28	0.28536	.	0.129452	0.35096	N	0.003456	T	0.80454	0.4626	L	0.48642	1.525	0.20563	N	0.999882	D;D	0.71674	0.998;0.997	D;D	0.77004	0.957;0.989	T	0.67768	-0.5585	10	0.10902	T	0.67	.	5.6584	0.17654	0.0:0.8466:0.0:0.1534	.	407;725	Q68D06-2;Q68D06	.;SLN13_HUMAN	K	725;407;725;725;407	ENSP00000285013:E725K;ENSP00000353692:E407K;ENSP00000434439:E725K;ENSP00000444016:E725K;ENSP00000435442:E407K	ENSP00000285013:E725K	E	-	1	0	SLFN13	30792248	0.010000	0.17322	0.054000	0.19295	0.019000	0.09904	0.671000	0.25172	1.811000	0.52892	0.407000	0.27541	GAA	.	.		0.443	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
CNTNAP1	8506	hgsc.bcm.edu	37	17	40835882	40835882	+	Silent	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:40835882C>A	ENST00000264638.4	+	2	328	c.111C>A	c.(109-111)tcC>tcA	p.S37S	CTD-3193K9.4_ENST00000593139.1_RNA|CCR10_ENST00000591765.1_5'Flank|CCR10_ENST00000332438.4_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	37	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		ATGCACGCTCCCTGGGCGCCT	0.642																																					p.S37S		Atlas-SNP	.											.	CNTNAP1	116	.	0			c.C111A						.						42.0	39.0	40.0					17																	40835882		2203	4300	6503	SO:0001819	synonymous_variant	8506	exon2			ACGCTCCCTGGGC	U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.111C>A	chr17.hg19:g.40835882C>A		51.0	0.0		62.0	28.0	NM_003632		Silent	SNP	ENST00000264638.4	hg19	CCDS11436.1																																																																																			.	.		0.642	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
ACBD4	79777	hgsc.bcm.edu	37	17	43214134	43214134	+	Silent	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:43214134G>A	ENST00000376955.4	+	4	582	c.285G>A	c.(283-285)gtG>gtA	p.V95V	ACBD4_ENST00000586346.1_Silent_p.V95V|ACBD4_ENST00000431281.1_Silent_p.V95V|ACBD4_ENST00000591136.1_3'UTR|ACBD4_ENST00000592162.1_Silent_p.V95V|ACBD4_ENST00000321854.8_Silent_p.V95V|ACBD4_ENST00000591859.1_Silent_p.V95V|ACBD4_ENST00000398322.3_Silent_p.V95V	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	95	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.						fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						TGAAACTGGTGGCACAGAAGG	0.597																																					p.V95V		Atlas-SNP	.											.	ACBD4	51	.	0			c.G285A						.						86.0	98.0	94.0					17																	43214134		2076	4198	6274	SO:0001819	synonymous_variant	79777	exon4			ACTGGTGGCACAG	BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.285G>A	chr17.hg19:g.43214134G>A		66.0	0.0		56.0	23.0	NM_001135707	D3DX64|Q8IUT1|Q9H8Q4	Silent	SNP	ENST00000376955.4	hg19	CCDS45711.1																																																																																			.	.		0.597	ACBD4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000449816.1	NM_024722	
BZRAP1	9256	hgsc.bcm.edu	37	17	56383220	56383220	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:56383220G>T	ENST00000343736.4	-	27	5394	c.5231C>A	c.(5230-5232)tCg>tAg	p.S1744*	BZRAP1_ENST00000268893.6_Nonsense_Mutation_p.S1684*|BZRAP1_ENST00000355701.3_Nonsense_Mutation_p.S1744*			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1744						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGGCCTTCCGACTCAGCTGT	0.667																																					p.S1744X		Atlas-SNP	.											.	BZRAP1	287	.	0			c.C5231A						.						46.0	45.0	45.0					17																	56383220		2203	4300	6503	SO:0001587	stop_gained	9256	exon27			CCTTCCGACTCAG	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.5231C>A	chr17.hg19:g.56383220G>T	ENSP00000345824:p.Ser1744*	45.0	0.0		54.0	15.0	NM_004758	O75111|Q8N5W3	Nonsense_Mutation	SNP	ENST00000343736.4	hg19	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	G	8.239	0.806310	0.16467	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	.	.	.	5.02	-5.59	0.02505	.	3.477390	0.00447	N	0.000096	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	2.5045	0.04641	0.4619:0.1199:0.2963:0.1219	.	.	.	.	X	1744;1744;1684	.	ENSP00000268893:S1684X	S	-	2	0	BZRAP1	53738219	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-0.456000	0.06754	-1.368000	0.02149	0.561000	0.74099	TCG	.	.		0.667	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
BPTF	2186	hgsc.bcm.edu	37	17	65870972	65870972	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:65870972T>C	ENST00000321892.4	+	4	1761	c.1700T>C	c.(1699-1701)aTt>aCt	p.I567T	BPTF_ENST00000306378.6_Missense_Mutation_p.I567T|BPTF_ENST00000424123.3_Missense_Mutation_p.I428T|BPTF_ENST00000335221.5_Missense_Mutation_p.I567T			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	567					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAGGGAGACATTGATAATGTT	0.313																																					p.I567T		Atlas-SNP	.											.	BPTF	415	.	0			c.T1700C						.						74.0	78.0	76.0					17																	65870972		2203	4300	6503	SO:0001583	missense	2186	exon4			GAGACATTGATAA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.1700T>C	chr17.hg19:g.65870972T>C	ENSP00000315454:p.Ile567Thr	374.0	1.0		487.0	235.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	hg19		.	.	.	.	.	.	.	.	.	.	T	4.630	0.117102	0.08881	.	.	ENSG00000171634	ENST00000544491;ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	T;T;T	0.61980	0.06;0.08;0.08	4.79	2.5	0.30297	.	.	.	.	.	T	0.48926	0.1527	L	0.51422	1.61	0.26731	N	0.970594	B;B;P	0.37276	0.002;0.043;0.589	B;B;B	0.36608	0.004;0.011;0.229	T	0.34204	-0.9838	9	0.07482	T	0.82	-1.5246	7.5904	0.28017	0.0:0.173:0.0:0.827	.	567;567;567	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	T	472;567;567;567;428	ENSP00000307208:I567T;ENSP00000334351:I567T;ENSP00000315454:I567T	ENSP00000307208:I567T	I	+	2	0	BPTF	63301434	1.000000	0.71417	0.510000	0.27712	0.581000	0.36288	3.122000	0.50446	0.248000	0.21435	0.482000	0.46254	ATT	.	.		0.313	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
NEDD4L	23327	hgsc.bcm.edu	37	18	56033235	56033235	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr18:56033235A>T	ENST00000400345.3	+	21	2121	c.1838A>T	c.(1837-1839)gAt>gTt	p.D613V	NEDD4L_ENST00000356462.6_Missense_Mutation_p.D549V|NEDD4L_ENST00000456986.1_Missense_Mutation_p.D492V|NEDD4L_ENST00000357895.5_Missense_Mutation_p.D605V|NEDD4L_ENST00000431212.2_Missense_Mutation_p.D492V|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000435432.2_Missense_Mutation_p.D472V|NEDD4L_ENST00000256830.9_Missense_Mutation_p.D509V|NEDD4L_ENST00000256832.7_Missense_Mutation_p.D473V|NEDD4L_ENST00000382850.4_Missense_Mutation_p.D593V|NEDD4L_ENST00000456173.2_Missense_Mutation_p.D472V|NEDD4L_ENST00000586263.1_Missense_Mutation_p.D585V	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	613					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						GTGTAGGCTGATATCCCCAAT	0.338																																					p.D613V		Atlas-SNP	.											.	NEDD4L	126	.	0			c.A1838T						.						75.0	68.0	70.0					18																	56033235		1821	4081	5902	SO:0001583	missense	23327	exon21			AGGCTGATATCCC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1838A>T	chr18.hg19:g.56033235A>T	ENSP00000383199:p.Asp613Val	72.0	0.0		70.0	34.0	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	hg19	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039288	0.75617	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.76186	1.08;1.08;1.08;1.08;-1.0;-1.0;1.08;-1.0;-1.0;-1.0	5.54	5.54	0.83059	HECT (1);	0.000000	0.85682	D	0.000000	T	0.81498	0.4835	L	0.39397	1.21	0.80722	D	1	D;P;D;D;D;P	0.69078	0.967;0.933;0.992;0.997;0.968;0.933	P;P;P;D;P;P	0.76575	0.819;0.795;0.708;0.988;0.787;0.684	D	0.83526	0.0088	10	0.87932	D	0	.	15.9755	0.80060	1.0:0.0:0.0:0.0	.	585;605;472;549;613;593	Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;NED4L_HUMAN;.	V	613;593;549;509;473;492;605;472;472;492	ENSP00000383199:D613V;ENSP00000372301:D593V;ENSP00000348847:D549V;ENSP00000256830:D509V;ENSP00000256832:D473V;ENSP00000411947:D492V;ENSP00000350569:D605V;ENSP00000393395:D472V;ENSP00000405440:D472V;ENSP00000389406:D492V	ENSP00000256830:D509V	D	+	2	0	NEDD4L	54184215	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.287000	0.95975	2.219000	0.72066	0.528000	0.53228	GAT	.	.		0.338	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
POLRMT	5442	hgsc.bcm.edu	37	19	621737	621737	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:621737G>A	ENST00000588649.2	-	10	2045	c.1961C>T	c.(1960-1962)cCc>cTc	p.P654L	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	654					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGATGTCCAGGGCAGCGGGGG	0.672																																					p.P654L		Atlas-SNP	.											.	POLRMT	91	.	0			c.C1961T						.						23.0	26.0	25.0					19																	621737		2200	4300	6500	SO:0001583	missense	5442	exon10			GTCCAGGGCAGCG		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1961C>T	chr19.hg19:g.621737G>A	ENSP00000465759:p.Pro654Leu	37.0	0.0		53.0	20.0	NM_005035	O60370	Missense_Mutation	SNP	ENST00000588649.2	hg19	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	17.85	3.490176	0.64074	.	.	ENSG00000099821	ENST00000215591	T	0.57273	0.41	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.74794	0.3763	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79761	-0.1667	10	0.87932	D	0	-37.2048	16.5929	0.84772	0.0:0.0:1.0:0.0	.	654	O00411	RPOM_HUMAN	L	654	ENSP00000215591:P654L	ENSP00000215591:P654L	P	-	2	0	POLRMT	572737	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	9.017000	0.93651	2.398000	0.81561	0.455000	0.32223	CCC	.	.		0.672	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
INSR	3643	hgsc.bcm.edu	37	19	7152760	7152760	+	Silent	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:7152760C>T	ENST00000302850.5	-	10	2350	c.2208G>A	c.(2206-2208)ctG>ctA	p.L736L	INSR_ENST00000341500.5_Silent_p.L736L	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	736	Insulin-binding.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CCACGTTGTGCAGGTAATCCT	0.547																																					p.L736L		Atlas-SNP	.											.	INSR	265	.	0			c.G2208A						.						195.0	173.0	181.0					19																	7152760		2203	4300	6503	SO:0001819	synonymous_variant	3643	exon10			GTTGTGCAGGTAA	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2208G>A	chr19.hg19:g.7152760C>T		61.0	0.0		53.0	21.0	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	hg19	CCDS12176.1																																																																																			.	.		0.547	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
FCER2	2208	hgsc.bcm.edu	37	19	7762139	7762139	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:7762139T>A	ENST00000346664.5	-	6	511	c.299A>T	c.(298-300)cAg>cTg	p.Q100L	FCER2_ENST00000597921.1_Missense_Mutation_p.Q100L|FCER2_ENST00000360067.4_Missense_Mutation_p.Q99L	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	100					Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						TTTCAATCTCTGCTGTTCAGC	0.562																																					p.Q100L		Atlas-SNP	.											.	FCER2	19	.	0			c.A299T						.						88.0	84.0	86.0					19																	7762139		2203	4300	6503	SO:0001583	missense	2208	exon6			AATCTCTGCTGTT	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.299A>T	chr19.hg19:g.7762139T>A	ENSP00000264072:p.Gln100Leu	103.0	0.0		66.0	16.0	NM_002002		Missense_Mutation	SNP	ENST00000346664.5	hg19	CCDS12184.1	.	.	.	.	.	.	.	.	.	.	T	2.309	-0.358417	0.05138	.	.	ENSG00000104921	ENST00000346664;ENST00000360067	T;T	0.17691	2.26;2.26	4.56	2.27	0.28462	.	0.679188	0.12112	N	0.498394	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	B;B	0.20671	0.017;0.047	B;B	0.17098	0.016;0.017	T	0.36986	-0.9725	10	0.25751	T	0.34	.	5.051	0.14508	0.1816:0.0:0.1887:0.6298	.	99;100	P06734-2;P06734	.;FCER2_HUMAN	L	100;99	ENSP00000264072:Q100L;ENSP00000353178:Q99L	ENSP00000264072:Q100L	Q	-	2	0	FCER2	7668139	0.061000	0.20836	0.144000	0.22314	0.054000	0.15201	0.045000	0.14013	0.745000	0.32763	0.533000	0.62120	CAG	.	.		0.562	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002	
DMKN	93099	hgsc.bcm.edu	37	19	36003550	36003550	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:36003550C>A	ENST00000339686.3	-	2	745	c.569G>T	c.(568-570)gGa>gTa	p.G190V	DMKN_ENST00000440396.1_Missense_Mutation_p.G190V|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.G190V|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.G190V|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000429837.1_Missense_Mutation_p.G190V|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000419602.1_Missense_Mutation_p.G190V|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.G190V|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.G190V	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	190	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCAGGGAGCTCCCTGAGGATT	0.612																																					p.G190V		Atlas-SNP	.											.	DMKN	116	.	0			c.G569T						.						91.0	96.0	94.0					19																	36003550		2203	4300	6503	SO:0001583	missense	93099	exon2			GGAGCTCCCTGAG	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.569G>T	chr19.hg19:g.36003550C>A	ENSP00000342012:p.Gly190Val	81.0	0.0		101.0	37.0	NM_001190347	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	hg19	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648211	0.29336	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.54866	1.25;1.09;1.04;0.55;0.62;0.66;0.67;0.73	4.91	3.88	0.44766	.	0.194407	0.25613	N	0.029471	T	0.66723	0.2818	M	0.68317	2.08	0.24535	N	0.994095	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.999;0.999	D;D;D;D;D;D;D	0.81914	0.995;0.995;0.995;0.995;0.991;0.991;0.991	T	0.58047	-0.7705	10	0.87932	D	0	-8.4188	8.9618	0.35851	0.0:0.8999:0.0:0.1001	.	190;190;190;190;190;190;190	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	V	190	ENSP00000342012:G190V;ENSP00000405503:G190V;ENSP00000391036:G190V;ENSP00000394908:G190V;ENSP00000415277:G190V;ENSP00000414743:G190V;ENSP00000388404:G190V;ENSP00000409513:G190V	ENSP00000342012:G190V	G	-	2	0	DMKN	40695390	0.984000	0.35163	0.494000	0.27515	0.026000	0.11368	1.956000	0.40382	1.276000	0.44395	0.655000	0.94253	GGA	.	.		0.612	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
SLC8A2	6543	hgsc.bcm.edu	37	19	47944676	47944676	+	Silent	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:47944676T>A	ENST00000236877.6	-	5	2180	c.1785A>T	c.(1783-1785)atA>atT	p.I595I	SLC8A2_ENST00000542837.1_Silent_p.I351I|SLC8A2_ENST00000539381.1_Silent_p.I58I|SLC8A2_ENST00000601757.1_5'UTR	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	595	Calx-beta 2.				blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CGTCATCAACTATCTTCACCT	0.542																																					p.I595I		Atlas-SNP	.											.	SLC8A2	77	.	0			c.A1785T						.						63.0	64.0	64.0					19																	47944676		2203	4300	6503	SO:0001819	synonymous_variant	6543	exon5			ATCAACTATCTTC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.1785A>T	chr19.hg19:g.47944676T>A		41.0	0.0		62.0	29.0	NM_015063	B4DYQ9	Silent	SNP	ENST00000236877.6	hg19	CCDS33065.1																																																																																			.	.		0.542	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
TMEM143	55260	hgsc.bcm.edu	37	19	48848536	48848536	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:48848536T>A	ENST00000293261.3	-	4	761	c.445A>T	c.(445-447)Aat>Tat	p.N149Y	TMEM143_ENST00000436660.2_Intron|TMEM143_ENST00000541566.1_Missense_Mutation_p.N39Y|TMEM143_ENST00000435956.3_Missense_Mutation_p.N114Y|TMEM143_ENST00000377431.2_Intron	NM_018273.2	NP_060743.2	Q96AN5	TM143_HUMAN	transmembrane protein 143	149					hematopoietic progenitor cell differentiation (GO:0002244)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	14		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		TCCTGCTCATTAGACAGACGC	0.592																																					p.N149Y		Atlas-SNP	.											.	TMEM143	29	.	0			c.A445T						.						125.0	123.0	124.0					19																	48848536		2203	4300	6503	SO:0001583	missense	55260	exon4			GCTCATTAGACAG	AK129801	CCDS12716.1	19q13.32	2008-02-05				ENSG00000161558			25603	protein-coding gene	gene with protein product						12975309	Standard	NM_018273		Approved	FLJ10922	uc002pix.1	Q96AN5		ENST00000293261.3:c.445A>T	chr19.hg19:g.48848536T>A	ENSP00000293261:p.Asn149Tyr	159.0	0.0		188.0	88.0	NM_018273	A8K656|Q6UXY4|Q9NV49	Missense_Mutation	SNP	ENST00000293261.3	hg19	CCDS12716.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700786	0.48307	.	.	ENSG00000161558	ENST00000293261;ENST00000435956;ENST00000541566	T;T;T	0.49139	0.79;0.8;0.79	4.33	4.33	0.51752	.	0.189716	0.34110	N	0.004257	T	0.28599	0.0708	N	0.24115	0.695	0.80722	D	1	P;P	0.44877	0.845;0.761	B;B	0.34722	0.188;0.123	T	0.14952	-1.0454	10	0.66056	D	0.02	-1.7925	8.8581	0.35240	0.1677:0.0:0.0:0.8323	.	114;149	B4DMT0;Q96AN5	.;TM143_HUMAN	Y	149;114;39	ENSP00000293261:N149Y;ENSP00000397038:N114Y;ENSP00000444275:N39Y	ENSP00000293261:N149Y	N	-	1	0	TMEM143	53540348	0.997000	0.39634	0.970000	0.41538	0.354000	0.29330	3.249000	0.51437	1.734000	0.51633	0.254000	0.18369	AAT	.	.		0.592	TMEM143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465622.1	NM_018273	
LRRC4B	94030	hgsc.bcm.edu	37	19	51022527	51022527	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr19:51022527G>A	ENST00000599957.1	-	3	640	c.443C>T	c.(442-444)aCg>aTg	p.T148M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.T148M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	148					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CGTGGGCACCGTGGTCAGCCG	0.632																																					p.T148M		Atlas-SNP	.											.	LRRC4B	89	.	0			c.C443T						.						53.0	58.0	56.0					19																	51022527		2201	4300	6501	SO:0001583	missense	94030	exon3			GGCACCGTGGTCA	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.443C>T	chr19.hg19:g.51022527G>A	ENSP00000471502:p.Thr148Met	80.0	0.0		109.0	19.0	NM_001080457	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	hg19	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172669	0.38413	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	D	0.91996	-2.95	3.96	3.96	0.45880	.	0.505755	0.17542	U	0.170501	D	0.89594	0.6760	L	0.57536	1.79	0.32427	N	0.548533	D	0.56968	0.978	B	0.41813	0.367	D	0.90656	0.4586	10	0.35671	T	0.21	.	13.9104	0.63864	0.0:0.0:1.0:0.0	.	148	Q9NT99	LRC4B_HUMAN	M	148	ENSP00000373853:T148M	ENSP00000373853:T148M	T	-	2	0	LRRC4B	55714339	0.999000	0.42202	0.998000	0.56505	0.994000	0.84299	4.110000	0.57831	2.235000	0.73313	0.491000	0.48974	ACG	.	.		0.632	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
SIRPG	55423	hgsc.bcm.edu	37	20	1616155	1616155	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr20:1616155C>A	ENST00000303415.3	-	4	903	c.839G>T	c.(838-840)aGc>aTc	p.S280I	SIRPG_ENST00000216927.4_Intron|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381583.2_Intron|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000381580.1_Missense_Mutation_p.S247I	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	280	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						CAGCTGTAGGCTCTGGGGGTA	0.547																																					p.S280I		Atlas-SNP	.											.	SIRPG	61	.	0			c.G839T						.						148.0	128.0	135.0					20																	1616155		2203	4300	6503	SO:0001583	missense	55423	exon4			TGTAGGCTCTGGG	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.839G>T	chr20.hg19:g.1616155C>A	ENSP00000305529:p.Ser280Ile	187.0	0.0		232.0	116.0	NM_018556	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	hg19	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	1.096	-0.662636	0.03454	.	.	ENSG00000089012	ENST00000381580;ENST00000303415	T;T	0.00622	6.16;6.16	1.6	-3.2	0.05156	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.719800	0.02509	N	0.091352	T	0.00724	0.0024	L	0.38953	1.18	0.09310	N	1	B	0.16603	0.018	B	0.16722	0.016	T	0.47142	-0.9140	10	0.39692	T	0.17	.	3.7544	0.08579	0.0:0.4327:0.2184:0.349	.	280	Q9P1W8	SIRPG_HUMAN	I	247;280	ENSP00000370992:S247I;ENSP00000305529:S280I	ENSP00000305529:S280I	S	-	2	0	SIRPG	1564155	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-5.626000	0.00108	-1.511000	0.01794	-1.076000	0.02234	AGC	.	.		0.547	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
CHGB	1114	hgsc.bcm.edu	37	20	5903869	5903869	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr20:5903869A>T	ENST00000378961.4	+	4	1283	c.1079A>T	c.(1078-1080)gAg>gTg	p.E360V		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	360						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						CTGGAGTGGGAGCGCTATAGG	0.527																																					p.E360V		Atlas-SNP	.											.	CHGB	112	.	0			c.A1079T						.						87.0	89.0	88.0					20																	5903869		2203	4300	6503	SO:0001583	missense	1114	exon4			AGTGGGAGCGCTA		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1079A>T	chr20.hg19:g.5903869A>T	ENSP00000368244:p.Glu360Val	61.0	0.0		78.0	33.0	NM_001819	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	ENST00000378961.4	hg19	CCDS13092.1	.	.	.	.	.	.	.	.	.	.	A	5.131	0.209807	0.09757	.	.	ENSG00000089199	ENST00000378961	T	0.01422	4.91	5.37	-10.7	0.00240	.	1.911260	0.02637	N	0.104888	T	0.01254	0.0041	L	0.34521	1.04	0.09310	N	1	B	0.14805	0.011	B	0.15052	0.012	T	0.30208	-0.9986	10	0.49607	T	0.09	2.8012	5.1021	0.14764	0.1434:0.5006:0.1919:0.1642	.	360	P05060	SCG1_HUMAN	V	360	ENSP00000368244:E360V	ENSP00000368244:E360V	E	+	2	0	CHGB	5851869	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.697000	0.05098	-4.337000	0.00055	-0.490000	0.04691	GAG	.	.		0.527	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
EPB41L1	2036	hgsc.bcm.edu	37	20	34810266	34810266	+	Missense_Mutation	SNP	G	G	A	rs371978327		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr20:34810266G>A	ENST00000338074.2	+	21	2748	c.2587G>A	c.(2587-2589)Gta>Ata	p.V863I	EPB41L1_ENST00000373946.3_Missense_Mutation_p.V683I|EPB41L1_ENST00000373941.1_Missense_Mutation_p.V862I|EPB41L1_ENST00000441639.1_Missense_Mutation_p.V761I|EPB41L1_ENST00000373950.2_Missense_Mutation_p.V754I|EPB41L1_ENST00000202028.5_Missense_Mutation_p.V761I	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	863	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.V863I(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CAAAGCTGTCGTATACAGAGA	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		19242	0.0		0.001	False		,,,				2504	0.0				p.V863I		Atlas-SNP	.											EPB41L1,rectum,carcinoma,0,1	EPB41L1	111	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2587A						.	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	115.0	107.0	110.0		2587,2281	4.6	1.0	20		110	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EPB41L1	NM_012156.2,NM_177996.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	863/882,761/780	34810266	1,13005	2203	4300	6503	SO:0001583	missense	2036	exon21			GCTGTCGTATACA	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.2587G>A	chr20.hg19:g.34810266G>A	ENSP00000337168:p.Val863Ile	67.0	0.0		61.0	30.0	NM_012156	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	hg19	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416844	0.83449	0.0	1.16E-4	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	4.61	4.61	0.57282	Band 4.1, C-terminal (1);	.	.	.	.	D	0.87962	0.6310	L	0.42686	1.345	0.53688	D	0.999972	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.994;0.999	D;D;D;D;D	0.85130	0.997;0.972;0.993;0.972;0.991	D	0.89351	0.3661	9	0.87932	D	0	.	16.6051	0.84826	0.0:0.0:1.0:0.0	.	863;683;754;754;761	Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	E41L1_HUMAN;.;.;.;.	I	761;754;754;761;683;863;862	ENSP00000202028:V761I;ENSP00000363061:V754I;ENSP00000399214:V761I;ENSP00000363057:V683I;ENSP00000337168:V863I;ENSP00000363052:V862I	ENSP00000202028:V761I	V	+	1	0	EPB41L1	34273680	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.263000	0.95617	2.401000	0.81631	0.462000	0.41574	GTA	.	.		0.542	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
ZBTB46	140685	hgsc.bcm.edu	37	20	62378586	62378586	+	Silent	SNP	C	C	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr20:62378586C>A	ENST00000245663.4	-	5	1617	c.1467G>T	c.(1465-1467)gtG>gtT	p.V489V	ZBTB46_ENST00000395104.1_Silent_p.V489V|ZBTB46_ENST00000302995.2_Silent_p.V489V|RP4-583P15.10_ENST00000433905.2_RNA|RP4-583P15.10_ENST00000447343.2_RNA	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	489					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					GCCTGATGCCCACGCTGGCGG	0.697																																					p.V489V		Atlas-SNP	.											.	ZBTB46	72	.	0			c.G1467T						.						9.0	8.0	9.0					20																	62378586		2163	4219	6382	SO:0001819	synonymous_variant	140685	exon5			GATGCCCACGCTG	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.1467G>T	chr20.hg19:g.62378586C>A		103.0	0.0		90.0	17.0	NM_025224	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Silent	SNP	ENST00000245663.4	hg19	CCDS13538.1																																																																																			.	.		0.697	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
ATP6V1E1	529	hgsc.bcm.edu	37	22	18095625	18095625	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr22:18095625T>C	ENST00000253413.5	-	4	411	c.229A>G	c.(229-231)Aat>Gat	p.N77D	ATP6V1E1_ENST00000399796.2_Missense_Mutation_p.N77D|ATP6V1E1_ENST00000478963.1_5'UTR|ATP6V1E1_ENST00000399798.2_Missense_Mutation_p.N55D	NM_001696.3	NP_001687.1	P36543	VATE1_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1	77					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	10		all_epithelial(15;0.206)		Lung(27;0.19)		CTCGCTTGATTCATCAAATTG	0.353																																					p.N77D		Atlas-SNP	.											.	ATP6V1E1	28	.	0			c.A229G						.						86.0	85.0	85.0					22																	18095625		2203	4300	6503	SO:0001583	missense	529	exon4			CTTGATTCATCAA	X76228	CCDS13745.1, CCDS42977.1, CCDS42978.1	22q11.2	2010-04-21	2006-01-13	2002-06-21	ENSG00000131100	ENSG00000131100	3.6.3.14	"""ATPases / V-type"""	857	protein-coding gene	gene with protein product		108746	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1"""	ATP6E, ATP6V1E		8004105, 8250920	Standard	NM_001696		Approved	P31, Vma4, ATP6E2	uc002zmr.1	P36543	OTTHUMG00000059320	ENST00000253413.5:c.229A>G	chr22.hg19:g.18095625T>C	ENSP00000253413:p.Asn77Asp	356.0	0.0		378.0	77.0	NM_001039367	A8MUE4|A8MUN4	Missense_Mutation	SNP	ENST00000253413.5	hg19	CCDS13745.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.669777	0.88348	.	.	ENSG00000131100	ENST00000253413;ENST00000399796;ENST00000399798;ENST00000413576	.	.	.	4.64	4.64	0.57946	.	0.091661	0.64402	D	0.000001	D	0.86657	0.5985	H	0.96142	3.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.90545	0.4505	9	0.87932	D	0	-21.4191	13.175	0.59621	0.0:0.0:0.0:1.0	.	55;77;77	A8MUE4;A8MUN4;P36543	.;.;VATE1_HUMAN	D	77;77;55;78	.	ENSP00000253413:N77D	N	-	1	0	ATP6V1E1	16475625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.454000	0.80714	1.941000	0.56285	0.533000	0.62120	AAT	.	.		0.353	ATP6V1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131790.3	NM_001696	
SLC25A1	6576	hgsc.bcm.edu	37	22	19166135	19166135	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr22:19166135C>T	ENST00000215882.5	-	1	208	c.52G>A	c.(52-54)Ggg>Agg	p.G18R	CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000451283.1_5'Flank|SLC25A1_ENST00000461267.1_5'Flank	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	18					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)			cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		TTGGCCTTCCCGGAcgcgggc	0.811																																					p.G18R		Atlas-SNP	.											.	SLC25A1	14	.	0			c.G52A						.						2.0	3.0	2.0					22																	19166135		1113	2188	3301	SO:0001583	missense	6576	exon1			CCTTCCCGGACGC	U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.52G>A	chr22.hg19:g.19166135C>T	ENSP00000215882:p.Gly18Arg	7.0	0.0		10.0	7.0	NM_005984	A8K8E8|Q9BSK6	Missense_Mutation	SNP	ENST00000215882.5	hg19	CCDS13758.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.950915	0.92660	.	.	ENSG00000100075	ENST00000215882	T	0.79554	-1.28	3.24	3.24	0.37175	.	0.301431	0.30142	U	0.010309	T	0.75576	0.3868	L	0.47716	1.5	0.80722	D	1	D	0.63880	0.993	P	0.45167	0.472	T	0.77227	-0.2665	10	0.46703	T	0.11	-12.6645	12.1036	0.53798	0.0:1.0:0.0:0.0	.	18	P53007	TXTP_HUMAN	R	18	ENSP00000215882:G18R	ENSP00000215882:G18R	G	-	1	0	SLC25A1	17546135	0.018000	0.18449	0.143000	0.22291	0.919000	0.55068	0.863000	0.27913	1.832000	0.53329	0.442000	0.29010	GGG	.	.		0.811	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316441.1	NM_005984	
EFHC2	80258	hgsc.bcm.edu	37	X	44101519	44101519	+	Silent	SNP	A	A	C			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chrX:44101519A>C	ENST00000420999.1	-	8	1211	c.1128T>G	c.(1126-1128)gtT>gtG	p.V376V		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	376							calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						GCTTGCATGAAACTGAGGTAA	0.373																																					p.V376V		Atlas-SNP	.											.	EFHC2	81	.	0			c.T1128G						.						56.0	47.0	50.0					X																	44101519		1845	4088	5933	SO:0001819	synonymous_variant	80258	exon8			GCATGAAACTGAG	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.1128T>G	chrX.hg19:g.44101519A>C		128.0	0.0		75.0	63.0	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Silent	SNP	ENST00000420999.1	hg19	CCDS55405.1	.	.	.	.	.	.	.	.	.	.	A	3.590	-0.083758	0.07141	.	.	ENSG00000183690	ENST00000441230	.	.	.	5.9	4.75	0.60458	.	.	.	.	.	T	0.57548	0.2061	.	.	.	0.49582	D	0.999805	.	.	.	.	.	.	T	0.56232	-0.8013	4	.	.	.	-9.4716	7.9529	0.30025	0.8459:0.0:0.1541:0.0	.	.	.	.	V	357	.	.	F	-	1	0	EFHC2	43986463	0.884000	0.30299	0.024000	0.17045	0.789000	0.44602	1.902000	0.39848	1.991000	0.58162	0.486000	0.48141	TTC	.	.		0.373	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	
MT-CYB	4519	hgsc.bcm.edu	37	M	15092	15092	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chrM:15092G>A	ENST00000361789.2	+	1	346	c.346G>A	c.(346-348)Ggc>Agc	p.G116S	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	116					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CCTGAAACATCGGCATTATCC	0.463											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G116S		Atlas-SNP	.											.	.	.	.	0			c.G346A						.																																			SO:0001583	missense	0	exon1			AACATCGGCATTA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.346G>A	chrM.hg19:g.15092G>A	ENSP00000354554:p.Gly116Ser	38.0	0.0	585	12.0	8.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.463	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
FKBP9	11328	hgsc.bcm.edu	37	7	33044951	33044977	+	Stop_Codon_Del	DEL	CGATGAACTCTAAACCTGGCATGAACC	CGATGAACTCTAAACCTGGCATGAACC	-			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	CGATGAACTCTAAACCTGGCATGAACC	CGATGAACTCTAAACCTGGCATGAACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr7:33044951_33044977delCGATGAACTCTAAACCTGGCATGAACC	ENST00000242209.4	+	0	1870_1896				FKBP9_ENST00000538443.1_Stop_Codon_Del|FKBP9_ENST00000490776.2_Stop_Codon_Del|FKBP9_ENST00000538336.1_Stop_Codon_Del|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa						chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AAGCCAAACACGATGAACTCTAAACCTGGCATGAACCAGATGGTGCC	0.502																																					p.567_571del		Atlas-INDEL	.											.	FKBP9	335	.	0			c.1700_1894del						.																																			SO:0001567	stop_retained_variant	11328	exon10			.	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	Exception_encountered	chr7.hg19:g.33044951_33044977delCGATGAACTCTAAACCTGGCATGAACC		360.0	0.0		267.0	71.0	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Frame_Shift_Del	DEL	ENST00000242209.4	hg19	CCDS5439.1																																																																																			.	.		0.502	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
C6	729	hgsc.bcm.edu	37	5	41181567	41181567	+	Frame_Shift_Del	DEL	T	T	-	rs199795699|rs557023458	byFrequency	TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr5:41181567delT	ENST00000263413.3	-	7	1085	c.821delA	c.(820-822)cagfs	p.Q274fs	C6_ENST00000337836.5_Frame_Shift_Del_p.Q274fs|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	274	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GCTCCCCCCCTGACTTGAGAA	0.393													T|T|-|deletion	3	0.000599042	0.0023	0.0	5008	,	,		15554	0.0		0.0	False		,,,				2504	0.0				p.Q274fs		Atlas-INDEL	.											.	C6	197	.	0			c.822delG	GRCh37	CD002162	C6	D		.		,	25,4241		0,25,2108	83.0	83.0	83.0		,	-7.2	0.0	5		84	0,8252		0,0,4126	no	frameshift,frameshift	C6	NM_001115131.1,NM_000065.2	,	0,25,6234	A1A1,A1R,RR		0.0,0.586,0.1997	,	,	41181567	25,12493	2203	4299	6502	SO:0001589	frameshift_variant	729	exon7			.	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.821delA	chr5.hg19:g.41181567delT	ENSP00000263413:p.Gln274fs	114.0	0.0		173.0	90.0	NM_001115131		Frame_Shift_Del	DEL	ENST00000263413.3	hg19	CCDS3936.1																																																																																			.	.		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
CDKN2A	1029	hgsc.bcm.edu	37	9	21974776	21974777	+	Frame_Shift_Ins	INS	-	-	GCCA	rs587782206		TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr9:21974776_21974777insGCCA	ENST00000304494.5	-	1	320_321	c.50_51insTGGC	c.(49-51)gccfs	p.-17fs	RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.-17fs|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.-17fs|CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.-17fs|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000361570.3_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A						cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.L16fs*9(3)|p.S12fs*6(1)|p.0(1)|p.A17_T18insTA(1)|p.A17fs*5(1)|p.S7_A19del(1)|p.S12fs*20(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCGCGGCCGTGGCCAGCCAGTC	0.752		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.A17fs		Atlas-INDEL	.											.	CDKN2A	4810	.	1347	Whole gene deletion(1316)|Unknown(23)|Deletion - Frameshift(6)|Insertion - In frame(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(279)|skin(169)|central_nervous_system(164)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(48)|ovary(34)|kidney(31)|pancreas(31)|breast(30)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.51_52insTGGC						.																																			SO:0001589	frameshift_variant	1029	exon1			.	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.47_50dupTGGC	chr9.hg19:g.21974781_21974784dupGCCA	ENSP00000307101:p.Ala17fs	59.0	0.0		57.0	28.0	NM_058197	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Ins	INS	ENST00000304494.5	hg19	CCDS6510.1																																																																																			.	.		0.752	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
NGFR	4804	hgsc.bcm.edu	37	17	47590366	47590367	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr17:47590366_47590367delGT	ENST00000172229.3	+	6	1404_1405	c.1279_1280delGT	c.(1279-1281)gtgfs	p.V427fs	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Frame_Shift_Del_p.V333fs	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	427					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CACATCCCCGGTGTGAGCCCAA	0.718																																					p.426_427del		Atlas-INDEL	.											.	NGFR	46	.	0			c.1278_1279del						.																																			SO:0001589	frameshift_variant	4804	exon6			.	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1279_1280delGT	chr17.hg19:g.47590368_47590369delGT	ENSP00000172229:p.Val427fs	49.0	0.0		61.0	22.0	NM_002507	B2R961|B4E096	Frame_Shift_Del	DEL	ENST00000172229.3	hg19	CCDS11549.1																																																																																			.	.		0.718	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
TP53BP1	7158	hgsc.bcm.edu	37	15	43712632	43712634	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr15:43712632_43712634delCAG	ENST00000263801.3	-	21	4787_4789	c.4535_4537delCTG	c.(4534-4539)gctggg>ggg	p.A1512del	TP53BP1_ENST00000450115.2_In_Frame_Del_p.A1517del|TP53BP1_ENST00000382044.4_In_Frame_Del_p.A1517del|TP53BP1_ENST00000382039.3_In_Frame_Del_p.A1467del	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1512	Interaction with dimethylated histone H4.|Tudor-like.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TTATACTTCCCAGCTCCGACATC	0.488								Other conserved DNA damage response genes																													p.1517_1518del		Atlas-INDEL	.											.	TP53BP1	157	.	0			c.4551_4553del						.																																			SO:0001651	inframe_deletion	7158	exon21			.	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.4535_4537delCTG	chr15.hg19:g.43712632_43712634delCAG	ENSP00000263801:p.Ala1512del	105.0	0.0		105.0	50.0	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	In_Frame_Del	DEL	ENST00000263801.3	hg19	CCDS10096.1																																																																																			.	.		0.488	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
SLC5A11	115584	hgsc.bcm.edu	37	16	24922649	24922650	+	Splice_Site	DEL	GT	GT	-			TCGA-DD-AAD8-01A-11D-A40R-10	TCGA-DD-AAD8-10A-01D-A40U-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e9bd10d3-14cc-458b-ad39-9001c8870b4e	8f73a6a2-ac9e-4907-8a3a-8b8d79b2d7d2	g.chr16:24922649_24922650delGT	ENST00000347898.3	+	16	2445_2446	c.1823_1824delGT	c.(1822-1824)tgt>t	p.C608fs	SLC5A11_ENST00000539472.1_Splice_Site_p.C544fs|SLC5A11_ENST00000565769.1_Splice_Site_p.C544fs|SLC5A11_ENST00000449109.2_Splice_Site_p.C452fs|SLC5A11_ENST00000569071.1_Splice_Site_p.C452fs|SLC5A11_ENST00000567758.1_Splice_Site_p.C573fs|SLC5A11_ENST00000545376.1_Splice_Site_p.C538fs|SLC5A11_ENST00000424767.2_Splice_Site_p.C573fs|SLC5A11_ENST00000568579.1_Splice_Site_p.C538fs	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TTCTTTCTAGGTGACATGACCC	0.54																																					p.608_608del		Atlas-INDEL	.											.	SLC5A11	97	.	0			c.1823_1823del						.																																			SO:0001630	splice_region_variant	115584	exon16			.	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1823-1GT>-	chr16.hg19:g.24922649_24922650delGT		92.0	0.0		88.0	43.0	NM_052944		Frame_Shift_Del	DEL	ENST00000347898.3	hg19	CCDS10625.1																																																																																			.	.		0.540	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944	Frame_Shift_Del
